USF Libraries
USF Digital Collections

On the involvement of the low-density lipoprotein receptor in the pathogenesis and progression of alzheimer's disease

MISSING IMAGE

Material Information

Title:
On the involvement of the low-density lipoprotein receptor in the pathogenesis and progression of alzheimer's disease
Physical Description:
Book
Language:
English
Creator:
Abisambra, Jose
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Neurodegeneration
Apolipoprotein E
Cholesterol
Transgenic mice
Amyloid
Dissertations, Academic -- Molecular Medicine -- Doctoral -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: Alzheimer's disease (AD) is the most prevalent form of age-associated dementia. Cholesterol dysregulation is linked with AD onset. Besides age, the most important risk factor associated with AD is the inheritance of the ε-4 allele of apolipoprotein E, a cholesterol transporter. In addition, while hypercholesterolemia has been shown to be an independent risk factor for AD, the nature of the cholesterol-AD link is still not clear. This gap in our understanding is partly due to a lack of knowledge about cholesterol metabolism in the central nervous system (CNS). The low-density lipoprotein receptor (LDLR) is the main receptor of apoE and a central regulator of serum cholesterol levels. Therefore, we sought to characterize the potential participation of LDLR in AD pathogenesis and/or progression. Previous reports with similar aims came to contradictory conclusions. Such studies assessed potential changes in AD in the absence of LDLR by utilizing the LDLR-/- mouse model and crossing it to AD mouse models. Initially we evaluated LDLR-/- mice as a suitable model to study AD. We found that LDLR-/- mice overexpressed a functional splice-variant of LDLR, LDLRΔ4. Moreover, its protein localized in similar regions as the LDLR did in control mice. Finally, we determined that LDLRΔ4 bound apoE, which underscores the impact of the isoform's function in the CNS. We then focused on characterizing changes to LDLR in AD models. We found that APP overexpression in cells increased LDLR mRNA and protein. APP overexpression and Aβ treatment shifted LDLR localization. An AD mouse model showed increased LDLR in hippocampus. Conversely, LDLR levels were decreased in APP-/- mice. Finally, we found that microtubules were affected in cells overexpressing APP. In conclusion, the data presented argue for the importance of LDLR-mediated regulation of cholesterol during AD progression. Also, LDLR may participate in the initial pathogenic insults leading to amyloid deposition, which make it a potential therapeutic target to treat AD. Finally, we propose that APP/Aβ overexpression disrupts microtubule formation; this alteration affects protein trafficking. One of the proteins affected is LDLR, the repercussions of which may ultimately result in cholesterol dysregulation.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2010.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Jose Abisambra.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains X pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
usfldc doi - E14-SFE0003381
usfldc handle - e14.3381
System ID:
SFS0027697:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam 22 Ka 4500
controlfield tag 007 cr-bnu---uuuuu
008 s2010 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0003381
035
(OCoLC)
040
FHM
c FHM
049
FHMM
090
XX9999 (Online)
1 100
Abisambra, Jose.
0 245
On the involvement of the low-density lipoprotein receptor in the pathogenesis and progression of alzheimer's disease
h [electronic resource] /
by Jose Abisambra.
260
[Tampa, Fla] :
b University of South Florida,
2010.
500
Title from PDF of title page.
Document formatted into pages; contains X pages.
Includes vita.
502
Dissertation (Ph.D.)--University of South Florida, 2010.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
3 520
ABSTRACT: Alzheimer's disease (AD) is the most prevalent form of age-associated dementia. Cholesterol dysregulation is linked with AD onset. Besides age, the most important risk factor associated with AD is the inheritance of the ε-4 allele of apolipoprotein E, a cholesterol transporter. In addition, while hypercholesterolemia has been shown to be an independent risk factor for AD, the nature of the cholesterol-AD link is still not clear. This gap in our understanding is partly due to a lack of knowledge about cholesterol metabolism in the central nervous system (CNS). The low-density lipoprotein receptor (LDLR) is the main receptor of apoE and a central regulator of serum cholesterol levels. Therefore, we sought to characterize the potential participation of LDLR in AD pathogenesis and/or progression. Previous reports with similar aims came to contradictory conclusions. Such studies assessed potential changes in AD in the absence of LDLR by utilizing the LDLR-/- mouse model and crossing it to AD mouse models. Initially we evaluated LDLR-/- mice as a suitable model to study AD. We found that LDLR-/- mice overexpressed a functional splice-variant of LDLR, LDLRΔ4. Moreover, its protein localized in similar regions as the LDLR did in control mice. Finally, we determined that LDLRΔ4 bound apoE, which underscores the impact of the isoform's function in the CNS. We then focused on characterizing changes to LDLR in AD models. We found that APP overexpression in cells increased LDLR mRNA and protein. APP overexpression and Aβ treatment shifted LDLR localization. An AD mouse model showed increased LDLR in hippocampus. Conversely, LDLR levels were decreased in APP-/- mice. Finally, we found that microtubules were affected in cells overexpressing APP. In conclusion, the data presented argue for the importance of LDLR-mediated regulation of cholesterol during AD progression. Also, LDLR may participate in the initial pathogenic insults leading to amyloid deposition, which make it a potential therapeutic target to treat AD. Finally, we propose that APP/Aβ overexpression disrupts microtubule formation; this alteration affects protein trafficking. One of the proteins affected is LDLR, the repercussions of which may ultimately result in cholesterol dysregulation.
590
Advisor: Huntington Potter, Ph.D.
653
Neurodegeneration
Apolipoprotein E
Cholesterol
Transgenic mice
Amyloid
690
Dissertations, Academic
z USF
x Molecular Medicine
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.3381



PAGE 1

On the Involvement of the Low Density Lipoprotein Receptor in the Pathogenesis and Progression of Alzheimer's Disease by Jose Francisco Abisambra Socarras A dissertation submitted in partial fulfillment of the requirements for the degree of Docto r of Philosophy Department of Molecular Medicine College of Medicine University of South Florida Major Professor: Huntington Potter, Ph.D. G. William Rebeck, Ph.D. Edwin Weeber, Ph.D. Ken Keller, Ph.D. Larry Solomonson, Ph.D. Chad Dickey, Ph.D. Date of Approval: December 30, 2009 Keywords: Neurodegeneration, apolipoprotein E, cholesterol, transgenic mice, amyloid Copyright 2010, Jose Francisco Abisambra Socarras

PAGE 2

Dedication Para mi familia: Beatriz, Miguel, Carlos, Camila y Nidia.

PAGE 3

Acknowledgments I thank those who inspired me at both a scientific and personal level. Dr. Potter accepted me into his lab and taught me how to think about science in unconventional ways: marching to a different drumbeat. I re ceived invaluable scientific advice and guidance from Dr. Jaya Padmanabhan, Dr. Bonnie Goodwin, Dr. Inge Wefes, and Dr. Peter Neame. My dissertation advisory and examining committees offered further scientific guidance: Dr. Gloria Ferreira, Dr. Ken Keller, Dr. Larry Solomonson, Dr. Jun Tan, Dr. Ted Williams, Dr. Chad Dickey, and Dr. Edwin Weeber. Dr. Gene Ness initiated my interest in the LDLR. Dr. Donna Wilcock, Dr. Chad Dickey, and Dr. David Costa offered insightful scientific support and friendship. I th ank Dr. William Rebeck for accepting the role of external advisor of my dissertation. As brilliant scientists, the abovementioned participated in my mentorship. The support I received in my personal life maintained me focused and determined through the p ast few years. Jaya and Bonnie offered me their mentorship, but most importantly, I was fortunate to have received their friendship and wisdom. Together with Antoneta Granic and Anthony

PAGE 4

Jackson, the quotidian experiences in the lab became amenable during t imes of duress and exciting during times of celebration. Chantal Guidi offered me unwaivering love and support, which kept me motivated even in the most difficult periods during the end of my graduate studies. Additionally, I thank Tomasz Alemany David Costa, and Tim Jarvis, whose friendship and support gave me fortitude to climb over the tallest obstacles. My family continued to be quintessential in every aspect of my academic progress and personal growth. I am forever indebted to them.

PAGE 5

Table of Contents List of Tables iii List of Figures iv Abstract vi Nanos Gigantium Humerus Insidentes 1 Introduction 4 Alzheimer's Disease 4 Alzheimer's Disease Pathology 9 Amyloid Precursor Protein 12 Secretase 16 Secretase 18 # Secretase 20 Tau 2 4 Cholesterol and the Risk of Alzheimer's Disease 27 Cholesterol Metabolism in the Brain 29 # Cholesterol and Disease 34 Cholesterol and Atherosclerosis 36 Cholesterol and Alzheimer's Disease 38 Apolipoprotein E Isoforms and Disease 42 Low density Li poprotein Receptor (LDLR) and Disease 45 Final Introductory Remarks 51 References 53 Upregulation of a Functional, Structurally Homologous Splice Variant of Low Density Lipoprotein Receptor in LDLR / and Alzheimer's Disease Mice 91 Abstract 91 Introduction 93 Results 97 Discussion 105 Materials and Methods 110 Figures 117 References 133 LDLR Expression and Localization are Altered in Mouse and

PAGE 6

ii Human Cell Culture M odels of Alzheimer's Disease 140 Abstract 140 Introduction 142 Results 147 Discussion 154 Materials and Methods 161 Figures 168 References 192 Discussion 201 References 216 Appendices 267 Appendix A: Activation of the Hep atic LDLR by Thyroid Hormone 268 Abstract 268 Introduction 27 0 Materials and Methods 274 Results and Discussion 281 Acknowledgements 285 Figures 286 References 292 Appendix B: 300 LDLR!4 cDNA sequence 300 About the Author End Page

PAGE 7

iii List of Tables Table 1 Quantification of LDLR and LDLR $ 4 in NTG and LDLR / mouse brain and liver 121 Table 2 Increased LDLR!4 mRNA expression in PSAPP mice 132

PAGE 8

iv List of Figures Upregulation of a functional, structurally homologous splice variant of low density lipoprotein receptor in LDLR / and Alzheimer's disease mice Figure 1. LDLR!4 variant mRNA is expressed in brain and liver of LDLR / mice. 117 Figure 2. LDLR!4 variant mRNA is expressed in brain and liver of NTG mice and upregulated in brain and liver of LDLR / mice. 119 Figure 3. LDLR positive protein is present in L DLR / brain, but not liver. 122 Figure 4. LDLR signal is present in br ain and primary neurons of LDLR / and NTG mice with similar intensity and distribution. 124 Figure 5. ApoE binding in LDLR / primary neurons via LDLR protein is conserved. 126 Figure 6. Glial derived apoE co localizes with LDLR protein on the plasma me mbrane and cytoplasm of NTG and LDLR / primary neurons. 128 Figure 7. LDLR!4 variant mRNA expression is upregulated in the PSAPP mouse brain. 130 LDLR expression and localization are altered in mouse and human cell culture models of Alzheimer's disease Figure 1. LDLR mRNA and protein are upregulated in H4 APP cells compare d to H4 controls. 168 Figure 2. LDLR distribution is altered in H4 APP ce lls compared to H4 controls. 170

PAGE 9

v Figure 3. LDLR is reduced on the surface of H4 APP cells. 172 Figure 4. A 42 alters LDLR localization in p rimary neurons of NTG mice. 174 Figure 5. LDLR is abundant in the trans Gol gi network of H4 APP cells. 176 Figure 6. Brain LDLR is increased in PSAPP mice and decreased in APP / mice compared to controls. 178 Figure 7. LDLR is increased and delocalized in the hippocampus of PSAPP mice compa red to NTG controls. 180 Figure 8. # tubulin signal is more widely distributed in H4 APP ce lls compared to H4 controls. 182 Figure 9. tubulin signal is less widely distributed in H4 APP ce lls compared to H4 controls. 184 Figure 10. Proposed mechanism by which APP/A over expression diminishes LDLR trafficking by disru pting microtubule formation 186 Supplemental Figure 1: APP overexpression in H4 APP cells causes aberra nt localization in the cell. 188 Supplemental Figure 2: Quantification of staini ng using Image J 190

PAGE 10

vi On the Involvement of the Low Density Lipoprotein Receptor in the Pathogenesis and Progression of Alzheimer's Disease Jose Francisco Abisambra Socarras ABSTRACT Alzheimer's disease (AD) is the most prevalent form of age associated dementia. Cholesterol dysregulation is linked with AD onset. Besides age, the most important risk factor associated with AD is the inheritance of the % 4 allele of apolipoprotein E, a cholesterol transporter. In addition, while hyperchole sterolemia has been shown to be an independent risk factor for AD, the nature of the cholesterol AD link is still not clear. This gap in our understanding is partly due to a lack of knowledge about cholesterol metabolism in the central nervous system (CNS) The low density lipoprotein receptor (LDLR) is the main receptor of apoE and a central regulator of serum cholesterol levels. Therefore, we

PAGE 11

vii sought to characterize the potential participation of LDLR in AD pathogenesis and/or progression. Previous repo rts with similar aims came to contradictory conclusions. Such studies assessed potential changes in AD in the absence of LDLR by utilizing the LDLR / mouse model and crossing it to AD mouse models. Initially we evaluated LDLR / mice as a suitable mode l to study AD. We found that LDLR / mice overexpressed a functional splice variant of LDLR, LDLR "4. Moreover, its protein localized in similar regions as the LDLR did in control mice. Finally, we determined that LDLR"4 bound apoE, which underscores the impact of the isoform's function in the CNS. We then focused on characterizing changes to LDLR i n AD models. We found that APP overexpression in cells increased LDLR mRNA and protein. APP overexpression and A treatment shifted LDLR localization. An AD mouse model showed increased LDLR in hippocampus. Conversely, LDLR levels were decreased in APP / mice. Finally, we found that microtubules were affected in cells overexpressing APP. In conclusion, the data presented argue for the importance of LDLR mediated regulation of cholesterol during AD progression. Also, LDLR may

PAGE 12

viii participate in the initial pa thogenic insults leading to amyloid deposition, which make it a potential therapeutic target to treat AD. Finally, we propose that APP/A overexpression disrupts microtubule formation; this alteration affects protein trafficking. One of the proteins affect ed is LDLR, the repercussions of which may ultimately result in cholesterol dysregulation.

PAGE 13

NANOS GIGANTIUM HUME RUS INSIDENTES (Dwarves standing on the shoulders of giants) Bernard de Chartres Scientific progress cannot be achieved without the stron g foundation edified by other scientists. It is from the past that aspiring scientists like myself find inspiration to formulate our own hypotheses. The work in this dissertation is inspired by elegant reports written by scientists who exercised ingenuity, rigorous methodology, and astute interpretation in the fields of heart disease and Alzheimer's disease. These two devastating diseases have marred the lives of millions throughout the world. Thusly, the research of these ailments demands the intensity and perseverance these giants have dedicated. In 1901, while director of the state asylum of Frankfurt am Main, the psychiatrist and neuropathologist Alois Alzheimer met and treated Auguste D. She had been referred to the asylum for suffering from behavioral disorders characterized by progressive memory loss, irritation, and disorientation. After her death in 1905, Alzheimer performed an

PAGE 14

2 autopsy and described in 1906 the major hallmarks of the disease that today bears his name: neurodegeneration, amyloid plaq ues, and neurofibrillary tangles. This description is still used today to confirm Alzheimer's disease diagnoses, underscoring the importance of Alois Alzheimer's discovery. While investigating the root causes of familial hypercholesterolemia (FH), Micha el Brown and Joseph Goldstein discovered the low density lipoprotein receptor (LDLR), the main protein responsible for removing LDL cholesterol from the blood torrent. They concurrently described what is known today as the LDLR pathway, which includes a ge neral step in the import of substances inside cells termed receptor mediated endocytosis. Brown and Goldstein's astute strategy was to analyze the genetic makeup of individuals from families who suffered from high serum cholesterol levels. They found mut ations in the LDLR gene that rendered the receptor unable to function in separate steps of its metabolic cycle. As a result, the patients' ability to remove LDL from the blood was impaired, leading to hypercholesterolemia and subsequent sequelae. Brown a nd Goldstein were awarded the Nobel Prize in Physiology or

PAGE 15

3 Medicine in 1985 for these discoveries. Their strategy is used in the research of other diseases including AD, and has revealed important mutations that are involved in the disease process. The mut ant forms of several human genes that cause or promote familial Alzheimer's disease have been introduced into the genome of transgenic mice, which serve today as the most common in vivo model for AD research. Without exception, I based the hypotheses an d methods contained in this dissertation on the findings of many other researchers. I've had the unique opportunity to be a scientist during a very exciting time. The resources available today added to our own intellectual efforts produced the results pres ented in this dissertation. The experimental design and data presentation contain the signature of our own ingenuity to reveal the results presented herein. Conclusions derived from these results required careful analysis. This is our contribution. I hope that our results will feed the body of knowledge upon which other scientists will discover relevant information that may lead to strategies and approaches targeted to reduce or eliminate the suffering caused by AD.

PAGE 16

4 INTRODUCTION Alzheimer's Disease A lzheimer's disease (AD) is a chronic neurodegenerative disorder and the most common cause of dementia (Schoenberg, Kokmen, & Okazaki, 1987) AD patients are characterized by a loss of or decrease in memory, which is accompanied by a decline in at least one of the following cognitive abilities: (1) generation of coherent speech as well as understand ing written language; (2) identification of objects; (3) execution of motor tasks; and (4) capability to form abstract thought, make sound judgment, and plan and carry out complex tasks (Association, 2008 ) To meet these criteria, the patient must have intact motor and sensory systems, and must understand the tasks he or she is asked to perform. According to the Alzheimer's Association's 2008 Alzheimer's Disease Facts and Figures report, 5.2 million peo ple in the United States suffer from AD, and it accounts for 70% of dementias in people age 71 or older.

PAGE 17

5 Furthermore, 50% of the population over 85 years of age suffers from AD. Onset of AD after age 65 is defined as late onset or sporadic AD, which acco unts for over 95% of the AD population and has an idiopathic etiology with some genetic contribution. Early onset AD, which constitutes less than 1% of the remaining AD population, has a well characterized genetic etiology, whereby specific mutations lead to autosomal dominant inheritance of familial' AD, and it typically ensues under the age of 65. Epidemiological studies show that AD is more prevalent in women, in people who have fewer years of education, and in African Americans. Despite its first de scription over one hundred years ago, there is still no cure for AD. However, reports that AD patients have severely reduced levels of acetylcholine (Ach), a key memory associated neurotransmitter, triggered the development of pharmacological approaches to modulate Ach (Bartus, Dean, Beer, & Lippa, 1982; Coyle, Price, & DeLong, 1983; Davies & Verth, 1977; Gaykema, et al., 1992) Pharmacological modulation of acetylcholine transmission would be expected to diminish th e decline in learning and memory. In fact, it has

PAGE 18

6 been reported that there is mild cognitive improvement (Giacobini, 1997) One approach is to reduce or inhibit acetyl cholinesterase (AchE) activity, which increase Ach levels and aid in improving learning and memory. Unfortunately, cognit ive improvements are only mild due to short half life and adverse side effects, which restrict their use (Forsyth, et al., 1989; Tariot, et al., 2000; Watkins, Zimmerman, Knapp, Gracon, & Lewis, 1994) Donepezil hyd rochloride (Aricept) has been the most effective AchE inhibitor and is commonly used to treat AD patients (Rogers, Doody, Mohs, & F riedhoff, 1998) Cardiovascular disease and AD share many risk factors and correlates (Reid, Urano, Kodama, & Hamakubo, 2007) such as hypercholesterolemia (Soneira & Scott, 1996) and atherosclerosis (Hof man, et al., 1997; Kalback, et al., 2004; Reid, et al., 2007) hypertension (Skoog, et al., 1996) and diabetes type 2 (Ott, et al., 1996) Consequently, statins, cholesterol lowering drugs, have been evaluated as therapeutic agents to treat AD. However, so far the results are inconclusive (Dufouil, et al., 2005; Rea, et al., 2005; Sjogren, et al., 2003; Sparks, Connor, Browne, Lopez, & Sabbagh, 2002; S parks, Martins, & Martin, 2002; Wolozin, Kellman, Ruosseau, Celesia, & Siegel, 2000; Zamrini, McGwin, & Roseman, 2004; Zandi, et al., 2005)

PAGE 19

7 The Mini Mental State Exam (MMSE) is used to evaluate subjects who begin to present symptoms of cognitive impairme nt. During the past few years, I had the opportunity volunteer at the Johnnie B. Byrd, Sr. Alzheimer's Center and Research Institute Clinic to evaluate the cognitive status of Spanish speaking individuals using the MMSE. I found that in the initial stages of cognitive decline patients often present emotional distress in the form of depression, frustration, and irritability. These signs further exacerbate symptoms of dementia due to ensuing apathy, which leads to hypoprosexia or loss of attention. Patients i n advanced stages of AD or other types of dementia are typically apathetic. It was in these cases where it became evident that the caregivers were the burdened victims. Inasmuch as the disease causes harm to patients, social and economic burdens are inti mately related. Direct and indirect costs of the disease in the US have risen to over $148 billion annually. This figure does not account for an estimated $89 billion provided by the 10 million caregivers in unpaid services to AD patients (Association, 2008) This fiscal hemorrhage burdens State and Federal economies. The urgency for the discovery of effective therapeutic interventions is increasing as "baby boomers" reach the age of AD onset, which is estimated to amount to 10

PAGE 20

8 million people over the upcoming decades (Association, 2008) By 2050, it is estimated that the incidence of AD will reach one million persons per year and a prevalence of 11 to 16 million. Therefore, these costs are likely to widen the hole in the U.S. healthcare system as well as debilitate the efforts in place for the current economic recovery.

PAGE 21

9 Alzheimer's Disease Pathology The Clinical signs of Alzheimer dementia are the result of neurodegeneration, which is rooted in the build up of extracellular amyloid or senile plaques and intracellular neurofibrillary or tau tangles (Kidd, 1963) Alois Alzheimer recognized these structures in the brain sections of Auguste D. Plaques and tangles are similar in that they are aggregated protein complexes that deposit due to their highly unstructured and hydrophobic nature. However, they differ in their proteinaceous components and the pathways through which they conglomerate. The etiological hypotheses of AD pathogenesis have divided the field into two groups that have b een jocularly named "Tau ists" and " APP tists" (Tanzi & Parson, 2000) The former contend that the seeding pathogenic insult is the formation of tangles. Part of the argument is rooted in the fact that the amount of tangles directly correlates with the degree of dementia (Alafuzoff, Iqbal, Friden, Adolfsson, & Winblad, 1987) which is not true of amyloid plaques. The APP tists make

PAGE 22

10 compelling arguments based on the findings that mutations in the genes coding for amyloid precursor protein (APP) (Ancolio, et al., 1999; Chartier Harlin, et al., 1991; Eckman, et al., 1997; Goate, et al., 1991; Hendriks, et al., 1992; Mullan, et al., 1992; Murrell, Farlow, Ghetti, & Benson, 1991) and presenilin (Levy Lahad, et al., 1995; Rogaev, et al., 1995; Sherrington, et al., 1995) have been identified in patients with familial AD. Also, there is an APP gene dosage effect leading to AD or AD like symptoms in Down's syndrome (DS) individuals, who eventually will suffer from AD after their fourth decade of life (Rumble, et al., 1989; K. E. Wisniewski, Wisniewski, & Wen, 1985) Since the APP gene is in chromosome 21, DS individuals carry an extra copy of this gene, thereby increasing the amount of APP. Although recent evidence indicates that plaque deposition antecedes tangle formation (Gotz, Chen, van Dorpe, & Nitsch, 2001; J. Lewis, et al., 2001) it is not yet cl ear whether treatments would be most effective by targeting the clearance of plaques or tangles and when during the course of the disease, such treatments should be initiated. The most popular hypothesis of AD pathogenesis is known as the amyloid cascade which states that A generation is the initial pathogenic step leading to neurodegeneration and dementia (Hardy & Higgins,

PAGE 23

11 1992) Experimental evidence in transgenic mouse models indicates that A deposition is antecedent to tangle formation. Alternative hypotheses propose pacifying theories contending, for instance, that both hallmarks are the result of similar pathogenic pathways or that plaques and tangles are not the major pathogenic culprits in AD but rather by products of a more upstream insult to the CNS that accumula tes over time.

PAGE 24

12 Amyloid Precursor Protein Amyloid deposits at the center of senile plaques are the result of abnormal processing of the amyloid precursor protein (APP) (Kang, et al., 1987) In this process, APP is coordinately cleaved by two enzymes, and # secretase. In this amyloidogenic pathway, the APP protein generates a 38 42 amino acid peptide termed A The most toxic peptide product is A 42 and it is capable of self aggregation into oligomers of varying lengths including fibrils (Lambert, et al., 1998) The pleated she et structure of this peptide makes it more prone for aggregation. O ther proteins can catalyze A a ggregation Non classical chaperones, like apolipoprotein E (apoE) (Costa, Nilsson, Bales, Paul, & Potter, 2004; Howl and, et al., 1998) and anti chymotrypsin (ACT) (Abraham, Selkoe, & Potter, 1988) bind A and are thought to promote its deposition into amyloid. However, the notion that plaques are responsibl e of neurotoxicity is currently being reevaluated. Overwhelming data indicate that it is not plaques that cause the

PAGE 25

13 pathogenic insult leading to AD, but rather the A oligomers themselves that induce neurodegeneration (Hartley, et al., 1999; Hsia, et al., 1999; Lambert, et al., 1998; Lemere, et al., 1996; Mucke, et al., 2000; Walsh, et al., 2002) The APP gene is located on chromosome 21q21.2 3, and it codes for three major isoforms of 770, 751, and 695 amino acids (Kitaguchi, Takahashi, Tokushima, Shiojiri, & Ito, 1988) APP 695 lacks a 56 residue Kunitz protease inhibitor sequence that is present in the other two isoforms. Furthermore, APP 770 has a 19 amino acid sequence of unknown function that is absent in APP 751 Although the three isoforms can be made in many tissues and cells, the comparative ratios with which they are generated are different according to the type of tissue or sub region within the tissue, and the specia l circumstances under which the tissue is stimulated, such as specific developmental stages or disease. For instance, the brain mainly favors expression of APP 695 (Tanaka, et al., 1988) but cultured human a strocytes and hippocampal rat astrocytes preferentially make APP 770 and APP 751 (Gray & Patel, 1993; Rohan de Silva, et al., 1997) So far, there is no definitive explanation for these differences.

PAGE 26

14 APP is found in many membrane associated structures in the cell, and it can be processed in more than one location. Notably, APP has been detected in the endoplasmic reticulum (Tomimoto, Akiguchi, Wakita, Nakamura, & Kimura, 1995) several Golgi compartments (Caporaso, et al., 1994; Tomimoto, et al., 1995) the cell membrane (Tomimoto, et al., 1995) and lysosomes (Haass, Koo, Mellon, Hung, & Selkoe, 1992) Furthermore, APP deposits have been observed to be associated with specific molecules in synaptic vesicles, in postsynaptic membranes of axons and dendrites (Schubert, et al., 1991; Shigematsu, McGeer, & McGeer, 1992) and coupled to membrane rafts (Bouillot, Prochiantz, Rougon, & Allinquant, 1996; Hayashi, Mizuno, Michikawa, Haass, & Yanagisawa, 2000) A g reat deal of research is devoted to characterizing the normal function of APP as a means to understand the pathogenesis of AD. APP has been shown to assume the role of a G protein coupled receptor due to its intracellular association with G 0 in in vitro ex periments (Brouillet, et al., 1999) Also, many APP binding partners participate in cell adhesion and motility, which suggests that APP is also involved in these processes (Br een, 1992; M. Chen & Yankner, 1991; Sabo, Ikin, Buxbaum, & Greengard, 2001) However, the physiological function of APP and its

PAGE 27

15 cleavage products is still poorly understood. Conversely, a lot is known about APP's breakdown product A due to its participa tion in Alzheimer's. AD pathogenesis is the result of increased levels of A 42 which in FAD can be due to mutations on the genes coding for APP and/or the enzymes that process APP. These enzymes have been termed secretases as the products of their proteol ytic activity are secreted, and they have been catalogued based on the target site on APP, namely and # secretases.

PAGE 28

16 secretase APP cleavage can undergo non amyloidogenic processing, whereby secretase cleaves within the A sequen ce (termed the site), hampering formation and subsequent release of the fully formed toxic A peptide. The resulting product is a soluble species named sAPP which corresponds to the large ectodomain of APP. Normally, this is the main product of APP pro cessing in the body (Hooper, 2005) ; however, in AD patients sAPP is significantly decreased in cerebro spinal fluid (CSF) (Lannfelt, Basun, Wahlund, Rowe, & Wagner, 1995; Van Nostrand, et al., 1992) The secretase activity is dependent upon the distance of the cleavage site to the membrane, and the secondary helix structure (Sisodia, 1992) Both of these conditions can be altered by FAD mutations. Protein kinase C (PKC) activators and metabotropic glutamat e receptor agonists induce cleavage of APP at the site (Kirazov, Loffler, Schliebs, & Bigl, 1997; Nitsch, Deng, Wurtman, & Growdon, 1997) Since

PAGE 29

17 these stimuli activate a large number of enzymes, it has been sugges ted that APP is not the only substrate for an secretase. Instead, three enzyme candidates may in fact be secretase (Hooper, 2005) : tumor necrosis factor converting enzyme (TACE/ADAM17) (Black, et al., 1997; Moss, et al., 1997) ADAM9, and ADAM10 (reviewed in (Allinson, Parkin, Turner, & Hooper, 2003) ). Nonetheless, there is no confirmation of these findings. Promotion of cleavage on APP is an attractive therapeutic goal currently underway. However, this requires development of specific secretase agoni sts, since substances like PKC activators have wide range targets.

PAGE 30

18 secretase Pathogenic, A forming pathway of APP processing is executed by and # secretases' cleavage at the amino and carboxy termini of the A peptide, respectively. Th ere are two homologue secretases, BACE1 (Vassar, et al., 1999; Yan, et al., 1999) and BACE2 (Farzan, Schnitzler, Vasilieva, Leung, & Choe, 2000) ( site APP cleaving enzyme s), and they are membrane bound, aspartyl proteases that target APP. Their location, expression, and activity differ (Bennett, et al., 2000) BACE1 is found in many tissues, however particularly in brain and pancreas. In the CNS, BACE1 is mainly produced in neuro ns, while very low levels are detectable in glia (Vassar, et al., 1999) These data correlate with functional studies that show elevated products of BACE1 specific activity on APP in cortical neurons (Sinha, et al., 1999) On the contrary, BACE2 expression in the brain is notably lower than in peripheral tissues such as colon, stomach, and thyroid gland (Bennett, et al., 2000) In the CNS, BACE2 mRNA levels are virtually undetectable except in neurons of the ventromedial hypothalamus and the mamillary body (Bennett, et al.,

PAGE 31

19 2000) BACE2 activity is less prevalent than the pathogenic BACE1 cleavage, which takes place at the amino terminus of A and renders a soluble and extracellular fragment of APP, sAPP The product of BACE1 processing of APP is a membrane bound carboxy terminal fragment, APP CTF which is then available for # secretase to cleave at the carboxy terminus of A This toxic peptide is then released. In contrast, BACE2 cleav es at the site in a non amyloidogenic manner within the A peptide sequence. Therefore, A generation is hampered (Farzan, et al., 2000) Therapeutic interventions to increase BACE2's activity on the non pathogeni c target on APP are currently underway (Farzan, et al., 2000) Like in the case of secretase, full length APP is not the only substrate for secretases (Liu, Doms, & Lee, 2002) Nevertheless, BACE1's pathogenic processing of APP is increased in AD patients where its levels and activity are elevated. This risk is particularly high in indivi duals carrying the Swedish mutation because BACE1 can cleave APP Sw with significantly greater specificity than alternate forms of APP (Yan, et al., 1999)

PAGE 32

20 # secretase The # site on APP is cleaved by # secretas e, a complex enzyme made up of four components, presenilin (PS), nicastrin (NCT), aph 1 and pen 2 After secretase cleavage, # secretase processing of APP generates the A peptide. PS is an aspartyl protease that can incorporate one of two homologous ca talytic subunits, PS1 (Cruts, et al., 1995) and PS2 (J. Li, Ma, & Potter, 1995) They have eight transmembrane domains (TMD), and the active site resides between the sixth an d seventh TMD (X. Li & Greenwald, 1 998) It is here where the two ASP required of aspartyl protease activity are located. Mutation analyses showed that replacing the aspartate for alanine reduced production of A (Wolfe, et al., 1999) This relation ship had remained elusive due to the intra membranous location of the # site. Further progress in the identification of other intra membranous cleavages provided support for this obscure proteolytic activity termed regulated intra membrane proteolysis (RIP ) (Lee, et al., 2002; Ni, Murphy, Golde, & Carpenter, 2001; Sakai, et al., 1996; Schroeter, Kisslinger, & Kopan, 1998)

PAGE 33

21 Aspartyl proteases contain the D(T/S)G(T/S) consensus sequence in the active site. Interesting ly, PSs have a GxGD (where x is any amino acid) in place of the D(T/S)G(T/S) residues in the active site. The GxGD motif is also conserved in other enzymes that perform RIP, like type 4 prepilin peptidases (Steiner, et al., 2000) and signal peptide peptidases (discussed in (Weihofen & Martoglio, 2003) ). It has therefore been suggested that these proteins form a new family of aspartyl proteases whose specialized intra membranous cleavage activity requires a modified sequence from the consensus aspartyl peptidase site (Haass & Steiner, 2002) Linkage analyses identified over 100 mutations leading to some of the most common and aggressively progressing FAD pathologies in the PS genes. Mice with the PS2 gene knocked out (PS2 / ) show no significant change in phenotype from wild type controls, except for mild pulmonary fibrosis and increased ease of hemorrhage over time (Herreman, et al., 1999) APP processing is not affected i n these mice, leading to the assumption that: (1) PS2 may play a minor role regarding APP cleavage and (2) AD mutations on PS2 are gain of function mutations. In contrast, PS1 / mice show severe developmental

PAGE 34

22 deficiencies reminiscent of the Notch1 / phen otype (discussed later) (Herreman, et al., 1999) suggesting that PS1 plays a more physiologically relevant role (Herreman, et al., 1999) As stated previously, PS is a com ponent of the # secretase complex. As such, and based on experiments in different in vivo and in vitro models, it's # site cleavage activity is dependent upon the other four components (Francis, et al., 2002) NCT h as been mostly characterized under scrutiny of its role in # secretase activity, and it has been shown to be indispensable for secretase function (Edbauer, Winkler, Haass, & Steiner, 2002; Hu, Ye, & Fortini, 2002; Le em, et al., 2002) Knockdown and knockout experiments targeting NCT preclude maturation of the # secretase complex (Edbauer, et al., 2002) and reduce or abolish enzymatic activity (Hu, et al., 2002) Furthermore, PS1 / cells exhibit reduced levels of mature NCT, suggesting that NCT maturation is dependent on its interaction with PS 1 (Edbauer, et al., 2002) Genetic screens in C. elegans identified aph 1 (Goutte, Tsunozaki, Hale, & Priess, 2002) and pen 2 (Francis, et al., 2002) as critical elements for # secretase function. More over, pen 2 was found to co immunoprecipitate with NCT implying that it formed the # secretase complex (Steiner, et al., 2002)

PAGE 35

23 These two proteins were quickly recognized as having important roles in Notch process ing, another substrate of # secretase cleavage. Reduction of # secretase activity by downregulation or elimination of any component of the complex results in a phenotype similar to the Notch / models (discussed in (Haass & Steiner, 2002) ). As briefly mentioned above, Notch signaling pathway plays a key role in development. The study of the molecular mechanisms driving this pathway revealed the # secretase mediated cleavage, or S3, of Notch to release a Notch intracellular domain (NICD). This ne wly formed peptide translocates into the nucleus and functions as an activator of gene transcription. Likewise, the # secretase cleavage of APP releases an APP intracellular domain (AICD) that is thought to have transactivating properties like NICD. AICD p romoter elements have not been completely identified. Together, these two mechanisms underscore the way by which # secretase targets type 1 membrane proteins and release an S3 transcription factor. Other recently identified proteins that undergo # secretas e proteolysis are the APP homolog APLP1, Notch 2 4, ErbB 4, E Cadherin, CD44, Nectin1 and LRP (Haass & Steiner, 2002) However, the exact downstream effects of these cleavages have not been conclusively characterized.

PAGE 36

24 Tau The other major pathological hallmark present in AD brains is the presence of neurofibrillary tangles (NFT), made of paired helical filaments (PHF) or & tangles. These structures are intracellular deposits of a filamentous protein whose basic subunit is a toxic, misfolde d, and hyperphosphorylated & (Grundke Iqbal, et al., 1986; Iqbal, et al., 1974; Kosik, Joachim, & Selkoe, 1986) Normally, as a microtubule associated protein (MAP), & promotes elongation and stabilization of microt ubules. The human brain is capable of making six splice variants of & (Goedert, Spillantini, Jakes, Rutherford, & Crowther, 1989) which are ma inly phosphorylated by several kinases like glycogen synthase kinase 3 (GSK3) (Ishiguro, et al., 1993) Conversely, several phosphatases have also been detected as modifiers of & Together, these enzymes keep a balance of active and inactive & to stabilize polymerization of tubulin into microtubules. Interestingly, two of these enzymes, protein phosphatases PP 2A and PP 1, are reduced in AD brains, resulting in & hyperphosphorylation (Gong, Grundke Iqbal, & Iqbal, 199 4; Gong, Singh,

PAGE 37

25 Grundke Iqbal, & Iqbal, 1993) While & phosphorylation permits disassociation for microtubule breakdown, self aggregation and deposition of & is triggered by hyperphosphorylation. This pathogenic hyperphospho & form is not only incapable o f promoting the formation and stabilization of microtubules, but it also sequesters normal & as well as other microtubule stabilizers such as MAP1 and MAP2 (Alonso, Grundke Iqbal, & Iqbal, 1996; Alonso, Zaidi, Grundk e Iqbal, & Iqbal, 1994) The end result is inhibition and disruption of tubulin polymerization (Alonso, et al., 1994) Pathogenic & is present in two cellular pools: PHF and cytosolic hyperphosphorylated & While the former is inert and incapable of binding tubulin (Iqbal, Zaidi, Bancher, & Grundke Iqbal, 19 94) ; the latter comprises 40% of the pathogenic & The cytosolic portion is the most pathogenic as it is free to inhibit microtubule formation and stabilization by impairing microtubule associated proteins 1 and 2, and endogenous, non pathogenic tau (Alonso, et al., 1996; Alonso, et al., 1994; B. Li, Chohan, Grundke Iqbal, & Iqbal, 2007) Although AD brains have the same amount of non pathogenic & as those of non diseased individuals, toxic & levels are increased fo ur to eight fold in AD brains compared to those of non AD individuals (Khatoon, Grundke Iqbal, & Iqbal, 1992,

PAGE 38

26 1994) Since amyloid deposition seems to precede formation of PHF (Gotz, et al., 2001; J. Lewis, et al., 2001) & has been thought to be a downstream component of toxicity and thusly less effective as a therapeutic target. However, other neurodegenerative diseases fronto temporal dementia, progressive supranuclear pal sy, corticobasal degeneration, and Pick's disease, are called tauopathies as they are also characterized by having NFT. The identification of & as a component in the pathology of these diseases underscores the toxic impact of & in AD dementia. In fact, as opposed to amyloid plaques, the amount of tangles correlates better with the clinical diagnosis and degree of dementia in AD patients (Arriagada, Growdon, Hedley Whyte, & Hym an, 1992) ; patients burdened with A plaques without the tangle component lack signs of dementia (Arriagada, et al., 1992; Dickson, et al., 1988; Katzman, et al., 1988)

PAGE 39

27 Cholesterol and the Risk of Alzhei mer's Disease Cholesterol is vital to life because it is an essential component of cell membranes, it is the starting molecule from which steroid hormones originate, and it produces the bile for absorption of other fatty acids necessary for life. In cell membranes, cholesterol provides rigidity that can be used for protein docking, formation of lipid rafts, and to become part of vesicles that will either be fused or evacuated from the plasma membrane. Cholesterol is constantly shed from the cell membrane a nd actively replenished so that the net amount of cholesterol in a cell membrane remains constant. To maintain this equilibrium, a constant cholesterol supply needs to be maintained. To meet this requirement, almost every tissue in the body is capable of m aking and/or internalizing cholesterol. Elucidation of the pathways for biosynthesis, degradation, and cycling of cholesterol has revealed the function of proteins that are directly or indirectly involved in regulating cholesterol. Therefore,

PAGE 40

28 identificat ion of some of these proteins in the CNS has allowed swift strides in understanding how cholesterol is regulated in the brain. Some of these players are the cholesterol transporter, apoE, and its main receptors: LDLR, LRP (LDLR related protein), VLDLR (ver y LDLR), and apoER2 (Pitas, Boyles, Lee, Hui, & Weisgraber, 1987) However, the differences between both peripheral and central compartments relay distinctions between these players. For instance, the main cholesterol transporter in CNS is apoE, whereas in the periphery there are many other apolipoproteins that play a significant role in cholesterol circulation such as apoB and apoA. The brain makes its own apoE that is independent from the plasmatic pool (Linton, et al., 199 1) ; and it also differs in structure (Pitas, Boyles, Lee, Foss, & Mahley, 1987)

PAGE 41

29 Cholesterol Metabolis m in the Brain There is no experimental evidence proving that peripheral cholesterol crosses to the CNS. Several studies concluded that lipoprotein cholesterol did not cross the CNS at any age or region of the CNS. In effect, 125 I labeled LDL injected in travenously was virtually undetectable in CNS of adult mice, sheep, and rabbit, while the liver and adrenal gland took up LDL from 100 to 1000 l/h/g (Osono, Woollett, Herz, & Dietschy, 1995; Spady, Huettinger, Bilhe imer, & Dietschy, 1987) The same observation was found in sheep at both the fetal and suckling stages, which coincide with a very high level of cholesterol accretion due to brain growth and myelination (Turley, Burns, Rosenfeld, & Dietschy, 1996) Similar results were found with 14 C labeled cholesteryl esters in HDL, providing evidence that CNS impermeability to lipoproteins is not unique to LDL (reviewed in (Dietschy & Turley, 2004) ). Other efforts to find potential pathways of cholesterol transport from serum to the brain have be en disproven. For instance, there was no change in CNS cholesterol content or synthesis when deleting brain lipoprotein transporters like

PAGE 42

30 LDLR (Dietschy, Kita, Suckling, Goldstein, & Brown, 1983; Osono, et al., 1995) SR BI, or ABCA1 (Quan, Xie, Dietschy, & Turley, 2003) Finally, increasing serum cholesterol by dietary means did not change the cholesterol content in the CNS (Quan, et al ., 2003) Therefore, cholesterol metabolism in the CNS seems to be independent from peripheral input. This conclusion can be explained in part by the presence of the blood brain barrier (BBB) a cell layered structure of unique endothelial cells that cov er every capillary irrigating the CNS and selectively filters substances for entry to the CNS. Moreover, podocytic processes on astrocytes adjacent to the endothelial cells form tight junctions further reducing fenestrae and minimizing capillary exchange (Rubin & Staddon, 1999) Unlike other body regions where molecules can diffuse paracellularly, permeable substances to the BBB must face the endothelial cells parallel to the capillary (Stewa rt & Hayakawa, 1987) The result is an obstreperous, highly selectively permeable cellular membrane that protects the CNS by regulating the amount and type of molecules that can come in contact with neural tissue. Selective permeability is facilitated via specific transport proteins (Rubin & Staddon, 1999) ; furthermore, like most membranes in the body, the BBB

PAGE 43

31 is permeable to water, and therefore some hydroxylated substances are also capable of diffusing through to the CNS. Eval uation of cholesterol transport across the BBB performed during development yielded similar conclusions. Experiments in developing and adult rats, baboons, and humans show that labeled cholesterol administered intravenously, intragastrically, or by ingesti on in the diet was detected in peripheral organs like liver and adrenal glands; however, such exogenous cholesterol was not detected above background in the brain (Chobanian & Hollander, 1962; Edmond, Korsak, Morrow, Torok Both, & Catlin, 1991; Wilson, 1970; G. Xu, et al., 1998) Since its cholesterol requirement is vast and serum cholesterol is unable to form a part of the brain's sterol pool, the CNS must produce its own cholesterol supply (Dietschy & Turley, 2004) For example, cholesterol synthesis has been measured to be high in oligodendrocytes at the time of intensive myelin forma tion during development (Fu, et al., 1998; H. Jurevics, Bouldin, Toews, & Morell, 1998; H. A. Jurevics & Morell, 1994) This effect correlates with myelin formation in the periphery, where Schwann cells synthesize t he cholesterol used to form myelin in axonic and dendritic prolongations. Moreover, the rate of synthesis decreases as the organism reaches adulthood (H. Jurevics & Morell, 1995; Muse, Jurevics,

PAGE 44

32 Toews, Matsushima, & Morell, 2001; Quan, et al., 2003) Presumably, this occurs as myelin formation has culminated (Dietschy & Turley, 2004) D uring this stage of life, cholesterol accretion is lower than that of synthesis, indicating that the net movement of cholesterol is towards excretion. However, it has also been suggested that the disparity between synthesis and accretion is due to basal ma intenance of glial and neuronal membranes (Spady & Dietschy, 1983) The uniqueness of CNS cholesterol synthesis is also seen in that there is no evidence that CNS synthesized cholesterol is packaged in lipoproteins (Dietschy & Turley, 2004) The net flow of cholesterol exits the CNS into plasma, but in order to cross the BBB, sterols must be modified to become permeable. The enzyme cholesterol 24 hydroxylase ( CYP46A1) is capable of modifying cholesterol into a permeable molecule, 24( S ) hydroxycholesterol (Dietschy & Turley, 2004) Both the detection of mRNA for CYP46A1 almost exclusively in the CNS (Lund, et al., 2003; Lutjohann, et al., 1996) as well as identification of 24( S ) hydroxycholesterol's capacity of exiting the BBB from the CNS (Lutjohann, et al., 1996) suggested a method of sterol flow from CNS to plasma. Once in serum, 24( S ) hydroxycholesterol enters the liver where its conversion to bile acids and

PAGE 45

33 subsequent excretion takes place (Bjorkhem, et al., 2001) Levels of 24( S ) hydroxycholesterol in the develo ping mouse correlate with the initial decline in cholesterol synthesis in CNS (Lund, Guileyardo, & Russell, 1999) Interestingly, mRNA for CYP46A1 was mo stly found in neurons located in areas where the highest levels of myelin formation takes place, suggesting that it is this type of cell that regulates cholesterol turnover at the end of brain development (Lund, et al., 1999) This observation further supports the excretion pathway of cholesterol and contributes to the model of net cholesterol flow from the CNS during different ages in the mouse.

PAGE 46

34 Cholesterol and Disease Cholesterol's function as a delimiting component of plasma membrane and thereby its role as a mediator in cell to cell or cell to milieu interactions, make it subject to a wide range of pathogenic insults. Specifically, as a component of liquid ordered, detergent resistant membrane rafts (lipid rafts), cholesterol docks proteins that can be intrinsic to the memb rane, doubly acylated, palmitoy l a ted, or anchored by glycophosphatidyl inositol (GPI). These proteins perform a vast number of functions for cell survival, development, or homeostasis. Alterations to cholesterol in these membranes undoubtedly cause insults to the cellular balance and, in most extreme cases, cause disease. Some examples of diseases resulting from alterati ons to cholesterol in rafts are AD, Parkinson's disease, Niemann Pick disease, diabetes, neoplasia, atherosclerosis, B and T cell response, asthma, and prion diseases, among many others (K. Simons & Ehehalt, 2002) Genetic disorders inducing hypocholesterolemia further underscore

PAGE 47

35 the importance of cholesterol in brain development. Smith Lemli Optiz syndrome is characterized by the inability of patients to pro cure cholesterol. As a result, multisystemic alterations ensue, such as pulmonary deficit due to the inability to produce lung surfactant. Also, neurodevelopment is altered, and these patients are characterized by mental retardation (Salen, et al., 1996) Less severe cases where cholesterol fluctuations occur have been postulated as the root causes of behavioral diseases. For instance, low serum cholesterol levels have been related to suicidal, criminal, and aggressive beh avior and has led to the hypothesis that reduced serum cholesterol may in turn reduce serotonin, a hormone involved in behavior (Engelberg, 1992) In effect, these individuals have lower serum serotonin levels (Engelberg, 1992; Muldoon, Manuck, & Matthews, 1990) Also, hyper and hypocholesterolemia are associated with all cause mortality Too high or too low cholesterolemia is directly proportional to non violent mortality rates (Iribarren, Reed, Chen, Yano, & Dwyer, 1995; Jacobs, 1993; Muldoon, et al., 1990; Peterson, Trell, & Sternby, 1981) Howe ver, these latter hypotheses are based on association and have not been molecularly linked. AD and atherosclerosis are discussed below. Associations between cholesterol and these two diseases are population based, and their links

PAGE 48

36 have been further studi ed using animal models. Cholesterol and Atherosclerosis Cholesterol's reputation has been besmirched by its role in cardiovascular disease. Excess cholesterol from the diet leads to atherosclerosis, a condition where lipid deposits laminate and eventual ly obstruct the lumen of blood vessels (Small & Shipley, 1974) The result is reduction in blood supply to the region where arteries (at the capillary portion) irrigate. Atherosclerosis is especially damaging when it occurs in the coronary arteries that feed the heart since their occlusion mainly results in myocardial infarction and, in severe cases, leads to death (Keys, 1975) The population consuming western diets, where total concentration of cholesterol is 300 500 mg of cholesterol/day (Berenson, et al., 1992; L. A. Lewis, et al., 1957) compared to <100 mg of cholesterol/day in Amerindians, tribes in Papua New Guinea, and rural Chinese is at high risk for the fatal consequences of coronary occlusion (Z. Chen, et al., 1991; Connor, et al ., 1978; Dietschy & Turley, 2004; McMurry,

PAGE 49

37 Cerqueira, Connor, & Connor, 1991; McMurry, Connor, Lin, Cerqueira, & Connor, 1985; Mendez, Tejada, & Flores, 1962; Sinnett & Whyte, 1973; Whyte & Yee, 1958) As a result, these factors have prompted extensive in vestigation of peripheral cholesterol metabolism. However, though common, atherosclerosis induced cerebro vascular accidents have been a second plane of cholesterol research. Consequently, there is poor understanding of cholesterol homeostasis in the CNS. Hypercholesterolemia is not only found as a consequence of diet, but also from genetic predisposition. The most commonly studied form of hypercholesterolemia is the latter condition, where a series of mutations that affect proteins involved in cholestero l metabolism were analyzed. Familial hypercholesterolemia (FH), an autosomal dominantly inherited disease, is caused by mutations in a gene encoding a particular protein called the LDLR. This receptor has the highest binding affinity for apolipoprotein E ( apoE). FH mutations lead to a reduction or ablation of LDLR function, resulting in hypercholesterolemia. Patients who are homozygous for FH mutations have no functional LDLR; this severe form of the disease leads to early mortality typically by way of acut e myocardial infarction.

PAGE 50

38 Cholesterol and Alzheimer's Disease Cholesterol has been portrayed as an important link to AD pathogenesis because 1) apolipoprotein E4, a cholesterol transporter, is the main molecular risk factor for both AD and atheroscler osis (Corder, et al., 1993) ; 2) hypercholesterolemia is an independent risk factor, as increased levels of LDL cholesterol in mid life correlate with higher risk for AD (Notkola, et al., 1998) ; 3) cognitively intact individuals with signs of heart disease show prevalen t amyloid plaque load compared to age matched individuals without cardiovascular ailment (Sparks, et al., 1990) ; 4) AD patients have higher LDL, which correlate with A levels (Kuo, et al., 1998) ; 5) protective proteins against cardiovascular disease, like HDL and apoA1, are decreased in AD patients (Merched, Xia, Visvikis, Serot, & Siest, 2000) ; 5) A production can be manipulated by mod ifying the pools of membrane cholesterol (Fassbender, et al., 2001; M. Simons, et al., 1998) ; 6) brains of rabbits fed a high cholesterol diet present A deposits (Sparks, et al., 1994) ; 7) atherogenic diets accelerate A deposition in AD transgenic mice (Levin Allerhand, Lominska, & Smith,

PAGE 51

39 2002; Refolo, et al., 2000; Shie, Jin, Cook, Leverenz, & LeBoeuf, 2002) ; and 8) atherosclerotic l esions and cognitive decline correlate with A load in transgenic AD mice backcrossed to a strain that is susceptible to formation of atheromas (L. Li, Cao, Garber, Kim, & Fukuchi, 2003) Other preliminary observati ons include the finding that individuals treated with cholesterol lowering drugs are at lower risk of AD (Buxbaum, Cullen, & Friedhoff, 2002; Sjogren, et al., 2003) ; however, these results are contradicted and remai n unconfirmed (Fassbender, et al., 2002; M. Simons, et al., 2002) Studies carried out in vitro conclude that cholesterol plays a role in modulating A generation. Treatment of HEK 293 cells stably expressing full length APP with lovastatin reduces intracellular cholesterol by 50% and virtually inhibits secretion of amyloidogenic products from APP cleavage (F rears, Stephens, Walters, Davies, & Austen, 1999) Meanwhile, treatment of the same cells with exogenous cholesterol induces a 4 fold increase in total secreted amyloidogenic products and decreased products of APP cleavage by secretase (Bodovitz & Klein, 1996; Frears, et al., 1999) Interestingly, while 1.8 fold of the increased amyloidogenic species correspond to A 40 A 42 levels are decreased (Frears, et al., 1999) in the media. Cholesterol reduces glycosylation and consequently the cleavage of APP into non pathogenic products (Galbete, et al., 2000) Cellular ves icle transport is

PAGE 52

40 reduced when exposed to pathogenic A ; this alteration is replicated by treatment with low levels of extracellular cholesterol. Together, these studies indicate that exogenous cholesterol provokes A production and reduces secretase cle avage products. However, the exact mechanisms are unclear. These studies measure APP products in the media, yet intracellular A 42 is unaccounted upon cholesterol induced production of A It can be inferred that A 42 may cause intracellular toxicity leadi ng to cell death. Overall, the elucidation of cholesterol's involvement in neurodegenerative diseases has been elusive and this is partly due to the difficulty of accessing the CNS in vivo for analytical studies. Nevertheless, several groups have evaluat ed 24( S ) hydroxycholesterol as a measure of cholesterol efflux during disease (Bjorkhem & Meaney, 2004) and in the case of AD, it was found that there is an initial increase in serum 24( S ) hydroxycholesterol (Heverin, et al., 2004; Papassotiropoulos, et al., 2002; Papassotiropoulos, et al., 2000; Schonknecht, et al., 2002) Other studies revealed that CYP46A1 expression is shifted ectopically from neurons to glia in AD patients, which should result in de creased 24( S ) hydroxycholesterol (Bogdanovic, et al., 2001; J. Brown, 3rd, et al., 2004) The conflict in these results can be settled by underscoring the

PAGE 53

41 timing between these measurements, as an initial peak of 24( S ) hydroxycholesterol could be the result of demyelination, while the reduction in CYP46A1 expression could be the result of neuronal loss, as it is neurons that make this enzyme. Ultimately, AD patients have increased serum levels of another oxysterol tha t can evacuate the CNS by a CYP46A1 independent pathway. Conversion of cholesterol to 27 hydroxycholesterol is presumed to be accountable for the major sterol excretion from the CNS seen in AD. Unfortunately, there is a lack in confirmatory reports or even studies deepening the understanding of cholesterol flow during neurodegenerative diseases (Dietschy & Turley, 2004)

PAGE 54

42 Apolipoprotein E Isoforms and Disease ApoE is a 34 kDa, 299 amino acid glycoprotein and is the chief cholesterol transporter in the central nervous system (CNS). In the periphery, apoE is a major component of VLDL. Aside from its involvement in c holesterol transport, apoE also participates in peripheral nerve recovery, pathogenic chaperoning of A (T. Wisniewski & Frangione, 1992) and signal transductio n by way of the various receptors it is able to bind (Strittmatter, 2001) The APOE gene, located on chromosome 19q13, may code for any homozygote or heterozygote combination of three isoforms apoE2, apoE3, and apoE4 (Havel & Kane, 1973; Zannis, Just, & Breslow, 1981) Structure function differences between the apoE isoforms increase the ri sk for several diseases. The E4 isoform of apoE is the strongest molecular risk factor for AD onset. It is estimated that 60% of LOAD cases are attributable to the apoE4 isoform (Rubinsztein & Easton, 1999) and about 60 80% of all AD patients have at least one copy of apoE4

PAGE 55

43 (Mahley, Weisgraber, & Huang, 2006; Saunders, et al., 1993; Strittmatter, et al., 1993) Furthermore, the risk for AD is increased in an allelic dose dependent manner where two copies of apoE4 result in higher risk than any other isoform combination (Corder, et al., 19 93) The isoforms differ in both the frequencies with which they are found in the population as well as in the primary structure in amino acids 112 and 158: apoE2 (frequency of 2 5%) has a cysteine in each one of these sites; apoE3 is the most common (6 5 70%) and has Cys 112 and Arg 158; finally, apoE4 (15 20%) has two arginines at these sites (Rall, Weisgraber, & Mahley, 1982; Weisgraber, Rall, & Mahley, 1981) Structural differences affect the lipid content of t he isoforms, where Arg 112 on E4 makes it more favorable for carrying large, triglyceride rich VLDL particles, rather than smaller phospholipids on HDL. Furthermore, the apoE4 substitutions elicit a stronger interaction between the C terminal and N termina l domains, rendering a more compact structure than apoE3 (Mahley, 1988; Mahley & Rall, 2000; Weisgraber, 1994) In the CNS, apoE cholesterol is principally made in astrocytes and exported to neurons (Boyles, Pitas, Wilson, Mahley, & Taylor, 1985; Elshourbagy, Liao, Mahley, & Taylor, 1985) ; however, neurons can also

PAGE 56

44 produce apoE cholesterol during stress (Q. Xu, et al., 2006) Despite expressing several receptors that are capable of internalizing apoE, such as low density lipoprotein receptor (LDLR), LDLR related protein (LRP), apoER2, and VLDLR, neurons mainly import apoE via the LDLR (Innerarity & Mahley, 1978; Innerarity, Pitas, & Mahley, 1979; Mahley, 1988; Mahley & Rall, 2000)

PAGE 57

45 Low Density Lipoprotein Receptor (LDLR) and Disease While investigating the causes of Famil ial Hypercholesterolemia, Brown and Goldstein characterized the LDLR and elucidated the process of receptor mediated endocytosis (Goldstein & Brown, 1976) For this work, they were awarded the Nobel Prize in 1985. They describ ed the LDLR as a membrane spanning glycoprotein that plays a critical role in removing LDL and VLDL from the blood (Sudhof, Goldstein, Brown, & Russell, 1985) Under low intracellular sterol levels, LDLR gene expression is primarily and directly activated by sterol response element binding proteins (SREBPs) (Smith, Osborne, Goldstein, & Brown, 1990) and secondarily by thyroid hormone (Lopez, Abisambra Socarras, Bedi, & Ness, 2007) Translation of the mRNA yields a 120 kDa protein that is further post translationally modified in the Golgi apparatus into a mature, 160 kDa protein (Tolleshaug, Goldstein, Schneider, & Brown, 1982; Yamamoto, et al., 1984) It has been classified as having five regions: an N terminal ligand binding domain (LBD) (Sudhof, Goldstein, et al., 1985; Su dhof, Russell, et al., 1985) an epidermal growth factor precursor

PAGE 58

46 homology domain (Davis, Goldstein, et al., 1987; Sudhof, Russell, et al., 1985) an O linked polysaccharide domain (Davis, et al., 1986) where the protein is post translationally modified, a membrane spanning domain (Goldstein, Brown, Anderson, Russell, & Schneider, 1985; Lehrman, Russell, Goldstein, & Brown, 1987; Lehrm an, et al., 1985) and a C terminal cytoplasmic domain (Goldstein, et al., 1985) Upon maturation, the LDLR is transported to the cell membrane as a clathrin coat ed pit vesicle (Davis, van Driel, Russell, Brown, & Goldstein, 1987) On the membrane, the LBD is exposed to bind and internalize LDL or VLDL, mediated by apoB or apoE binding to LDLR, respectively. Once inside the cell, the LDLR ligand containing vesicle undergoes acidification by proton pumps (M. S. Brown & Goldstein, 1986) leading to uncoupling of the receptor ligand complex. At this point, the LDL or VLDL cholesterol undergoes further processing to be readily available for the cell's requirements. Meanwhile, the LDLR can be either recycled or degraded. The latter case occurs in a poorly understood process that involves the proprotein convertase subtilisin/kexin type 9 or neural apoptosis regulated converstase 1 (PCSK9/NARC1), the main regulator of LDLR turnover (Maxwell & Breslow, 2004; Maxwell, Fisher, & Breslow, 2005; Park, Moon, & Horton, 2004) This property was elucidated by characterizing the physiological implications of mutations leading to gain

PAGE 59

47 (Abifadel, et al., 2003; Allard, et al., 2005; Cameron, et al., 2008; S. N. Chen, et al., 2005; Leren, 2004; Miyake, et al., 2008; Scartezini, et al., 2007; Sun, et al., 2005; Timms, et al., 2004) and loss of PCSK9 function (Abboud, et al., 2007; Berge, Ose, & Leren, 2006; Cameron, et al., 2008; Cohen, et al., 2005; Fasano, et al., 2007; Miyake, et al., 2008; Scartezini, et al., 2007; Zhao, et al., 2006) which result in LDL induced hypercholesterolemi a and hypocholesterolemia, respectively. Linkage analyses were based on the fact that the LDLR gene locus and a region associated with high frequency of AD risk share a common location on chromosome 19 (Blacker, et al., 2003; Wijsman, et al., 2004) Furthermore, this peak of risk for AD onset is independent of the risk imparted by the apoE gene (Wijsman, et al., 2004) Consequent attempts to characterize linkage of LDLR and AD onset yielded at least ten, case control association studies and one family based study (Cheng, et al., 2005; Corder, et al., 2006; Gopalraj, et al., 2005; Lamsa, et al., 2008; Lendon, et al., 1997; H. Li, et al., 2008; Papassotiropoulos, et al., 2005; Retz, et al., 2001; Rodriguez, et al., 2006; Scacchi, et al., 2001; Zou, et al., 2008) Of particular interest were polymorphisms contained in exons 8, 10, 13, and 15, as they had been proposed to have associations with risk of AD onset (Cheng, et al., 2005; Gopalraj, et al., 2005; Retz, et

PAGE 60

48 al., 2001) The overall conclusion of these studies is not yet clear. Other conflicting reports investigating LDLR's participation in AD have taken place at the biological level (Cao, Fukuchi, Wan, Kim, & Li, 2006; Fryer, et al., 2005; Thirumangalakudi, et al., 2008) The purpose for these studies was to investigate whether elimination of LDLR expre ssion would affect the AD pathology in mouse models of the disease. To this end, Fryer et. al. and Cao et. al. crossed the LDLR / mouse with AD mouse models: the PDAPP and Tg2576, respectively. Both groups agree that LDLR is the main regulator of apoE in CNS as they observed a significant increase in apoE levels in the CNS of their respective mice. However, Fryer et. al. did not see changes in the Alzheimer's pathology. On the contrary, Cao et. al. report a mild yet significant increase in plaque depositi on; furthermore, this study also reported that the mice performed poorly on a battery of cognitive tests. Dietary cholesterol modulates the rate at which APP is processed into A Studies using animals fed high cholesterol diets revealed an increase in a myloid plaque formation in rabbits and in transgenic mouse models of AD (Howland, et al., 1998; Shie, et al., 2002; Sparks, et al., 1994) ; moreover, in these mice, the high cholesterol diet also induced

PAGE 61

49 cognitive de cline (Thirumangalakudi, et al., 2008) In vitro studies demonstrated that APP processing is highly dependent upon the availability of cellular cholesterol. Cholesterol depleted rat hippocampal primary neurons show reduced APP processing into A (Fassbender, et al., 2001; M. Simons, et al., 1998) yet favor the generation of non amyloidogenic APP processing by secretase (Bodovitz & Klei n, 1996; Kojro, Gimpl, Lammich, Marz, & Fahrenholz, 2001) These biochemical studies employed strategies and approaches that attempted to elucidate the effects of LDLR on amyloid pathology in AD mice. However, the question of whether LDLR is involved in AD pathogenesis and/or progression remains unanswered. Consequently, our approach was to determine the effects of amyloid pathology on LDLR expression and localization. The results described in chapter 3 show that overexpression of APP/A increased LDLR expression and causes it to accumulate in the trans Golgi network (TGN) by affecting microtubule organization. The implications are that LDLR function will be impaired. A normal response of decreased levels of intracellular cholesterol is transcriptional a ctivation of the metabolic pathways leading to increased cholesterol import and de novo biosynthesis. Consistent with these results is the upregulation of LDLR mRNA as a sign of reduced

PAGE 62

50 intracellular cholesterol. These effects could result in dysregulated cholesterol metabolism with increased membrane cholesterol, which in turn favors A production. Another implication is that APP/A induced microtubule damage would inherently affect protein trafficking, vesicle transport, and cytoskeletal support provid ed by the microtubule network. Taken together, these events may represent components of AD pathogenesis and or progression, and thusly merit further study.

PAGE 63

51 Final Introductory Remarks The work presented in the following chapters provides fu rther insight into the role of LDLR in AD pathogenesis and/or progression. The current knowledge of the LDLR and AD relationship is controversial in that both population studies and basic research approaches reach conflicting results, which grant or remove participation of LDLR in the pathogenic process of Alzheimer's disease. At best, one may conclude that different populations harbor specific polymorphisms in the LDLR gene that result in changes in cholesterol homeostasis. The common mouse model for th e study of atherosclerosis is the LDLR / mouse model of hypercholesterolemia (Cao, et al., 2006; Fryer, et al., 2005; Thirumangalakudi, et al., 2008) In principle this mouse model is expected to be deprived of LD LR and should therefore facilitate the evaluation of LDLR's downstream effects. These effects were studied with a focus on specific interactions with cholesterol levels in serum and CNS, cholesterol homeostasis on a high cholesterol diet, AD pathology,

PAGE 64

52 and cognition. The selection of cholesterol and apoE as targets for evaluation is appropriate as they are independent risk factors of AD. Likewise, the assessment of changes in AD pathogenesis or cognition was performed using a mouse model consisting of a cro ss between the LDLR / and other AD mouse models. Our first objective was to study the LDLR / model to assess whether it is a valid model for evaluating the effect of LDLR absence in AD. We surmised that defects in the models could result in opposing ou tcomes. In fact, Thirumangalakudi et. al. discuss this problem in their report by delineating differences in AD model backgrounds and ages at which the mice were evaluated in the studies by Fryer, et. al and Cao, et. al Nonetheless, they used the LDLR / model as a validated transgenic vehicle with precluded LDLR production. Our second objective was focused on characterizing possible alterations to the expression and localization of LDLR in AD. Specifically, we investigated the effects of overexpressing APP/A in in vivo and in vitro models on LDLR expression and localization. While previous studies by others evaluated the absence of LDLR in AD models, we sought to determine how APP overexpression altered the expression or location of

PAGE 65

53 LDLR. References Abboud, S., P. J. Karhunen, et al. (2007). "Proprotein convertase subtilisin/kexin type 9 (PCSK9) gene is a risk factor of large vessel atherosclerosis stroke." PLoS ONE 2(10): e1043. Abifadel, M., M. Varret, et al. (2003). "Mutations i n PCSK9 cause autosomal dominant hypercholesterolemia." Nat Genet 34(2): 154 6. Abraham, C. R., D. J. Selkoe, et al. (1988). "Immunochemical identification of the serine protease inhibitor alpha 1 antichymotrypsin in the brain amyloid deposits of Alzheimer 's disease." Cell 52(4): 487 501. Alafuzoff, I., K. Iqbal, et al. (1987). "Histopathological criteria for progressive dementia disorders: clinical pathological correlation and classification by multivariate data analysis." Acta Neuropathol 74(3): 209 25. A llard, D., S. Amsellem, et al. (2005). "Novel mutations of the PCSK9 gene cause variable phenotype of autosomal dominant

PAGE 66

54 hypercholesterolemia." Hum Mutat 26(5): 497. Allinson, T. M., E. T. Parkin, et al. (2003). "ADAMs family members as amyloid precursor p rotein alpha secretases." J Neurosci Res 74(3): 342 52. Alonso, A. C., I. Grundke Iqbal, et al. (1996). "Alzheimer's disease hyperphosphorylated tau sequesters normal tau into tangles of filaments and disassembles microtubules." Nat Med 2(7): 783 7. Alonso A. C., T. Zaidi, et al. (1994). "Role of abnormally phosphorylated tau in the breakdown of microtubules in Alzheimer disease." Proc Natl Acad Sci U S A 91(12): 5562 6. Ancolio, K., C. Dumanchin, et al. (1999). "Unusual phenotypic alteration of beta amylo id precursor protein (betaAPP) maturation by a new Val 715 -> Met betaAPP 770 mutation responsible for probable early onset Alzheimer's disease." Proc Natl Acad Sci U S A 96(7): 4119 24. Arriagada, P. V., J. H. Growdon, et al. (1992). "Neurofibrillary tan gles but not senile plaques parallel duration and severity of Alzheimer's disease." Neurology 42(3 Pt 1): 631 9. Association, A. s. (2008). "2008 Alzheimer's disease facts and figures." Alzheimers Dement 4(2): 110 33. Bartus, R. T., R. L. Dean, 3rd, et al. (1982). "The cholinergic hypothesis

PAGE 67

55 of geriatric memory dysfunction." Science 217(4558): 408 14. Bennett, B. D., S. Babu Khan, et al. (2000). "Expression analysis of BACE2 in brain and peripheral tissues." J Biol Chem 275(27): 20647 51. Berenson, G. S., W A. Wattigney, et al. (1992). "Atherosclerosis of the aorta and coronary arteries and cardiovascular risk factors in persons aged 6 to 30 years and studied at necropsy (The Bogalusa Heart Study)." Am J Cardio l 70(9): 851 8. Berge, K. E., L. Ose, et al. (2 006). "Missense mutations in the PCSK9 gene are associated with hypocholesterolemia and possibly increased response to statin therapy." Arterioscler Thromb Vasc Biol 26(5): 1094 100. Bjorkhem, I., U. Andersson, et al. (2001). "From brain to bile. Evidence that conjugation and omega hydroxylation are important for elimination of 24S hydroxycholesterol (cerebrosterol) in humans." J Biol Chem 276(40): 37004 10. Bjorkhem, I. and S. Meaney (2004). "Brain cholesterol: long secret life behind a barrier." Arteriosc ler Thromb Vasc Biol 24(5): 806 15. Black, R. A., C. T. Rauch, et al. (1997). "A metalloproteinase disintegrin that releases tumour necrosis factor alpha from cells." Nature 385(6618): 729 33.

PAGE 68

56 Blacker, D., L. Bertram, et al. (2003). "Results of a high reso lution genome screen of 437 Alzheimer's disease families." Hum Mol Genet 12(1): 23 32. Bodovitz, S. and W. L. Klein (1996). "Cholesterol modulates alpha secretase cleavage of amyloid precursor protein." J Biol Chem 271(8): 4436 40. Bogdanovic, N., L. Breti llon, et al. (2001). "On the turnover of brain cholesterol in patients with Alzheimer's disease. Abnormal induction of the cholesterol catabolic enzyme CYP46 in glial cells." Neurosci Lett 314(1 2): 45 8. Bouillot, C., A. Prochiantz, et al. (1996). "Axonal amyloid precursor protein expressed by neurons in vitro is present in a membrane fraction with caveolae like properties." J Biol Chem 271(13): 7640 4. Boyles, J. K., R. E. Pitas, et al. (1985). "Apolipoprotein E associated with astrocytic glia of the cent ral nervous system and with nonmyelinating glia of the peripheral nervous system." J Clin Invest 76(4): 1501 13. Breen, K. C. (1992). "APP collagen interaction is mediated by a heparin bridge mechanism." Mol Chem Neuropathol 16(1 2): 109 21. Brouillet, E., A. Trembleau, et al. (1999). "The amyloid precursor protein

PAGE 69

57 interacts with Go heterotrimeric protein within a cell compartment specialized in signal transduction." J Neurosci 19(5): 1717 27. Brown, J., 3rd, C. Theisler, et al. (2004). "Differential expres sion of cholesterol hydroxylases in Alzheimer's disease." J Biol Chem 279(33): 34674 81. Brown, M. S. and J. L. Goldstein (1986). "A receptor mediated pathway for cholesterol homeostasis." Science 232(4746): 34 47. Buxbaum, J. D., E. I. Cullen, et al. (200 2). "Pharmacological concentrations of the HMG CoA reductase inhibitor lovastatin decrease the formation of the Alzheimer beta amyloid peptide in vitro and in patients." Front Biosci 7: a50 9. Cameron, J., O. L. Holla, et al. (2008). "Characterization of n ovel mutations in the catalytic domain of the PCSK9 gene." J Intern Med 263(4): 420 31. Cao, D., K. Fukuchi, et al. (2006). "Lack of LDL receptor aggravates learning deficits and amyloid deposits in Alzheimer transgenic mice." Neurobiol Aging 27(11): 1632 43. Caporaso, G. L., K. Takei, et al. (1994). "Morphologic and biochemical analysis of the intracellular trafficking of the Alzheimer beta/A4 amyloid precursor protein." J Neurosci 14(5 Pt 2): 3122 38. Chartier Harlin, M. C., F. Crawford, et al. (1991). "E arly onset

PAGE 70

58 Alzheimer's disease caused by mutations at codon 717 of the beta amyloid precursor protein gene." Nature 353(6347): 844 6. Chen, M. and B. A. Yankner (1991). "An antibody to beta amyloid and the amyloid precursor protein inhibits cell substratum adhesion in many mammalian cell types." Neurosci Lett 125(2): 223 6. Chen, S. N., C. M. Ballantyne, et al. (2005). "A common PCSK9 haplotype, encompassing the E670G coding single nucleotide polymorphism, is a novel genetic marker for plasma low density li poprotein cholesterol levels and severity of coronary atherosclerosis." J Am Coll Cardiol 45(10): 1611 9. Chen, Z., R. Peto, et al. (1991). "Serum cholesterol concentration and coronary heart disease in population with low cholesterol concentrations." BMJ 303(6797): 276 82. Cheng, D., R. Huang, et al. (2005). "Functional interaction between APOE4 and LDL receptor isoforms in Alzheimer's disease." J Med Genet 42(2): 129 31. Chobanian, A. V. and W. Hollander (1962). "Body cholesterol metabolism in man. I. The equilibration of serum and tissue cholesterol." J Clin Invest 41: 1732 7. Cohen, J., A. Pertsemlidis, et al. (2005). "Low LDL cholesterol in individuals of African descent resulting from frequent nonsense

PAGE 71

59 mutations in PCSK9." Nat Genet 37(2): 161 5. Conno r, W. E., M. T. Cerqueira, et al. (1978). "The plasma lipids, lipoproteins, and diet of the Tarahumara indians of Mexico." Am J Clin Nutr 31(7): 1131 42. Corder, E. H., R. Huang, et al. (2006). "Membership in genetic groups predicts Alzheimer disease." Rej uvenation Res 9(1): 89 93. Corder, E. H., A. M. Saunders, et al. (1993). "Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer's disease in late onset families." Science 261(5123): 921 3. Costa, D. A., L. N. Nilsson, et al. (2004). "Apolip oprotein is required for the formation of filamentous amyloid, but not for amorphous Abeta deposition, in an AbetaPP/PS double transgenic mouse model of Alzheimer's disease." J Alzheimers Dis 6(5): 509 14. Coyle, J. T., D. L. Price, et al. (1983). "Alzheim er's disease: a disorder of cortical cholinergic innervation." Science 219(4589): 1184 90. Cruts, M., H. Backhovens, et al. (1995). "Genetic and physical characterization of the early onset Alzheimer's disease AD3 locus on chromosome 14q24.3." Hum Mol Gene t 4(8): 1355 64. Davies, P. and A. H. Verth (1977). "Regional distribution of muscarinic acetylcholine receptor in normal and Alzheimer's type dementia brains." Brain Res 138(2): 385 92.

PAGE 72

60 Davis, C. G., A. Elhammer, et al. (1986). "Deletion of clustered O li nked carbohydrates does not impair function of low density lipoprotein receptor in transfected fibroblasts." J Biol Chem 261(6): 2828 38. Davis, C. G., J. L. Goldstein, et al. (1987). "Acid dependent ligand dissociation and recycling of LDL receptor mediat ed by growth factor homology region." Nature 326(6115): 760 5. Davis, C. G., I. R. van Driel, et al. (1987). "The low density lipoprotein receptor. Identification of amino acids in cytoplasmic domain required for rapid endocytosis." J Biol Chem 262(9): 407 5 82. Dickson, D. W., J. Farlo, et al. (1988). "Alzheimer's disease. A double labeling immunohistochemical study of senile plaques." Am J Pathol 132(1): 86 101. Dietschy, J. M., T. Kita, et al. (1983). "Cholesterol synthesis in vivo and in vitro in the WHH L rabbit, an animal with defective low density lipoprotein receptors." J Lipid Res 24(4): 469 80. Dietschy, J. M. and S. D. Turley (2004). "Thematic review series: brain Lipids. Cholesterol metabolism in the central nervous system during early development and in the mature animal." J Lipid Res 45(8): 1375 97. Dufouil, C., F. Richard, et al. (2005). "APOE genotype, cholesterol level, lipid lowering treatment, and dementia: the Three City Study."

PAGE 73

61 Neurology 64(9): 1531 8. Eckman, C. B., N. D. Mehta, et al. (19 97). "A new pathogenic mutation in the APP gene (I716V) increases the relative proportion of A beta 42(43)." Hum Mol Genet 6(12): 2087 9. Edbauer, D., E. Winkler, et al. (2002). "Presenilin and nicastrin regulate each other and determine amyloid beta pepti de production via complex formation." Proc Natl Acad Sci U S A 99(13): 8666 71. Edmond, J., R. A. Korsak, et al. (1991). "Dietary cholesterol and the origin of cholesterol in the brain of developing rats." J Nutr 121(9): 1323 30. Elshourbagy, N. A., W. S. Liao, et al. (1985). "Apolipoprotein E mRNA is abundant in the brain and adrenals, as well as in the liver, and is present in other peripheral tissues of rats and marmosets." Proc Natl Acad Sci U S A 82(1): 203 7. Engelberg, H. (1992). "Low serum cholester ol and suicide." Lancet 339(8795): 727 9. Farzan, M., C. E. Schnitzler, et al. (2000). "BACE2, a beta secretase homolog, cleaves at the beta site and within the amyloid beta region of the amyloid beta precursor protein." Proc Natl Acad Sci U S A 97(17): 9 712 7. Fasano, T., A. B. Cefalu, et al. (2007). "A novel loss of function mutation

PAGE 74

62 of PCSK9 gene in white subjects with low plasma low density lipoprotein cholesterol." Arterioscler Thromb Vasc Biol 27(3): 677 81. Fassbender, K., M. Simons, et al. (2001). "Simvastatin strongly reduces levels of Alzheimer's disease beta amyloid peptides Abeta 42 and Abeta 40 in vitro and in vivo." Proc Natl Acad Sci U S A 98(10): 5856 61. Fassbender, K., M. Stroick, et al. (2002). "Effects of statins on human cerebral chole sterol metabolism and secretion of Alzheimer amyloid peptide." Neurology 59(8): 1257 8. Forsyth, D. R., G. K. Wilcock, et al. (1989). "Pharmacokinetics of tacrine hydrochloride in Alzheimer's disease." Clin Pharmacol Ther 46(6): 634 41. Francis, R., G. McG rath, et al. (2002). "aph 1 and pen 2 are required for Notch pathway signaling, gamma secretase cleavage of betaAPP, and presenilin protein accumulation." Dev Cell 3(1): 85 97. Frears, E. R., D. J. Stephens, et al. (1999). "The role of cholesterol in the b iosynthesis of beta amyloid." Neuroreport 10(8): 1699 705. Fryer, J. D., R. B. Demattos, et al. (2005). "The low density lipoprotein receptor regulates the level of central nervous system human and murine apolipoprotein E but does not modify amyloid plaque

PAGE 75

63 pathology in PDAPP mice." J Biol Chem 280(27): 25754 9. Fu, Q., J. F. Goodrum, et al. (1998). "Control of cholesterol biosynthesis in Schwann cells." J Neurochem 71(2): 549 55. Galbete, J. L., T. R. Martin, et al. (2000). "Cholesterol decreases secretion of the secreted form of amyloid precursor protein by interfering with glycosylation in the protein secretory pathway." Biochem J 348 Pt 2: 307 13. Gaykema, R. P., C. Nyakas, et al. (1992). "Cholinergic fiber aberrations in nucleus basalis lesioned rat and Alzheimer's disease." Neurobiol Aging 13(3): 441 8. Giacobini, E. (1997). "From molecular structure to Alzheimer therapy." Jpn J Pharmacol 74(3): 225 41. Goate, A., M. C. Chartier Harlin, et al. (1991). "Segregation of a missense mutation in the amyloid pr ecursor protein gene with familial Alzheimer's disease." Nature 349(6311): 704 6. Goedert, M., M. G. Spillantini, et al. (1989). "Multiple isoforms of human microtubule associated protein tau: sequences and localization in neurofibrillary tangles of Alzhei mer's disease." Neuron 3(4): 519 26. Goldstein, J. L. and M. S. Brown (1976). "The LDL pathway in human fibroblasts: a receptor mediated mechanism for the regulation of

PAGE 76

64 cholesterol metabolism." Curr Top Cell Regul 11: 147 81. Goldstein, J. L., M. S. Brown, et al. (1985). "Receptor mediated endocytosis: concepts emerging from the LDL receptor system." Annu Rev Cell Biol 1: 1 39. Gong, C. X., I. Grundke Iqbal, et al. (1994). "Dephosphorylation of Alzheimer's disease abnormally phosphorylated tau by protein ph osphatase 2A." Neuroscience 61(4): 765 72. Gong, C. X., T. J. Singh, et al. (1993). "Phosphoprotein phosphatase activities in Alzheimer disease brain." J Neurochem 61(3): 921 7. Gopalraj, R. K., H. Zhu, et al. (2005). "Genetic association of low density li poprotein receptor and Alzheimer's disease." Neurobiol Aging 26(1): 1 7. Gotz, J., F. Chen, et al. (2001). "Formation of neurofibrillary tangles in P301l tau transgenic mice induced by Abeta 42 fibrils." Science 293(5534): 1491 5. Goutte, C., M. Tsunozaki, et al. (2002). "APH 1 is a multipass membrane protein essential for the Notch signaling pathway in Caenorhabditis elegans embryos." Proc Natl Acad Sci U S A 99(2): 775 9. Gray, C. W. and A. J. Patel (1993). "Regulation of beta amyloid precursor protein is oform mRNAs by transforming growth factor beta 1 and interleukin 1 beta in astrocytes." Brain Res Mol Brain Res 19(3):

PAGE 77

65 251 6. Grundke Iqbal, I., K. Iqbal, et al. (1986). "Microtubule associated protein tau. A component of Alzheimer paired helical filaments ." J Biol Chem 261(13): 6084 9. Haass, C., E. H. Koo, et al. (1992). "Targeting of cell surface beta amyloid precursor protein to lysosomes: alternative processing into amyloid bearing fragments." Nature 357(6378): 500 3. Haass, C. and H. Steiner (2002). Alzheimer disease gamma secretase: a complex story of GxGD type presenilin proteases." Trends Cell Biol 12(12): 556 62. Hardy, J. A. and G. A. Higgins (1992). "Alzheimer's disease: the amyloid cascade hypothesis." Science 256(5054): 184 5. Hartley, D. M., D. M. Walsh, et al. (1999). "Protofibrillar intermediates of amyloid beta protein induce acute electrophysiological changes and progressive neurotoxicity in cortical neurons." J Neurosci 19(20): 8876 84. Havel, R. J. and J. P. Kane (1973). "Primary dysbeta lipoproteinemia: predominance of a specific apoprotein species in triglyceride rich lipoproteins." P roc Natl Acad Sci U S A 70(7): 2015 9. Hayashi, H., T. Mizuno, et al. (2000). "Amyloid precursor protein in unique cholesterol rich microdomains different f rom caveolae like

PAGE 78

66 domains." Biochim Biophys Acta 1483(1): 81 90. Hendriks, L., C. M. van Duijn, et al. (1992). "Presenile dementia and cerebral haemorrhage linked to a mutation at codon 692 of the beta amyloid precursor protein gene." Nat Genet 1(3): 218 2 1. Herreman, A., D. Hartmann, et al. (1999). "Presenilin 2 deficiency causes a mild pulmonary phenotype and no changes in amyloid precursor protein processing but enhances the embryonic lethal phenotype of presenilin 1 deficiency." Proc Natl Acad Sci U S A 96(21): 11872 7. Heverin, M., N. Bogdanovic, et al. (2004). "Changes in the levels of cerebral and extracerebral sterols in the brain of patients with Alzheimer's disease." J Lipid Res 45(1): 186 93. Hofman, A., A. Ott, et al. (1997). "Atherosclerosis, ap olipoprotein E, and prevalence of dementia and Alzheimer's disease in the Rotterdam Study." Lancet 349(9046): 151 4. Hooper, N. M. (2005). "Roles of proteolysis and lipid rafts in the processing of the amyloid precursor protein and prion protein." Biochem Soc Trans 33(Pt 2): 335 8. Howland, D. S., S. P. Trusko, et al. (1998). "Modulation of secreted beta amyloid precursor protein and amyloid beta peptide in brain by cholesterol." J Biol Chem 273(26): 16576 82. Hsia, A. Y., E. Masliah, et al. (1999). "Plaque independent disruption of

PAGE 79

67 neural circuits in Alzheimer's disease mouse models." Proc Natl Acad Sci U S A 96(6): 3228 33. Hu, Y., Y. Ye, et al. (2002). "Nicastrin is required for gamma secretase cleavage of the Drosophila Notch receptor." Dev Cell 2(1): 69 78. Innerarity, T. L. and R. W. Mahley (1978). "Enhanced binding by cultured human fibroblasts of apo E containing lipoproteins as compared with low density lipoproteins." Biochemistry 17(8): 1440 7. Innerarity, T. L., R. E. Pitas, et al. (1979). "Binding of arginine rich (E) apoprotein after recombination with phospholipid vesicles to the low density lipoprotein receptors of fibroblasts." J Biol Chem 254(10): 4186 90. Iqbal, K., H. M. Wisniewski, et al. (1974). "Protein changes in senile dementia." Brain Res 77(2): 337 43. Iqbal, K., T. Zaidi, et al. (1994). "Alzheimer paired helical filaments. Restoration of the biological activity by dephosphorylation." FEBS Lett 349(1): 104 8. Iribarren, C., D. M. Reed, et al. (1995). "Low serum cholesterol and mortalit y. Which is the cause and which is the effect?" Circulation 92(9): 2396 403. Ishiguro, K., A. Shiratsuchi, et al. (1993). "Glycogen synthase kinase 3 beta is identical to tau protein kinase I generating several epitopes

PAGE 80

68 of paired helical filaments." FEBS L ett 325(3): 167 72. Jacobs, D. R., Jr. (1993). "Why is low blood cholesterol associated with risk of nonatherosclerotic disease death?" Annu Rev Public Health 14: 95 114. Jurevics, H., T. W. Bouldin, et al. (1998). "Regenerating sciatic nerve does not util ize circulating cholesterol." Neurochem Res 23(3): 401 6. Jurevics, H. and P. Morell (1995). "Cholesterol for synthesis of myelin is made locally, not imported into brain." J Neurochem 64(2): 895 901. Jurevics, H. A. and P. Morell (1994). "Sources of chole sterol for kidney and nerve during development." J Lipid Res 35(1): 112 20. Kalback, W., C. Esh, et al. (2004). "Atherosclerosis, vascular amyloidosis and brain hypoperfusion in the pathogenesis of sporadic Alzheimer's disease." Neurol Res 26(5): 525 39. K ang, J., H. G. Lemaire, et al. (1987). "The precursor of Alzheimer's disease amyloid A4 protein resembles a cell surface receptor." Nature 325(6106): 733 6. Katzman, R., R. Terry, et al. (1988). "Clinical, pathological, and neurochemical changes in dementi a: a subgroup with preserved mental status and numerous neocortical plaques." Ann Neurol

PAGE 81

69 23(2): 138 44. Keys, A. (1975). "Coronary heart disease -the global picture." Atherosclerosis 22(2): 149 92. Khatoon, S., I. Grundke Iqbal, et al. (1992). "Brain level s of microtubule associated protein tau are elevated in Alzheimer's disease: a radioimmuno slot blot assay for nanograms of the protein." J Neurochem 59(2): 750 3. Khatoon, S., I. Grundke Iqbal, et al. (1994). "Levels of normal and abnormally phosphorylate d tau in different cellular and regional compartments of Alzheimer disease and control brains." FEBS Lett 351(1): 80 4. Kidd, M. (1963). "Paired helical filaments in electron microscopy of Alzheimer's disease." Nature 197: 192 3. Kirazov, L., T. Loffler, e t al. (1997). "Glutamate stimulated secretion of amyloid precursor protein from cortical rat brain slices." Neurochem Int 30(6): 557 63. Kitaguchi, N., Y. Takahashi, et al. (1988). "Novel precursor of Alzheimer's disease amyloid protein shows protease inhi bitory activity." Nature 331(6156): 530 2. Kojro, E., G. Gimpl, et al. (2001). "Low cholesterol stimulates the nonamyloidogenic pathway by its effect on the alpha secretase

PAGE 82

70 ADAM 10." Proc Natl Acad Sci U S A 98(10): 5815 20. Kosik, K. S., C. L. Joachim, e t al. (1986). "Microtubule associated protein tau (tau) is a major antigenic component of paired helical filaments in Alzheimer disease." Proc Natl Acad Sci U S A 83(11): 4044 8. Kuo, Y. M., M. R. Emmerling, et al. (1998). "Elevated low density lipoprotein in Alzheimer's disease correlates with brain abeta 1 42 levels." Biochem Biophys Res Commun 252(3): 711 5. Lambert, M. P., A. K. Barlow, et al. (1998). "Diffusible, nonfibrillar ligands derived from Abeta1 42 are potent central nervous system neurotoxins. Proc Natl Acad Sci U S A 95(11): 6448 53. Lamsa, R., S. Helisalmi, et al. (2008). "Genetic study evaluating LDLR polymorphisms and Alzheimer's disease." Neurobiol Aging 29(6): 848 55. Lannfelt, L., H. Basun, et al. (1995). "Decreased alpha secretase clea ved amyloid precursor protein as a diagnostic marker for Alzheimer's disease." Nat Med 1(8): 829 32. Lee, H. J., K. M. Jung, et al. (2002). "Presenilin dependent gamma secretase like intramembrane cleavage of ErbB4." J Biol Chem 277(8): 6318 23. Leem, J. Y ., S. Vijayan, et al. (2002). "Presenilin 1 is required for maturation and cell surface accumulation of nicastrin." J Biol Chem

PAGE 83

71 277(21): 19236 40. Lehrman, M. A., D. W. Russell, et al. (1987). "Alu Alu recombination deletes splice acceptor sites and produc es secreted low density lipoprotein receptor in a subject with familial hypercholesterolemia." J Biol Chem 262(7): 3354 61. Lehrman, M. A., W. J. Schneider, et al. (1985). "Mutation in LDL receptor: Alu Alu recombination deletes exons encoding transmembran e and cytoplasmic domains." Science 227(4683): 140 6. Lemere, C. A., J. K. Blusztajn, et al. (1996). "Sequence of deposition of heterogeneous amyloid beta peptides and APO E in Down syndrome: implications for initial events in amyloid plaque formation." Ne urobiol Dis 3(1): 16 32. Lendon, C. L., C. J. Talbot, et al. (1997). "Genetic association studies between dementia of the Alzheimer's type and three receptors for apolipoprotein E in a Caucasian population." Neurosci Lett 222(3): 187 90. Leren, T. P. (2004 ). "Mutations in the PCSK9 gene in Norwegian subjects with autosomal dominant hypercholesterolemia." Clin Genet 65(5): 419 22. Levin Allerhand, J. A., C. E. Lominska, et al. (2002). "Increased amyloid

PAGE 84

72 levels in APPSWE transgenic mice treated chronically w ith a physiological high fat high cholesterol diet." J Nutr Health Aging 6(5): 315 9. Levy Lahad, E., W. Wasco, et al. (1995). "Candidate gene for the chromosome 1 familial Alzheimer's disease locus." Science 269(5226): 973 7. Lewis, J., D. W. Dickson, et al. (2001). "Enhanced neurofibrillary degeneration in transgenic mice expressing mutant tau and APP." Science 293(5534): 1487 91. Lewis, L. A., F. Olmsted, et al. (1957). "Serum lipid levels in normal persons; findings of a cooperative study of lipoprotein s and atherosclerosis." Circulation 16(2): 227 45. Li, B., M. O. Chohan, et al. (2007). "Disruption of microtubule network by Alzheimer abnormally hyperphosphorylated tau." Acta Neuropathol 113(5): 501 11. Li, H., S. Wetten, et al. (2008). "Candidate singl e nucleotide polymorphisms from a genomewide association study of Alzheimer disease." Arch Neurol 65(1): 45 53. Li, J., J. Ma, et al. (1995). "Identification and expression analysis of a potential familial Alzheimer disease gene on chromosome 1 related to AD3." Proc Natl Acad Sci U S A 92(26): 12180 4.

PAGE 85

73 Li, L., D. Cao, et al. (2003). "Association of aortic atherosclerosis with cerebral beta amyloidosis and learning deficits in a mouse model of Alzheimer's disease." Am J Pathol 163(6): 2155 64. Li, X. and I. Greenwald (1998). "Additional evidence for an eight transmembrane domain topology for Caenorhabditis elegans and human presenilins." Proc Natl Acad Sci U S A 95(12): 7109 14. Linton, M. F., R. Gish, et al. (1991). "Phenotypes of apolipoprotein B and apolip oprotein E after liver transplantation." J Clin Invest 88(1): 270 81. Liu, K., R. W. Doms, et al. (2002). "Glu11 site cleavage and N terminally truncated A beta production upon BACE overexpression." Biochemistry 41(9): 3128 36. Lopez, D., J. F. Abisambra S ocarras, et al. (2007). "Activation of the hepatic LDL receptor promoter by thyroid hormone." Biochim Biophys Acta 1771(9): 1216 25. Lund, E. G., J. M. Guileyardo, et al. (1999). "cDNA cloning of cholesterol 24 hydroxylase, a mediator of cholesterol homeos tasis in the brain." Proc Natl Acad Sci U S A 96(13): 7238 43. Lund, E. G., C. Xie, et al. (2003). "Knockout of the cholesterol 24 hydroxylase gene in mice reveals a brain specific mechanism of cholesterol turnover." J Biol Chem 278(25): 22980 8.

PAGE 86

74 Lutjohann D., O. Breuer, et al. (1996). "Cholesterol homeostasis in human brain: evidence for an age dependent flux of 24S hydroxycholesterol from the brain into the circulation." Proc Natl Acad Sci U S A 93(18): 9799 804. Mahley, R. W. (1988). "Apolipoprotein E: cholesterol transport protein with expanding role in cell biology." Science 240(4852): 622 30. Mahley, R. W. and S. C. Rall, Jr. (2000). "Apolipoprotein E: far more than a lipid transport protein." Annu Rev Genomics Hum Genet 1: 507 37. Mahley, R. W., K. H Weisgraber, et al. (2006). "Apolipoprotein E4: a causative factor and therapeutic target in neuropathology, including Alzheimer's disease." Proc Natl Acad Sci U S A 103(15): 5644 51. Maxwell, K. N. and J. L. Breslow (2004). "Adenoviral mediated expressio n of Pcsk9 in mice results in a low density lipoprotein receptor knockout phenotype." Proc Natl Acad Sci U S A 101(18): 7100 5. Maxwell, K. N., E. A. Fisher, et al. (2005). "Overexpression of PCSK9 accelerates the degradation of the LDLR in a post endoplas mic reticulum compartment." Proc Natl Acad Sci U S A 102(6): 2069 74. McMurry, M. P., M. T. Cerqueira, et al. (1991). "Changes in lipid and

PAGE 87

75 lipoprotein levels and body weight in Tarahumara Indians after consumption of an affluent diet." N Engl J Med 325(24 ): 1704 8. McMurry, M. P., W. E. Connor, et al. (1985). "The absorption of cholesterol and the sterol balance in the Tarahumara Indians of Mexico fed cholesterol free and high cholesterol diets." Am J Clin Nutr 41(6): 1289 98. Mendez, J., C. Tejada, et al. (1962). "Serum lipid levels among rural Guatemalan Indians." Am J Clin Nutr 10: 403 9. Merched, A., Y. Xia, et al. (2000). "Decreased high density lipoprotein cholesterol and serum apolipoprotein AI concentrations are highly correlated with the severity o f Alzheimer's disease." Neurobiol Aging 21(1): 27 30. Miyake, Y., R. Kimura, et al. (2008). "Genetic variants in PCSK9 in the Japanese population: rare genetic variants in PCSK9 might collectively contribute to plasma LDL cholesterol levels in the general population." Atherosclerosis 196(1): 29 36. Moss, M. L., S. L. Jin, et al. (1997). "Structural features and biochemical properties of TNF alpha converting enzyme (TACE)." J Neuroimmunol 72(2): 127 9. Mucke, L., E. Masliah, et al. (2000). "High level neuron al expression of abeta 1 42 in wild type human amyloid protein precursor

PAGE 88

76 transgenic mice: synaptotoxicity without plaque formation." J Neurosci 20(11): 4050 8. Muldoon, M. F., S. B. Manuck, et al. (1990). "Lowering cholesterol concentrations and mortality: a quantitative review of primary prevention trials." BMJ 301(6747): 309 14. Mullan, M., F. Crawford, et al. (1992). "A pathogenic mutation for probable Alzheimer's disease in the APP gene at the N terminus of beta amyloid." Nat Genet 1(5): 345 7. Murrell, J., M. Farlow, et al. (1991). "A mutation in the amyloid precursor protein associated with hereditary Alzheimer's disease." Science 254(5028): 97 9. Muse, E. D., H. Jurevics, et al. (2001). "Parameters related to lipid metabolism as markers of myelination in mouse brain." J Neurochem 76(1): 77 86. Ni, C. Y., M. P. Murphy, et al. (2001). "gamma Secretase cleavage and nuclear localization of ErbB 4 receptor tyrosine kinase." Science 294(5549): 2179 81. Nitsch, R. M., A. Deng, et al. (1997). "Metabotropic gl utamate receptor subtype mGluR1alpha stimulates the secretion of the amyloid beta protein precursor ectodomain." J Neurochem 69(2): 704 12. Notkola, I. L., R. Sulkava, et al. (1998). "Serum total cholesterol,

PAGE 89

77 apolipoprotein E epsilon 4 allele, and Alzheime r's disease." Neuroepidemiology 17(1): 14 20. Osono, Y., L. A. Woollett, et al. (1995). "Role of the low density lipoprotein receptor in the flux of cholesterol through the plasma and across the tissues of the mouse." J Clin Invest 95(3): 1124 32. Ott, A., R. P. Stolk, et al. (1996). "Association of diabetes mellitus and dementia: the Rotterdam Study." Diabetologia 39(11): 1392 7. Papassotiropoulos, A., D. Lutjohann, et al. (2002). "24S hydroxycholesterol in cerebrospinal fluid is elevated in early stages o f dementia." J Psychiatr Res 36(1): 27 32. Papassotiropoulos, A., D. Lutjohann, et al. (2000). "Plasma 24S hydroxycholesterol: a peripheral indicator of neuronal degeneration and potential state marker for Alzheimer's disease." Neuroreport 11(9): 1959 62. Papassotiropoulos, A., M. A. Wollmer, et al. (2005). "A cluster of cholesterol related genes confers susceptibility for Alzheimer's disease." J Clin Psychiatry 66(7): 940 7. Park, S. W., Y. A. Moon, et al. (2004). "Post transcriptional regulation of low de nsity lipoprotein receptor protein by proprotein convertase subtilisin/kexin type 9a in mouse liver." J Biol Chem 279(48): 50630 8.

PAGE 90

78 Peterson, B., E. Trell, et al. (1981). "Low cholesterol level as risk factor for noncoronary death in middle aged men." JAMA 245(20): 2056 7. Pitas, R. E., J. K. Boyles, et al. (1987). "Astrocytes synthesize apolipoprotein E and metabolize apolipoprotein E containing lipoproteins." Biochim Biophys Acta 917(1): 148 61. Pitas, R. E., J. K. Boyles, et al. (1987). "Lipoproteins and their receptors in the central nervous system. Characterization of the lipoproteins in cerebrospinal fluid and identification of apolipoprotein B,E(LDL) receptors in the brain." J Biol Chem 262(29): 14352 60. Quan, G., C. Xie, et al. (2003). "Ontogenesis and regulation of cholesterol metabolism in the central nervous system of the mouse." Brain Res Dev Brain Res 146(1 2): 87 98. Rall, S. C., Jr., K. H. Weisgraber, et al. (1982). "Human apolipoprotein E. The complete amino acid sequence." J Biol Chem 257(8) : 4171 8. Rea, T. D., J. C. Breitner, et al. (2005). "Statin use and the risk of incident dementia: the Cardiovascular Health Study." Arch Neurol 62(7): 1047 51. Refolo, L. M., B. Malester, et al. (2000). "Hypercholesterolemia accelerates the Alzheimer's a myloid pathology in a transgenic mouse model." Neurobiol Dis 7(4): 321 31.

PAGE 91

79 Reid, P. C., Y. Urano, et al. (2007). "Alzheimer's disease: cholesterol, membrane rafts, isoprenoids and statins." J Cell Mol Med 11(3): 383 92. Retz, W., J. Thome, et al. (2001). Potential genetic markers of sporadic Alzheimer's dementia." Psychiatr Genet 11(3): 115 22. Rodriguez, E., I. Mateo, et al. (2006). "Genetic interaction between two apolipoprotein E receptors increases Alzheimer's disease risk." J Neurol 253(6): 801 3. Rog aev, E. I., R. Sherrington, et al. (1995). "Familial Alzheimer's disease in kindreds with missense mutations in a gene on chromosome 1 related to the Alzheimer's disease type 3 gene." Nature 376(6543): 775 8. Rogers, S. L., R. S. Doody, et al. (1998). "Don epezil improves cognition and global function in Alzheimer disease: a 15 week, double blind, placebo controlled study. Donepezil Study Group." Arch Intern Med 158(9): 1021 31. Rohan de Silva, H. A., A. Jen, et al. (1997). "Cell specific expression of beta amyloid precursor protein isoform mRNAs and proteins in neurons and astrocytes." Brain Res Mol Brain Res 47(1 2): 147 56. Rubin, L. L. and J. M. Staddon (1999). "The cell biology of the blood brain barrier." Annu Rev Neurosci 22: 11 28.

PAGE 92

80 Rubinsztein, D. C. and D. F. Easton (1999). "Apolipoprotein E genetic variation and Alzheimer's disease. a meta analysis." Dement Geriatr Cogn Disord 10(3): 199 209. Rumble, B., R. Retallack, et al. (1989). "Amyloid A4 protein and its precursor in Down's syndrome and Alzheim er's disease." N Engl J Med 320(22): 1446 52. Sabo, S. L., A. F. Ikin, et al. (2001). "The Alzheimer amyloid precursor protein (APP) and FE65, an APP binding protein, regulate cell movement." J Cell Biol 153(7): 1403 14. Sakai, J., E. A. Duncan, et al. (19 96). "Sterol regulated release of SREBP 2 from cell membranes requires two sequential cleavages, one within a transmembrane segment." Cell 85(7): 1037 46. Salen, G., S. Shefer, et al. (1996). "Abnormal cholesterol biosynthesis in sitosterolaemia and the Sm ith Lemli Opitz syndrome." J Inherit Metab Dis 19(4): 391 400. Saunders, A. M., W. J. Strittmatter, et al. (1993). "Association of apolipoprotein E allele epsilon 4 with late onset familial and sporadic Alzheimer's disease." Neurology 43(8): 1467 72. Scacc hi, R., G. Gambina, et al. (2001). "Polymorphisms of the apolipoprotein E gene regulatory region and of the LDL receptor gene in late onset Alzheimer's disease in relation to the plasma

PAGE 93

81 lipidic pattern." Dement Geriatr Cogn Disord 12(2): 63 8. Scartezini, M., C. Hubbart, et al. (2007). "The PCSK9 gene R46L variant is associated with lower plasma lipid levels and cardiovascular risk in healthy U.K. men." Clin Sci (Lond) 113(11): 435 41. Schoenberg, B. S., E. Kokmen, et al. (1987). "Alzheimer's disease and ot her dementing illnesses in a defined United States population: incidence rates and clinical features." Ann Neurol 22(6): 724 9. Schonknecht, P., D. Lutjohann, et al. (2002). "Cerebrospinal fluid 24S hydroxycholesterol is increased in patients with Alzheime r's disease compared to healthy controls." Neurosci Lett 324(1): 83 5. Schroeter, E. H., J. A. Kisslinger, et al. (1998). "Notch 1 signalling requires ligand induced proteolytic release of intracellular domain." Nature 393(6683): 382 6. Schubert, W., R. Pr ior, et al. (1991). "Localization of Alzheimer beta A4 amyloid precursor protein at central and peripheral synaptic sites." Brain Res 563(1 2): 184 94. Sherrington, R., E. I. Rogaev, et al. (1995). "Cloning of a gene bearing missense mutations in early ons et familial Alzheimer's disease." Nature 375(6534): 754 60. Shie, F. S., L. W. Jin, et al. (2002). "Diet induced hypercholesterolemia enhances brain A beta accumulation in transgenic mice."

PAGE 94

82 Neuroreport 13(4): 455 9. Shigematsu, K., P. L. McGeer, et al. (19 92). "Localization of amyloid precursor protein in selective postsynaptic densities of rat cortical neurons." Brain Res 592(1 2): 353 7. Simons, K. and R. Ehehalt (2002). "Cholesterol, lipid rafts, and disease." J Clin Invest 110(5): 597 603. Simons, M., P Keller, et al. (1998). "Cholesterol depletion inhibits the generation of beta amyloid in hippocampal neurons." Proc Natl Acad Sci U S A 95(11): 6460 4. Simons, M., F. Schwarzler, et al. (2002). "Treatment with simvastatin in normocholesterolemic patients with Alzheimer's disease: A 26 week randomized, placebo controlled, double blind trial." Ann Neurol 52(3): 346 50. Sinha, S., J. P. Anderson, et al. (1999). "Purification and cloning of amyloid precursor protein beta secretase from human brain." Nature 40 2(6761): 537 40. Sinnett, P. F. and H. M. Whyte (1973). "Epidemiological studies in a total highland population, Tukisenta, New Guinea. Cardiovascular disease and relevant clinical, electrocardiographic, radiological and biochemical findings." J Chronic Di s 26(5): 265 90. Sisodia, S. S. (1992). "Beta amyloid precursor protein cleavage by a

PAGE 95

83 membrane bound protease." Proc Natl Acad Sci U S A 89(13): 6075 9. Sjogren, M., K. Gustafsson, et al. (2003). "Treatment with simvastatin in patients with Alzheimer's dis ease lowers both alpha and beta cleaved amyloid precursor protein." Dement Geriatr Cogn Disord 16(1): 25 30. Skoog, I., B. Lernfelt, et al. (1996). "15 year longitudinal study of blood pressure and dementia." Lancet 347(9009): 1141 5. Small, D. M. and G. G. Shipley (1974). "Physical chemical basis of lipid deposition in atherosclerosis." Science 185(147): 222 9. Smith, J. R., T. F. Osborne, et al. (1990). "Identification of nucleotides responsible for enhancer activity of sterol regulatory element in low d ensity lipoprotein receptor gene." J Biol Chem 265(4): 2306 10. Soneira, C. F. and T. M. Scott (1996). "Severe cardiovascular disease and Alzheimer's disease: senile plaque formation in cortical areas." Clin Anat 9(2): 118 27. Spady, D. K. and J. M. Dietsc hy (1983). "Sterol synthesis in vivo in 18 tissues of the squirrel monkey, guinea pig, rabbit, hamster, and rat." J Lipid Res 24(3): 303 15. Spady, D. K., M. Huettinger, et al. (1987). "Role of receptor independent low density lipoprotein transport in the maintenance of tissue

PAGE 96

84 cholesterol balance in the normal and WHHL rabbit." J Lipid Res 28(1): 32 41. Sparks, D. L., D. J. Connor, et al. (2002). "HMG CoA reductase inhibitors (statins) in the treatment of Alzheimer's disease and why it would be ill advise t o use one that crosses the blood brain barrier." J Nutr Health Aging 6(5): 324 31. Sparks, D. L., J. C. Hunsaker, 3rd, et al. (1990). "Cortical senile plaques in coronary artery disease, aging and Alzheimer's disease." Neurobiol Aging 11(6): 601 7. Sparks, D. L., R. Martins, et al. (2002). "Cholesterol and cognition: rationale for the AD cholesterol lowering treatment trial and sex related Differences in beta amyloid accumulation in the brains of spontaneously hypercholesterolemic Watanabe rabbits." Ann N Y Acad Sci 977: 356 66. Sparks, D. L., S. W. Scheff, et al. (1994). "Induction of Alzheimer like beta amyloid immunoreactivity in the brains of rabbits with dietary cholesterol." Exp Neurol 126(1): 88 94. Steiner, H., M. Kostka, et al. (2000). "Glycine 384 is required for presenilin 1 function and is conserved in bacterial polytopic aspartyl proteases." Nat Cell Biol 2(11): 848 51. Steiner, H., E. Winkler, et al. (2002). "PEN 2 is an integral component of

PAGE 97

85 the gamma secretase complex required for coordinated expression of presenilin and nicastrin." J Biol Chem 277(42): 39062 5. Stewart, P. A. and E. M. Hayakawa (1987). "Interendothelial junctional changes underlie the developmental 'tightening' of the blood brain barrier." Brain Res 429(2): 271 81. Strittmatte r, W. J. (2001). "Apolipoprotein E and Alzheimer's disease: signal transduction mechanisms." Biochem Soc Symp (67): 101 9. Strittmatter, W. J., A. M. Saunders, et al. (1993). "Apolipoprotein E: high avidity binding to beta amyloid and increased frequency of type 4 allele in late onset familial Alzheimer disease." Proc Natl Acad Sci U S A 90(5): 1977 81. Sudhof, T. C., J. L. Goldstein, et al. (1985). "The LDL receptor gene: a mosaic of exons shared with different proteins." Science 228(4701): 815 22. Sudhof, T. C., D. W. Russell, et al. (1985). "Cassette of eight exons shared by genes for LDL receptor and EGF precursor." Science 228(4701): 893 5. Sun, X. M., E. R. Eden, et al. (2005). "Evidence for effect of mutant PCSK9 on apolipoprotein B secretion as the ca use of unusually severe dominant hypercholesterolaemia." Hum Mol Genet 14(9): 1161 9.

PAGE 98

86 Tanaka, S., S. Nakamura, et al. (1988). "Three types of amyloid protein precursor mRNA in human brain: their differential expression in Alzheimer's disease." Biochem Biop hys Res Commun 157(2): 472 9. Tanzi, R. E. and A. B. Parson (2000). Decoding darkness : the search for the genetic causes of Alzheimer's disease Cambridge, Mass., Perseus Pub. Tariot, P. N., P. R. Solomon, et al. (2000). "A 5 month, randomized, placebo co ntrolled trial of galantamine in AD. The Galantamine USA 10 Study Group." Neurology 54(12): 2269 76. Thirumangalakudi, L., A. Prakasam, et al. (2008). "High cholesterol induced neuroinflammation and amyloid precursor protein processing correlate with loss of working memory in mice." J Neurochem 106(1): 475 85. Timms, K. M., S. Wagner, et al. (2004). "A mutation in PCSK9 causing autosomal dominant hypercholesterolemia in a Utah pedigree." Hum Genet 114(4): 349 53. Tolleshaug, H., J. L. Goldstein, et al. (198 2). "Posttranslational processing of the LDL receptor and its genetic disruption in familial hypercholesterolemia." Cell 30(3): 715 24. Tomimoto, H., I. Akiguchi, et al. (1995). "Ultrastructural localization of

PAGE 99

87 amyloid protein precursor in the normal and p ostischemic gerbil brain." Brain Res 672(1 2): 187 95. Turley, S. D., D. K. Burns, et al. (1996). "Brain does not utilize low density lipoprotein cholesterol during fetal and neonatal development in the sheep." J Lipid Res 37(9): 1953 61. Van Nostrand, W. E., S. L. Wagner, et al. (1992). "Decreased levels of soluble amyloid beta protein precursor in cerebrospinal fluid of live Alzheimer disease patients." Proc Natl Acad Sci U S A 89(7): 2551 5. Vassar, R., B. D. Bennett, et al. (1999). "Beta secretase cleav age of Alzheimer's amyloid precursor protein by the transmembrane aspartic protease BACE." Science 286(5440): 735 41. Walsh, D. M., I. Klyubin, et al. (2002). "Naturally secreted oligomers of amyloid beta protein potently inhibit hippocampal long term pote ntiation in vivo." Nature 416(6880): 535 9. Watkins, P. B., H. J. Zimmerman, et al. (1994). "Hepatotoxic effects of tacrine administration in patients with Alzheimer's disease." JAMA 271(13): 992 8. Weihofen, A. and B. Martoglio (2003). "Intramembrane clea ving proteases: controlled liberation of proteins and bioactive peptides." Trends Cell Biol 13(2): 71 8.

PAGE 100

88 Weisgraber, K. H. (1994). "Apolipoprotein E: structure function relationships." Adv Protein Chem 45: 249 302. Weisgraber, K. H., S. C. Rall, Jr., et al (1981). "Human E apoprotein heterogeneity. Cysteine arginine interchanges in the amino acid sequence of the apo E isoforms." J Biol Chem 256(17): 9077 83. Whyte, H. M. and I. L. Yee (1958). "Serum cholesterol levels of Australians and natives of New Guin ea from birth to adulthood." Australas Ann Med 7(4): 336 9. Wijsman, E. M., E. W. Daw, et al. (2004). "Evidence for a novel late onset Alzheimer disease locus on chromosome 19p13.2." Am J Hum Genet 75(3): 398 409. Wilson, J. D. (1970). "The measurement of the exchangeable pools of cholesterol in the baboon." J Clin Invest 49(4): 655 65. Wisniewski, K. E., H. M. Wisniewski, et al. (1985). "Occurrence of neuropathological changes and dementia of Alzheimer's disease in Down's syndrome." Ann Neurol 17(3): 278 8 2. Wisniewski, T. and B. Frangione (1992). "Apolipoprotein E: a pathological chaperone protein in patients with cerebral and systemic amyloid." Neurosci Lett 135(2): 235 8. Wolfe, M. S., W. Xia, et al. (1999). "Two transmembrane aspartates in presenilin 1 required for presenilin endoproteolysis and gamma

PAGE 101

89 secretase activity." Nature 398(6727): 513 7. Wolozin, B., W. Kellman, et al. (2000). "Decreased prevalence of Alzheimer disease associated with 3 hydroxy 3 methyglutaryl coenzyme A reductase inhibitors." A rch Neurol 57(10): 1439 43. Xu, G., R. J. Servatius, et al. (1998). "Relationship between abnormal cholesterol synthesis and retarded learning in rats." Metabolism 47(7): 878 82. Xu, Q., A. Bernardo, et al. (2006). "Profile and regulation of apolipoprotein E (ApoE) expression in the CNS in mice with targeting of green fluorescent protein gene to the ApoE locus." J Neurosci 26(19): 4985 94. Yamamoto, T., C. G. Davis, et al. (1984). "The human LDL receptor: a cysteine rich protein with multiple Alu sequences in its mRNA." Cell 39(1): 27 38. Yan, R., M. J. Bienkowski, et al. (1999). "Membrane anchored aspartyl protease with Alzheimer's disease beta secretase activity." Nature 402(6761): 533 7. Zamrini, E., G. McGwin, et al. (2004). "Association between statin u se and Alzheimer's disease." Neuroepidemiology 23(1 2): 94 8. Zandi, P. P., D. L. Sparks, et al. (2005). "Do statins reduce risk of incident dementia and Alzheimer disease? The Cache County

PAGE 102

90 Study." Arch Gen Psychiatry 62(2): 217 24. Zannis, V. I., P. W. Ju st, et al. (1981). "Human apolipoprotein E isoprotein subclasses are genetically determined." Am J Hum Genet 33(1): 11 24. Zhao, Z., Y. Tuakli Wosornu, et al. (2006). "Molecular characterization of loss of function mutations in PCSK9 and identification of a compound heterozygote." Am J Hum Genet 79(3): 514 23. Zou, F., R. K. Gopalraj, et al. (2008). "Sex dependent association of a common low density lipoprotein receptor polymorphism with RNA splicing efficiency in the brain and Alzheimer's disease." Hum Mol Genet 17(7): 929 35.

PAGE 103

91 UPREGULATION OF A FUNCTIONAL, STRUCTURALLY HOMOLOGOUS SPLICE VARIANT OF LOW0DENSITY LIPOPROTEIN RECEPTOR IN LDLR / AND ALZHEIMER'S DISEASE MICE Abstract Alzheimer's disease (AD) is the most prevalent form of age a ssociated dementia. Besides age, the most important risk factor associated with AD onset is the inheritance of the # 4 allele of apolipoprotein E. ApoE is a cholesterol carrier that is internalized by neurons primarily via the low density lipoprotein recep tor (LDLR). We sought to compare apoE/cholesterol uptake by LDLR in the brains and livers of non transgenic (NTG) and LDLR / mice. RT PCR experiments revealed the presence of a LDLR mRNA that lacks exon 4 (LDLR!4) in NTG mice and that is upregulated LDLR / mice. Because LDLR transcription in LDLR / mice is interrupted by insertion of a neo cassette with an RNA cleavage/polyA addition site in this exon, the 4 alternative splicing event

PAGE 104

92 evidently bypasses the knock out scheme. Indeed, immunofluorescence a nd immunoblot assays detected a LDLR like protein in LDLR / brain whose distribution in the brains of LDLR / mice coincides with that of LDLR expression in NTG mice. To determine LDLR!4 function, immunohistochemistry and functional assays were used to sh ow that this LDLR like variant binds and internalizes apoE. Finally, RT PCR showed that the AD, double transgenic mouse model, PS+/ APP+/ expresses higher levels of LDLR!4 in brain than the NTG control. Our findings indicate that an assessment of associa tion between LDLR and AD will require a new knock down model that totally eliminates LDLR in brain. Similar alternative splicing may interfere with other knock out mice.

PAGE 105

93 Introduction Apolipoprotein E (apoE) is pivotal for CNS cholesterol dist ribution (Boyles, et al., 1985; Elshourbagy, et al., 1985) and is the main protein component of the very low density lipoprotein (VLDL) particle in the blood (Blum, Aron, & Sc iacca, 1980; Mackie, Caslake, Packard, & Shepherd, 1981) Consequently, alterations in apoE metabolism result in a series of lipid related disorders. The apoE4 isoform, in particular, is linked to an increased risk for cardiovascular ailments (Mahley & Huang, 1999) and neurodegenerative diseases (Arnold, et al., 1997 ; Corder, et al., 1993; Deane, et al., 2008; Hata, Kunugi, Nanko, Fukuda, & Kaminaga, 2002; Ma, Yee, Brewer, Das, & Potter, 1994; Pickar, Malhotra, Rooney, Breier, & Goldman, 1997; Potter, Wefes, & Nilsson, 2001; Saunders, et al., 1993; T. Wisniewski, Cast ano, Golabek, Vogel, & Frangione, 1994) The main cellular receptor for lipidated apoE is the low density lipoprotein receptor (LDLR) (Fryer, et al., 2005) In contrast to our

PAGE 106

94 extensive knowledge of LDLR function and dysfunction in the periphery, the role of LDLR in pathogenic pathways pertaining to the CNS is still not fully understood (M. S. Brown & Goldstein, 1986) For example, because both abnormal cholesterol metabolism and the presenc e of the apoE4 isoform of apoE are risk factors for sporadic, late onset AD, the LDLR may play a role as a potential mediator of AD pathology via its interaction with apoE (5 13). Recent studies that investigated this relationship based on LDLR / mice tha t had been crossed with AD mouse models, reported conflicting conclusions (Cao, et al., 2006; Fryer, et al., 2005) The mouse LDLR gene is composed of 18 exons that code for a 95 kDa protein (Goldstein, et al., 1985; Yamamoto, et al., 1984) Some of these exons undergo alternative splicing, but potential alternative functions of the resulting LDLR splice forms are unknown (Tveten, Ranh eim, Berge, Leren, & Kulseth, 2006; Zou, et al., 2008) The first five LDLR exons encode the ligand binding domain (LBD), which is composed of seven, 40 amino acid repeats (R1 R7) (Goldstein, et al., 1985) Each repeat is interspersed with six evolutionarily conserved cysteine residues (Goldstein, et al., 1985) Site directed mut agenesis studies showed a marked decrease in LDLR binding to apoB by deletion of any repeat between R2 and R7 (Esser, Limbird, Brown, Goldstein, & Russell, 1988;

PAGE 107

95 Russell, Brown, & Goldstein, 1989) In turn, deletion of R5, which is encoded by exon 4, yielded maximal reduction of apoE binding (Russell, et al., 1989) These data suggest that the apoE binding region surrounds R5 of the LDLR ligand binding domain. To further investigate the role of LDLR as a potential mediator of AD pat hology, we analyzed the LDLR expression profile in liver and brain of NTG and LDLR / mice. Because of the likely importance of the apoE binding site in LDLR for the receptor's involvement in AD, we focused our analysis on exon 4. Specifically, we evaluate d the abi lity of LDLR / mice to express a LDLR splice variant that lacks exon 4, because a LDLR!4 was recently described in humans (Neff, et al., 2003; Tveten, et al., 2006) Not only would such a splicing event in mice aff ect LDLR binding to apoE, but it would also bypass the knock out scheme in the LDLR / mouse, which is based on the interruption of translation by the insertion of a neo cassette in exon 4 (Ishibashi, et al., 1993) We report that LDLR!4 is expressed in both brain and liver in NTG mice and is upregulated in LDLR / mice. Furthermore, the ability of LDLR!4 to bind apoE is not impaired. Finally, our finding that LDLR!4 is even more upregulated in a mouse model of AD and can bind and

PAGE 108

96 internalize apoE, suggests that LDLR may play an important role in the apoE related aspects of Alzheimer's pathology. These results also indicate that while the LDLR / mouse is a valuable model for hypercholesterolemia studies in the periphe ry, the presence of an apoE binding LDLR!4 splice variant restricts its use for cholesterol research in the CNS.

PAGE 109

97 Results LDLR!4 variant mRNA is expressed in mouse liver and brain, and is upregulated in both organs in LDLR / mice. In ord er to develop an animal model for human hypercholesterolemia in which the potential for LDLR gene therapy could be studied, Ishibashi et al. designed a LDLR / mouse by interrupting exon 4 of the LDLR gene with a neo encoding cassette (Ishibashi, et al., 1993) The recombinant LDLR transcript should generate a short mRNA that ends in exon 4 because cleavage and polyadenylation is under direction of the neo cassette. Consequently, the mice expressing this short mRNA f ail to express full length LDLR protein in the liver. Physiologically, this LDLR / mouse is characterized by a 7.4 9 fold increase in serum LDL/IDL and a modest increase in VLDL and HDL. This hypercholesterolemic phenotype is routinely enhanced by a lipid rich diet. We sought to determine the relative amount of LDLR and its splice variant, LDLR!4, in liver and brain of non transgenic and LDLR / mice.

PAGE 110

98 Initially, we used an end point PCR to identify the splice variant in brain and liver of the LDLR / mice (Fig. 1). Pr imer A annealed to a sequence in exon 3 (70 bp upstream of the 5' end of exon 4), whereas primer B bound to a sequence in exon 5 (35 bp downstream of the 3' end of exon 4) (Fig. 1A). The presence or absence of exon 4 (comprising 384 nucleotides) should cha nge the size of the PCR product from 489 to 105 bp, respectively. Our data show that in NTG mice, full length LDLR is expressed in hippocampus, cortex, and liver (Fig. 1B). As expected in LDLR / mice, we did not detect full length LDLR with this PCR stra tegy. However, we did amplify a 105 bp product from LDLR / hippocampus, cortex, and liver. DNA sequencing of the PCR products confirmed that the amplified fragments correspond to exon 4 containing and exon 4 lacking LDLR mRNAs. To further confirm and qua ntitate LDLR! 4 mRNA expression in NTG and LDLR / tissues, we utilized quantitative RT PCR. We designed two sets of primer pairs and TaqMan probes that amplify either the exon 4 5 boundary that is unique to the full length LDLR or the exon 3 5 junction tha t is exclusive of the LDLR!4. Consistent with the end point PCR results, primer pairs that only recognize the exon 4 5 boundary did not detect full length LDLR mRNA in LDLR / mice (Fig. 2 A ). However, this

PAGE 111

99 approach detected trace amounts of LDLR!4 in NTG t issues (Fig 2B D, and Table 1). Furthermore in LDLR / mice, the LDLR!4 variant's mRNA was present and significantly upregulated in both brain and liver (Fig. 2D). In brains of LDLR / mice, the upregulated LDLR!4 transcript amounts to 50% of the hepatic L DLR!4 mRNA (Table 1); this is far more than the 1:20 brain/liver ratio of full length LDLR in NTG mice. Keeping in mind that in NTG mice the ratio of LDLR!4 to LDLR mRNA levels is higher in brain (1:20) than in liver (1:221), our results suggest that LDLR !4 may play a significant role in brain physiology. Anti LDLR antibody detects protein in LDLR / mouse brain. We used a polyclonal antibody raised against the amino terminus of the LDLR (Ishibashi, et al., 1993) to assess the expression of LDLR in brain and liver of LDLR / mice. As previously reported (Ishibashi, et al., 1993) we did not detect LDLR bands in the livers of LDLR / mice (Fig. 3A). However, we observed a ban d corresponding to a smaller LDLR in the brains of NTG and LDLR / mice (Fig. 3B). The intensity of this band is not significantly different between the two genotypes (Fig. 3C). In addition, only in NTG brain we observed a smear above the LDLR immuno react ive band, which corresponds in size and heterogeneity to glycosylated LDLR from the liver.

PAGE 112

100 In order to compare the cellular location and tissue distribution of the LDLR positive signal in LDLR / mice and NTG controls, we immuno stained brain and liver s ections from these mice. As expected, we observed a large decrease in the LDLR signal in livers from LDLR / mice compared to the NTG controls (Fig. 4B & H). In contrast, in the brains of NTG and LDLR / mice the LDLR immuno reactivity was equally strong ( Fig. 4A). This result was similar to the immunoblot results, which showed equal signal intensity in the brains of both mice (Fig. 3B). To confirm its specificity, the antibody was pre incubated with a recombinant LDLR protein prior to application to the ti ssue sections. The LDLR reactive signal was proportionally decreased in the brain sections that had been incubated with the pre adsorbed antibody (Fig. 4C). The signal distribution across different brain regions was also conserved between the LDLR / and N TG mice as determined by immuno staining (Fig. 4D G). We further investigated the location of LDLR signal in primary neurons from LDLR / and NTG mice. In both genotypes, immuno staining analysis revealed LDLR signal in vesicle like structures surrounding the soma and in the dendritic and axonal prolongations of primary neurons (Fig. 4I).

PAGE 113

101 Primary and tertiary structure analysis show similarities between LDLR and LDLR!4. If the LDLR!4 expression in brain is to have physiological significance, the LDLR!4 protein must either retain the function of LDLR or acquire a novel function due to the ex cision of exon 4 We examined LDLR! 4's activity by first comparing its protein structure to the structure of the full length protein and then testing its apoE binding capacity. Each of the seven repeats of the LDLR ligand binding domain (LBD) (R1 R7) has s ix conserved cysteines (Esser, et al., 1988) (Fig 5A). Negatively charged residues are located in the carboxy terminus of each repeat, where they participate in ligand binding. ApoE binding occurs in the area surrounding R5 (Esser, et al., 1988; Russell, et al., 1989) Therefore, if LDLR!4 is to bind apoE in a similar manner to the full length LDLR, the protein must include features that are similar to the region encompassing R5 in the full length protein. Exo n 4 codes for the protein sequence of R3 R5 (highlighted in red in fig. 5A). The resulting LBD of LDLR!4 is thus composed of R1, R2, R6, and R7 (Fig. 5B). Consequently, in LDLR!4, R2 substitutes for R5 adjacent to R6. Interestingly, an amino acid sequence alignment of R5 with R2 shows conservation of negatively charged residues and those that participate in calcium coordination (Fig.5C). Both of these features are required for ligand binding (Goldstein, et al., 1985; Yamamoto, et al., 1984)

PAGE 114

102 The sequence similarities between R2 and R5 together with R2's position in the protein structure, suggested to us that R2 might have the capacity to functionally replace R5 in the shortened LDLR!4 protein and prompted a search for potential common tertiary structures of the apoE binding regions of the LDLR and its LDLR!4 variant. Since R2/R6 in LDLR!4 substitutes for R5/R6 in LDLR, we selected combinations of double repeat sequences of the LDLR ligand binding domain that correspond to the region encoded by exon 4 (R2/R3, R3/R4, R4/R5, R5/R6), and compared their predicted tertiary structures to that of the fused double repeat R2/R6 of LDLR! 4 using the SWISS PROT Repository (ExPASy). The comparison showed that the double repeat structure of the apoE binding re gion of LDLR (R5/R6) and LDLR!4 (R2/R6) are very similar and completely different from the structures of all other LDLR repeat pairs (Fig. 5D). LDLR positive signal in LDLR / primary neurons binds and internalizes glia derived apoE. Because the double r epeat equivalents of the LBDs from LDLR (R5/R6) and LDLR"4 (R2/R6) predicted similar structures (Fig. 5C and D), we hypothesized that they may have similar functions as well. To investigate if the protein identified in LDLR / mice

PAGE 115

103 can function like LDLR, we tested its ability to bind glial derived apoE. ApoE was extracted from primary glial cultures and incubated with primary neurons from NTG and LDLR / mice. Immunohistochemical analysis showed that LDLR / primary neurons display similar LDLR staining as NTG primary neurons (Fig. 6). In addition, apoE binding was found to co localize with the LDLR signal in both types of cells. As a negative control, we incubated primary neurons without primary antibodies and found no positive staining for either apoE or LDLR/LDLR!4 (data not shown). Furthermore, addition of 1 M RAP blocked apoE binding to NTG and LDLR / neurons (Fig. 6). These results indicate that the LDLR immuno positive protein in LDLR / neurons is capable of binding and internalizing apoE. LDLR"4 is upregulated in PSAPP mice brains. Because the presence of the apoE4 isoform of apoE is a risk factor for sporadic, late onset AD (Corder, et al., 1993; Saunders, et al., 1993) and because LDLR is the main apoE receptor in the brain, it is important to investigate the role of LDLR and LDLR $ 4 as potential mediators of AD pathology. To this end, we quantified hippocampal and cortical mRNA from 11 12 month old PSAPP and NTG control mice. At this age, PSAPP mice are commonly cognitively impaired, and amyloid plaques are prevalent in the

PAGE 116

104 hippocampus and cortex (Games, et al., 1995) Using RT PCR we detected equal expression of LDLR mRNA in the PSAPP model of AD and age matched N TG control mice (Fig. 7). However, the LDLR!4 variant mRNA was found to be two fold overexpressed in the brains of PSAPP mice in comparison to the wild type mice (Table 2). Since both LDLR and LDLR"4 can bind and internalize apoE (Fig. 6), the upregulation of the LDLR"4 variant in mouse models of AD suggests that this splice variant may play a role in the apoE related mechanism of Alzheimer's pathology.

PAGE 117

105 Discussion NTG mice express two types of LDLR mRNA : a full length form and a sp l ice var iant that is shortened by 384 nucleotides. Both forms are expressed in brain and liver and the full length form is more strongly expressed in liver than in brain. In the brains of wild type mice, the LDLR!4 variant amounts to about 5% of the total LDLR. I n the brains of LDLR / mice, LDLR!4 mRNA is 653 fold upregulated in comparison to wild type animals. We also found that primary neurons of these LDLR / mice are capable of binding and internalizing apoE. Based on the upregulation of LDLR!4 mRNA, it is l ikely that the protein identified in LDLR / mice is LDLR!4. The LDLR antibody we utilized for LDLR detection recognizes an epitope upstream of the exon 4 encoded fragment and thus should recognize both LDLR and LDLR!4. Western blot analysis for LDLR in mi ce reveals a range of bands between 95 and 130 kDa, which represent different states of post translational modification. The LDLR like protein detected in LDLR / brain showed a molecular weight of 95 kDa, which corresponds to the lower end of the range of

PAGE 118

106 full length LDLR signal that was identified in NTG brain (Fig 4B). In addition, immunohistochemical assays revealed that the LDLR signal in LDLR / and NTG tissues resembled the intensity observed in western blots, and it was similarly distributed across different brain regions. LDLR is the primary receptor for lipidated apoE, which in turn is the primary lipid carrier in brain. Disruption of the LBD at the apoE binding juncture precludes apoB binding (Esser, et al ., 1988; Russell, et al., 1989) and is expected to reduce apoE's linkage to the receptor. However, apoE binding properties and structure are conserved between the full length LDLR in LDLR!4. Furthermore, we found LDLR and lipidated apoE co localization in primary neurons of NTG and LDLR / mice. These data suggest that LDLR / mice are able to internalize apoE via a LDLR like protein. In 2005, Fryer et al. and Cao et al. crossed the LDLR / mouse with different mouse models of Alzheimer's disease (PDAPP and Tg2576) (Cao, et al., 2006; Fryer, et al., 2005) Although the conclusions of the reports contradict each other, resulting in an unclear understanding of LDLR's role in AD, they shed light on the characteristics of the LDLR / mouse regarding LDLR!4. For instance, they show that apoE is increased by

PAGE 119

107 60% in LDLR / cortex and CSF. This result was corroborated by Elder et al. (Elder, et al., 2007) who additionally found a decrease in apoE mRNA. While thi s observation may seem paradoxical, it could suggest that total apoE binding is knocked down in LDLR / cortex and apoE translation is upregulated as a compensatory response. Alternatively, the observation may indicate that a higher amount of apoE has been internalized by LDLR / mouse cells leading to a reduced transcription of the apoE gene. We found that LDLR !4 mRNA is upregulated two fold in the brains of PSAPP mice. Because LDLR!4 internalizes apoE, its overexpression should lead to increased intra neuronal apoE. Another way to increase apoE is by feeding high cholesterol diets. Such food induces cognitive d eficits in NTG mice and promotes amyloid plaque formation in rabbits (Sparks, et al., 1994) and APP transgenic mice (Blacker, et al., 2003; Refolo, et al., 2000; Shie, et al., 2002) ApoE has previously been shown to be a necessary chaperone for the promotion of amyloid plaque deposition in AD mice (Ma, et al., 1994; Potter, et al., 2001; T. Wisniewski, et al., 1994) As APP processing is proposed to take place inside the cell, the intracellular increase in apoE, endogenous or imported, will promote oligomerization of A$ into fibrils, which will then be secreted into the extracellular space. Therefore, it seems likely that

PAGE 120

108 the augmented amyloid plaque deposition in LDLR / mice found by Cao et al. (Cao, et al., 2006) is apoE related, rather than being a mere consequence of diminished LDLR. The combination of increased A$ and apoE in the LDLR / xTg2576 mice should thus be sufficient to trigger and promote incr eased amyloid plaque deposits and induce cognitive deficits by increasing the relative intracellular concentration of these two essential amyloid components. In sum, our results describe an alternative splicing phenomenon that bypasses the knock out stra tegy in the LDLR / mouse. Despite effective use of this model to study the implications of systemic, apoB induced hypercholesterolemia, interpretation of apoE related changes in cholesterol metabolism in the CNS is problematic. As a result, we propose tha t a re interpretation of previous data acquired by the utilization of the LDLR / mouse for LDLR mediated apoE metabolism in the brain is appropriate. To our knowledge, the only other example of a related knockout escape by alternative splicing was descr ibed for the sorLA/R11 knock out mouse during the preparation of this manuscript. The sorLA/LR11 knock out mouse also undergoes an identical splice mediated elusion of the

PAGE 121

109 knock out scheme as we preliminarily reported in the LDLR / mice (Abisambra, Padmanabhan, Wefes, Neame, & Potter, 2007; Dodson, et al., 2008) The results also implicate deletion of exon 4, the site where the new RNA cleavage and poly adenylation site was introduced in the sorLA/LR11 / mouse. At the mRNA and protein level, the authors found similar results to ours, implying that this alternative splicing activity may be common in the LDLR family of proteins. Together, these results support the conclusion that exon skipping must be considered while targeting an exon for knock out mouse generation. More research to determine the normal function of splice variants of LDLR and SorLA/LR11 should prove valuable in determining if these shortened proteins work independently or in concert with the cholester ol and apoE metabolism. Furthermore, search for other splicing motifs within gene families may shed light on unprecedented regulation of the functions of the products of such gene families. In the case of LDLR, the exon 4 splice variant may be expressed to eliminate ligand competition between apoB and apoE. If so, this phenomenon might be a more efficient pathway for apoE metabolism. Participation of other LDLR family members and their splice variants in cholesterol regulation remains to be determined.

PAGE 122

110 Materials and Methods Materials : Quantitative PCR experiments were performed using products from Applied Biosystems, which include PCR master mixes, mouse GAPDH endogenous control assays, gene expression assays for LDLR exon 4 5 boundary (assay ID Mm0115 1338_m1), and a custom gene expression assay for LDLR!4 detection. Tissue culture reagents and electrophoresis supplies were purchased from Gibco/Invitrogen. Recombinant mouse LDLR was purchased from R&D Systems. Protein concentrations were determined with BCA TM (Pierce) colorimetric assays. Antibodies : Rabbit anti LDLR antiserum was used as primary antibody for immunoblots (1:1000) and immunohistochemistry assays (1:100) (Ishibashi, et al., 1993; Russell, et al., 19 84) Monoclonal mouse anti actin (Sigma Aldrich) and AlexaFluor 488 and 594 (Invitrogen/Molecular Probes) antibodies were diluted according to the manufacturer for western blot (WB) and immunohistochemistry (IHC) assays, respectively. Goat anti mouse IRDy e¨800CW and goat anti rabbit IRDye¨680 were purchased from LI COR Biosciences (WB: 1:15,000; IHC: 1:1500). Mouse

PAGE 123

111 anti apoE monoclonal antibody (BD Biosciences Laboratories TM ) was used for WB, IHC, and immuno purification of lipidated apoE. This last proced ure was done with tosyl activated, magnetic beads (Dynal Biotech) according to manufacturer's specifications and is described below. Animals : All procedures involving experimentation on animal subjects were done in accord with the guidelines set forth b y the University of South Florida's Institutional Animal Care and Use Committee (IACUC). The LDLR / mouse (B6.129S7 Ldlr tm1Her /J) was obtained from The Jackson Laboratory (Ishibashi, et al., 1993) Mice with the ge notype APP +/ PS1 +/ were generated by crossing heterozygous PDGF hAPP(V717F) mice [Swiss Webster X C57BL/6] with PDGF hPS1(M146L) heterozygotes [Swiss Webster X C57BL/6] as described (Costa, et al., 2007) Non tra nsgenic (NTG) control mice for LDLR / mice were C57BL/6J expressing endogenous LDLR (The Jackson Laboratory). NTG control mice for APP +/ PS1 +/ were littermates that lacked both transgenes. All mice were genotyped by PCR to confirm the presence or absen ce of LDLR (Ishibashi, et al., 1993; Soriano, Montgomery, Geske, & Bradley, 1991) PDGF hAPP (Games, et al., 1995) and PDGF hPS1 (Duff, et al., 1996)

PAGE 124

112 Tissue preparation : Brains and livers were acquired by anesthetizing mice with 0.1 mg/g Nembutal followed by transcardial perfusion with 0.9% saline solution for 8 12 min at 120 mmHg. Portions of the left, right, and median lobe of the mice livers, as well as whole brains were immediately removed for processing. Messenger R NA was extracted by homogenizing tissues in TRI reagent (Sigma Aldrich). Only cortices and hippocampi were processed for brain mRNA isolation; All liver extracts consisted of the same liver portions for each mouse. Microsome protein extracts were obtained as previously described (Ness, Sample, Smith, Pendleton, & Eichler, 1986) with minor modifications: 0.25M sucrose was prepared with protease inhibitors (1 tablet mini Complete/ 10 ml sucrose, Roche Applied Science). Samples were spun once at 30,000 x g for 90 min in a fixed angle rotor. Microsome pellets were resuspended in PBS with 10% glycerol and protease inhibitor cocktail (Roche). Brains for immunohistochemistry assays were fixed for 24 hrs in 4% para formaldehyde. The f ixed tissues were cryo protected in successive sucrose gradients as previously described (Nilsson, et al., 2001) Brains were frozen on a temperature controlled freezing stage, coronally sectioned (25 m) on a sliding microtome, and stored in a solution of PBS containing 0.02% NaN 3 at 4 o C.

PAGE 125

113 End point RT PCR and quantitative RT PCR : Five micrograms of DNase treated mRNA were reverse transcribed with SuperScript¨ VILO TM cDNA Synthesis Kit (Invitrogen) using random hexamers according to the manufacturer's instructions. Endpoint PCR was conducted using primer A (sense): 5' TGCATTCCTGACTCCTGGAG ATGT 3' and Primer B (ant i sense): 5' ACACTGGAATTCATCAGGTC GGCA 3' (IDT). Thermal cycling conditions were 95¡C for 5 min, 35 cycles of 95¡C for 30 seconds, 56¡C for 60 seconds, and 72¡C for 60 seconds. PCR products were analyzed in 1.5% TAE agarose gels stained with ethidium brom ide. Gels were scanned with the Alpha Imager (Alpha Innotech). Copy DNA was recovered from the bands and sequenced at H. Lee Moffitt Cancer Center & Research Institute DNA Sequencing Core. Quantitative RT PCR was performed according to manufacturer. Custom gene expression assay for LDLR!4 detection contained a sense primer (5' TGGACAGGTAGACTGTGAAAATGAC 3'), an anti sense primer (5' CATCTGCACACTGGAATTCATCA 3'), and a FAM conjugated, MGB TM probe (5' AACAAGGCTGTCCGGTGG 3'); the resulting PCR product span s the exon 3 5 boundary. Quantitative PCR reactions were processed in the 7500 FAST System with its Sequence Detection Software (SDS) from Applied Biosystems.

PAGE 126

114 Western blots: Unless otherwise indicated, 15 g and 50 g (protein) of liver and brain microsom es, respectively, were denatured with LDS sample buffer according to the Invitrogen protocol. Samples were loaded onto 3 8%, 1.0 or 1.5mm Tris Acetate gels, and run at 80V for 180 min. Gels were dry transferred onto PVDF membranes for 9 min (iBlot, Invitro gen). Non specific protein binding to the membrane was blocked by incubating with 5% BSA for 90 min at room temperature. Primary antibodies for actin and LDLR were diluted 1:10000, and 1:1000 in blocking buffer and incubated overnight at 4¡C. Monoclonal m ouse anti actin antibody and secondary antibody incubations with IR dyes (1:15000) were performed sequentially for 60 min at room temperature. Membranes were washed three times for 10 min with PBS and 0.1% Tween 20 after incubation with each antibody. Memb ranes were scanned and analyzed with the LI COR Odyssey and accompanying software. Immunohistochemistry : Brain sections were mounted onto Colorfrost¨/ Plus slides (Fisher Scientific). Non specific binding was blocked in NGS (10% normal goat serum, 0.2% Tri ton X 100, and 0.02% NaN 3 in Tris buffered saline (TBS)) for 120 min at room temperature. Primary antibodies were incubated overnight at 4¡C in 10% NGS. After four 5 min washes in TBS, slides were incubated with secondary

PAGE 127

115 antibodies (IR dyes or AlexaFluor) in 10% NGS for 60 min at room temperature and washed in TBS. Slides were stained with Hoechst (1 %g/ml in PBS) for 2 minutes to reveal cellular nuclei and mounted using GelMount (Fisher Scientific). Staining was analyzed with the Zeiss AxioImager.Z1 and Ax ioVision software. ApoE binding studies : Primary glial cells were isolated from E18 fetuses of NTG mice (Padmanabhan, Levy, Dickson, & Potter, 2006) and cultured in 75 cm 2 flasks coated with poly lysine D (50 %g/ml ). The tissue culture supernatant from these cells was used for purification of lipidated apoE. The ApoE purification protocol (Fagan, et al., 1999) was modified by immuno purifying lipidated apoE with an anti apoE antibody conjugated to magnetic beads. Conjugation, purification, and elution were done according to manu facturer's specifications (company). Cortical and hippocampal neurons were isolated from E18 fetuses of LDLR / and NTG controls as described (Padmanabhan, et al., 2006) Primary neurons were grown for one week on p oly L lysine coated 8 chamber slides in neurobasal media with B27 supplement and then treated with 0.5 M lipidated apoE for 60 min at 37¡C. Control cells were treated with 0.5 M lipidated apoE that had been pre incubated overnight at 37¡C with 1 M recep tor associated protein (RAP), a dose that effectively blocks ligand

PAGE 128

116 binding to LDLR family members (Fryer, et al., 2005; Medh, et al., 1995) Cells were washed in PBS and then fixed in 4% para formaldehyde for 10 mi n. Slides were immuno stained for LDLR and apoE as described above. Protein modeling : Three dimensional images were created in the alignment mode functionality of the SWISS MODEL Repository from ExPASy. Sequences spanning different two repeat combination s of the LDLR ligand binding domain were aligned with the LDLR tertiary structure in the database. Statistical analyses : All data reported were obtained from independent experiments repeated at least three times. Data were plotted as SE of the mean. P v alues were obtained from paired t test analyses.

PAGE 129

117 Figures FIGURE 1. LDLR!4 variant mRNA is expressed in brain and liver of LDLR / mice. End point PCR was used to identify LDLR! 4 transcripts. (A) Primers A and B were designed to anneal 70 bp upstream and 35bp downstream of exon 4, respectively. (B) Amplification of cDNA from NTG and LDLR / hippocampus, cortex, and liver gave products corresponding to full length LDLR (489 bp) or LDLR lacking exon 4 (105 bp).

PAGE 130

118

PAGE 131

119 FIGURE 2. LDLR!4 variant mRNA is expressed in brain and liver of NTG mice and upregulated in bra in and liver of LDLR / mice. Real time quantitative RT PCR was used to detect LDLR (A) and LDLR!4 (B) mRNA in brain and liver of NTG and LDLR / mice. Primer and probe sets were specifically designed to amplify the exon 4 5 and 3 5 boundaries of cDNA from brain and liver samples. Relative quantitation of LDLR!4 and LDLR were obtained from three independent experiments using samples from NTG mice (n=5). Trace amounts of LDLR!4 signal were detected above background in brain (C) and liver (D) of NTG mice. LDL R!4 signal between brain and liver of LDLR / was p > 0.05. Student's t tests were performed using data from experiments done in triplicate. ND: not detectable. P values in the graphs correspond to the statistical difference between the conditions indicate d within the brackets.

PAGE 132

120

PAGE 133

121 TABLE 1. LDLR! 4 variant mRNA is upregulated in LDLR / mice. Summary of RT PCR data from figures 1 and 2.

PAGE 134

122 FIGURE 3. LDLR positive protein is present in LDLR / brain, but not liver. Western blots for LDL R in liver (A) and brain (B) using the anti LDLR antibody. Gels were loaded with equal amounts of microsomal proteins. Actin detection was used as a loading control. (C) Quantitation of the relative intensity of the LDLR positive signal in NTG and LDLR / brain samples (n=5; P =0.63). NL: NTG liver; / L: LDLR / liver.

PAGE 135

123

PAGE 136

124 FIGURE 4. LDLR signal is present in brain and primary neurons of LDLR / and NTG mice with similar intensity and distribution. Brain (A) and liver (B) sections of NTG and LDLR / mice were immuno stained with anti LDLR antibody, detected with IR Dye 680 goat anti rabbit secondary and scanned on the Odyssey Imager. Signal detection was proportionally inhibited with incubation of the primary antibody with increasing amounts of rmLDLR (C). (D H) Sagittal sections of NTG and LDLR / brain and liver were immuno stained with anti LDLR antibody. Representative images of medial cortex (D), hippocampus (E), ventricle (F), cerebellum (G), and liver (H) are shown. The negative control samples correspon d to staining without primary antibody. (I) Primary neuronal cultures from NTG and LDLR / mice were immuno stained as described for panels D H rmLDLR: recombinant mouse LDLR protein.

PAGE 137

125

PAGE 138

126 FIGURE 5. ApoE binding in LDLR / primary neurons via LDLR protei n is conserved. (A) The seven repeats of the LDLR LBD are aligned to show distribution of the six cysteine containing regions in each repeat. The sequence coded by exon 4 is highlighted in red. (B) The resulting LBD of LDLR!4 contains repeats 1, 2, 6, and 7 of the full length LDLR. R5 and R2 are the repeats that flank upstream of R6 in the LDLR and LDLR!4 LBD, respectively. (C) Residues participating in ligand binding ( ) and calcium coordin ation ( # ) are shown within the boxes. (D) Schematics derived from ExPASy indicating the tertiary structures of coupled repeats in the LDLR LBD. ( i i v ) Tertiary structures of the sequences spanning repeats 2 and 3 ( i ), 3 and 4 ( ii ), 4 and 5 ( iii ), and 5 and 6 ( iv ) of the LDLR. The last image ( v ) corresponds to the sequences of repeat 2 and 6, which is the resulting apoE binding region of LDLR!4.

PAGE 139

127

PAGE 140

128 FIGURE 6. Glia derived apoE co localizes with LDLR protein on the plasma membrane and cytoplasm of NTG and LDLR / primary neurons. Primary neurons from NTG and LDLR / mice were incubated with glia derived apoE. Cells were fixed and immuno stained for LDLR (red) and apoE (green). The merged image (yellow) shows potential Hoechst staining was used as a nuclear marker.

PAGE 141

129

PAGE 142

130 FIGURE 7. LDLR!4 variant mRN A expression is upregulated in the PSAPP mouse brain. LDLR and LDLR!4 mRNA expression in NTG and PSAPP brain tissue was detected by quantitative RT PCR. (n=5; P value for LDLR! 4 is 0.01). Mice were 11 12 months old, and experiments were done in triplicate.

PAGE 143

131

PAGE 144

132 TABLE 2. Increased LDLR!4 mRNA expression in PSAPP mice. Summary of RT PCR data from figure 7.

PAGE 145

133 References 1. Boyles JK et al. (1985) Apolipoprotein E associated with astrocytic glia of the centr al nervous system and with nonmyelinating glia of the peripheral nervous system. J Clin Invest 76: 1501 1513. 2. Elshourbagy NA, Liao WS, Mahley RW, & Taylor JM (1985) Apolipoprotein E mRNA is abundant in the brain and adrenals, as well as in the liver, an d is present in other peripheral tissues of rats and marmosets. Proc Natl Acad Sci U S A 82: 203 207. 3. Blum CB, Aron L, & Sciacca R (1980) Radioimmunoassay studies of human apolipoprotein E. J Clin Invest 66: 1240 1250. 4. Mackie A, Caslake MJ, Packard C J, & Shepherd J (1981) Concentration and distribution of human plasma apolipoprotein E. Clin Chim Acta 116: 35 45. 5. Mahley RW & Huang Y (1999) Apolipoprotein E: from atherosclerosis to Alzheimer's disease and beyond. Curr Opin Lipidol 10: 207 217. 6. Pot ter H, Wefes IM, & Nilsson LN (2001) The inflammation induced pathological chaperones ACT and apo E are necessary catalysts of Alzheimer amyloid formation. Neurobiol Aging 22: 923 930.

PAGE 146

134 7. Ma J et al. (1994) Amyloid associated proteins alpha 1 antichymotry psin and apolipoprotein E promote assembly of Alzheimer beta protein into filaments. Nature 372: 92 94. 8. Arnold SE et al. (1997) Apolipoprotein E genotype in schizophrenia: frequency, age of onset, and neuropathologic features. Neuroreport 8: 1523 1526. 9. Pickar D et al. (1997) Apolipoprotein E epsilon 4 and clinical phenotype in schizophrenia. Lancet 350: 930 931. 10. Hata T et al. (2002) Possible effect of the APOE epsilon 4 allele on the hippocampal volume and asymmetry in schizophrenia. Am J Med G enet 114: 641 642. 11. Corder EH et al. (1993) Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer's disease in late onset families. Science 261: 921 923. 12. Saunders AM et al. (1993) Association of apolipoprotein E allele epsilon 4 wi th late onset familial and sporadic Alzheimer's disease. Neurology 43: 1467 1472. 13. Wisniewski T et al. (1994) Acceleration of Alzheimer's fibril formation by apolipoprotein E in vitro. Am J Pathol 145: 1030 1035. 14. Deane R et al. (2008) apoE isoform specific disruption of amyloid

PAGE 147

135 beta peptide clearance from mouse brain. J Clin Invest 118: 4002 4013. 15. Fryer JD et al. (2005) The low density lipoprotein receptor regulates the level of central nervous system human and murine apolipoprotein E but does not modify amyloid plaque pathology in PDAPP mice. J Biol Chem 280: 25754 25759. 16. Brown MS & Goldstein JL (1986) A receptor mediated pathway for cholesterol homeostasis. Science 232: 34 47. 17. Cao D et al. (2006) Lack of LDL receptor aggravates learn ing deficits and amyloid deposits in Alzheimer transgenic mice. Neurobiol Aging 27: 1632 1643. 18. Goldstein JL et al. (1985) Receptor mediated endocytosis: concepts emerging from the LDL receptor system. Annu Rev Cell Biol 1: 1 39. 19. Yamamoto T et al. (1984) The human LDL receptor: a cysteine rich protein with multiple Alu sequences in its mRNA. Cell 39: 27 38. 20. Tveten K et al. (2006) Analysis of alternatively spliced isoforms of human LDL receptor mRNA. Clin Chim Acta 373: 151 157. 21. Zou F et a l. (2008) Sex dependent association of a common low density lipoprotein receptor polymorphism with RNA splicing efficiency in the brain and Alzheimer's disease. Hum Mol Genet 17:

PAGE 148

136 929 935. 22. Russell DW, Brown MS, & Goldstein JL (1989) Different combinatio ns of cysteine rich repeats mediate binding of low density lipoprotein receptor to two different proteins. J Biol Chem 264: 21682 21688. 23. Esser V et al. (1988) Mutational analysis of the ligand binding domain of the low density lipoprotein receptor. J Biol Chem 263: 13282 13290. 24. Neff D et al. (2003) Detection of a novel exon 4 low density lipoprotein receptor gene deletion in a swiss family with severe familial hypercholesterolemia. Clin Chem Lab Med 41: 266 271. 25. Ishibashi S et al. (1993) Hype rcholesterolemia in low density lipoprotein receptor knockout mice and its reversal by adenovirus mediated gene delivery. J Clin Invest 92: 883 893. 26. Games D et al. (1995) Alzheimer type neuropathology in transgenic mice overexpressing V717F beta amylo id precursor protein. Nature 373: 523 527. 27. Elder GA et al. (2007) Elevated plasma cholesterol does not affect brain Abeta in mice lacking the low density lipoprotein receptor. J Neurochem 102: 1220 1231. 28. Sparks DL et al. (1994) Induction of Alzhe imer like beta amyloid immunoreactivity in the brains of rabbits with dietary cholesterol.

PAGE 149

137 Exp Neurol 126: 88 94. 29. Refolo LM et al. (2000) Hypercholesterolemia accelerates the Alzheimer's amyloid pathology in a transgenic mouse model. Neurobiol Dis 7: 321 331. 30. Shie FS et al. (2002) Diet induced hypercholesterolemia enhances brain A beta accumulation in transgenic mice. Neuroreport 13: 455 459. 31. Li L et al. (2003) Association of aortic atherosclerosis with cerebral beta amyloidosis and learning deficits in a mouse model of Alzheimer's disease. Am J Pathol 163: 2155 2164. 32. Dodson SE et al. (2008) Loss of LR11/SORLA enhances early pathology in a mouse model of amyloidosis: evidence for a proximal role in Alzheimer's disease. J Neurosci 28: 1287 7 12886. 33. Abisambra JF et al. (2007) A low density lipoprotein receptor isoform lacking exon 4 is present in low density lipoprotein receptor knock out mouse brain. Society for Neuroscience 2007 Meeting 34. Russell DW et al. (1984) Domain map of the LDL receptor: sequence homology with the epidermal growth factor precursor. Cell 37: 577 585. 35. Costa DA et al. (2007) Enrichment improves cognition in AD mice by

PAGE 150

138 amyloid related and unrelated mechanisms. Neurobiol Aging 28: 831 844. 36. Soriano P, Mon tgomery C, Geske R, & Bradley A (1991) Targeted disruption of the c src proto oncogene leads to osteopetrosis in mice. Cell 64: 693 702. 37. Duff K et al. (1996) Increased amyloid beta42(43) in brains of mice expressing mutant presenilin 1. Nature 383: 71 0 713. 38. Ness GC et al. (1986) Characteristics of rat liver microsomal 3 hydroxy 3 methylglutaryl coenzyme A reductase. Biochem J 233: 167 172. 39. Nilsson LN et al. (2001) Alpha 1 antichymotrypsin promotes beta sheet amyloid plaque deposition in a tra nsgenic mouse model of Alzheimer's disease. J Neurosci 21: 1444 1451. 40. Padmanabhan J, Levy M, Dickson DW, & Potter H (2006) Alpha1 antichymotrypsin, an inflammatory protein overexpressed in Alzheimer's disease brain, induces tau phosphorylation in neuro ns. Brain 129: 3020 3034. 41. Fagan AM et al. (1999) Unique lipoproteins secreted by primary astrocytes from wild type, apoE ( / ), and human apoE transgenic mice. J Biol Chem 274: 30001 30007. 42. Medh JD et al. (1995) The 39 kDa receptor associated pro tein

PAGE 151

139 modulates lipoprotein catabolism by binding to LDL receptors. J Biol Chem 270: 536 540.

PAGE 152

140 LDLR EXPRESSION AND LOCALIZATION ARE ALTERED IN MOUSE AND HUMAN CELL CULTURE MODELS OF ALZHEIMER'S DISEASE Abstract Background: Alzheimer' s disease (AD) is a chronic neurodegenerative disorder and the most common form of dementia. The major molecular risk factor for late onset AD is expression of the % 4 allele of apolipoprotein E (apoE), the major cholesterol transporter in the brain. The l ow density lipoprotein receptor (LDLR) has the highest affinity for apoE and plays an important role in brain cholesterol metabolism. Methodology/Principal Findings: Using RT PCR and western blotting techniques we found that over expression of APP caused increases in both LDLR mRNA and protein levels in APP transfected H4 neuroglioma cells compared to H4 controls. Furthermore, immunohistochemical experiments showed aberrant localization of LDLR in both H4 APP neuroglioma cells and in the PSAPP transgenic m ouse model of AD. Finally, these changes were paralleled by and likely the result of a

PAGE 153

141 disruption of the microtubule organizing center and associated microtubule network, as evidenced by immunofluorescent staining of both # and tubulin. Conclusions/Sig nificance: These data suggest that increased APP alters microtubule function leading to alterations in LDLR location. Consequent deleterious effects on apoE uptake and function will have implications for AD pathogenesis and/or progression.

PAGE 154

142 Introduction Alzheimer's disease (AD) is a chronic neurodegenerative disorder and the most common form of dementia. Currently, almost 50% of the population over 85 years of age suffers from AD. Onset of the disease after age 65 is described as late onset or sporadic AD, which accounts for over 95% of the cases and has an idiopathic etiology. Extracellular amyloid deposits in the cores of neuronal (senile) plaques and in vessel walls, intraneuronal neurofibrillary tangles, and neuroinflammation characteri ze the disease's pathology resulting in accelerated neuron loss and dementia (Glenner & Wong, 1984) Amyloid deposits are the result of abnormal processing of the amyloi d precursor protein (APP) by two enzymes: and # secretase. Mutations in the two presenilin (PS) genes encoding the catalytic core of # secretase as well as mutations in the APP gene lead to increases or alterations in A a 38 42 amino acid peptide and the seed for, and major component of amyloid pathology. The particular structure of A 42 which is the most pathogenic form, confers the ability to self aggregate, oligomerize, and, dependent on the presence apolipoprotein E (apoE), to polymerize into amyl oid filaments

PAGE 155

143 (Mahley, et al., 2006; Potter, et al., 2001; Strittmatter, et al., 1993) The % 4 isoform of apoE is the strongest molecular risk factor for the development of AD. About 60 80% of AD patients have at least one copy of apoE4 (Mahley, et al., 2006; Saunders, et al., 1993; Strittmatter, et al., 1993) and the risk for AD is increased in an % 4 allele dose dependent manner (Cor der, et al., 1993) ApoE is a 34 kDa, 299 amino acid glycoprotein and is the chief cholesterol transporter in the central nervous system (CNS). It's gene, located on chromosome 19q13, may code for any homozygote or heterozygote combination of three common isoforms, apoE2, apoE3, and apoE4 (Havel & Kane, 1973; Zannis, et al., 1981) In the CNS, apoE cholesterol is principally made in astrocytes and exported to neurons (Boyles, et al., 1985; Elshourbagy, et al., 1985) ; however, neurons can also produce apoE cholesterol during stress (Q. Xu, et al., 2006) Despite the presence of seve ral receptors that are capable of internalizing apoE such as low density lipoprotein receptor (LDLR), LDLR related protein (LRP), apoER2, and VLDLR, in neurons apoE is mostly imported via the LDLR (Innerarity & Mahle y, 1978; Innerarity, et al., 1979; Mahley, 1988; Mahley & Rall, 2000) LDLR is a membrane spanning glycoprotein that plays a critical role

PAGE 156

144 in removing LDL and VLDL from the blood (Goldstein & Brown, 1976; Sudhof, Goldstein, et al., 1985) Under low intracellular sterol levels, LDLR gene expression is primarily and directly activated by sterol response element binding proteins (SREBPs) (Smith, et al., 1990) and secondarily by thyroid hormone (Lopez, et al., 2007) The translation of LDLR mRNA yields a 120 kDa protein that is post translationally modified in the Golgi apparatus into the mature, 160 kDa LDLR (Tolleshaug, et al., 1982; Yamamoto, et al., 1984) The mature recept or can be divided into five regions: the N terminal ligand binding domain (Sudhof, Goldstein, et al., 1985; Sudhof, Russell, et al., 1985) the epidermal growth factor precursor homology domain (Davis, Goldstein, et al., 1987; Sudhof, Russell, et al., 1985) the O linked polysaccharide domain (Davis, et al., 1986) where the protein is post translationally modified, the membrane spanning domain (Goldstein, et al., 1985; Lehrman, et al., 1987; Lehrman, et al., 1985) and the C terminal cytoplasmic domain (Gol dstein, et al., 1985) Upon maturation, LDLR is transported to the cell membrane via a clathrin coated pit vesicle (Davis, van Driel, et al., 1987) On the membrane, the ligand binding domain is exposed extracellularly to associate and internalize LDL or VLDL, mediated by apoB or apoE, respective ly. Once inside the cell, LDLR ligand containing vesicles are acidified by proton pumps (M. S. Brown & Goldstein, 1986)

PAGE 157

145 leading to uncoupling of the receptor ligand complex. At this point, the LDL or VLDL cholesterol undergoes fu rther processing to be readily available for the cell's requirements. Several groups identified a potential contribution of LDLR to AD and investigated potential links, for example by crossing AD transgenic mice with the LDLR / mouse model of hyperchole sterolemia to investigate the effects of LDLR deficiency (Blacker, et al., 2003; Cheng, et al., 2005; Corder, et al., 2006; Gopalraj, et al., 2005; Lamsa, et al., 2008; H. Li, et al., 2008; Papassotiropoulos, et al., 2005; Retz, et al., 2001; Rodriguez, et al., 2006; Scacchi, et al., 2001; Wijsman, et al., 2004) Some apparently opposing results were obtained. Here we investigate the effects of APP over expression on the expression and localization of LDLR to identif y possible changes that could result in an altered apoE metabolism. We report that over expression of APP in a human neuroglioma cell line increased the amounts of LDLR mRNA and protein, and the receptor accumulated in the perinuclear region of the APP exp ressing cells. This altered localization was specific to LDLR and could not be seen for LRP. Furthermore, in comparing NTG with PSAPP and APP / transgenic mouse models, we found that LDLR protein levels were directly proportional to the amount of APP. Imm unohistochemical analysis

PAGE 158

146 of and # tubulin suggest that alterations in LDLR are rooted in an APP mediated disturbance of the centrosome and microtubules, preventing proper transport of LDLR to the plasma membrane.

PAGE 159

147 Results Initially we sought to determine changes in the mRNA and protein levels of LDLR in human neuroglioma cells that were stably transfected with human wild type APP (H4 APP) and used their non transfected H4 counterpart as controls. H4 APP cells express about 12 times more APP than non transfected controls and it is distributed throughout the whole cell (Supplemental Figure S1). RT PCR experiments with H4 and H4 APP cells demonstrated a 3 fold increase in LDLR mRNA in H4 APP cells compared to H4 controls (Figure 1A). T his result was paralleled at the protein level as evidenced by western blot analysis (Figure 1B). Quantification of the immunoblots showed a 4 fold increase in LDLR protein in H4 APP cells compared to H4 controls (Figure 1C). Next, we performed immunoflu orescence imaging on H4 and H4 APP cells to determine changes in LDLR localization. In order to assess whether potential APP induced alterations were specific to LDLR, we immunostained for LDLR and another member of the LDLR family, LRP (LDLR related prote in 1) (Figure 2A). Images of H4 and H4 APP cells

PAGE 160

148 without primary antibody incubation are shown as a negative control of the assay (Figure 2A). While we did not observe significant changes in the distribution of LRP, we found that in H4 APP cells, LDLR had become densely concentrated in the perinuclear region (indicated by the arrowheads in panels 2A and 2B). Compared to LDLR localization, the LRP signal was concentrated in a perinuclear density in both H4 and H4 APP cells. At closer inspection (Figure 2B), we confirmed that in H4 control cells, LDLR is homogeneously distributed, whereas in H4 APP cells, LDLR appears to converge to form a dense perinuclear core. To quantifify this effect, we defined cells displaying a dense LDLR positive focus as cells contai ning a signal that was three standard deviations above the background and with at least 1000 pixels 2 By this criterion, 59% of H4 APP versus 10% of H4 cells had LDLR accumulated in the perinuclear zone of the cells. (Figure 2C; p = 0.001). In contrast, 7 2% of H4 APP cells and 66% of H4 cells displayed the dense perinuclear signal for LRP, not indicating any significant change (Figure 2D; p = 0.56). It seems reasonable that if LDLR becomes highly concentrated in a single perinuclear core, then there may be a relative deficit of LDLR in its normal, physiologically relevant location on the plasma membrane. We therefore examined H4 and H4 APP cells with the LDLR antibody as

PAGE 161

149 above, but leaving out the permeabilization step so as to only visualize cell surfac e LDLR. H4 APP cells exhibited a 32% significant reduction of plasma membrane associated LDLR (Figure 3A, 3B, and 3C). This result indicated that there was likely a concomitant reduction in LDLR function, despite the compensatory upregulation of LDLR mRNA and protein shown in Figure 1. AD pathology is initiated and maintained when the APP protein becomes proteolytically cleaved to generate various forms of the A peptide, the 1 42 amino acid version being one of the most pathogenic. In order to assess the general relevance of the redistribution of the LDLR in H4 APP cells, we repeated the experiment using cultured mouse cortical neurons from normal mice and e xposing them to 1uM of either A 40 or A 42 for 48 hours; as a reference, we also treated and immuno stained a set of neurons with a peptide consisting of scrambled amino acids of the A 42 peptide (Figure 4A and 4B). Similar to the H4 APP cells, the A 40 and A 42 treated cortical neurons had 23% (* p < 0.05) and 13% (** p < 0.01) less surface LDLR compare d to A 42 scrambled peptide treated cells (Figure 4C). The amount of surface LDLR was also significantly decreased in A 40 treated compared to A 42 treated cells (10%; p < 0.05).

PAGE 162

150 Thus far we have shown that the upregulated LDLR protein in H4 APP cells ca nnot be accounted for on their cell membrane. To identify the localization of the LDLR aggregate, we co stained LDLR with organelle markers for the Golgi apparatus (Figure 5A and 5B), lysosomes (Figure 5C and 5D), endoplasmic reticulum (Figure 5E and 5F), and early endosomes (Figure 5G and 5H). We found that in H4 APP cells, LDLR signal co localized in the Golgi apparatus and lysosomes, or the trans Golgi network. In contrast, LDLR signal in the ER or endosomes was not particular to either H4 or H4 APP cell s. We next sought to reproduce the APP induced LDLR over expression and mis localization in a physiologically relevant experimental system an in vivo model of AD. We chose PS1+/ APP+/ (PSAPP) mice at 10 months of age when their brains are burdened with amyloid, homogenized brain tissue from the PSAPP mice and age matched non transgenic (NTG) controls and performed western blot analysis for LDLR. We observed a modest, yet significant increase of LDLR in PSAPP mice compared to controls (Figure 6A and 6B; 2 0% increase with p = 0.05). The same experiment served to confirm that the PSAPP mice overexpressed APP (Figure 6A). In order to further investigate whether

PAGE 163

151 the LDLR protein levels are influenced by APP expression, we performed western blots for LDLR in 1 0 month old APP / mice. Interestingly, we found that LDLR was decreased by 55% in these mice compared to age matched controls (Figure 6C and 6D; p = 0.04). These experiments indicate that LDLR expression directly correlates with APP expression. To deter mine if changes in LDLR expression are paralleled by changes in its localization in PSAPP mice, we performed immunohistochemistry on brain tissue sections of PSAPP mice of 10 months and age matched controls. We detected an increase in the LDLR signal in th e hippocampus of PSAPP mice, a region that is particularly affected by the amyloid pathology. This effect was the strongest in the CA3 region of the hippocampus (Figure 7A). At higher magnification, we found that cells surrounding the neuronal layer of the hippocampus in PSAPP tissues also showed a dense accumulation of LDLR similar to that observed in H4 APP cells (arrowhead in PSAPP hippocampal cell of figure 7A), whereas the NTG counterpart lacked that same signal concentration (Figure 7A). After quantif ication of the LDLR signal normalized to the amount of DAPI signal in each field, we calculated a 30% increase (* p = 0.04) in LDLR in the hippocampi of PSAPP mice compared to NTG controls (Figure 7B).

PAGE 164

152 The centrosome, or microtubule organizing center (MTO C), is responsible for the nucleation step preceding the polymerization of microtubules and maintains the structure of the microtubule network. It was previously reported that PS1 and APP bind to the centrosome (J. L i, Xu, Zhou, Ma, & Potter, 1997; Nizzari, et al., 2007) We therefore reasoned that the mechanism behind the changes in localization and expression levels of LDLR mRNA and protein could be based on an APP mediated alteration of the microtubule trafficking system. To address this hypothesis, we performed immunohistochemistry in H4 and H4 APP cells targeting # tubulin as a marker of the MTOC. While we observed condensed staining of # tubulin in H4 cells, H4 APP cells showed a diffuse, non nuclear pattern of # tubulin signal (Figure 8A and 8B) where 0.64% of the # tubulin signal was dispersed in H4 APP cell. In contrast, 0.72% percent of the # tubulin signal was diffuse in the H4 cells; this was a modest change (0.08%), yet it was significantly different (* p = 0.01; Figure 8C). Finally, to address the relationship between APP over expression and alterations to the mature microtubule trafficking network, we performed immunofluorescent staining of H4 and H4 APP cells targeting

PAGE 165

153 tubulin as an indicator of micro tubule localization. We found that only 82% of the alpha tubulin signal in H4 APP cells was diffuse, while H4 cells had 87% of the total tubulin signal spread throughout the cell (Figure 9A and 9B). Like in the # tubulin staining experiment, this was a m odest but significant change in signal distribution (5%; p = 0.04) between the transgenic and non transgenic (Figure 9C).

PAGE 166

154 Discussion Characterization of apoE metabolism in the brain is of critical importance for the development of pote ntial therapeutic targets for AD. Because apoE is the principal ligand for LDLR, alterations to LDLR trafficking are likely to impact AD pathology as well. As the main cholesterol transporter in the CNS, apoE is produced by glia and delivers cholesterol ca rgo to neurons by receptor mediated endocytosis via LDLR. In order for apoE cholesterol to enter the cell, LDLR must be localized to the plasma membrane. Our findings indicate that in H4 APP cells and primary neurons treated with A this localization is a ltered in that there is a significant decrease in the amount of cell surface LDLR (Figure 3 and 4). As, transcriptional activation of the LDLR gene is normally induced by a system that is sensitive to low levels of intracellular sterols (Smith, et al., 1990) it seems likely that the upregulatio n of LDLR (Figure 1) indicates that the H4 APP cells are cholesterol starved due to non functional localization of LDLR. Dietary and endogenous biosynthesis of cholesterol modulates the

PAGE 167

155 rate at which APP is processed into A Studies using animals fed hi gh cholesterol diets revealed an increase in amyloid plaque formation in rabbits and in transgenic mouse models of AD (Howland, et al., 1998; Shie, et al., 2002; Sparks, et al., 1994) ; moreover, in these mice, the h igh cholesterol diet induced cognitive decline (Thirumangalakudi, et al., 2008) In vitro studies show that imbalances in cellular cholesterol may favor APP cleavage by either or # secretase. Conversely, choleste rol depleted rat hippocampal primary neurons show reduced APP processing into A (Fassbender, et al., 2001; M. Simons, et al., 1998) and favor the generation of non amyloidogenic APP processing by secretase to yie ld the soluble, non pathogenic protein sAPP (Bodovitz & Klein, 1996; Kojro, et al., 2001) In contrast, # secretase processing is favored when APP is located in the lipid raft; the result is formation of toxic A p eptide. Thus, the amount and distribution of cellular cholesterol is essential for the formation of lipid rafts, and therefore the localization and processing of APP. This connection might also mean that if the observed increased expression of LDLR in appa rent compensation for incorrect localization induced by APP overshoots, then more apoE cholesterol could be imported, lead ing to more APP processing to A in an accelerating pathogenic cycle.

PAGE 168

1 56 Our experiments on PSAPP mice show that LDLR and APP protein l evels are directly proportional (Figure 3). These results together with those obtained with the H4 and H4 APP cell models suggest that APP over expression affects the MTOC such that LDLR transport to the cell membrane is significantly abrogated. Consequent ly, net cholesterol import into the cell is decreased, leading to upregulation of LDLR transcription and protein levels. It was previously shown that APP and PS1 bind to the centrosome (J. Li, et al., 1997; Nizzari, et al., 2007) As a result, the centrosome's nucleation function for microtubule formation may be disrupted by association with excess levels of APP or A in our over expression models or by mutations of the APP gene. This in turn may have widespread detr imental effects for the entire microtubule trafficking system. Our results provide evidence that trafficking of other proteins, organelles, or vesicles in the cell may also be disturbed, although this cannot be true for all proteins as LRP localization was unchanged in the H4 APP cells. (Figure 2A). Over the past 15 years, a considerable amount of effort has been dedicated to characterize the potential participation of LDLR in AD pathology. This interest is based on data procured from linkage analyses of AD risk and the LDLR gene, preliminary data from population and case

PAGE 169

157 control studies, and the importance of LDLR function in the regulation of cholesterol homeostasis via apoE metabolism, whose e4 allele is the most important risk factor for sporadic' AD besides age. Linkage analyses were based on the fact that the LDLR gene locus and a region associated with high frequency of AD risk share a common location on chromosome 19 (Blacker, et al., 2003; Wijsman, et al., 2 004) Furthermore, this peak of risk for AD onset is independent of the risk imparted by the nearby apoE4 gene (Wijsman, et al., 2004) Consequent attempts to characterize linkage of LDLR and AD onset yielded at le ast ten, case control association studies and one family based study (Cheng, et al., 2005; Corder, et al., 2006; Gopalraj, et al., 2005; Lamsa, et al., 2008; Lendon, et al., 1997; H. Li, et al., 2008; Papassotiropoul os, et al., 2005; Retz, et al., 2001; Rodriguez, et al., 2006; Scacchi, et al., 2001; Zou, et al., 2008) Of particular interest were polymorphisms contained in exons 8, 10, 13, and 15, as they had been proposed to have associations with risk of AD onset (Cheng, et al., 2005; Gopalraj, et al., 2005; Retz, et al., 2001) The overall conclusion of these studies is, however, still developing. Other conflicting reports have investigated LDLR's participation in AD at th e molecular level (Cao, et al., 2006; Fryer, et al., 2005;

PAGE 170

158 Thirumangalakudi, et al., 2008) The objective of these studies was to study whether elimination of LDLR expression would affect the pathology in AD mice. T o this end Fryer et. al. (Fryer, et al., 2005) and Cao et. al. (Cao, et al., 2006) crossed the LDLR / mouse with mouse models of AD: the PDAPP and Tg2576, respectively. Both groups agreed that LDLR is the main regulator of apoE in C NS as they observed a significant increase in apoE levels in the CNS of their mice. However, Fryer et. al. did not observe changes in pathology, whereas Cao et. al. reported a mild yet significant increase in plaque deposition. Furthermore, this latter stu dy also reported that the mice performed poorly on a battery of cognitive tests. The question of whether LDLR is involved in AD pathogenesis and/or progression remains unanswered. In contrast to the investigations of the role of LDLR in AD, our approach was to determine instead the effects of amyloid pathology on LDLR metabolism. We describe in this report that APP/A over expression causes alterations to LDLR that may be explained by an APP/A mediated effect on the microtubule trafficking system. In H4 APP cells, a human neuroglioma cell line stably over expressing human wild type APP, LDLR mRNA and protein levels are increased. In these conditions, H4 APP had LDLR aggregated in the trans Golgi network, which precluded its

PAGE 171

159 trafficking to the cell membran e. Furthermore, A treatment also caused aggregation of the LDLR signal. Concomitantly, the PSAPP mouse model of AD, which over expresses the full length human APP containing the V717F mutation, also shows aberrant distribution and a mild, yet significant increase in LDLR protein. The experiments suggest that a likely explanation for these phenomena is that H4 APP cells have changes in the localizati on of the microtubule proteins and # tubulin. The H4 APP cells and PSAPP mouse models we evaluated emula te the APP induced amyloidogenic effects seen in individuals with trisomy 21. Interestingly, the serum cholesterol and lipid profiles of these individuals are abnormal, yet they are protected against atherosclerosis (Murdoch, Rodger, Rao, Fletcher, & Dunnigan, 1977; Yla Herttuala, Luoma, Nikkari, & Kivimaki, 1989) It would be interesting to assess whether LDLR turnover rates are changed in different tissues of individuals with trisomy 21. Based on our data, we sug gest that, rather than a precursor, DS and AD dyslipidemia is a consequence of AD like amyloid pathology induced by increased APP. We propose that rescuing the LDLR transport to the cell membrane would provide benefit to AD patients. Furthermore,

PAGE 172

160 careful e valuation of the mechanisms underlying APP processing as a factor in cholesterol metabolism may yield novel therapeutic targets against Alzheimer's.

PAGE 173

161 Materials and Methods Materials : Quantitative PCR experiments were performed using Ap plied Biosystems, PCR master mixes, human GAPDH endogenous control assays, and gene expression assays for human LDLR (assay ID Hs01092525_m1 ). Tissue culture reagents and electrophoresis supplies were purchased from Gibco/Invitrogen. Protein concentrations were determined with BCA TM (Pierce) colorimetric assays. A peptides were obtained from American Peptide. Antibodies : Rabbit anti LDLR antiserum was a generous gift from Dr. Joachim Herz at the University of Texas Southwestern. It was used as primary ant ibody for immunoblots (1:1000) and immunohistochemistry assays (1:100) (Ishibashi, et al., 1993) Alternatively, a monoclonal anti LDLR antibody from Fitzgerald Industries International (cat.# 10 L55A) was used for immunohistochemistry experiments where the co stain targets required rabbit polyclonal antibodies. Organelle markers for the Golgi apparatus, lysosomes, and early endosomes (GM130, L AMP1, and EEA1 antibodies, resp ectively) were purchased from Cell Signali ng

PAGE 174

162 Technologies, while the KDEL antibody, a marker of endoplasmic reticulum was purchased from Stressgen. Monoclonal mouse anti actin (Sigma Aldrich) and AlexaFluor 488 and 594 (Invitrogen/Molecular Probes) antibodies were diluted according to the manufact urer for western blot (WB) and immunohistochemistry (IHC) assays, respectively. Goat anti mouse IRDye¨800CW and goat anti rabbit IRDye¨680 were purchased from LI COR Biosciences (WB: 1:15,000; IHC: 1:1500). Monoclonal anti tubulin and # tubulin antibodie s were obtained from Sigma Aldrich and diluted according to the company's specifications. Anti LRP antibody was a generous gift from Dr. Guojun Bu. Animals : All procedures involving experimentation on animal subjects were done in accord with the guideline s set forth by the University of South Florida's Institutional Animal Care and Use Committee (IACUC). Mice with the genotype APP +/ PS1 +/ were generated by crossing heterozygous PDGF hAPP(V717F) mice [Swiss Webster X C57BL/6] with PDGF hPS1(M146L) hetero zygotes [Swiss Webster X C57BL/6] as described (Costa, et al., 2007) Non transgenic (NTG) control mice for LDLR / mice were C57BL/6J expressing endogenous LDLR (The Jackson Laboratory). NTG control mice for APP +/ PS1 +/ were littermates that lacked both transgenes. All mice were genotyped by PCR to confirm the

PAGE 175

163 presence or absence of PDGF hAPP (Games, et al., 1995) and PDGF hPS1 (Duff, et al., 1996) APP knock out mice (strain B6.129S7 APP tm1Dbo /J) were obtained from The Jackson Laboratory and were genotyped according to the provider's recommendations. Primary neurons were obtained from the cortex and hippocampus of E18 NTG mice as described (Padmanabhan, et al., 2006) Neurons wer e grown for one week on poly L lysine coated 8 chamber slides in neurobasal medium with B27 supplement. Neurons were then treated for 48 hours with 1 M concentration of either A 40 or A 42 Cells were then fixed and stained as described below in the immun ohistochemistry section. Tissue preparation : Brain tissue was acquired by anesthetizing mice with 0.1 mg/g Nembutal followed by transcardial perfusion with 0.9% saline solution for 8 12 min at 120 mmHg. Whole brains were immediately removed for processing Messenger RNA was extracted by homogenizing tissues in TRI reagent (Sigma Aldrich). Microsomal protein extracts were obtained as previously described (Ness, et al., 1986) with minor modifications: 0.25M sucrose was prepare d with protease inhibitors (1 tablet mini Complete/ 10 ml sucrose, Roche Applied Science). Samples were dounce homogenized and spun at 10,000 x g for 10 min. Then, supernatants were spun once at 30,000 x g for 90 min in a fixed angle

PAGE 176

164 rotor. Microsome pelle ts were resuspended in PBS with 10% glycerol and protease inhibitor cocktail (Roche). Brains for immunohistochemistry assays were fixed for 24 hrs in 4% para formaldehyde. The fixed tissues were cryo protected in successive sucrose gradients as previously described (Nilsson, et al., 2001) Brains were frozen on a temperature controlled freezing stage, coronally sectioned (25 m) on a sliding microtome, and stored in a solution of PBS containing 0.02% NaN 3 at 4 o C. Quantitative RT PCR : Five micrograms of DNase treated mRNA were reverse trans cribed with SuperScript¨ VILO TM cDNA Synthesis Kit (Invitrogen) using random hexamers according to the manufacturer's instructions. Quantitative RT PCR was performed according to the manufacturer. Reactions were processed in the 7500 FAST System with its S equence Detection Software (SDS) from Applied Biosystems. Western blots: Unless otherwise indicated, 50 g (protein) of brain microsomes, were denatured with LDS sample buffer according to the Invitrogen protocol. Samples were loaded onto 3 8%, 1.0 or 1.5mm Tris Acetate gels, and run at 80V for 180 min. Gels were dry (iBlot, Invitrogen) or wet transferred onto PVDF membranes for 9 min. Non

PAGE 177

165 specific protein binding to the membrane was blocked by incubating with 5% BSA or 7% non fat dry milk for 90 min at room temperature. Primary antibody for actin was diluted 1:10000, while LD LR antibodies were diluted 1:1000 in blocking buffer and incubated overnight at 4¡C. Secondary antibody incubations with either IR dyes (1:15000) or HRP conjugated were performed sequentially for 60 min at room temperature. Membranes were washed three time s for 10 min with PBS or TBS and 0.1% Tween 20 after incubation with each antibody. Membranes were scanned and analyzed with the LI COR Odyssey and accompanying software or developed using ECL reagent. Immunohistochemistry : H4 and H4 APP cells were cultu red in 8 chamber slides for 3 days prior to immunostaining. Cells were then fixed in ice cold methanol or 4% para formaldehyde for 15 min at room temperature and incubated with blocking buffer (described below). Brain sections were mounted onto Colorfrost¨ / Plus slides (Fisher Scientific) Non specific binding was blocked in NGS (10% normal goat serum, 0.2% Triton X 100, and 0.02% NaN 3 in Tris buffered saline (TBS)) or in NGS without detergents for non permeabilizing experiments, for 120 min at room temperatu re. Primary antibodies were incubated overnight at 4¡C in 10% NGS. After four, 5 min washes in TBS, slides were incubated with

PAGE 178

166 AlexaFluor 594 and 488 (anti rabbit and anti mouse, respectively) secondary antibodies in 10% NGS for 60 min at room temperatur e and washed in TBS. Slides were stained with Hoechst (1%g/ml in PBS) for 2 min to reveal cellular nuclei and mounted using GelMount (Fisher Scientific). Staining was analyzed with the Zeiss AxioImager.Z1 and AxioVision software using 5x/0.16 or 40x/0.75 d ry ECPlan NeoFluo r objectives where specified. Images were captured at room temperature with an AxioCam MR3 camera. Fluorochromes used were DAPI, DsRed, and FITC. The magnified hippocampal cell image in figure 4A was modified in Adobe Photoshop by changing the brightness and contrast to both the NTG and PSAPP cell images equally and simultaneously. Image quantification : LDLR, LRP, # and tubulins, and APP were quantified using ImageJ as described in Figure S2. Analysis of figures 3 and 4 were performed by the following procedure: images scanning the entire wells for H4, H4 APP, and no primary antibody negative controls were obtained. These images were taken at 100x and using the same exposure time for the channel corresponding to LDLR. We discarded picture s containing artifacts (such as those with cells damaged by the pipette tip), images from the edges of the wells (due to potential artifacts caused by the rubber gasket), and fields containing less than 200 nuclei.

PAGE 179

167 We obtained the integrated density (I.D.) of each field and the number of cell nuclei using ImageJ (Abramoff, 2004; Rasband, 1997 2009) We divided the I.D. by the number of cell nuclei to generate the amount of plasma membrane LDLR/cell (I.D./cell). The I.D./cell for the negative contro l was subtracted from the I.D./cell of H4 and H4 APP cells. The average of the values for each condition was compared. Statistical analyses : All data reported were obtained from independent experiments. Data were plotted as SE of the mean. P values were obtained from paired t test analyses. Acknowledgements: Funding provided by the Johnnie B. Byrd Sr. Alzheimer's Center and Research Institute and the Eric Pfeiffer Chair for Research on Alzheimer's Disease. We acknowledge Dr. Joachim Herz and Dr. Guojun Bu for kindly providing antibodies.

PAGE 180

168 Figures Figure 1. LDLR mRNA and protein are upregulated in H4 APP cells compared to H4 controls. (A) RT PCR quantification of LDLR mRNA expression level in H4 and H4 APP cells (n = 3; p = 0.04). LDLR threshold cycle values were normalized to GAPDH. (B) Western blot for LDLR in whole cell lysates from H4 and H4 APP cells. Lane 1 contains liver whole cell lysate from a NTG mouse. (C) Quantification of western blot (n = 3; p = 0.01). All bands for LDLR were quanti fied and their values shown in this graph. The LDLR band densities were normalized to the actin band in each lane. RT PCR and western blot experiments were conducted in triplicate.

PAGE 181

169

PAGE 182

170 Figure 2. LDLR distribution is altered in H4 APP cells compared to H4 controls. (A) Immunohistochemistry imaging at 400x magnification of LDLR and LRP in H4 and H4 APP cells. Red signal corresponds to LDLR or LRP as indicated and blue signal corresponds to Hoechst labeled cell nuclei. Arrowheads point to thr ee examples of a dense perinuclear LDLR positive signal present in H4 APP cells. (B) Larger image of a selected cell from panel 2A; the arrowhead points to an LDLR positive density. (C and D) Quantification of the percentage of cells with perinuclear densi ty of fluorescent signal in LDLR (C) and LRP (D), which is described in more detail in supplemental figure 2.

PAGE 183

171

PAGE 184

172 Figure 3. Surface LDLR is reduced in H4 APP cells compared to H4 controls. H4 and H4 APP cells were immunostained for LDLR in the absence of de tergents to prevent permeabilization of the plasma membrane. (A) Images magnified at 400x showing LDLR signal (red) and nuclei (blue) for H4 and H4 APP. (B) Zoomed image of one cell isolated from panel A. (C) Quantification of the average LDLR positive sig nal per cell showing a 32% reduction of LDLR on the membrane of H4 APP cells (* p = 0.03). The average of the ratio of the total LDLR intensity and the number of cell nuclei for the H4 condition was equaled to 100%. The H4 APP ratio was divided by the H4 ra tio of LDLR intensity per cell; A total of ~18,000 cells were taken into account from three independent experiments.

PAGE 185

173

PAGE 186

174 Figure 4. A 42 alters LDLR localization in primary neurons of NTG mice. Primary neurons were obtained from E18 fetuses, plated and grow n for one week, and treated with 1 M A 40 or A 42 for 48 hours. Cell surface LDLR was immunostained (red). (A) Image of primary neurons from cells treated for 48 hours with 1 M A 42 scrambled peptide (as positive control), A 40 and A 42 ; image is magnifi ed 630x. (B) Zoomed image isolating one cell in each field of panel A. The negative control corresponds to staining in the absence of primary antibody.

PAGE 187

175

PAGE 188

176 FIGURE 5. LDLR is abundant in the trans Golgi network of H4 APP cells. H4 and H4 APP cells were co stained for LDLR and different organelle markers. A and B show Golgi apparatus at low and high magnification, respectively. C and D show LDLR co stained with lysosomal marker at low and high magnification, respectively. E and F show LDLR co stained for endosomes at low and high magnification respectively. G and H show LDLR co stained with endoplasmic reticulum at low and high magnification, respectively. A, C, E, and G were taken at 400x, while B, D, F, and H are zoomed images.

PAGE 189

177

PAGE 190

178 Figure 6. Brain LDL R is increased in PSAPP mice and decreased in APP / mice compared to controls. Whole cell lysates were prepared from brains of 10 month old PSAPP, APP / and age matched non transgenic control mice for western blot analyses; liver whole cell lysates wer e prepared from NTG and LDLR / as positive and negative control homogenates, respectively. (A) Western blot for LDLR, APP, and actin from PSAPP and NTG control lysates. (B) Quantification of LDLR signal normalized to actin in western blot of panel A (n = 5; p = 0.05). (C) Western blot for LDLR and actin from NTG and APP / mice. (D) Quantification of LDLR signal normalized to actin in western blot of panel C (n NTG = 3 and n APP / = 4; p = 0.04).

PAGE 191

179

PAGE 192

180 Figure 7. LDLR is increased and delocalized in th e hippocampus of PSAPP mice compared to NTG controls. (A) Representative images at 5x magnification of immunohistochemistry staining of the CA3 region of the hippocampus and an enlarged view of a representative hippocampal cell surrounding the neuronal lay er of a PSAPP and NTG mouse. Mice were 10 month old PSAPP and NTG. LDLR signal is in red and cell nuclei are in blue. Arrowhead in PSAPP hippocampal neuron indicates the concentration LDLR positive signal. (B) Quantification of LDLR positive signal normali zed by the DAPI signal in hippocampus of PSAPP and NTG mice. Experiments were done in triplicate using brain sections of 8 mice for each condition.

PAGE 193

181

PAGE 194

182 Figure 8. # tubulin signal is more widely distributed in H4 APP cells compared to H4 contro ls. (A) Immunohistochemistry imaging at 400x magnification of LDLR and # tubulin in H4 and H4 APP cells. Red, green, and blue signals correspond to LDLR, # tubulin, and cell nuclei, respectively. Arrowheads indicate three examples of H4 APP cells containin g greater area of # tubulin signal distribution. (B) Larger image of a selected cell from the same slide. Merged images in A and B show the location of LDLR in relation to # tubulin and the nucleus. (C) Percentage of diffuse # tubulin signal in H4 compared to H4 APP cells. Quantification is described in further detail in supplemental figure 2.

PAGE 195

183

PAGE 196

184 Figure 9. tubulin is less widely distributed in H4 APP cells compared to H4 controls. (A) Immunohistochemistry imaging at 400x magnification of LDLR and tubuli n in H4 and H4 APP cells. Red, green, and blue signals correspond to LDLR, tubulin, and cell nuclei, respectively. Arrowheads indicate three examples of H4 APP cells containing less diffuse tubulin. (B) Larger images of selected cells from panel A. Mer ged images in A and B show the location of LDLR in relation to tubulin and the nucleus. (C) Percentage of diffuse tubulin signal in H4 compared to H4 APP cells. Quantification is described in further detail in supplemental figure 2.

PAGE 197

185

PAGE 198

186 Figure 10. Propo sed mechanism by which APP/A overexpression diminishes LDLR trafficking by disrupting microtubule formation. Overexpression of APP/A causes microtubule destabilization by altering the centrosome, and consequently, polymerized microtubules. As a result, L DLR trafficking from the TGN to the plasma membrane is impaired. Therefore, LDLR accumulates in the TGN. The implications are that the cell is unable to import cholesterol effectively, which causes transcriptional activation of the LDLR gene.

PAGE 199

187

PAGE 200

188 Supplemental figure 1. APP overexpression in H4 APP cells causes aberrant localization in the cell. (A) Immunohistochemistry imaging at 400x magnification of LDLR and APP in H4 and H4 APP cells. Red, green, and blue signals correspond to LDLR, APP, and cell nuclei, respectively. (B) Quantification graph of diffuse APP signal between H4 and H4 APP cells. (C) Western blot of APP in H4 vs. H4 APP cells; actin was used as a loading control. (D) Quantification of western blot in (C); quantification is descri bed in more detail in supplemental figure 2.

PAGE 201

189

PAGE 202

190 Supplemental figure 2. Quantification of staining using Image J. (A) Representative image of H4 APP cells for analysis. The cells have been stained for LDLR. (B) Histogram generated from ImageJ based on the image shown in panel A. Pixel gray value is the color of the pixel on a scale of 0 to 255, with 0 being absolute black and 255 being absolute wh ite. (C) Magnification of the histogram in panel B. In this representative histogram, the mean pixel value is 11.801, and the standard deviation of the histogram is 23.217. In order to identify the intensely stained perinuclear density, the image was thres holded at 3 standard deviations from the mean. At this threshold, only pixels with a gray value of 81 or greater were identified as positive stain (dark gray region in right tail). Identification of total cellular staining was done with the image threshold ed at 0.5 standard deviations from the mean of the image, so all pixels with a value of 21 or greater were identified as positive stain (light gray region and dark gray region). For tubulin staining, staining outside of the density was defined as that fall ing between 0.5 standard deviations and 3 standard deviations (light gray region only). D) Image showing thresholding of the image shown in panel A at 3 standard deviations. Note that only intense staining is identified at this threshold. E) Further identi fication of the intense perinuclear density based on the criterion that the region be at least 1000 square pixels in

PAGE 203

191 area. FK) Representative image of H4 cells stained for LDLR, thresholded, and perinuclear densities identified as described in AE.

PAGE 204

192 References 1. Glenner GG, Wong CW (1984) Alzheimer's disease: initial report of the purification and characterization of a novel cerebrovascular amyloid protein. Biochem Biophys Res Commun 120: 885 890. 2. Strittmatter WJ, Saunders AM, Schmechel D, Pericak Vance M, Enghild J, et al. (1993) Apolipoprotein E: high avidity binding to beta amyloid and increased frequency of type 4 allele in late onset familial Alzheimer disease. Proc Natl Acad Sci U S A 90: 1977 1981. 3. Potter H, Wefes IM, Nilsson LN (2001) The inflammation induced pathological chaperones ACT and apo E are necessary catalysts of Alzheimer amyloid formation. Neurobiol Aging 22: 923 930. 4. Mahley RW, Weisgraber KH, Huang Y (2006) Apolipoprotein E4: a causative factor and the rapeutic target in neuropathology, including Alzheimer's disease. Proc Natl Acad Sci U S A 103: 5644 5651. 5. Saunders AM, Strittmatter WJ, Schmechel D, George Hyslop PH, Pericak Vance MA, et al. (1993) Association of apolipoprotein E allele epsilon 4 with late onset familial and sporadic Alzheimer's disease. Neurology 43: 1467 1472. 6. Corder EH, Saunders AM, Strittmatter WJ, Schmechel DE, Gaskell PC, et al. (1993) Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer's disease in late onse t families. Science 261: 921 923.

PAGE 205

193 7. Havel RJ, Kane JP (1973) Primary dysbetalipoproteinemia: predominance of a specific apoprotein species in triglyceride rich lipoproteins. Proc Natl Acad Sci U S A 70: 2015 2019. 8. Zannis VI, Just PW, Breslow JL (1981) Human apolipoprotein E isoprotein subclasses are genetically determined. Am J Hum Genet 33: 11 24. 9. Boyles JK, Pitas RE, Wilson E, Mahley RW, Taylor JM (1985) Apolipoprotein E associated with astrocytic glia of the central nervous system and with nonmyel inating glia of the peripheral nervous system. J Clin Invest 76: 1501 1513. 10. Elshourbagy NA, Liao WS, Mahley RW, Taylor JM (1985) Apolipoprotein E mRNA is abundant in the brain and adrenals, as well as in the liver, and is present in other peripheral ti ssues of rats and marmosets. Proc Natl Acad Sci U S A 82: 203 207. 11. Xu Q, Bernardo A, Walker D, Kanegawa T, Mahley RW, et al. (2006) Profile and regulation of apolipoprotein E (ApoE) expression in the CNS in mice with targeting of green fluorescent prot ein gene to the ApoE locus. J Neurosci 26: 4985 4994. 12. Mahley RW (1988) Apolipoprotein E: cholesterol transport protein with expanding role in cell biology. Science 240: 622 630. 13. Mahley RW, Rall SC, Jr. (2000) Apolipoprotein E: far more than a lipid transport protein. Annu Rev Genomics Hum Genet 1: 507 537. 14. Innerarity TL, Mahley RW (1978) Enhanced binding by cultured human fibroblasts of apo E containing lipoproteins as compared with low density lipoproteins. Biochemistry 17: 1440 1447. 15. Inner arity TL, Pitas RE, Mahley RW (1979) Binding of arginine rich (E) apoprotein after recombination with phospholipid vesicles to the low density lipoprotein receptors of fibroblasts. J Biol Chem 254:

PAGE 206

194 4186 4190. 16. Goldstein JL, Brown MS (1976) The LDL pathw ay in human fibroblasts: a receptor mediated mechanism for the regulation of cholesterol metabolism. Curr Top Cell Regul 11: 147 181. 17. Sudhof TC, Goldstein JL, Brown MS, Russell DW (1985) The LDL receptor gene: a mosaic of exons shared with different pr oteins. Science 228: 815 822. 18. Smith JR, Osborne TF, Goldstein JL, Brown MS (1990) Identification of nucleotides responsible for enhancer activity of sterol regulatory element in low density lipoprotein receptor gene. J Biol Chem 265: 2306 2310. 19. Lop ez D, Abisambra Socarras JF, Bedi M, Ness GC (2007) Activation of the hepatic LDL receptor promoter by thyroid hormone. Biochim Biophys Acta 1771: 1216 1225. 20. Tolleshaug H, Goldstein JL, Schneider WJ, Brown MS (1982) Posttranslational processing of the LDL receptor and its genetic disruption in familial hypercholesterolemia. Cell 30: 715 724. 21. Yamamoto T, Davis CG, Brown MS, Schneider WJ, Casey ML, et al. (1984) The human LDL receptor: a cysteine rich protein with multiple Alu sequences in its mRNA. C ell 39: 27 38. 22. Sudhof TC, Russell DW, Goldstein JL, Brown MS, Sanchez Pescador R, et al. (1985) Cassette of eight exons shared by genes for LDL receptor and EGF precursor. Science 228: 893 895. 23. Davis CG, Goldstein JL, Sudhof TC, Anderson RG, Russel l DW, et al. (1987) Acid dependent ligand dissociation and recycling of LDL receptor mediated by growth factor homology region. Nature 326: 760 765. 24. Davis CG, Elhammer A, Russell DW, Schneider WJ, Kornfeld S, et al.

PAGE 207

195 (1986) Deletion of clustered O linke d carbohydrates does not impair function of low density lipoprotein receptor in transfected fibroblasts. J Biol Chem 261: 2828 2838. 25. Goldstein JL, Brown MS, Anderson RG, Russell DW, Schneider WJ (1985) Receptor mediated endocytosis: concepts emerging f rom the LDL receptor system. Annu Rev Cell Biol 1: 1 39. 26. Lehrman MA, Schneider WJ, Sudhof TC, Brown MS, Goldstein JL, et al. (1985) Mutation in LDL receptor: Alu Alu recombination deletes exons encoding transmembrane and cytoplasmic domains. Science 22 7: 140 146. 27. Lehrman MA, Russell DW, Goldstein JL, Brown MS (1987) Alu Alu recombination deletes splice acceptor sites and produces secreted low density lipoprotein receptor in a subject with familial hypercholesterolemia. J Biol Chem 262: 3354 3361. 28 Davis CG, van Driel IR, Russell DW, Brown MS, Goldstein JL (1987) The low density lipoprotein receptor. Identification of amino acids in cytoplasmic domain required for rapid endocytosis. J Biol Chem 262: 4075 4082. 29. Brown MS, Goldstein JL (1986) A re ceptor mediated pathway for cholesterol homeostasis. Science 232: 34 47. 30. Scacchi R, Gambina G, Martini MC, Ruggeri M, Ferrari G, et al. (2001) Polymorphisms of the apolipoprotein E gene regulatory region and of the LDL receptor gene in late onset Alzhe imer's disease in relation to the plasma lipidic pattern. Dement Geriatr Cogn Disord 12: 63 68. 31. Papassotiropoulos A, Wollmer MA, Tsolaki M, Brunner F, Molyva D, et al. (2005) A cluster of cholesterol related genes confers susceptibility for Alzheimer's disease. J Clin Psychiatry 66: 940

PAGE 208

196 947. 32. Lamsa R, Helisalmi S, Herukka SK, Tapiola T, Pirttila T, et al. (2008) Genetic study evaluating LDLR polymorphisms and Alzheimer's disease. Neurobiol Aging 29: 848 855. 33. Cheng D, Huang R, Lanham IS, Cathcart HM, Howard M, et al. (2005) Functional interaction between APOE4 and LDL receptor isoforms in Alzheimer's disease. J Med Genet 42: 129 131. 34. Blacker D, Bertram L, Saunders AJ, Moscarillo TJ, Albert MS, et al. (2003) Results of a high resolution genome s creen of 437 Alzheimer's disease families. Hum Mol Genet 12: 23 32. 35. Wijsman EM, Daw EW, Yu CE, Payami H, Steinbart EJ, et al. (2004) Evidence for a novel late onset Alzheimer disease locus on chromosome 19p13.2. Am J Hum Genet 75: 398 409. 36. Corder E H, Huang R, Cathcart HM, Lanham IS, Parker GR, et al. (2006) Membership in genetic groups predicts Alzheimer disease. R ejuvenation Res 9: 89 93. 37. Gopalraj RK, Zhu H, Kelly JF, Mendiondo M, Pulliam JF, et al. (2005) Genetic association of low density lip oprotein receptor and Alzheimer's disease. Neurobiol Aging 26: 1 7. 38. Li H, Wetten S, Li L, St Jean PL, Upmanyu R, et al. (2008) Candidate single nucleotide polymorphisms from a genomewide association study of Alzheimer disease. Arch Neurol 65: 45 53. 39 Retz W, Thome J, Durany N, Harsanyi A, Retz Junginger P, et al. (2001) Potential genetic markers of sporadic Alzheimer's dementia. Psychiatr Genet 11: 115 122. 40. Rodriguez E, Mateo I, Llorca J, Sanchez Quintana C, Infante J, et al. (2006) Genetic inter action between two apolipoprotein E receptors increases Alzheimer's disease risk. J Neurol 253: 801 803.

PAGE 209

197 41. Nizzari M, Venezia V, Bianchini P, Caorsi V, Diaspro A, et al. (2007) Amyloid precursor protein and Presenilin 1 interaction studied by FRET in hum an H4 cells. Ann N Y Acad Sci 1096: 249 257. 42. Li J, Xu M, Zhou H, Ma J, Potter H (1997) Alzheimer presenilins in the nuclear membrane, interphase kinetochores, and centrosomes suggest a role in chromosome segregation. Cell 90: 917 927. 43. Sparks DL, Sc heff SW, Hunsaker JC, 3rd, Liu H, Landers T, et al. (1994) Induction of Alzheimer like beta amyloid immunoreactivity in the brains of rabbits with dietary cholesterol. Exp Neurol 126: 88 94. 44. Howland DS, Trusko SP, Savage MJ, Reaume AG, Lang DM, et al. (1998) Modulation of secreted beta amyloid precursor protein and amyloid beta peptide in brain by cholesterol. J Biol Chem 273: 16576 16582. 45. Shie FS, Jin LW, Cook DG, Leverenz JB, LeBoeuf RC (2002) Diet induced hypercholesterolemia enhances brain A bet a accumulation in transgenic mice. Neuroreport 13: 455 459. 46. Thirumangalakudi L, Prakasam A, Zhang R, Bimonte Nelson H, Sambamurti K, et al. (2008) High cholesterol induced neuroinflammation and amyloid precursor protein processing correlate with loss o f working memory in mice. J Neurochem 106: 475 485. 47. Fassbender K, Simons M, Bergmann C, Stroick M, Lutjohann D, et al. (2001) Simvastatin strongly reduces levels of Alzheimer's disease beta amyloid peptides Abeta 42 and Abeta 40 in vitro and in vivo. Proc Natl Acad Sci U S A 98: 5856 5861. 48. Simons M, Keller P, De Strooper B, Beyreuther K, Dotti CG, et al. (1998) Cholesterol depletion inhibits the generation of beta

PAGE 210

198 amyloid in hippocampal neurons. Proc Natl Acad Sci U S A 95: 6460 6464. 49. Kojro E, Gimpl G, Lammich S, Marz W, Fahrenholz F (2001) Low cholesterol stimulates the nonamyloidogenic pathway by its effect on the alpha secretase ADAM 10. Proc Natl Acad Sci U S A 98: 5815 5820. 50. Bodovitz S, Klein WL (1996) Cholesterol modulates alpha secre tase cleavage of amyloid precursor protein. J Biol Chem 271: 4436 4440. 51. Zou F, Gopalraj RK, Lok J, Zhu H, Ling IF, et al. (2008) Sex dependent association of a common low density lipoprotein receptor polymorphism with RNA splicing efficiency in the bra in and Alzheimer's disease. Hum Mol Genet 17: 929 935. 52. Lendon CL, Talbot CJ, Craddock NJ, Han SW, Wragg M, et al. (1997) Genetic association studies between dementia of the Alzheimer's type and three receptors for apolipoprotein E in a Caucasian popula tion. Neurosci Lett 222: 187 190. 53. Fryer JD, Demattos RB, McCormick LM, O'Dell MA, Spinner ML, et al. (2005) The low density lipoprotein receptor regulates the level of central nervous system human and murine apolipoprotein E but does not modify amyloid plaque pathology in PDAPP mice. J Biol Chem 280: 25754 25759. 54. Cao D, Fukuchi K, Wan H, Kim H, Li L (2006) Lack of LDL receptor aggravates learning deficits and amyloid deposits in Alzheimer transgenic mice. Neurobiol Aging 27: 1632 1643. 55. Murdoch J C, Rodger JC, Rao SS, Fletcher CD, Dunnigan MG (1977) Down's syndrome: an atheroma free model? Br Med J 2: 226 228. 56. Yla Herttuala S, Luoma J, Nikkari T, Kivimaki T (1989) Down's

PAGE 211

199 syndrome and atherosclerosis. Atherosclerosis 76: 269 272. 57. Ishibashi S Brown MS, Goldstein JL, Gerard RD, Hammer RE, et al. (1993) Hypercholesterolemia in low density lipoprotein receptor knockout mice and its reversal by adenovirus mediated gene delivery. J Clin Invest 92: 883 893. 58. Costa DA, Cracchiolo JR, Bachstetter AD, Hughes TF, Bales KR, et al. (2007) Enrichment improves cognition in AD mice by amyloid related and unrelated mechanisms. Neurobiol Aging 28: 831 844. 59. Games D, Adams D, Alessandrini R, Barbour R, Berthelette P, et al. (1995) Alzheimer type neuropath ology in transgenic mice overexpressing V717F beta amyloid precursor protein. Nature 373: 523 527. 60. Duff K, Eckman C, Zehr C, Yu X, Prada CM, et al. (1996) Increased amyloid beta42(43) in brains of mice expressing mutant presenilin 1. Nature 383: 710 71 3. 61. Padmanabhan J, Levy M, Dickson DW, Potter H (2006) Alpha1 antichymotrypsin, an inflammatory protein overexpressed in Alzheimer's disease brain, induces tau phosphorylation in neurons. Brain 129: 3020 3034. 62. Ness GC, Sample CE, Smith M, Pendleton LC, Eichler DC (1986) Characteristics of rat liver microsomal 3 hydroxy 3 methylglutaryl coenzyme A reductase. Biochem J 233: 167 172. 63. Nilsson LN, Bales KR, DiCarlo G, Gordon MN, Morgan D, et al. (2001) Alpha 1 antichymotrypsin promotes beta sheet amyl oid plaque deposition in a transgenic mouse model of Alzheimer's disease. J Neurosci 21: 1444 1451. 64. Rasband WS (1997 2009) ImageJ. 65. Abramoff MD, Magelhaes, P.J., Ram, S.J. (2004) Image Processing

PAGE 212

200 with ImageJ. Biophotonics International 11: 36 42.

PAGE 213

201 DISCUSSION The novel contributions of the work presented in this dissertation encompass the study of LDLR in the pathogenesis and progression of AD from two different perspectives: (1) evaluation of the adequacy of the LDLR / model for the study of AD, and (2) investigation of the effects of APP/A overexpression on LDLR. Initially, the literature on LDLR and AD shows significant contradictions. We do not argue that these data are erred, rather that their differences are the consequ ence of the methods employed. In population studies, we suspect that the genetic makeup inherent to the different populations studied by the authors of these reports contains SNPs that can attribute unique differences in the LDLR structure and function. Mo reover, different environmental pressures may also play a role in unmasking risk of disease processes by LDLR. These differences may not be significant to the normal LDLR function in regulating serum cholesterol. Yet, they may affect LDLR mediated processe s in the CNS. Seemingly miniscule changes to LDLR function could suffice to contribute to disease. The end result could be that each region and population may have unique etiological processes of AD

PAGE 214

202 pathogenesis. This suspicion becomes more valid when cons idering that AD is likely to be the product of multiple contributing sources, as it is to be expected of diseases of aging where genetic etiologies are only one contributing factor. Previous efforts undertaking the study of LDLR and AD, specifically pro jects that used the LDLR / mouse to characterize its effect in the CNS, are very valuable. However, our results suggest that the LDLR / mouse may be inadequate for studying the effects of the absence of LDLR in the CNS. Therefore, and particularly in the area of AD, the PDAPP x LDLR / and Tg2576 x LDLR / mouse models are not suitable for determining whether the lack of LDLR may prevent, stave off, or worsen the disease process (Cao, et al., 2006; Fryer, et al., 20 05) Instead, the data reported by these groups reveal important information about the mice themselves irrespective of LDLR mediated binding of apoE. The two major conclusions of these separate studies are that lack of LDLR had no effect in the AD proce ss and that the lack of LDLR increased AD pathology and cognitive decline. In 2006, soon after these conflicting results were published, Tveten et. al. reported having identified two novel splice variants of LDLR (Tveten, et al., 2 006) One of

PAGE 215

203 them, the LDLR $ 4, was of interest to us because the knockout scheme for the LDLR / mouse used exon 4 as part of the knockout strategy. Specifically, Ishibashi et. al. inserted a neomycin cassette within exon 4; the cassette codes for a poly adenylation site at the 3' end of its sequence (Ishibashi, et al., 1993) As a result, transcription of the LDLR is incomplete, and generates a truncated LDLR that lacks its intra membranous sequence and therefore i t cannot be incorporated into a vesicle for transport to the plasma membrane. We hypothesized that exon 4 skipping during transcription would bypass the poly A site and continue transcribing exons 5 18. Indeed, after RT PCR analyses, we discovered that t he LDLR / mouse was capable of producing LDLR mRNA lacking the exon 4 sequence. We confirmed these results by sequencing the cDNA obtained from the mice. Quantification of LDLR $ 4 mRNA levels revealed transcriptional upregulation of the splice variant sugg estive of a compensatory mechanism. This finding is provocative as it discovers a phenomenon that poses an obstacle for the generation of transgenic, knockout mice. The next step was to determine if the splice variant generated a functional protein. Cons equently, we tested a total of 14 antibodies as a

PAGE 216

204 means of identifying LDLR $ 4 protein. In western blotting experiments, most antibodies detected many non specific bands, which made it difficult to confirm that a band located at the predicted molecular weig ht for LDLR $ 4 could in fact be this protein. Other antibodies were effective at detecting LDLR in liver, but fell short in brain homogenates, where western blots showed no bands. We suspect that the problem arises because the region coded by exon 4 is not immunogenic and LDLR expression is very low in the CNS. In 1987, Brown and Goldstein encountered similar problems in rabbits: "Several attempts to demonstrate the presence of LDL receptors in rabbit brain and spinal cord were unsuccessful because of the la ck of high affinity antibody that recognizes the rabbit LDL receptor and the large amounts of myelin that limited recovery of the membrane proteins" (Hofmann, Russell, Goldstein, & Brown, 1987) They turned to the bovine brain as a means to recover a larger fraction of membrane proteins and successfully detected LDLR. The difficulty of detecting LDLR in brain led us to try a proteomic approach. We tried to separate LDLR and LDLR $ 4 by runni ng brain and liver homogenates of both NTG and LDLR / mice on a gel and staining with Coomassie blue. We used mass spectroscopy and sequenced a total of 12 bands and were unable to detect either form of LDLR. We then enriched the amount of these LDLR/LDLR $ 4 by performing

PAGE 217

205 an immuno precipitation. Again, the data coincided with neither LDLR nor LDLR $ 4 sequences. Finally, since the isoelectric points of the full length LDLR and the predicted exon 4 lacking variant differ sufficiently (~4.7 to ~7.8) we separat ed them using 2D gels. We were fortunate to have received a polyclonal rabbit antibody from Dr. Joachim Herz (Russell, et al., 1984) This antibody gave clear bands from brain and liver samples of NTG mice in western blots at t he expected molecular weight of LDLR. Furthermore, in LDLR / brain microsomal protein preparations, the Herz antibody revealed bands at a slightly lower molecular weight for LDLR (shown in Chapter 2). We interpreted this result as the detection of LDLR $ 4. It is critical to note that the lack of a specific antibody for LDLR $ 4 limited the confirmation of the ability of the cell to make this protein. However, despite this caveat, we felt confident that the most likely explanation of the detection of this band was that it was the result of the upregulated transcription of the LDLR $ 4 mRNA. As a result, we performed the IHC experiments to characterize the location and function of LDLR $ 4 in LDLR / mice compared to the full length LDLR in NTG mice, as noted in cha pter 2. We communicated these results to Dr. Herz, who was of the opinion that the LDLR bands in LDLR / lanes are the result of non specific binding of the

PAGE 218

206 LDLR / antibody. Rather than creating an impasse, these opinions show the necessity of developing an antibody raised against an immunogenic region specific for LDLR $ 4. We attempted to induce these antibodies in BALB/c mice and rabbits, but the unique signature of the LDLR $ 4 is insufficient to generate an immune response, and therefore, our efforts were not fruitful. The abovementioned obstacles did not mar our investigations, as our subsequent data suggested that LDLR $ 4 might play a role in AD pathogenesis. We found that the transcription level of this LDLR isoform is increased two fold in amyloid rid den PSAPP mice. Because of the ability of this LDLR species to co localize with apoE, further work should focus on identifying the kinetics dictating the interaction between LDLR $ 4 and apoE. The predicted tertiary structure of the putative apoE binding reg ion on LDLR $ 4 strikingly resembled that on the full length counterpart. Also, it is possible that LDLR $ 4 may have other ligands, the identification of which will reveal important information about cholesterol metabolism in the CNS. Proteomic based screens could help answer these questions. However, it will be difficult to make significant progress in this aim until we can generate antibodies specific to LDLR $ 4.

PAGE 219

207 There is no direct evidence indicating that serum cholesterol crosses into the CNS (Dietschy & Turley, 2004) The logical suspicion that this might be the case is well founded: first, the suckling period, when dietary cholesterol is introduced to the organism for the first time, coincides with the highest cholesterol requirement for CNS growth and myelination (Dietschy & Turley, 2004) ; second, endothelial cells that make up the blood brain barrier express nuclear receptors that regulate the expression of cholesterol transporters like ABCA1 (ATP binding cassette A1) (Ohtsuki, et al., 2004; Panzenboeck, et al., 2002) ; finally, mRNA for LDLR is found in the brain (Hofmann, et al., 1987) Together, these observations support the notion t hat serum lipoproteins could enter the CNS. On the contrary, experimental data indicate that the CNS is largely independent from peripheral cholesterol metabolism. The availability of a mouse model that favors lipid removal from periphery selectively from the CNS would be very powerful for characterizing such differences. Furthermore, the onset of many neurodegenerative diseases such as vascular dementia, Niemann Pick's disorder, and AD are associated with cholesterol dysregulation. Thus, the LDLR / mouse becomes a powerful tool to study the differences between peripheral and CNS cholesterol metabolism, for instance, by crossing this mouse with other models of neurodegenerative diseases and documenting changes in

PAGE 220

208 the disease outcome. Inherently, LDLR $ 4 may be a key participant of these processes and would be characterized in subsequent research efforts. An important implication of these results is that alternative splicing must be taken into account when designing knock out and siRNA mechanisms. To our know ledge, the only other example of a related knockout escape by alternative splicing was described for the sorLA/ L R11 knock out mouse during the preparation of this work. The sorLA/LR11 knock out mouse also undergoes an identical splice mediated elusion of t he knock out scheme as we preliminarily reported in the LDLR / mice (Abisambra, et al., 2007; Dodson, et al., 2008) The results also implicate deletion of exon 4, the site where the new RNA cleavage and poly aden ylation site was introduced in the sorLA/LR11 / mouse. At the mRNA and protein level, the authors found similar results to ours, implying that this alternative splicing activity may be common in the LDLR family of proteins. Together, these results support the conclusion that exon skipping must be considered while targeting an exon for knock out mouse generation. More research to determine the normal function of splice variants of LDLR and SorLA/LR11 should prove valuable in determining if these shortened p roteins work independently or in concert

PAGE 221

209 with the cholesterol and apoE metabolism. Furthermore, search for other splicing motifs within gene families may shed light on unprecedented regulation of the functions of the products of such gene families. In the case of LDLR, the exon 4 splice variant may be expressed to eliminate ligand competition between apoB and apoE. If so, this phenomenon might be a more efficient pathway for apoE metabolism. Participation of other LDLR family members and their splice varian ts in cholesterol regulation remains to be determined. The second focus of my work is presented in chapter 3. Many studies approached the elucidation of links between LDLR and AD by modifying the former and documenting changes in the latter. To the contra ry, our strategy was to determine if the impact of APP/A overexpression would modify LDLR. This perspective would not only clarify details of apoE metabolism by LDLR, but also do so during APP/A promoted disease. We identified detrimental effects to mi crotubule organization by APP/A overexpression. Due to the critical functions of microtubules necessary for cell survival, we suspect that the impact of microtubule damage could participate in pathogenesis of AD. For example, changes in

PAGE 222

210 cell morphology du ring disease could be explained by APP/A induced damage to microtubules. Therefore, cytoarchitectural support would be compromised leading to the neuritic atrophy. Another example of microtubule dysfunction is that protein and vesicle trafficking could b e reduced or inhibited. The implications of microtubule damage in this scenario would depend on the particular protein or vesicle being affected at any point in time. In our studies, we found accumulation of LDLR in the TGN. Furthermore, its localization i n the plasma membrane was significantly reduced, which indirectly may have led to an attempted compensatory increase in its expression. Microtubule mediated dysfunction of the LDLR pathway could have severe implications for apoE metabolism, and thusly ch olesterol homeostasis. Presumably, depletion of LDLR from the plasma membrane may lead to decreased import of apoE and its lipid contents (including cholesterol). This would result in two opposing outcomes that can be viewed as an acute and chronic cellula r adaptation. Reduced cholesterol import inherently leads to low intracellular cholesterol levels. Consequently, SREBPs are cleaved from the Golgi

PAGE 223

211 apparatus and translocate into the nucleus for transcriptional activation of the cell machinery involved in both de novo cholesterol biosynthesis and increased production of cholesterol receptors. We find evidence for this effect with the detection of increased mRNA and LDLR protein levels. Other reports have suggested that certain regions of AD brains have inc reased levels of HMG CoA reductase, the rate limiting enzyme in the cholesterol biosynthetic pathway. Together, these data suggest that the cell has induced transcriptional activation of proteins responsible for increasing cholesterol production and import However, other apoE receptors like LRP 1, apoER2, and VLDLR follow the same transport as LDLR during low intracellular cholesterol conditions. Therefore, APP/A destabilization of microtubule dynamics appears to reduce or impedes apoE receptor transport to the plasma membrane. As a result, the only cholesterol available for the cell is that which is made de novo within itself. This single source would increase the time during which the cell reaches normal cholesterol levels. It would be interesting to see if slower adaptation to decreases in intracellular cholesterol can cause cellular stress, lipid peroxidation due to excess lipid concentration on membranes, or other byproducts that result in cell toxicity. This would be especially impactful for neurons, whose cholesterol requirement is very high.

PAGE 224

212 Also, cholesterol migration to and storage in membranes would inherently increase its rigidity and the formation of lipid rafts. APP anchoring within lipid rafts favors the and # secretase induced amyloidog enic pathway, whereas non raft APP is mainly cleaved by secretase. Animals fed high cholesterol diets show an increase in amyloid plaque formation in rabbits and in transgenic mouse models of AD (Howland, et al., 1 998; Shie, et al., 2002; Sparks, et al., 1994) ; moreover, in these mice, the high cholesterol diet induced cognitive decline (Thirumangalakudi, et al., 2008) In vitro studies showed that APP processing is highly d ependent upon availability of cellular cholesterol. Cholesterol depleted rat hippocampal primary neurons show reduced APP processing into A (Fassbender, et al., 2001; M. Simons, et al., 1998) yet favor the generati on of non amyloidogenic APP processing by secretase (Bodovitz & Klein, 1996; Kojro, et al., 2001) Therefore, increased A production could ensue, further feeding into deregulation of cholesterol import and prod uction. Chronically, it would be difficult to predict if the cell, particularly AD neurons, would have too high or too low cholesterol levels. Nonetheless, it would be safe to say that cholesterol homeostasis is altered. This may be especially

PAGE 225

213 detrimental for cells that require high cholesterol levels like neurons. Furthermore, it may well constitute one of the initial steps of neurodegeneration in AD. Other implications for APP/A mediated microtubule damage may be the release of tau. As a microtubule st abilizer, tau levels may increase due to the reduction or disorganization of microtubules. Consequently, free tau would be available for hyper phosphorylation and aggregation into tangles. It is not clear yet whether free tau becomes more hyper phosphoryla ted than microtubule bound tau, but the availability of phosphorylation sites on it are increased while not bound. Besides abnormal processing, A levels can also be augmented by increasing production of APP. Since the APP gene resides on chromosome 21, i ndividuals with trisomy 21 (resulting in Down's Syndrome DS) are subject to higher levels of APP, and thusly A By the fourth decade, these individuals develop signs of dementia, and their brains are heavily plaque ridden. Interestingly, the serum chole sterol and lipid profiles of these individuals are abnormal, yet they are protected against atherosclerosis. It would be interesting to assess whether LDLR turnover rates are changed in different tissues of individuals with trisomy 21.

PAGE 226

214 Careful follow up of these patients may reveal knowledge about the in vivo relationship of LDLR and APP overexpression. These potential studies could provide insights into the effects and mechanisms by which APP overexpression modulates of apoE metabolism. We show increased LDLR in APP transgenic mice and APP over expressing cells and a decreased LDLR in APP / mice. One mechanism for this appears to be decreased expression of the protein responsible for LDLR turnover, PCSK9. These observations suggest that, rather than a pr ecursor, DS and AD dyslipidemia is a consequence of AD like amyloid pathology induced by increased APP. The molecular mechanisms underlying these events remain unclear. The scope of our methods does not encompass enough data to confirm that these condition s are generalized to other models of APP over expression. Further analysis of tissues and serum lipid profiles from AD patients may reveal important insights into cholesterol induced pathogenesis. Regardless, careful evaluation of the mechanisms underlying APP processing as a factor of cholesterol levels may yield novel therapeutic targets. In this regard, PCSK9 inhibitors and activators as a means to manipulate LDLR may provide modulation of APP processing into A

PAGE 227

215 In conclusion, we provide further insigh t into the complicated system of cholesterol metabolism in the brain from the perspective of the LDLR. Furthermore, we do so on the basis of Alzheimer's, a condition where altered cholesterol levels have an unknown impact on the disease pathogenesis and/or progression. Nonetheless, and unexpectedly, our work culminates in further detailing a link between APP/A and abnormal microtubule formation.

PAGE 228

216 References Abboud, S., Karhunen, P. J., Lutjohann, D., Goebeler, S., Luoto T., Friedrichs, S., et al. (2007). Proprotein convertase subtilisin/kexin type 9 (PCSK9) gene is a risk factor of large vessel atherosclerosis stroke. PLoS ONE, 2 (10), e1043. Abifadel, M., Varret, M., Rabes, J. P., Allard, D., Ouguerram, K., Devillers, M ., et al. (2003). Mutations in PCSK9 cause autosomal dominant hypercholesterolemia. Nat Genet, 34 (2), 154 156. Abisambra, J. F., Padmanabhan, J., Wefes, I., Neame, P. J., & Potter, H. (2007). A low density lipoprotein receptor isoform lacking exon 4 is pre sent in low density lipoprotein receptor knock out mouse brain. Society for Neuroscience 2007 Meeting, ( ), Abraham, C. R., Selkoe, D. J., & Potter, H. (1988). Immunochemical identification of the serine protease inhibitor alpha 1 antichymotrypsin in the brain amyloid deposits of Alzheimer's disease. Cell, 52 (4), 487 501. Abramoff, M. D., Magelhaes, P.J., Ram, S.J. (2004). Image Processing with ImageJ. Biophotonics International, 11 (7), 36 42.

PAGE 229

217 Alafuzoff, I., Iqbal, K., Friden, H., Adolfsson, R., & Winblad B. (1987). Histopathological criteria for progressive dementia disorders: clinical pathological correlation and classification by multivariate data analysis. Acta Neuropathol, 74 (3), 209 225. Allard, D., Amsellem, S., Abifadel, M., Trillard, M., Deviller s, M., Luc, G., et al. (2005). Novel mutations of the PCSK9 gene cause variable phenotype of autosomal dominant hypercholesterolemia. Hum Mutat, 26 (5), 497. Allinson, T. M., Parkin, E. T., Turner, A. J., & Hooper, N. M. (2003). ADAMs family members as amyl oid precursor protein alpha secretases. J Neurosci Res, 74 (3), 342 352. Alonso, A. C., Grundke Iqbal, I., & Iqbal, K. (1996). Alzheimer's disease hyperphosphorylated tau sequesters normal tau into tangles of filaments and disassembles microtubules. Nat Med 2 (7), 783 787. Alonso, A. C., Zaidi, T., Grundke Iqbal, I., & Iqbal, K. (1994). Role of abnormally phosphorylated tau in the breakdown of microtubules in Alzheimer disease. Proc Natl Acad Sci U S A, 91 (12), 5562 5566. Ancolio, K., Dumanchin, C., Barelli, H., Warter, J. M., Brice, A., Campion, D., et al. (1999). Unusual phenotypic alteration of beta amyloid precursor protein (betaAPP) maturation by a new Val 715 -> Met betaAPP 770 mutation responsible for probable early onset

PAGE 230

218 Alzheimer's disease. Proc Nat l Acad Sci U S A, 96 (7), 4119 4124. Arnold, S. E., Joo, E., Martinoli, M. G., Roy, N., Trojanowski, J. Q., Gur, R. E., et al. (1997). Apolipoprotein E genotype in schizophrenia: frequency, age of onset, and neuropathologic features. Neuroreport, 8 (6), 1523 1526. Arriagada, P. V., Growdon, J. H., Hedley Whyte, E. T., & Hyman, B. T. (1992). Neurofibrillary tangles but not senile plaques parallel duration and severity of Alzheimer's disease. Neurology, 42 (3 Pt 1), 631 639. Association, A. s. (2008). 2008 Alzhe imer's disease facts and figures. Alzheimers Dement, 4 (2), 110 133. Bartus, R. T., Dean, R. L., 3rd, Beer, B., & Lippa, A. S. (1982). The cholinergic hypothesis of geriatric memory dysfunction. Science, 217 (4558), 408 414. Bennett, B. D., Babu Khan, S., Lo eloff, R., Louis, J. C., Curran, E., Citron, M., et al. (2000). Expression analysis of BACE2 in brain and peripheral tissues. J Biol Chem, 275 (27), 20647 20651. Berenson, G. S., Wattigney, W. A., Tracy, R. E., Newman, W. P., 3rd, Srinivasan, S. R., Webber, L. S., et al. (1992). Atherosclerosis of the aorta and coronary arteries and cardiovascular risk factors in persons aged 6 to 30 years and studied at necropsy (The Bogalusa

PAGE 231

219 Heart Study). Am J Cardiol, 70 (9), 851 858. Berge, K. E., Ose, L., & Leren, T. P. (2006). Missense mutations in the PCSK9 gene are associated with hypocholesterolemia and possibly increased response to statin therapy. Arterioscler Thromb Vasc Biol, 26 (5), 1094 1100. Bjorkhem, I., Andersson, U., Ellis, E., Alvelius, G., Ellegard, L., Dic zfalusy, U., et al. (2001). From brain to bile. Evidence that conjugation and omega hydroxylation are important for elimination of 24S hydroxycholesterol (cerebrosterol) in humans. J Biol Chem, 276 (40), 37004 37010. Bjorkhem, I., & Meaney, S. (2004). Brain cholesterol: long secret life behind a barrier. Arterioscler Thromb Vasc Biol, 24 (5), 806 815. Black, R. A., Rauch, C. T., Kozlosky, C. J., Peschon, J. J., Slack, J. L., Wolfson, M. F., et al. (1997). A metalloproteinase disintegrin that releases tumour n ecrosis factor alpha from cells. Nature, 385 (6618), 729 733. Blacker, D., Bertram, L., Saunders, A. J., Moscarillo, T. J., Albert, M. S., Wiener, H., et al. (2003). Results of a high resolution genome screen of 437 Alzheimer's disease families. Hum Mol Gen et, 12 (1), 23 32. Blum, C. B., Aron, L., & Sciacca, R. (1980). Radioimmunoassay studies of

PAGE 232

220 human apolipoprotein E. J Clin Invest, 66 (6), 1240 1250. Bodovitz, S., & Klein, W. L. (1996). Cholesterol modulates alpha secretase cleavage of amyloid precursor pro tein. J Biol Chem, 271 (8), 4436 4440. Bogdanovic, N., Bretillon, L., Lund, E. G., Diczfalusy, U., Lannfelt, L., Winblad, B., et al. (2001). On the turnover of brain cholesterol in patients with Alzheimer's disease. Abnormal induction of the cholesterol cat abolic enzyme CYP46 in glial cells. Neurosci Lett, 314 (1 2), 45 48. Bouillot, C., Prochiantz, A., Rougon, G., & Allinquant, B. (1996). Axonal amyloid precursor protein expressed by neurons in vitro is present in a membrane fraction with caveolae like prope rties. J Biol Chem, 271 (13), 7640 7644. Boyles, J. K., Pitas, R. E., Wilson, E., Mahley, R. W., & Taylor, J. M. (1985). Apolipoprotein E associated with astrocytic glia of the central nervous system and with nonmyelinating glia of the peripheral nervous sy stem. J Clin Invest, 76 (4), 1501 1513. Breen, K. C. (1992). APP collagen interaction is mediated by a heparin bridge mechanism. Mol Chem Neuropathol, 16 (1 2), 109 121. Brouillet, E., Trembleau, A., Galanaud, D., Volovitch, M., Bouillot, C., Valenza, C., et al. (1999). The amyloid precursor protein interacts

PAGE 233

221 with Go heterotrimeric protein within a cell compartment specialized in signal transduction. J Neurosci, 19 (5), 1717 1727. Brown, J., 3rd, Theisler, C., Silberman, S., Magnuson, D., Gottardi Littell, N., Lee, J. M., et al. (2004). Differential expression of cholesterol hydroxylases in Alzheimer's disease. J Biol Chem, 279 (33), 34674 34681. Brown, M. S., & Goldstein, J. L. (1986). A receptor mediated pathway for cholesterol homeostasis. Science, 232 (4746), 34 47. Buxbaum, J. D., Cullen, E. I., & Friedhoff, L. T. (2002). Pharmacological concentrations of the HMG CoA reductase inhibitor lovastatin decrease the formation of the Alzheimer beta amyloid peptide in vitro and in patients. Front Biosci, 7 a50 59. C ameron, J., Holla, O. L., Laerdahl, J. K., Kulseth, M. A., Ranheim, T., Rognes, T., et al. (2008). Characterization of novel mutations in the catalytic domain of the PCSK9 gene. J Intern Med, 263 (4), 420 431. Cao, D., Fukuchi, K., Wan, H., Kim, H., & Li, L (2006). Lack of LDL receptor aggravates learning deficits and amyloid deposits in Alzheimer transgenic mice. Neurobiol Aging, 27 (11), 1632 1643. Caporaso, G. L., Takei, K., Gandy, S. E., Matteoli, M., Mundigl, O., Greengard, P., et al. (1994). Morphologi c and biochemical analysis

PAGE 234

222 of the intracellular trafficking of the Alzheimer beta/A4 amyloid precursor protein. J Neurosci, 14 (5 Pt 2), 3122 3138. Chartier Harlin, M. C., Crawford, F., Houlden, H., Warren, A., Hughes, D., Fidani, L., et al. (1991). Early o nset Alzheimer's disease caused by mutations at codon 717 of the beta amyloid precursor protein gene. Nature, 353 (6347), 844 846. Chen, M., & Yankner, B. A. (1991). An antibody to beta amyloid and the amyloid precursor protein inhibits cell substratum adhe sion in many mammalian cell types. Neurosci Lett, 125 (2), 223 226. Chen, S. N., Ballantyne, C. M., Gotto, A. M., Jr., Tan, Y., Willerson, J. T., & Marian, A. J. (2005). A common PCSK9 haplotype, encompassing the E670G coding single nucleotide polymorphism, is a novel genetic marker for plasma low density lipoprotein cholesterol levels and severity of coronary atherosclerosis. J Am Coll Cardiol, 45 (10), 1611 1619. Chen, Z., Peto, R., Collins, R., MacMahon, S., Lu, J., & Li, W. (1991). Serum cholesterol conce ntration and coronary heart disease in population with low cholesterol concentrations. BMJ, 303 (6797), 276 282. Cheng, D., Huang, R., Lanham, I. S., Cathcart, H. M., Howard, M., Corder, E. H., et al. (2005). Functional interaction between APOE4

PAGE 235

223 and LDL rec eptor isoforms in Alzheimer's disease. J Med Genet, 42 (2), 129 131. Chobanian, A. V., & Hollander, W. (1962). Body cholesterol metabolism in man. I. The equilibration of serum and tissue cholesterol. J Clin Invest, 41 1732 1737. Cohen, J., Pertsemlidis, A ., Kotowski, I. K., Graham, R., Garcia, C. K., & Hobbs, H. H. (2005). Low LDL cholesterol in individuals of African descent resulting from frequent nonsense mutations in PCSK9. Nat Genet, 37 (2), 161 165. Connor, W. E., Cerqueira, M. T., Connor, R. W., Wall ace, R. B., Malinow, M. R., & Casdorph, H. R. (1978). The plasma lipids, lipoproteins, and diet of the Tarahumara indians of Mexico. Am J Clin Nutr, 31 (7), 1131 1142. Corder, E. H., Huang, R., Cathcart, H. M., Lanham, I. S., Parker, G. R., Cheng, D., et al (2006). Membership in genetic groups predicts Alzheimer disease. Rejuvenation Res, 9 (1), 89 93. Corder, E. H., Saunders, A. M., Strittmatter, W. J., Schmechel, D. E., Gaskell, P. C., Small, G. W., et al. (1993). Gene dose of apolipoprotein E type 4 allel e and the risk of Alzheimer's disease in late onset families. Science, 261 (5123), 921 923. Costa, D. A., Cracchiolo, J. R., Bachstetter, A. D., Hughes, T. F., Bales, K.

PAGE 236

224 R., Paul, S. M., et al. (2007). Enrichment improves cognition in AD mice by amyloid rel ated and unrelated mechanisms. Neurobiol Aging, 28 (6), 831 844. Costa, D. A., Nilsson, L. N., Bales, K. R., Paul, S. M., & Potter, H. (2004). Apolipoprotein is required for the formation of filamentous amyloid, but not for amorphous Abeta deposition, in an AbetaPP/PS double transgenic mouse model of Alzheimer's disease. J Alzheimers Dis, 6 (5), 509 514. Coyle, J. T., Price, D. L., & DeLong, M. R. (1983). Alzheimer's disease: a disorder of cortical cholinergic innervation. Science, 219 (4589), 1184 1190. Cruts M., Backhovens, H., Theuns, J., Clark, R. F., Le Paslier, D., Weissenbach, J., et al. (1995). Genetic and physical characterization of the early onset Alzheimer's disease AD3 locus on chromosome 14q24.3. Hum Mol Genet, 4 (8), 1355 1364. Davies, P., & Vert h, A. H. (1977). Regional distribution of muscarinic acetylcholine receptor in normal and Alzheimer's type dementia brains. Brain Res, 138 (2), 385 392. Davis, C. G., Elhammer, A., Russell, D. W., Schneider, W. J., Kornfeld, S., Brown, M. S., et al. (1986). Deletion of clustered O linked carbohydrates does not impair function of low density lipoprotein

PAGE 237

225 receptor in transfected fibroblasts. J Biol Chem, 261 (6), 2828 2838. Davis, C. G., Goldstein, J. L., Sudhof, T. C., Anderson, R. G., Russell, D. W., & Brown, M. S. (1987). Acid dependent ligand dissociation and recycling of LDL receptor mediated by growth factor homology region. Nature, 326 (6115), 760 765. Davis, C. G., van Driel, I. R., Russell, D. W., Brown, M. S., & Goldstein, J. L. (1987). The low density l ipoprotein receptor. Identification of amino acids in cytoplasmic domain required for rapid endocytosis. J Biol Chem, 262 (9), 4075 4082. Deane, R., Sagare, A., Hamm, K., Parisi, M., Lane, S., Finn, M. B., et al. (2008). apoE isoform specific disruption of amyloid beta peptide clearance from mouse brain. J Clin Invest, 118 (12), 4002 4013. Dickson, D. W., Farlo, J., Davies, P., Crystal, H., Fuld, P., & Yen, S. H. (1988). Alzheimer's disease. A double labeling immunohistochemical study of senile plaques. Am J Pathol, 132 (1), 86 101. Dietschy, J. M., Kita, T., Suckling, K. E., Goldstein, J. L., & Brown, M. S. (1983). Cholesterol synthesis in vivo and in vitro in the WHHL rabbit, an animal with defective low density lipoprotein receptors. J Lipid Res, 24 (4), 469 480.

PAGE 238

226 Dietschy, J. M., & Turley, S. D. (2004). Thematic review series: brain Lipids. Cholesterol metabolism in the central nervous system during early development and in the mature animal. J Lipid Res, 45 (8), 1375 1397. Dodson, S. E., Andersen, O. M., Karma li, V., Fritz, J. J., Cheng, D., Peng, J., et al. (2008). Loss of LR11/SORLA enhances early pathology in a mouse model of amyloidosis: evidence for a proximal role in Alzheimer's disease. J Neurosci, 28 (48), 12877 12886. Duff, K., Eckman, C., Zehr, C., Yu, X., Prada, C. M., Perez tur, J., et al. (1996). Increased amyloid beta42(43) in brains of mice expressing mutant presenilin 1. Nature, 383 (6602), 710 713. Dufouil, C., Richard, F., Fievet, N., Dartigues, J. F., Ritchie, K., Tzourio, C., et al. (2005). APO E genotype, cholesterol level, lipid lowering treatment, and dementia: the Three City Study. Neurology, 64 (9), 1531 1538. Eckman, C. B., Mehta, N. D., Crook, R., Perez tur, J., Prihar, G., Pfeiffer, E., et al. (1997). A new pathogenic mutation in the APP g ene (I716V) increases the relative proportion of A beta 42(43). Hum Mol Genet, 6 (12), 2087 2089. Edbauer, D., Winkler, E., Haass, C., & Steiner, H. (2002). Presenilin and nicastrin regulate each other and determine amyloid beta peptide

PAGE 239

227 production via compl ex formation. Proc Natl Acad Sci U S A, 99 (13), 8666 8671. Edmond, J., Korsak, R. A., Morrow, J. W., Torok Both, G., & Catlin, D. H. (1991). Dietary cholesterol and the origin of cholesterol in the brain of developing rats. J Nutr, 121 (9), 1323 1330. Elder G. A., Cho, J. Y., English, D. F., Franciosi, S., Schmeidler, J., Sosa, M. A., et al. (2007). Elevated plasma cholesterol does not affect brain Abeta in mice lacking the low density lipoprotein receptor. J Neurochem, 102 (4), 1220 1231. Elshourbagy, N. A. Liao, W. S., Mahley, R. W., & Taylor, J. M. (1985). Apolipoprotein E mRNA is abundant in the brain and adrenals, as well as in the liver, and is present in other peripheral tissues of rats and marmosets. Proc Natl Acad Sci U S A, 82 (1), 203 207. Engelber g, H. (1992). Low serum cholesterol and suicide. Lancet, 339 (8795), 727 729. Esser, V., Limbird, L. E., Brown, M. S., Goldstein, J. L., & Russell, D. W. (1988). Mutational analysis of the ligand binding domain of the low density lipoprotein receptor. J Bio l Chem, 263 (26), 13282 13290. Fagan, A. M., Holtzman, D. M., Munson, G., Mathur, T., Schneider, D., Chang, L. K., et al. (1999). Unique lipoproteins secreted by primary astrocytes from wild type, apoE ( / ), and human apoE transgenic

PAGE 240

228 mice. J Biol Chem, 274 (42), 30001 30007. Farzan, M., Schnitzler, C. E., Vasilieva, N., Leung, D., & Choe, H. (2000). BACE2, a beta secretase homolog, cleaves at the beta site and within the amyloid beta region of the amyloid beta precursor protein. Proc Natl Acad Sci U S A, 97 (17), 9712 9717. Fasano, T., Cefalu, A. B., Di Leo, E., Noto, D., Pollaccia, D., Bocchi, L., et al. (2007). A novel loss of function mutation of PCSK9 gene in white subjects with low plasma low density lipoprotein cholesterol. Arterioscler Thromb Vasc Biol 27 (3), 677 681. Fassbender, K., Simons, M., Bergmann, C., Stroick, M., Lutjohann, D., Keller, P., et al. (2001). Simvastatin strongly reduces levels of Alzheimer's disease beta amyloid peptides Abeta 42 and Abeta 40 in vitro and in vivo. Proc Natl Acad Sci U S A, 98 (10), 5856 5861. Fassbender, K., Stroick, M., Bertsch, T., Ragoschke, A., Kuehl, S., Walter, S., et al. (2002). Effects of statins on human cerebral cholesterol metabolism and secretion of Alzheimer amyloid peptide. Neurology, 59 (8), 1257 1258 Forsyth, D. R., Wilcock, G. K., Morgan, R. A., Truman, C. A., Ford, J. M., & Roberts, C. J. (1989). Pharmacokinetics of tacrine hydrochloride in Alzheimer's disease. Clin Pharmacol Ther, 46 (6), 634 641. Francis, R., McGrath, G., Zhang, J., Ruddy, D. A., Sym, M., Apfeld, J., et

PAGE 241

229 al. (2002). aph 1 and pen 2 are required for Notch pathway signaling, gamma secretase cleavage of betaAPP, and presenilin protein accumulation. Dev Cell, 3 (1), 85 97. Frears, E. R., Stephens, D. J., Walters, C. E., Davies, H., & Aus ten, B. M. (1999). The role of cholesterol in the biosynthesis of beta amyloid. Neuroreport, 10 (8), 1699 1705. Fryer, J. D., Demattos, R. B., McCormick, L. M., O'Dell, M. A., Spinner, M. L., Bales, K. R., et al. (2005). The low density lipoprotein receptor regulates the level of central nervous system human and murine apolipoprotein E but does not modify amyloid plaque pathology in PDAPP mice. J Biol Chem, 280 (27), 25754 25759. Fu, Q., Goodrum, J. F., Hayes, C., Hostettler, J. D., Toews, A. D., & Morell, P. (1998). Control of cholesterol biosynthesis in Schwann cells. J Neurochem, 71 (2), 549 555. Galbete, J. L., Martin, T. R., Peressini, E., Modena, P., Bianchi, R., & Forloni, G. (2000). Cholesterol decreases secretion of the secreted form of amyloid precurs or protein by interfering with glycosylation in the protein secretory pathway. Biochem J, 348 Pt 2 307 313. Games, D., Adams, D., Alessandrini, R., Barbour, R., Berthelette, P., Blackwell, C., et al. (1995). Alzheimer type neuropathology in transgenic mic e overexpressing V717F beta amyloid precursor

PAGE 242

230 protein. Nature, 373 (6514), 523 527. Gaykema, R. P., Nyakas, C., Horvath, E., Hersh, L. B., Majtenyi, C., & Luiten, P. G. (1992). Cholinergic fiber aberrations in nucleus basalis lesioned rat and Alzheimer's di sease. Neurobiol Aging, 13 (3), 441 448. Giacobini, E. (1997). From molecular structure to Alzheimer therapy. Jpn J Pharmacol, 74 (3), 225 241. Glenner, G. G., & Wong, C. W. (1984). Alzheimer's disease: initial report of the purification and characterization of a novel cerebrovascular amyloid protein. Biochem Biophys Res Commun, 120 (3), 885 890. Goate, A., Chartier Harlin, M. C., Mullan, M., Brown, J., Crawford, F., Fidani, L., et al. (1991). Segregation of a missense mutation in the amyloid precursor protein gene with familial Alzheimer's disease. Nature, 349 (6311), 704 706. Goedert, M., Spillantini, M. G., Jakes, R., Rutherford, D., & Crowther, R. A. (1989). Multiple isoforms of human microtubule associated protein tau: sequences and localization in neurofib rillary tangles of Alzheimer's disease. Neuron, 3 (4), 519 526. Goldstein, J. L., & Brown, M. S. (1976). The LDL pathway in human fibroblasts: a receptor mediated mechanism for the regulation of cholesterol metabolism. Curr Top Cell Regul, 11 147 181.

PAGE 243

231 Gold stein, J. L., Brown, M. S., Anderson, R. G., Russell, D. W., & Schneider, W. J. (1985). Receptor mediated endocytosis: concepts emerging from the LDL receptor system. Annu Rev Cell Biol, 1 1 39. Gong, C. X., Grundke Iqbal, I., & Iqbal, K. (1994). Dephosph orylation of Alzheimer's disease abnormally phosphorylated tau by protein phosphatase 2A. Neuroscience, 61 (4), 765 772. Gong, C. X., Singh, T. J., Grundke Iqbal, I., & Iqbal, K. (1993). Phosphoprotein phosphatase activities in Alzheimer disease brain. J Ne urochem, 61 (3), 921 927. Gopalraj, R. K., Zhu, H., Kelly, J. F., Mendiondo, M., Pulliam, J. F., Bennett, D. A., et al. (2005). Genetic association of low density lipoprotein receptor and Alzheimer's disease. Neurobiol Aging, 26 (1), 1 7. Gotz, J., Chen, F., van Dorpe, J., & Nitsch, R. M. (2001). Formation of neurofibrillary tangles in P301l tau transgenic mice induced by Abeta 42 fibrils. Science, 293 (5534), 1491 1495. Goutte, C., Tsunozaki, M., Hale, V. A., & Priess, J. R. (2002). APH 1 is a multipass membr ane protein essential for the Notch signaling pathway in Caenorhabditis elegans embryos. Proc Natl Acad Sci U S A, 99 (2), 775 779.

PAGE 244

232 Gray, C. W., & Patel, A. J. (1993). Regulation of beta amyloid precursor protein isoform mRNAs by transforming growth factor beta 1 and interleukin 1 beta in astrocytes. Brain Res Mol Brain Res, 19 (3), 251 256. Grundke Iqbal, I., Iqbal, K., Quinlan, M., Tung, Y. C., Zaidi, M. S., & Wisniewski, H. M. (1986). Microtubule associated protein tau. A component of Alzheimer paired heli cal filaments. J Biol Chem, 261 (13), 6084 6089. Haass, C., Koo, E. H., Mellon, A., Hung, A. Y., & Selkoe, D. J. (1992). Targeting of cell surface beta amyloid precursor protein to lysosomes: alternative processing into amyloid bearing fragments. Nature, 35 7 (6378), 500 503. Haass, C., & Steiner, H. (2002). Alzheimer disease gamma secretase: a complex story of GxGD type presenilin proteases. Trends Cell Biol, 12 (12), 556 562. Hardy, J. A., & Higgins, G. A. (1992). Alzheimer's disease: the amyloid cascade hypo thesis. Science, 256 (5054), 184 185. Hartley, D. M., Walsh, D. M., Ye, C. P., Diehl, T., Vasquez, S., Vassilev, P. M., et al. (1999). Protofibrillar intermediates of amyloid beta protein induce acute electrophysiological changes and progressive neurotoxici ty in cortical neurons. J Neurosci, 19 (20), 8876 8884.

PAGE 245

233 Hata, T., Kunugi, H., Nanko, S., Fukuda, R., & Kaminaga, T. (2002). Possible effect of the APOE epsilon 4 allele on the hippocampal volume and asymmetry in schizophrenia. Am J Med Genet, 114 (6), 641 64 2. Havel, R. J., & Kane, J. P. (1973). Primary dysbetalipoproteinemia: predominance of a specific apoprotein species in triglyceride rich lipoproteins. Proc Natl Acad Sci U S A, 70 (7), 2015 2019. Hayashi, H., Mizuno, T., Michikawa, M., Haass, C., & Yanagis awa, K. (2000). Amyloid precursor protein in unique cholesterol rich microdomains different from caveolae like domains. Biochim Biophys Acta, 1483 (1), 81 90. Hendriks, L., van Duijn, C. M., Cras, P., Cruts, M., Van Hul, W., van Harskamp, F., et al. (1992). Presenile dementia and cerebral haemorrhage linked to a mutation at codon 692 of the beta amyloid precursor protein gene. Nat Genet, 1 (3), 218 221. Herreman, A., Hartmann, D., Annaert, W., Saftig, P., Craessaerts, K., Serneels, L., et al. (1999). Presenil in 2 deficiency causes a mild pulmonary phenotype and no changes in amyloid precursor protein processing but enhances the embryonic lethal phenotype of presenilin 1 deficiency. Proc Natl Acad Sci U S A, 96 (21), 11872 11877.

PAGE 246

234 Heverin, M., Bogdanovic, N., Lut johann, D., Bayer, T., Pikuleva, I., Bretillon, L., et al. (2004). Changes in the levels of cerebral and extracerebral sterols in the brain of patients with Alzheimer's disease. J Lipid Res, 45 (1), 186 193. Hofman, A., Ott, A., Breteler, M. M., Bots, M. L. Slooter, A. J., van Harskamp, F., et al. (1997). Atherosclerosis, apolipoprotein E, and prevalence of dementia and Alzheimer's disease in the Rotterdam Study. Lancet, 349 (9046), 151 154. Hofmann, S. L., Russell, D. W., Goldstein, J. L., & Brown, M. S. (1 987). mRNA for low density lipoprotein receptor in brain and spinal cord of immature and mature rabbits. Proc Natl Acad Sci U S A, 84 (17), 6312 6316. Hooper, N. M. (2005). Roles of proteolysis and lipid rafts in the processing of the amyloid precursor prot ein and prion protein. Biochem Soc Trans, 33 (Pt 2), 335 338. Howland, D. S., Trusko, S. P., Savage, M. J., Reaume, A. G., Lang, D. M., Hirsch, J. D., et al. (1998). Modulation of secreted beta amyloid precursor protein and amyloid beta peptide in brain by cholesterol. J Biol Chem, 273 (26), 16576 16582. Hsia, A. Y., Masliah, E., McConlogue, L., Yu, G. Q., Tatsuno, G., Hu, K., et al. (1999). Plaque independent disruption of neural circuits in

PAGE 247

235 Alzheimer's disease mouse models. Proc Natl Acad Sci U S A, 96 (6), 3228 3233. Hu, Y., Ye, Y., & Fortini, M. E. (2002). Nicastrin is required for gamma secretase cleavage of the Drosophila Notch receptor. Dev Cell, 2 (1), 69 78. Innerarity, T. L., & Mahley, R. W. (1978). Enhanced binding by cultured human fibroblasts of apo E containing lipoproteins as compared with low density lipoproteins. Biochemistry, 17 (8), 1440 1447. Innerarity, T. L., Pitas, R. E., & Mahley, R. W. (1979). Binding of arginine rich (E) apoprotein after recombination with phospholipid vesicles to the low density lipoprotein receptors of fibroblasts. J Biol Chem, 254 (10), 4186 4190. Iqbal, K., Wisniewski, H. M., Shelanski, M. L., Brostoff, S., Liwnicz, B. H., & Terry, R. D. (1974). Protein changes in senile dementia. Brain Res, 77 (2), 337 343. Iqbal, K., Z aidi, T., Bancher, C., & Grundke Iqbal, I. (1994). Alzheimer paired helical filaments. Restoration of the biological activity by dephosphorylation. FEBS Lett, 349 (1), 104 108. Iribarren, C., Reed, D. M., Chen, R., Yano, K., & Dwyer, J. H. (1995). Low serum cholesterol and mortality. Which is the cause and which is the effect? Circulation, 92 (9), 2396 2403.

PAGE 248

236 Ishibashi, S., Brown, M. S., Goldstein, J. L., Gerard, R. D., Hammer, R. E., & Herz, J. (1993). Hypercholesterolemia in low density lipoprotein receptor knockout mice and its reversal by adenovirus mediated gene delivery. J Clin Invest, 92 (2), 883 893. Ishiguro, K., Shiratsuchi, A., Sato, S., Omori, A., Arioka, M., Kobayashi, S., et al. (1993). Glycogen synthase kinase 3 beta is identical to tau protein ki nase I generating several epitopes of paired helical filaments. FEBS Lett, 325 (3), 167 172. Jacobs, D. R., Jr. (1993). Why is low blood cholesterol associated with risk of nonatherosclerotic disease death? Annu Rev Public Health, 14 95 114. Jurevics, H., Bouldin, T. W., Toews, A. D., & Morell, P. (1998). Regenerating sciatic nerve does not utilize circulating cholesterol. Neurochem Res, 23 (3), 401 406. Jurevics, H., & Morell, P. (1995). Cholesterol for synthesis of myelin is made locally, not imported into brain. J Neurochem, 64 (2), 895 901. Jurevics, H. A., & Morell, P. (1994). Sources of cholesterol for kidney and nerve during development. J Lipid Res, 35 (1), 112 120. Kalback, W., Esh, C., Castano, E. M., Rahman, A., Kokjohn, T., Luehrs, D. C., et al. (20 04). Atherosclerosis, vascular amyloidosis and brain

PAGE 249

237 hypoperfusion in the pathogenesis of sporadic Alzheimer's disease. Neurol Res, 26 (5), 525 539. Kang, J., Lemaire, H. G., Unterbeck, A., Salbaum, J. M., Masters, C. L., Grzeschik, K. H., et al. (1987). Th e precursor of Alzheimer's disease amyloid A4 protein resembles a cell surface receptor. Nature, 325 (6106), 733 736. Katzman, R., Terry, R., DeTeresa, R., Brown, T., Davies, P., Fuld, P., et al. (1988). Clinical, pathological, and neurochemical changes in dementia: a subgroup with preserved mental status and numerous neocortical plaques. Ann Neurol, 23 (2), 138 144. Keys, A. (1975). Coronary heart disease -the global picture. Atherosclerosis, 22 (2), 149 192. Khatoon, S., Grundke Iqbal, I., & Iqbal, K. (1992) Brain levels of microtubule associated protein tau are elevated in Alzheimer's disease: a radioimmuno slot blot assay for nanograms of the protein. J Neurochem, 59 (2), 750 753. Khatoon, S., Grundke Iqbal, I., & Iqbal, K. (1994). Levels of normal and abno rmally phosphorylated tau in different cellular and regional compartments of Alzheimer disease and control brains. FEBS Lett, 351 (1), 80 84. Kidd, M. (1963). Paired helical filaments in electron microscopy of

PAGE 250

238 Alzheimer's disease. Nature, 197 192 193. Kira zov, L., Loffler, T., Schliebs, R., & Bigl, V. (1997). Glutamate stimulated secretion of amyloid precursor protein from cortical rat brain slices. Neurochem Int, 30 (6), 557 563. Kitaguchi, N., Takahashi, Y., Tokushima, Y., Shiojiri, S., & Ito, H. (1988). N ovel precursor of Alzheimer's disease amyloid protein shows protease inhibitory activity. Nature, 331 (6156), 530 532. Kojro, E., Gimpl, G., Lammich, S., Marz, W., & Fahrenholz, F. (2001). Low cholesterol stimulates the nonamyloidogenic pathway by its effec t on the alpha secretase ADAM 10. Proc Natl Acad Sci U S A, 98 (10), 5815 5820. Kosik, K. S., Joachim, C. L., & Selkoe, D. J. (1986). Microtubule associated protein tau (tau) is a major antigenic component of paired helical filaments in Alzheimer disease. Proc Natl Acad Sci U S A, 83 (11), 4044 4048. Kuo, Y. M., Emmerling, M. R., Bisgaier, C. L., Essenburg, A. D., Lampert, H. C., Drumm, D., et al. (1998). Elevated low density lipoprotein in Alzheimer's disease correlates with brain abeta 1 42 levels. Biochem Biophys Res Commun, 252 (3), 711 715. Lambert, M. P., Barlow, A. K., Chromy, B. A., Edwards, C., Freed, R., Liosatos, M., et al. (1998). Diffusible, nonfibrillar ligands derived

PAGE 251

239 from Abeta1 42 are potent central nervous system neurotoxins. Proc Natl Acad S ci U S A, 95 (11), 6448 6453. Lamsa, R., Helisalmi, S., Herukka, S. K., Tapiola, T., Pirttila, T., Vepsalainen, S., et al. (2008). Genetic study evaluating LDLR polymorphisms and Alzheimer's disease. Neurobiol Aging, 29 (6), 848 855. Lannfelt, L., Basun, H., Wahlund, L. O., Rowe, B. A., & Wagner, S. L. (1995). Decreased alpha secretase cleaved amyloid precursor protein as a diagnostic marker for Alzheimer's disease. Nat Med, 1 (8), 829 832. Lee, H. J., Jung, K. M., Huang, Y. Z., Bennett, L. B., Lee, J. S., Mei L., et al. (2002). Presenilin dependent gamma secretase like intramembrane cleavage of ErbB4. J Biol Chem, 277 (8), 6318 6323. Leem, J. Y., Vijayan, S., Han, P., Cai, D., Machura, M., Lopes, K. O., et al. (2002). Presenilin 1 is required for maturation an d cell surface accumulation of nicastrin. J Biol Chem, 277 (21), 19236 19240. Lehrman, M. A., Russell, D. W., Goldstein, J. L., & Brown, M. S. (1987). Alu Alu recombination deletes splice acceptor sites and produces secreted low density lipoprotein receptor in a subject with familial hypercholesterolemia. J Biol Chem, 262 (7), 3354 3361.

PAGE 252

240 Lehrman, M. A., Schneider, W. J., Sudhof, T. C., Brown, M. S., Goldstein, J. L., & Russell, D. W. (1985). Mutation in LDL receptor: Alu Alu recombination deletes exons encodi ng transmembrane and cytoplasmic domains. Science, 227 (4683), 140 146. Lemere, C. A., Blusztajn, J. K., Yamaguchi, H., Wisniewski, T., Saido, T. C., & Selkoe, D. J. (1996). Sequence of deposition of heterogeneous amyloid beta peptides and APO E in Down syn drome: implications for initial events in amyloid plaque formation. Neurobiol Dis, 3 (1), 16 32. Lendon, C. L., Talbot, C. J., Craddock, N. J., Han, S. W., Wragg, M., Morris, J. C., et al. (1997). Genetic association studies between dementia of the Alzheime r's type and three receptors for apolipoprotein E in a Caucasian population. Neurosci Lett, 222 (3), 187 190. Leren, T. P. (2004). Mutations in the PCSK9 gene in Norwegian subjects with autosomal dominant hypercholesterolemia. Clin Genet, 65 (5), 419 422. Le vin Allerhand, J. A., Lominska, C. E., & Smith, J. D. (2002). Increased amyloid levels in APPSWE transgenic mice treated chronically with a physiological high fat high cholesterol diet. J Nutr Health Aging, 6 (5), 315 319.

PAGE 253

241 Levy Lahad, E., Wasco, W., Poorka j, P., Romano, D. M., Oshima, J., Pettingell, W. H., et al. (1995). Candidate gene for the chromosome 1 familial Alzheimer's disease locus. Science, 269 (5226), 973 977. Lewis, J., Dickson, D. W., Lin, W. L., Chisholm, L., Corral, A., Jones, G., et al. (200 1). Enhanced neurofibrillary degeneration in transgenic mice expressing mutant tau and APP. Science, 293 (5534), 1487 1491. Lewis, L. A., Olmsted, F., Page, I. H., Lawry, E. Y., Mann, G. V., Stare, F. J., et al. (1957). Serum lipid levels in normal persons; findings of a cooperative study of lipoproteins and atherosclerosis. Circulation, 16 (2), 227 245. Li, B., Chohan, M. O., Grundke Iqbal, I., & Iqbal, K. (2007). Disruption of microtubule network by Alzheimer abnormally hyperphosphorylated tau. Acta Neuropa thol, 113 (5), 501 511. Li, H., Wetten, S., Li, L., St Jean, P. L., Upmanyu, R., Surh, L., et al. (2008). Candidate single nucleotide polymorphisms from a genomewide association study of Alzheimer disease. Arch Neurol, 65 (1), 45 53. Li, J., Ma, J., & Potter H. (1995). Identification and expression analysis of a potential familial Alzheimer disease gene on chromosome 1

PAGE 254

242 related to AD3. Proc Natl Acad Sci U S A, 92 (26), 12180 12184. Li, J., Xu, M., Zhou, H., Ma, J., & Potter, H. (1997). Alzheimer presenilins i n the nuclear membrane, interphase kinetochores, and centrosomes suggest a role in chromosome segregation. Cell, 90 (5), 917 927. Li, L., Cao, D., Garber, D. W., Kim, H., & Fukuchi, K. (2003). Association of aortic atherosclerosis with cerebral beta amyloid osis and learning deficits in a mouse model of Alzheimer's disease. Am J Pathol, 163 (6), 2155 2164. Li, X., & Greenwald, I. (1998). Additional evidence for an eight transmembrane domain topology for Caenorhabditis elegans and human presenilins. Proc Natl A cad Sci U S A, 95 (12), 7109 7114. Linton, M. F., Gish, R., Hubl, S. T., Butler, E., Esquivel, C., Bry, W. I., et al. (1991). Phenotypes of apolipoprotein B and apolipoprotein E after liver transplantation. J Clin Invest, 88 (1), 270 281. Liu, K., Doms, R. W ., & Lee, V. M. (2002). Glu11 site cleavage and N terminally truncated A beta production upon BACE overexpression. Biochemistry, 41 (9), 3128 3136. Lopez, D., Abisambra Socarras, J. F., Bedi, M., & Ness, G. C. (2007). Activation of the hepatic LDL receptor promoter by thyroid hormone. Biochim Biophys Acta, 1771 (9), 1216 1225.

PAGE 255

243 Lund, E. G., Guileyardo, J. M., & Russell, D. W. (1999). cDNA cloning of cholesterol 24 hydroxylase, a mediator of cholesterol homeostasis in the brain. Proc Natl Acad Sci U S A, 96 (13) 7238 7243. Lund, E. G., Xie, C., Kotti, T., Turley, S. D., Dietschy, J. M., & Russell, D. W. (2003). Knockout of the cholesterol 24 hydroxylase gene in mice reveals a brain specific mechanism of cholesterol turnover. J Biol Chem, 278 (25), 22980 22988. Lu tjohann, D., Breuer, O., Ahlborg, G., Nennesmo, I., Siden, A., Diczfalusy, U., et al. (1996). Cholesterol homeostasis in human brain: evidence for an age dependent flux of 24S hydroxycholesterol from the brain into the circulation. Proc Natl Acad Sci U S A 93 (18), 9799 9804. Ma, J., Yee, A., Brewer, H. B., Jr., Das, S., & Potter, H. (1994). Amyloid associated proteins alpha 1 antichymotrypsin and apolipoprotein E promote assembly of Alzheimer beta protein into filaments. Nature, 372 (6501), 92 94. Mackie, A ., Caslake, M. J., Packard, C. J., & Shepherd, J. (1981). Concentration and distribution of human plasma apolipoprotein E. Clin Chim Acta, 116 (1), 35 45. Mahley, R. W. (1988). Apolipoprotein E: cholesterol transport protein with expanding role in cell biol ogy. Science, 240 (4852), 622 630.

PAGE 256

244 Mahley, R. W., & Huang, Y. (1999). Apolipoprotein E: from atherosclerosis to Alzheimer's disease and beyond. Curr Opin Lipidol, 10 (3), 207 217. Mahley, R. W., & Rall, S. C., Jr. (2000). Apolipoprotein E: far more than a li pid transport protein. Annu Rev Genomics Hum Genet, 1 507 537. Mahley, R. W., Weisgraber, K. H., & Huang, Y. (2006). Apolipoprotein E4: a causative factor and therapeutic target in neuropathology, including Alzheimer's disease. Proc Natl Acad Sci U S A, 1 03 (15), 5644 5651. Maxwell, K. N., & Breslow, J. L. (2004). Adenoviral mediated expression of Pcsk9 in mice results in a low density lipoprotein receptor knockout phenotype. Proc Natl Acad Sci U S A, 101 (18), 7100 7105. Maxwell, K. N., Fisher, E. A., & Bre slow, J. L. (2005). Overexpression of PCSK9 accelerates the degradation of the LDLR in a post endoplasmic reticulum compartment. Proc Natl Acad Sci U S A, 102 (6), 2069 2074. McMurry, M. P., Cerqueira, M. T., Connor, S. L., & Connor, W. E. (1991). Changes i n lipid and lipoprotein levels and body weight in Tarahumara Indians after consumption of an affluent diet. N Engl J

PAGE 257

245 Med, 325 (24), 1704 1708. McMurry, M. P., Connor, W. E., Lin, D. S., Cerqueira, M. T., & Connor, S. L. (1985). The absorption of cholesterol and the sterol balance in the Tarahumara Indians of Mexico fed cholesterol free and high cholesterol diets. Am J Clin Nutr, 41 (6), 1289 1298. Medh, J. D., Fry, G. L., Bowen, S. L., Pladet, M. W., Strickland, D. K., & Chappell, D. A. (1995). The 39 kDa rec eptor associated protein modulates lipoprotein catabolism by binding to LDL receptors. J Biol Chem, 270 (2), 536 540. Mendez, J., Tejada, C., & Flores, M. (1962). Serum lipid levels among rural Guatemalan Indians. Am J Clin Nutr, 10 403 409. Merched, A., X ia, Y., Visvikis, S., Serot, J. M., & Siest, G. (2000). Decreased high density lipoprotein cholesterol and serum apolipoprotein AI concentrations are highly correlated with the severity of Alzheimer's disease. Neurobiol Aging, 21 (1), 27 30. Miyake, Y., Kim ura, R., Kokubo, Y., Okayama, A., Tomoike, H., Yamamura, T., et al. (2008). Genetic variants in PCSK9 in the Japanese population: rare genetic variants in PCSK9 might collectively contribute to plasma LDL cholesterol levels in the general population. Ather osclerosis, 196 (1), 29 36. Moss, M. L., Jin, S. L., Becherer, J. D., Bickett, D. M., Burkhart, W.,

PAGE 258

246 Chen, W. J., et al. (1997). Structural features and biochemical properties of TNF alpha converting enzyme (TACE). J Neuroimmunol, 72 (2), 127 129. Mucke, L., Masliah, E., Yu, G. Q., Mallory, M., Rockenstein, E. M., Tatsuno, G., et al. (2000). High level neuronal expression of abeta 1 42 in wild type human amyloid protein precursor transgenic mice: synaptotoxicity without plaque formation. J Neurosci, 20 (11), 40 50 4058. Muldoon, M. F., Manuck, S. B., & Matthews, K. A. (1990). Lowering cholesterol concentrations and mortality: a quantitative review of primary prevention trials. BMJ, 301 (6747), 309 314. Mullan, M., Crawford, F., Axelman, K., Houlden, H., Lilius, L. Winblad, B., et al. (1992). A pathogenic mutation for probable Alzheimer's disease in the APP gene at the N terminus of beta amyloid. Nat Genet, 1 (5), 345 347. Murdoch, J. C., Rodger, J. C., Rao, S. S., Fletcher, C. D., & Dunnigan, M. G. (1977). Down's s yndrome: an atheroma free model? Br Med J, 2 (6081), 226 228. Murrell, J., Farlow, M., Ghetti, B., & Benson, M. D. (1991). A mutation in the amyloid precursor protein associated with hereditary Alzheimer's disease. Science, 254 (5028), 97 99.

PAGE 259

247 Muse, E. D., Ju revics, H., Toews, A. D., Matsushima, G. K., & Morell, P. (2001). Parameters related to lipid metabolism as markers of myelination in mouse brain. J Neurochem, 76 (1), 77 86. Neff, D., Ruschitzka, F., Hersberger, M., Enseleit, F., Hurlimann, D., Noll, G., e t al. (2003). Detection of a novel exon 4 low density lipoprotein receptor gene deletion in a swiss family with severe familial hypercholesterolemia. Clin Chem Lab Med, 41 (3), 266 271. Ness, G. C., Sample, C. E., Smith, M., Pendleton, L. C., & Eichler, D. C. (1986). Characteristics of rat liver microsomal 3 hydroxy 3 methylglutaryl coenzyme A reductase. Biochem J, 233 (1), 167 172. Ni, C. Y., Murphy, M. P., Golde, T. E., & Carpenter, G. (2001). gamma Secretase cleavage and nuclear localization of ErbB 4 rec eptor tyrosine kinase. Science, 294 (5549), 2179 2181. Nilsson, L. N., Bales, K. R., DiCarlo, G., Gordon, M. N., Morgan, D., Paul, S. M., et al. (2001). Alpha 1 antichymotrypsin promotes beta sheet amyloid plaque deposition in a transgenic mouse model of Al zheimer's disease. J Neurosci, 21 (5), 1444 1451. Nitsch, R. M., Deng, A., Wurtman, R. J., & Growdon, J. H. (1997). Metabotropic glutamate receptor subtype mGluR1alpha stimulates the secretion of the amyloid beta protein precursor ectodomain. J

PAGE 260

248 Neurochem, 6 9 (2), 704 712. Nizzari, M., Venezia, V., Bianchini, P., Caorsi, V., Diaspro, A., Repetto, E., et al. (2007). Amyloid precursor protein and Presenilin 1 interaction studied by FRET in human H4 cells. Ann N Y Acad Sci, 1096 249 257. Notkola, I. L., Sulkava, R., Pekkanen, J., Erkinjuntti, T., Ehnholm, C., Kivinen, P., et al. (1998). Serum total cholesterol, apolipoprotein E epsilon 4 allele, and Alzheimer's disease. Neuroepidemiology, 17 (1), 14 20. Ohtsuki, S., Watanabe, Y., Hori, S., Suzuki, H., Bhongsatiern J., Fujiyoshi, M., et al. (2004). mRNA expression of the ATP binding cassette transporter subfamily A (ABCA) in rat and human brain capillary endothelial cells. Biol Pharm Bull, 27 (9), 1437 1440. Osono, Y., Woollett, L. A., Herz, J., & Dietschy, J. M. (1 995). Role of the low density lipoprotein receptor in the flux of cholesterol through the plasma and across the tissues of the mouse. J Clin Invest, 95 (3), 1124 1132. Ott, A., Stolk, R. P., Hofman, A., van Harskamp, F., Grobbee, D. E., & Breteler, M. M. (1 996). Association of diabetes mellitus and dementia: the Rotterdam Study. Diabetologia, 39 (11), 1392 1397. Padmanabhan, J., Levy, M., Dickson, D. W., & Potter, H. (2006). Alpha1

PAGE 261

249 antichymotrypsin, an inflammatory protein overexpressed in Alzheimer's disease brain, induces tau phosphorylation in neurons. Brain, 129 (Pt 11), 3020 3034. Panzenboeck, U., Balazs, Z., Sovic, A., Hrzenjak, A., Levak Frank, S., Wintersperger, A., et al. (2002). ABCA1 and scavenger receptor class B, type I, are modulators of reverse s terol transport at an in vitro blood brain barrier constituted of porcine brain capillary endothelial cells. J Biol Chem, 277 (45), 42781 42789. Papassotiropoulos, A., Lutjohann, D., Bagli, M., Locatelli, S., Jessen, F., Buschfort, R., et al. (2002). 24S hy droxycholesterol in cerebrospinal fluid is elevated in early stages of dementia. J Psychiatr Res, 36 (1), 27 32. Papassotiropoulos, A., Lutjohann, D., Bagli, M., Locatelli, S., Jessen, F., Rao, M. L., et al. (2000). Plasma 24S hydroxycholesterol: a peripher al indicator of neuronal degeneration and potential state marker for Alzheimer's disease. Neuroreport, 11 (9), 1959 1962. Papassotiropoulos, A., Wollmer, M. A., Tsolaki, M., Brunner, F., Molyva, D., Lutjohann, D., et al. (2005). A cluster of cholesterol rel ated genes confers susceptibility for Alzheimer's disease. J Clin Psychiatry, 66 (7), 940 947. Park, S. W., Moon, Y. A., & Horton, J. D. (2004). Post transcriptional

PAGE 262

250 regulation of low density lipoprotein receptor protein by proprotein convertase subtilisin/ kexin type 9a in mouse liver. J Biol Chem, 279 (48), 50630 50638. Peterson, B., Trell, E., & Sternby, N. H. (1981). Low cholesterol level as risk factor for noncoronary death in middle aged men. JAMA, 245 (20), 2056 2057. Pickar, D., Malhotra, A. K., Rooney, W., Breier, A., & Goldman, D. (1997). Apolipoprotein E epsilon 4 and clinical phenotype in schizophrenia. Lancet, 350 (9082), 930 931. Pitas, R. E., Boyles, J. K., Lee, S. H., Foss, D., & Mahley, R. W. (1987). Astrocytes synthesize apolipoprotein E and met abolize apolipoprotein E containing lipoproteins. Biochim Biophys Acta, 917 (1), 148 161. Pitas, R. E., Boyles, J. K., Lee, S. H., Hui, D., & Weisgraber, K. H. (1987). Lipoproteins and their receptors in the central nervous system. Characterization of the l ipoproteins in cerebrospinal fluid and identification of apolipoprotein B,E(LDL) receptors in the brain. J Biol Chem, 262 (29), 14352 14360. Potter, H., Wefes, I. M., & Nilsson, L. N. (2001). The inflammation induced pathological chaperones ACT and apo E ar e necessary catalysts of Alzheimer amyloid formation. Neurobiol Aging, 22 (6),

PAGE 263

251 923 930. Quan, G., Xie, C., Dietschy, J. M., & Turley, S. D. (2003). Ontogenesis and regulation of cholesterol metabolism in the central nervous system of the mouse. Brain Res De v Brain Res, 146 (1 2), 87 98. Rall, S. C., Jr., Weisgraber, K. H., & Mahley, R. W. (1982). Human apolipoprotein E. The complete amino acid sequence. J Biol Chem, 257 (8), 4171 4178. Rasband, W. S. (1997 2009). ImageJ, from http://rsb.info.nih.gov/ij/ Rea, T. D., Breitner, J. C., Psaty, B. M., Fitzpatrick, A. L., Lopez, O. L., Newman, A. B., et al. (2005). Statin use and the risk of incident dementia: the Cardiovascular Health Study. Arch Neurol, 62 (7), 1047 1051. Refolo, L. M., Malester, B., LaFrancois, J., Bryant Thomas, T., Wang, R., Tint, G. S., et al. (2000). Hypercholesterolemia accelerates the Alzheimer's amyloid pathology in a transgenic mouse model. Neurobiol Dis, 7 (4), 321 331. Reid, P. C., Urano, Y., Koda ma, T., & Hamakubo, T. (2007). Alzheimer's disease: cholesterol, membrane rafts, isoprenoids and statins. J Cell Mol Med, 11 (3), 383 392. Retz, W., Thome, J., Durany, N., Harsanyi, A., Retz Junginger, P., Kornhuber, J., et al. (2001). Potential genetic mar kers of sporadic

PAGE 264

252 Alzheimer's dementia. Psychiatr Genet, 11 (3), 115 122. Rodriguez, E., Mateo, I., Llorca, J., Sanchez Quintana, C., Infante, J., Berciano, J., et al. (2006). Genetic interaction between two apolipoprotein E receptors increases Alzheimer's d isease risk. J Neurol, 253 (6), 801 803. Rogaev, E. I., Sherrington, R., Rogaeva, E. A., Levesque, G., Ikeda, M., Liang, Y., et al. (1995). Familial Alzheimer's disease in kindreds with missense mutations in a gene on chromosome 1 related to the Alzheimer's disease type 3 gene. Nature, 376 (6543), 775 778. Rogers, S. L., Doody, R. S., Mohs, R. C., & Friedhoff, L. T. (1998). Donepezil improves cognition and global function in Alzheimer disease: a 15 week, double blind, placebo controlled study. Donepezil Study Group. Arch Intern Med, 158 (9), 1021 1031. Rohan de Silva, H. A., Jen, A., Wickenden, C., Jen, L. S., Wilkinson, S. L., & Patel, A. J. (1997). Cell specific expression of beta amyloid precursor protein isoform mRNAs and proteins in neurons and astrocytes. Brain Res Mol Brain Res, 47 (1 2), 147 156. Rubin, L. L., & Staddon, J. M. (1999). The cell biology of the blood brain barrier. Annu Rev Neurosci, 22 11 28. Rubinsztein, D. C., & Easton, D. F. (1999). Apolipoprotein E genetic variation and Alzheimer's dis ease. a meta analysis. Dement Geriatr

PAGE 265

253 Cogn Disord, 10 (3), 199 209. Rumble, B., Retallack, R., Hilbich, C., Simms, G., Multhaup, G., Martins, R., et al. (1989). Amyloid A4 protein and its precursor in Down's syndrome and Alzheimer's disease. N Engl J Med, 3 20 (22), 1446 1452. Russell, D. W., Brown, M. S., & Goldstein, J. L. (1989). Different combinations of cysteine rich repeats mediate binding of low density lipoprotein receptor to two different proteins. J Biol Chem, 264 (36), 21682 21688. Russell, D. W., Sc hneider, W. J., Yamamoto, T., Luskey, K. L., Brown, M. S., & Goldstein, J. L. (1984). Domain map of the LDL receptor: sequence homology with the epidermal growth factor precursor. Cell, 37 (2), 577 585. Sabo, S. L., Ikin, A. F., Buxbaum, J. D., & Greengard, P. (2001). The Alzheimer amyloid precursor protein (APP) and FE65, an APP binding protein, regulate cell movement. J Cell Biol, 153 (7), 1403 1414. Sakai, J., Duncan, E. A., Rawson, R. B., Hua, X., Brown, M. S., & Goldstein, J. L. (1996). Sterol regulated release of SREBP 2 from cell membranes requires two sequential cleavages, one within a transmembrane segment. Cell, 85 (7), 1037 1046.

PAGE 266

254 Salen, G., Shefer, S., Batta, A. K., Tint, G. S., Xu, G., & Honda, A. (1996). Abnormal cholesterol biosynthesis in sitoste rolaemia and the Smith Lemli Opitz syndrome. J Inherit Metab Dis, 19 (4), 391 400. Saunders, A. M., Strittmatter, W. J., Schmechel, D., George Hyslop, P. H., Pericak Vance, M. A., Joo, S. H., et al. (1993). Association of apolipoprotein E allele epsilon 4 w ith late onset familial and sporadic Alzheimer's disease. Neurology, 43 (8), 1467 1472. Scacchi, R., Gambina, G., Martini, M. C., Ruggeri, M., Ferrari, G., Silvestri, M., et al. (2001). Polymorphisms of the apolipoprotein E gene regulatory region and of the LDL receptor gene in late onset Alzheimer's disease in relation to the plasma lipidic pattern. Dement Geriatr Cogn Disord, 12 (2), 63 68. Scartezini, M., Hubbart, C., Whittall, R. A., Cooper, J. A., Neil, A. H., & Humphries, S. E. (2007). The PCSK9 gene R4 6L variant is associated with lower plasma lipid levels and cardiovascular risk in healthy U.K. men. Clin Sci (Lond), 113 (11), 435 441. Schoenberg, B. S., Kokmen, E., & Okazaki, H. (1987). Alzheimer's disease and other dementing illnesses in a defined Unit ed States population: incidence rates and clinical features. Ann Neurol, 22 (6), 724 729.

PAGE 267

255 Schonknecht, P., Lutjohann, D., Pantel, J., Bardenheuer, H., Hartmann, T., von Bergmann, K., et al. (2002). Cerebrospinal fluid 24S hydroxycholesterol is increased in patients with Alzheimer's disease compared to healthy controls. Neurosci Lett, 324 (1), 83 85. Schroeter, E. H., Kisslinger, J. A., & Kopan, R. (1998). Notch 1 signalling requires ligand induced proteolytic release of intracellular domain. Nature, 393 (6683) 382 386. Schubert, W., Prior, R., Weidemann, A., Dircksen, H., Multhaup, G., Masters, C. L., et al. (1991). Localization of Alzheimer beta A4 amyloid precursor protein at central and peripheral synaptic sites. Brain Res, 563 (1 2), 184 194. Sherrington, R ., Rogaev, E. I., Liang, Y., Rogaeva, E. A., Levesque, G., Ikeda, M., et al. (1995). Cloning of a gene bearing missense mutations in early onset familial Alzheimer's disease. Nature, 375 (6534), 754 760. Shie, F. S., Jin, L. W., Cook, D. G., Leverenz, J. B. & LeBoeuf, R. C. (2002). Diet induced hypercholesterolemia enhances brain A beta accumulation in transgenic mice. Neuroreport, 13 (4), 455 459. Shigematsu, K., McGeer, P. L., & McGeer, E. G. (1992). Localization of amyloid precursor protein in selective p ostsynaptic densities of rat cortical neurons. Brain Res, 592 (1 2), 353 357.

PAGE 268

256 Simons, K., & Ehehalt, R. (2002). Cholesterol, lipid rafts, and disease. J Clin Invest, 110 (5), 597 603. Simons, M., Keller, P., De Strooper, B., Beyreuther, K., Dotti, C. G., & S imons, K. (1998). Cholesterol depletion inhibits the generation of beta amyloid in hippocampal neurons. Proc Natl Acad Sci U S A, 95 (11), 6460 6464. Simons, M., Schwarzler, F., Lutjohann, D., von Bergmann, K., Beyreuther, K., Dichgans, J., et al. (2002). T reatment with simvastatin in normocholesterolemic patients with Alzheimer's disease: A 26 week randomized, placebo controlled, double blind trial. Ann Neurol, 52 (3), 346 350. Sinha, S., Anderson, J. P., Barbour, R., Basi, G. S., Caccavello, R., Davis, D., et al. (1999). Purification and cloning of amyloid precursor protein beta secretase from human brain. Nature, 402 (6761), 537 540. Sinnett, P. F., & Whyte, H. M. (1973). Epidemiological studies in a total highland population, Tukisenta, New Guinea. Cardiova scular disease and relevant clinical, electrocardiographic, radiological and biochemical findings. J Chronic Dis, 26 (5), 265 290. Sisodia, S. S. (1992). Beta amyloid precursor protein cleavage by a membrane bound protease. Proc Natl Acad Sci U S A, 89 (13),

PAGE 269

257 6075 6079. Sjogren, M., Gustafsson, K., Syversen, S., Olsson, A., Edman, A., Davidsson, P., et al. (2003). Treatment with simvastatin in patients with Alzheimer's disease lowers both alpha and beta cleaved amyloid precursor protein. Dement Geriatr Cogn D isord, 16 (1), 25 30. Skoog, I., Lernfelt, B., Landahl, S., Palmertz, B., Andreasson, L. A., Nilsson, L., et al. (1996). 15 year longitudinal study of blood pressure and dementia. Lancet, 347 (9009), 1141 1145. Small, D. M., & Shipley, G. G. (1974). Physical chemical basis of lipid deposition in atherosclerosis. Science, 185 (147), 222 229. Smith, J. R., Osborne, T. F., Goldstein, J. L., & Brown, M. S. (1990). Identification of nucleotides responsible for enhancer activity of sterol regulatory element in low d ensity lipoprotein receptor gene. J Biol Chem, 265 (4), 2306 2310. Soneira, C. F., & Scott, T. M. (1996). Severe cardiovascular disease and Alzheimer's disease: senile plaque formation in cortical areas. Clin Anat, 9 (2), 118 127. Soriano, P., Montgomery, C. Geske, R., & Bradley, A. (1991). Targeted disruption of the c src proto oncogene leads to osteopetrosis in mice. Cell, 64 (4), 693 702.

PAGE 270

258 Spady, D. K., & Dietschy, J. M. (1983). Sterol synthesis in vivo in 18 tissues of the squirrel monkey, guinea pig, rabb it, hamster, and rat. J Lipid Res, 24 (3), 303 315. Spady, D. K., Huettinger, M., Bilheimer, D. W., & Dietschy, J. M. (1987). Role of receptor independent low density lipoprotein transport in the maintenance of tissue cholesterol balance in the normal and W HHL rabbit. J Lipid Res, 28 (1), 32 41. Sparks, D. L., Connor, D. J., Browne, P. J., Lopez, J. E., & Sabbagh, M. N. (2002). HMG CoA reductase inhibitors (statins) in the treatment of Alzheimer's disease and why it would be ill advise to use one that crosses the blood brain barrier. J Nutr Health Aging, 6 (5), 324 331. Sparks, D. L., Hunsaker, J. C., 3rd, Scheff, S. W., Kryscio, R. J., Henson, J. L., & Markesbery, W. R. (1990). Cortical senile plaques in coronary artery disease, aging and Alzheimer's disease. Neurobiol Aging, 11 (6), 601 607. Sparks, D. L., Martins, R., & Martin, T. (2002). Cholesterol and cognition: rationale for the AD cholesterol lowering treatment trial and sex related Differences in beta amyloid accumulation in the brains of spontaneously h ypercholesterolemic Watanabe rabbits. Ann N Y Acad Sci, 977 356 366.

PAGE 271

259 Sparks, D. L., Scheff, S. W., Hunsaker, J. C., 3rd, Liu, H., Landers, T., & Gross, D. R. (1994). Induction of Alzheimer like beta amyloid immunoreactivity in the brains of rabbits with d ietary cholesterol. Exp Neurol, 126 (1), 88 94. Steiner, H., Kostka, M., Romig, H., Basset, G., Pesold, B., Hardy, J., et al. (2000). Glycine 384 is required for presenilin 1 function and is conserved in bacterial polytopic aspartyl proteases. Nat Cell Biol 2 (11), 848 851. Steiner, H., Winkler, E., Edbauer, D., Prokop, S., Basset, G., Yamasaki, A., et al. (2002). PEN 2 is an integral component of the gamma secretase complex required for coordinated expression of presenilin and nicastrin. J Biol Chem, 277 (42 ), 39062 39065. Stewart, P. A., & Hayakawa, E. M. (1987). Interendothelial junctional changes underlie the developmental 'tightening' of the blood brain barrier. Brain Res, 429 (2), 271 281. Strittmatter, W. J. (2001). Apolipoprotein E and Alzheimer's disea se: signal transduction mechanisms. Biochem Soc Symp (67), 101 109. Strittmatter, W. J., Saunders, A. M., Schmechel, D., Pericak Vance, M., Enghild, J., Salvesen, G. S., et al. (1993). Apolipoprotein E: high avidity binding to beta amyloid and increased fre quency of type 4 allele in late onset familial Alzheimer disease. Proc Natl Acad Sci U

PAGE 272

260 S A, 90 (5), 1977 1981. Sudhof, T. C., Goldstein, J. L., Brown, M. S., & Russell, D. W. (1985). The LDL receptor gene: a mosaic of exons shared with different proteins. S cience, 228 (4701), 815 822. Sudhof, T. C., Russell, D. W., Goldstein, J. L., Brown, M. S., Sanchez Pescador, R., & Bell, G. I. (1985). Cassette of eight exons shared by genes for LDL receptor and EGF precursor. Science, 228 (4701), 893 895. Sun, X. M., Eden E. R., Tosi, I., Neuwirth, C. K., Wile, D., Naoumova, R. P., et al. (2005). Evidence for effect of mutant PCSK9 on apolipoprotein B secretion as the cause of unusually severe dominant hypercholesterolaemia. Hum Mol Genet, 14 (9), 1161 1169. Tanaka, S., Na kamura, S., Ueda, K., Kameyama, M., Shiojiri, S., Takahashi, Y., et al. (1988). Three types of amyloid protein precursor mRNA in human brain: their differential expression in Alzheimer's disease. Biochem Biophys Res Commun, 157 (2), 472 479. Tanzi, R. E., & Parson, A. B. (2000). Decoding darkness : the search for the genetic causes of Alzheimer's disease Cambridge, Mass.: Perseus Pub.

PAGE 273

261 Tariot, P. N., Solomon, P. R., Morris, J. C., Kershaw, P., Lilienfeld, S., & Ding, C. (2000). A 5 month, randomized, placebo controlled trial of galantamine in AD. The Galantamine USA 10 Study Group. Neurology, 54 (12), 2269 2276. Thirumangalakudi, L., Prakasam, A., Zhang, R., Bimonte Nelson, H., Sambamurti, K., Kindy, M. S., et al. (2008). High cholesterol induced neuroinflamma tion and amyloid precursor protein processing correlate with loss of working memory in mice. J Neurochem, 106 (1), 475 485. Timms, K. M., Wagner, S., Samuels, M. E., Forbey, K., Goldfine, H., Jammulapati, S., et al. (2004). A mutation in PCSK9 causing autos omal dominant hypercholesterolemia in a Utah pedigree. Hum Genet, 114 (4), 349 353. Tolleshaug, H., Goldstein, J. L., Schneider, W. J., & Brown, M. S. (1982). Posttranslational processing of the LDL receptor and its genetic disruption in familial hyperchole sterolemia. Cell, 30 (3), 715 724. Tomimoto, H., Akiguchi, I., Wakita, H., Nakamura, S., & Kimura, J. (1995). Ultrastructural localization of amyloid protein precursor in the normal and postischemic gerbil brain. Brain Res, 672 (1 2), 187 195. Turley, S. D., Burns, D. K., Rosenfeld, C. R., & Dietschy, J. M. (1996).

PAGE 274

262 Brain does not utilize low density lipoprotein cholesterol during fetal and neonatal development in the sheep. J Lipid Res, 37 (9), 1953 1961. Tveten, K., Ranheim, T., Berge, K. E., Leren, T. P., & Kulseth, M. A. (2006). Analysis of alternatively spliced isoforms of human LDL receptor mRNA. Clin Chim Acta, 373 (1 2), 151 157. Van Nostrand, W. E., Wagner, S. L., Shankle, W. R., Farrow, J. S., Dick, M., Rozemuller, J. M., et al. (1992). Decreased levels of soluble amyloid beta protein precursor in cerebrospinal fluid of live Alzheimer disease patients. Proc Natl Acad Sci U S A, 89 (7), 2551 2555. Vassar, R., Bennett, B. D., Babu Khan, S., Kahn, S., Mendiaz, E. A., Denis, P., et al. (1999). Beta secretase cleavage of Alzheimer's amyloid precursor protein by the transmembrane aspartic protease BACE. Science, 286 (5440), 735 741. Walsh, D. M., Klyubin, I., Fadeeva, J. V., Cullen, W. K., Anwyl, R., Wolfe, M. S., et al. (2002). Naturally secreted oligomers of am yloid beta protein potently inhibit hippocampal long term potentiation in vivo. Nature, 416 (6880), 535 539. Watkins, P. B., Zimmerman, H. J., Knapp, M. J., Gracon, S. I., & Lewis, K. W. (1994). Hepatotoxic effects of tacrine administration in

PAGE 275

263 patients with Alzheimer's disease. JAMA, 271 (13), 992 998. Weihofen, A., & Martoglio, B. (2003). Intramembrane cleaving proteases: controlled liberation of proteins and bioactive peptides. Trends Cell Biol, 13 (2), 71 78. Weisgraber, K. H. (1994). Apolipoprotein E: stru cture function relationships. Adv Protein Chem, 45 249 302. Weisgraber, K. H., Rall, S. C., Jr., & Mahley, R. W. (1981). Human E apoprotein heterogeneity. Cysteine arginine interchanges in the amino acid sequence of the apo E isoforms. J Biol Chem, 256 (17 ), 9077 9083. Whyte, H. M., & Yee, I. L. (1958). Serum cholesterol levels of Australians and natives of New Guinea from birth to adulthood. Australas Ann Med, 7 (4), 336 339. Wijsman, E. M., Daw, E. W., Yu, C. E., Payami, H., Steinbart, E. J., Nochlin, D., et al. (2004). Evidence for a novel late onset Alzheimer disease locus on chromosome 19p13.2. Am J Hum Genet, 75 (3), 398 409. Wilson, J. D. (1970). The measurement of the exchangeable pools of cholesterol in the baboon. J Clin Invest, 49 (4), 655 665. Wisni ewski, K. E., Wisniewski, H. M., & Wen, G. Y. (1985). Occurrence of neuropathological changes and dementia of Alzheimer's disease in

PAGE 276

264 Down's syndrome. Ann Neurol, 17 (3), 278 282. Wisniewski, T., Castano, E. M., Golabek, A., Vogel, T., & Frangione, B. (1994) Acceleration of Alzheimer's fibril formation by apolipoprotein E in vitro. Am J Pathol, 145 (5), 1030 1035. Wisniewski, T., & Frangione, B. (1992). Apolipoprotein E: a pathological chaperone protein in patients with cerebral and systemic amyloid. Neurosci Lett, 135 (2), 235 238. Wolfe, M. S., Xia, W., Ostaszewski, B. L., Diehl, T. S., Kimberly, W. T., & Selkoe, D. J. (1999). Two transmembrane aspartates in presenilin 1 required for presenilin endoproteolysis and gamma secretase activity. Nature, 398 (6727), 513 517. Wolozin, B., Kellman, W., Ruosseau, P., Celesia, G. G., & Siegel, G. (2000). Decreased prevalence of Alzheimer disease associated with 3 hydroxy 3 methyglutaryl coenzyme A reductase inhibitors. Arch Neurol, 57 (10), 1439 1443. Xu, G., Servatius, R. J., Shefer, S., Tint, G. S., O'Brien, W. T., Batta, A. K., et al. (1998). Relationship between abnormal cholesterol synthesis and retarded learning in rats. Metabolism, 47 (7), 878 882. Xu, Q., Bernardo, A., Walker, D., Kanegawa, T., Mahley, R. W., & Huang Y. (2006). Profile and regulation of apolipoprotein E (ApoE)

PAGE 277

265 expression in the CNS in mice with targeting of green fluorescent protein gene to the ApoE locus. J Neurosci, 26 (19), 4985 4994. Yamamoto, T., Davis, C. G., Brown, M. S., Schneider, W. J., Case y, M. L., Goldstein, J. L., et al. (1984). The human LDL receptor: a cysteine rich protein with multiple Alu sequences in its mRNA. Cell, 39 (1), 27 38. Yan, R., Bienkowski, M. J., Shuck, M. E., Miao, H., Tory, M. C., Pauley, A. M., et al. (1999). Membrane anchored aspartyl protease with Alzheimer's disease beta secretase activity. Nature, 402 (6761), 533 537. Yla Herttuala, S., Luoma, J., Nikkari, T., & Kivimaki, T. (1989). Down's syndrome and atherosclerosis. Atherosclerosis, 76 (2 3), 269 272. Zamrini, E., McGwin, G., & Roseman, J. M. (2004). Association between statin use and Alzheimer's disease. Neuroepidemiology, 23 (1 2), 94 98. Zandi, P. P., Sparks, D. L., Khachaturian, A. S., Tschanz, J., Norton, M., Steinberg, M., et al. (2005). Do statins reduce risk of incident dementia and Alzheimer disease? The Cache County Study. Arch Gen Psychiatry, 62 (2), 217 224. Zannis, V. I., Just, P. W., & Breslow, J. L. (1981). Human apolipoprotein E isoprotein subclasses are genetically determined. Am J Hum

PAGE 278

266 Genet, 33 (1), 11 24. Zhao, Z., Tuakli Wosornu, Y., Lagace, T. A., Kinch, L., Grishin, N. V., Horton, J. D., et al. (2006). Molecular characterization of loss of function mutations in PCSK9 and identification of a compound heterozygote. Am J Hum Genet, 79 (3), 514 523. Zou, F., Gopalraj, R. K., Lok, J., Zhu, H., Ling, I. F., Simpson, J. F., et al. (2008). Sex dependent association of a common low density lipoprotein receptor polymorphism with RNA splicing efficiency in the brain and Alzheimer's disease. Hum Mol Genet, 17 (7), 929 935.

PAGE 279

267 Appendices

PAGE 280

268 APPENDIX A Activation of the Hepatic LDL Receptor by Thyroid Hormone This appendix was prepared by Dayami Lopez, Jose F. Abisambra Socarr‡s, Mohini Bedi, and Gene C. Ness A bstract The question of whether mature sterol regulatory element binding protein 2 (SREBP 2) is involved in the transcriptional activation of the hepatic low density lipoprotein (LDL) receptor by thyroid hormone was investigated. Western blotti ng analysis and electrophoretic mobility shift assays demonstrated that mature (nuclear) SREBP 2 protein could be detected in the nuclear extracts prepared from normal animals but not in extracts prepared from either hypophysectomized (Hx) or thyroparathyr oidectomized (Tx) rats two hypothyroid states. Treatment of Hx rats with T 3 restored LDL receptor mRNA levels in about 1 hr and caused a 6 fold increase 2.5 hrs after T 3 administration. No detectable mature SREBP 2 was seen in this time period despite a

PAGE 281

269 substantial reduction in serum cholesterol levels caused by T 3 treatment. The data indicate that SREBP 2 is not required for transcriptional activation of the LDL receptor by thyroid hormone suggesting a direct effect of this hormone on LDL receptor tra nscription.

PAGE 282

270 Introduction Hypothyroidism, in both humans and experimental animals, is well known to be accompanied by elevated levels of serum cholesterol, especially low density lipoprotein (LDL) cholesterol [1 6]. The effect can be re versed by thyroid hormone treatment [5 13]. This property of thyroid hormones has been extensively explored in the development of thyromimetics as possible anti cholesterolemic drugs [8, 14 16 ]. Several studies have established that the effects of thyroid hormone on serum cholesterol levels are due, at least in part, to alterations in expression of the hepatic LDL receptor [4, 13, 15, 17 21]. In hypophysectomized rats, for example, administration of thyroid hormone rapidly and significantly increases hepa tic LDL receptor mRNA and protein levels within 1 hour [18]. This enhancement in hepatic LDL receptor expression results from 4 to 5 fold increases in the rate of transcription that occurs 30 to 60 minutes after giving thyroid hormone [22]. Based on thi s, it is logical to assume that thyroid hormone influences the expression of this gene through a direct mechanism involving activation of its nuclear receptors (TRs).

PAGE 283

271 Independent of any direct effect that thyroid hormone may have via a TR, the possibili ty that induction of hepatic LDL receptors occurs as a consequence of reduction in cellular levels of cholesterol, a key factor in regulation of the LDL receptor [23 29], cannot be ignored. In the human LDL receptor gene, transcriptional regulation by cho lesterol requires a 10 base pair (bp) element, designated sterol response element 1 (SRE 1) [30]. SRE 1 is located in the center of two Sp1 binding sites [30]. In vivo all three elements, the SRE 1 and the two Sp1 sites, are necessary for high levels of transcription in the absence of sterols [30]. Putative SRE containing regions have been identified in the promoters of the rat [31], hamster [31], and mouse [32] LDL receptor genes. Transcriptional activation through an SRE is mediated by a gr oup of proteins known as sterol regulatory element binding proteins (SREBP 1a, 1c and 2) [33 40]. SREBPs are synthesized as 125 kDa precursors that are attached to the endoplasmic reticulum (ER) membrane and the nuclear envelope [41, 42]. Maturation of these transcription factors occurs through a proteolytic process that releases their NH 2 terminal (active) regions, which enter the nucleus, bind to a SRE, and activate transcription of a target gene [39, 41]. Sterol regulation of the

PAGE 284

272 proteolytic cleavag e resides in the formation of a complex between the SREBP precursor and another membrane bound protein called the SREBP cleavage activating protein (SCAP) [43]. Under high cholesterol levels, the SREBP/SCAP complex is retained in the ER preventing SREBP p rocessing [43]. Once the ER membrane becomes depleted of cholesterol, the SREBP/SCAP complex moves to the Golgi complex where proteolytic cleavage of SREBP occurs [43]. Although in cultured cells, the three SREBPs appear to act independently and in an ap parent redundant manner [44], in vivo studies clearly indicate that SREBP 1c is involved in the activation of fatty acid and glucose/insulin metabolism related genes, whereas SREBP 2 is more specific for genes involved in cholesterol metabolism such as the LDL receptor [43]. Thus, SREBP 2 could be considered a potential candidate to mediate thyroid hormone's effects on the LDL receptor gene. Interestingly, increases in mature SREBP 2 protein levels as a result of thyroid hormone treatment have been recent ly reported by Shin and Osborne [45]. In that study, changes in mature SREBP 2 protein levels seen in the presence of thyroid hormone directly correlated with changes in LDL receptor mRNA levels [45]. In view of these findings, we set out to determine wh ether an increase in mature SREBP 2 might precede or occur simultaneously and thus

PAGE 285

273 might mediate the increase in hepatic LDL receptor expression caused by thyroid hormone. No detectable mature SREBP 2 was found in the first 2.5 hrs following thyroid hormon e administration when hepatic LDL receptor mRNA was maximally induced. These data indicate that the rapid transcriptional activation of the rat hepatic LDL receptor by thyroid hormone is not dependent on mature (nuclear) SREBP 2 protein. This finding supp orts a mechanism involving a direct effect of thyroid hormone on the rat hepatic LDL receptor gene.

PAGE 286

274 Materials and Methods Animals Normal, hypophysectomized (Hx), and thyroparathyroidectomized (Tx) male Sprague Dawley rats weighing 125 to 1 50 g were purchased from Harlan Industries (Madison, WI). All protocols involving animals were approved by the University of South Florida IACUC Committee. Normal and Hx rats received regular water and Purina Rodent Laboratory Chow 5001 ad libitum The Tx animals were maintained on 2% (w/v) calcium gluconate as their drinking water and an iodine deficient diet (Harlan Industries). All animals were housed in a light controlled reversed cycle room with 12 hrs of light followed by 12 hrs of darkness Hx a nd Tx rats were used in experiments 10 to 21 days following surgery. The status of the Hx rats was confirmed by failure to gain weight, whereas the status of the Tx rats was confirmed by weight gains of one half the rate of normal rats. Some rats receive d an injection of triiodothyronine (T 3 ; Sigma Co., St. Louis, MO) subcutaneously at a dose of 10 g per 100 g of body weight, 1 to 2.5 hours before euthanatization. Rats were euthanatized at the fourth hour of the dark period by an isofluorane overdose. Liver portions were quickly removed

PAGE 287

275 for preparation of nuclear extracts and RNA. Serum samples were prepared from all the rats. Free T 3 levels in the serum of these animals were determined using an ELISA kit from Research Diagnostics, Inc. (Flanders, NJ) Serum cholesterol levels were determined using Infinity Reagent from Sigma Co., (St. Louis, Mo). Materials The BCA protein assay kit, pre cast 4 20% sodium dodecyl sulfate polyacrylamide gels (SDS PAGE), and the SuperSignal ULTRA Chemiluminescent S ubstrate were purchased from Pierce (Rockford, IL). Pre stained protein molecular weight markers and SYBR Green Real time PCR supermix were obtained from BioRad Labs (Hercules, CA). Nitrocellulose membrane and BioMax MR films were purchased from Fisher S cientific (Norcross, GA). Antibody specific for SREBP 2 and the horseradish peroxidase conjugated goat anti rabbit secondary antibody were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). The f ree T 3 ELISA kit was from Research Diagnostics, Inc. (Flanders, NJ). TR 1 specific antisera was purchased from Upstate Biotechnology Inc. (Lake Placid, NY) Oligonucleotides were synthesized by Integrated DNA Technologies (Coralville, IA). Klenow enzyme, restriction enzymes, and the Reverse Transcriptase System were purchased from Promega Corp (Madison, WI). [ 32 P]dCTP (3000 Ci/mmol) was obtained from Perkin

PAGE 288

276 Elmer/New England Nuclear (Wilmington, DE). TRI Reagent was obtained from Molecular Research Center (Cincinnati, OH). The Turbo DNA free Kit was pu rchased from Ambion. All other chemicals were obtained from Fisher Scientific or Sigma Chemical Co. (St. Louis, MO). Preparation of nuclear extracts Rat liver samples, 400 mg, were minced and homogenized in 10 ml of buffer A (15 mM Tris HCl, pH 7.5 ; 15 mM KCl, 15 mM mercaptoethanol, 2 mM EDTA, 0.5 mM EGTA, 0.15 mM spermine, 0.5 mM spermidine, 1.9 M sucrose, 0.1% Triton X 100 and 0.1 mM PMSF) using a motor driven serrated Teflon pestle in a 20 ml glass Potter Elvehjem homogenizer. The homogenate w as filtered through nylon gauze and layered over an equal volume of the same buffer lacking Triton X 100. Samples were centrifuged at 90,000 x g for 90 minutes at 4 ¡ C. The white nuclei pellet was resuspended in 1 ml of buffer B (15 mM Tris HCl, pH 7.5; 1 5 mM NaCl, 60 mM KCl, 15 mM mercaptoethanol, 0.15 mM spermine, 0.5 mM spermidine, 0.34 M sucrose and 0.1 mM PMSF) and centrifuged at 3,000 x g for 5 minutes at 4 ¡ C. The resulting pellet was resuspended in 1 ml of Buffer C (420 mM NaCl, 20 mM HEPES, pH 7 .9, 1 mM EDTA, 1 mM EGTA, 20 mM NaF, 1 mM Na 3 VO 4 1 mM Na 4 P 2 O 7 1 mM DTT and 0.5 mM PMSF) and incubated at 4 ¡ C for 30 minutes on a rotating wheel to extract nuclear protein. The

PAGE 289

277 mixture was then centrifuged for 15 minutes at 8,400 x g. Supernatants corre sponding to the nuclear extracts were aliquoted and stored at 70 ¡ C until used. Protein concentrations were determined using the BCA protein assay kit (Pierce). Western blotting analysis Ten g of liver nuclear protein were denatured at 100 o C in loadi ng buffer and subjected to electrophoresis on a pre cast 4 20% SDS PAGE. Pre stained molecular weight markers (Bio Rad Labs) were applied to one lane. After electrophoresis, samples were electroblotted onto nitrocellulose membranes (0.2 m pore) in buffe r containing 0.25 M Tris hydrochloride (Tris HCl; pH 8.3), 1.92 M glycine, and 20% (v/v) methanol for 16 hours at 4 o C. To verify equal protein loading, membranes were stained with 0.1% (v/v) Ponceau Solution in 5% (v/v) acetic acid (Sigma Co.) and destain ed in water. Blocking was performed in 5% (w/v) non fat dry milk in TTBS (10 mM Tris HCl pH 8.0, 150 mM NaCl, 0.01% Tween 20) for 30 min at room temperature. Western blotting analysis for SREBP 2 and TR 1 (control) proteins was carried out with a 1:1000 of rabbit polyclonal antibodies to SREBP 2 and TR 1, respectively, in TTBS supplemented with 2% (w/v) non fat dry milk and incubated overnight at 4 o C. Immunoreactive proteins were then visualized using a 1:10,000 dilution of horseradish

PAGE 290

278 peroxidase conjuga ted goat anti rabbit antisera (Santa Cruz Biotechnology) in TTBS supplemented with 2% (w/v) non fat dry milk and the SuperSignal ULTRA Chemiluminescent Substrate method (Pierce). Washes after each antibody (six total) were performed with TTBS supplemented with 0.5% (w/v) non fat dry milk. Multiple exposures ranging from 5 seconds to 20 minutes were made. Electrophoretic mobility shift assays Electrophoretic mobility shift assays were performed as previously described [46] except that binding reaction s were carried out at room temperature for 30 minutes. Complementary oligonucleotides containing the rat LDL receptor SRE motif located at bp 242 to 234 were synthesized and labeled using [ 32 P] dCTP and the Klenow polymerase fill in reaction with oligo nucleotide pairs constructed to provide overhangs. The sequence of one strand of the complementary oligonucleotide probe was 5' TTTTTGAAAATCACCCCACTGCAGACTCCT 3'. Binding reactions were carried out in 20 l volumes with the indicated proteins and 25 fmol of labeled probe. SREBP 2 specific antibody was added as indicated. The samples were run on 6% acrylamide/bisacrylamide gels. Gels were then vacuum dried and exposed to X ray films at 80 o C for 12 24 hours.

PAGE 291

279 Real time Reverse transcriptase PCR Total hepatic RNA was isolated using the guanidinium thiocyanate phenol chloroform extraction method employing TRI Reagent (Molecular Research Center). This method consistently yields 5 8 g of RNA per mg of tissue. Fifty g of total RNA was first DNase I trea ted using the Turbo DNA free kit (Ambion). After inactivation of the DNase I enzyme, 1 g of the DNA free RNA was reverse transcribed using Promega's Reverse transcriptase system and random primers as per the manufacturer's instructions. Real time PCR re actions were performed using 100 ng of ssDNA, the BioRad SYBR Green real time RT PCR kit, and the iCycler real time PCR system. Rat LDL receptor specific primers used were 5' GGGCTGGCGGTAGACTGGATC 3' (sense) and 5' CAATCTGTCCAGTACATGAAGC 3' (antisense). The size of the LDL receptor fragment that is amplified using these primers is 200 bp. Primers specific for 18S (5' GTAACCCGTTGAACCCCATT 3' and 5' CCATCCAATCGGTAGTAGCG 3') were used as the internal control for these studies. The parameters for the PCR re actions were denaturation at 95 ¡ C for 3 minutes, followed by 39 cycles of denaturation at 95 ¡ C for 30 seconds, annealing at 63 ¡ C for 30 seconds, and extension at 72 ¡ C for 30 seconds. The melt curve was performed starting at 55 o C with increases of 0.5 o C ev ery 30 seconds for 80 repeats ending at 95 o C. Quantitation of the results was performed using the Comparative CT

PAGE 292

280 method.

PAGE 293

281 Results and Discussion To examine whether levels of mature (nuclear) SREBP 2 protein in liver correlate with se rum levels of thyroid hormone, liver nuclear extracts and serum samples were prepared from normal, hypophysectomized (Hx) and thyroparathyroidectomized (Tx) rats. Western blotting analysis for mature SREBP 2 protein and measurements of free T 3 levels in t he serum were performed as described in Material and methods. As shown in Fig. 1, SREBP 2 protein was detected in nuclear extracts prepared from normal animals but not in nuclear extracts prepared from either Hx or Tx rats. F ree T 3 levels for the normal and Hx rats were 4.35 and 1.75 pg/dl, respectively, whereas Tx rats' free T 3 levels were too low to be determined (Fig. 1). Changes in SREBP 2 levels appear to be specific for this protein, since control Western blots obtained using a thyroid hormone rec eptor 1 (TR 1) specific antibody demonstrated that TR 1 levels were unaffected under the same conditions (Fig. 1). To further assess the presence of mature SREBP 2 protein in the

PAGE 294

282 normal, Hx and Tx nuclear extracts, electrophoretic mobility shift assa ys were carried out using the rat LDL receptor SRE motif located at bp 242 within the promoter region of this gene (GenBank accession number AY675581). As shown in Fig. 2A, formation of a DNA/protein complex between liver nuclear extracts and the SRE pro be was observed in the presence of extracts from normal (N; lanes 2 4) but not from Tx (lanes 5 8) or Hx (lanes 9 11) rats. Although these results are in complete agreement with the Western blot data presented in Fig. 1, it was still necessary to determin e whether SREBP 2 was part of the DNA protein complex observed using the normal samples. To examine this, electrophoretic mobility shift assays were performed in the presence of a SREBP 2 specific antibody. As shown in Fig. 2B (lane 4), the addition of S REBP 2 antibody (5 g IgG) to the binding reactions was able to reduce DNA protein complex formation between normal liver nuclear extracts and the rat LDL receptor SRE motif. Once again, no binding between Tx nuclear extracts and the SRE motif was observe d (Fig. 2B, lanes 3 and 5). Participation of SREBP 2 in the thyroid hormone dependent regulation of the LDL receptor gene was originally suggested by Shin and Osborne [45]. In that report, it was demonstrated that the SREBP 2 gene is

PAGE 295

283 regulated by thyroid hormone mainly at the transcriptional level via binding and activation of a putative DR 4 TRE site located in the SREBP 2 promoter [45]. This resulted in increases in mature SREBP 2 protein levels with comparable increases in LDL receptor mRNA [45]. How ever, considering the rapid time course (30 to 60 minutes) for the T 3 mediated activation of LDL receptor transcription [22], it is logical to assume that if SREBP 2 is responsible for the changes seen in hepatic LDL receptor expression under these conditi ons, an increase in mature SREBP 2 protein levels should precede or occur simultaneously with the enhancement in LDL receptor transcription. To examine this possibility, Hx rats were injected subcutaneously with 10 g of T 3 per 100 g of body weight, 1 to 2.5 hours before euthanatization. Hepatic nuclear extract preparation and Western blotting analysis for mature SREBP 2 protein were performed as described in Fig. 1. Surprisingly, no mature SREBP 2 protein was detected in any of the nuclear extracts prep ared from the Hx animals even at 2.5 hours after T 3 injection (Fig. 3). Hepatic LDL receptor mRNA levels were returned to near normal 1 hr after T 3 administration. At 2.5 hrs after T 3 treatment hepatic LDL receptor mRNA levels were increased 6 fold over those of the Hx animals (Fig. 3). Serum cholesterol levels were substantially decreased by T 3 treatment to levels below those of the normal (Fig. 3). This data clearly indicates that

PAGE 296

2 84 SREBP 2 is not required for transcriptional activation of the hepatic L DL receptor after thyroid hormone treatment. In the studies by Shin and Osborne [45] hypothyroid mice were treated daily for 4 days with 100 %g of T 3 per 100 g of body weight. This dose of T 3 is much higher than that used in the present study. In the pr eviously reported study [45] any rapid effect of thyroid hormone on hepatic LDL receptor mRNA would have been overlooked. It is well established that T 3 acts to quickly increase transcription of the hepatic LDL receptor gene [4, 18, 22]. The data presen ted in this report demonstrate that mature SREBP 2 is not required for transcriptional activation of the rat LDL receptor by thyroid hormone These findings support a mechanism involving a primary effect of thyroid hormone on the LDL receptor gene via act ivation of the TRs. In fact, we have identified two promoter regions located at 614 and 156, relative to the translation start site, that specifically bind to recombinant TR 1 (unpublished observations). Furthermore, studies using the human gene have s uggested the presence of functional TREs between 687 and 160 bp upstream of the ATG translation start site [51].

PAGE 297

285 Acknowledgements This investigation was supported in part by grant 04 TSP 03 provided by the Florida Department of Health (GCN) and Grant # 0555334B from the American Heart Association Florida Affiliate (DL).

PAGE 298

286 Figures Fig. 1. Effects of hypophysectomy and thyroparathyroidectomy on mature sterol regulatory element binding protein 2 (SREBP 2) levels in rat liver. Liver nuclear extracts, 10 g each, from normal, hypophysectomized (Hx), and thyroparathyroidectomized (Tx) rats were subjected to Western blotting analysis for mature SREBP 2 protein. Free T 3 levels in serum samples were determined as described under Ma terials and methods. "UD" refers to T 3 levels too low to be determined. The blots were also probed with TR 1 specific antibody. Molecular weight markers were applied to one lane. A representative Western blot is presented. Similar results were obtaine d in four separate experiments.

PAGE 299

287

PAGE 300

288 Fig. 2. Electrophoretic mobility shift assays depicting binding of rat liver nuclear extracts to the rat LDL receptor SRE motif. 32 P labeled rat LDL receptor SRE (Rat LDLR SRE) probe was incubate d with 10 g of the indicated liver nuclear extract as described in Materials and methods. Representative electrophoretic mobility shift assay autoradiographs are shown. "P" refers to a binding reaction performed in the presence of probe only. The posit ion of the SRE/protein complex in each autoradiograph has been indicated by an arrow. A. Binding of normal (N) but not of the thyroparathyroidectomized (Tx) and hypophysectomized (Hx) extracts to the SRE. B. SREBP 2 specific antibody (5 g IgG) reduces the complex formation between the normal liver nuclear extracts (N) and the rat LDL receptor SRE.

PAGE 301

289

PAGE 302

290 Fig. 3. Effects of triiodothyronine (T 3 ) treatment on mature SREBP 2 protein and LDL receptor mRNA levels in rat liver. Liver nuclear extra cts and total RNA from normal and Hx rats treated with T 3 for the indicated times were analyzed by Western blotting analysis and real time RT PCR for mature SREBP 2 and LDL receptor mRNA respectively. A representative Western blot is presented. Similar r esults were obtained in three separate experiments. The data from the real time RT PCR are represented as mean relative LDL receptor mRNA levels where the value of LDL receptor mRNA for the normal sample was set to 1.0. Serum levels of free T 3 are presen ted in terms of pg/dl. Serum cholesterol values in mg/dl for each rat are also presented.

PAGE 303

291

PAGE 304

292 References [1] B.G. Brown, Contemporary Insights, Cholesterol metabolism and its regulation, 2003. [2] K.W. Walton, D.A. Campbell, E.L. To nks, The significance of alterations in serum lipids in thyroid dysfunction, I. The relation between serum lipoproteins, carotenoids and vitamin A in hypothyroidism and thyrotoxicosis, Clin. Sci. 29 (1965) 199 215. [3] D. Illingworth, M.R. McClung, W.E. C onner, P. Alaupovic, Familial hypercholesterolaemia and primary hypothyroidism: Coexistence of both disorders in a young woman with severe hypercholesterolaemia, Clin. Endocrinol. 14 (1981) 145 152. [4] G.C. Ness, L.C. Pendleton, Y.C. Li, J.Y.L. Chiang, Ef fect of thyroid hormone on hepatic cholesterol 7 hydroxylase, LDL receptor, HMG CoA reductase, Farnesyl Pyrophosphate Synthase and Apolipoprotein A I mRNA levels in hypophysectomized rats, Biochem. Biophys. Res. Commun. 172 (1990) 1150 1156. [5] A.R. Capp ola, P.W. Ladenson, Hypothyroidism and Atherosclerosis, J. Clin. Endocrinol. Metab. 88 (2003) 2438 2444. [6] P. Hansson, S. Valdemarsson, P. Nilsson Ehle, Experimental hyperthyroidism in man. Effects on plasma lipoproteins, lipoprotein lipase and hepatic lipase, Horm. Metab. Res. 15 (1983) 449 452. [7] G.C. Ness, Thyroid hormone: basis for its hypocholesterolemic effect, J. Fla. Med. Assoc. 78 (1991) 383 385. [8] A.H. Underwood, J.C. Emmett, D. Ellis, S. Flynn, B. Leeson, G.M. Benson, R. Novelli, N.J. Pear ce, V.P. Shaw, A thyromimetics that

PAGE 305

293 decreases plasma cholesterol levels without increasing cardiac activity, Nature 324 (1986) 425 429. [9] Z.F. Stephan, E.C. Yurachek, R. Sharif, J.M. Wasvary, R.E. Steele, C. Howes, Reduction of cardiovascular and thyroxi ne suppressing activities of L T 3 by liver targeting with cholic acid, Biochem. Pharmacol. 43 (1992) 1969 1974. [10] R.E. Steele, J.M. Wasvary, B.N. Dardik, C.D. Schwarzkopf, R. Sharif, K.S. Leonards, C.W. Hu, E.C. Yuracheck, Z.F. Stephan, CGS 26214, the t hyroxine connection revisited. In: Atherosclerosis X (Ed: Woodford FP, Davignon J, & Sniderman A; Elsevier, New York), pp. 321 324, 1995. [11] S.F. Engelken, R.P. Eaton, The effects of altered thyroid status on lipid metabolism in the genetic hyperlipemic Zucker rat, Atherosclerosis 38 (1981) 177 188. [12] M. Aviram, R. Luboshitzky, J.G. Brook, Lipid and lipoprotein patterns in thyroid dysfunction and the effect of therapy, Clin. Biochem. 15 (1982) 62 66. [13] G.R. Thompson, A.K. Soutar, F.A. Spengel, A. J adhav, S.J.P. Gavigan, N.B. Myant, Defects of receptor mediated low density lipoprotein catabolism in homozygous familial hypercholesterolemia and hypothyroidism in vivo Proc. Natl. Acad. Sci. USA 78 (1981) 2591 2595. [14] P.D. Leeson, J.C. Emmett, V.P. Shah, G.A. Showell, R. Novelli, H.D. Prain, M.G. Benson, D. Ellis, N.J. Pearce, A.H. Underwood, Selective thyromimetics. Cardiac sparing thyroid hormone analogues containing 3' arylmethyl substituents, J. Med. Chem. 32 (1989) 320 336. [15] K.W. Walton, P.J Scott, P.W. Dykes, J.W.L. Davies, The significance

PAGE 306

294 of alterations in serum lipids in thyroid dysfunction, II. Alterations of the metabolism and turnover of 131 I low density lipoproteins in hypothyroidism and thyrotoxicosis, Clin. Sci. 29 (1965) 217 238. [16] E. Morkin, P. Ladenson, S. Goldman, C. Adamson, Thyroid hormone analogs for treatment of hypercholesterolemia and heart failure: past, present and future prospects, J. Mol. Cell. Cardiol. 37 (2004) 1137 1146. [17] A.M. Salter, R. Hayashi, M. Al Seeni N.F. Brown, J. Bruce, O. Sorensen, A. Atkinson, B. Middleton, R.C. Bleackley, D.N. Brindley, Effects of hypothyroidism and high fat feeding on mRNA concentrations for the low density lipoprotein receptor and on acyl CoA:cholesterol acyltransferase activi ties in rat liver, Biochem. J. 276 (1991) 825 832. [18] G.C. Ness, Z. Zhao, Thyroid hormone rapidly induces hepatic LDL receptor mRNA levels in hypophysectomized rats, Arch. Biochem. Biophys. 315 (1994) 199 202. [19] B. Staels, A. Van Tol, L. Chan, H. Wil l, G. Verhoeven, J. Auwerx, Alterations in thyroid status modulate apolipoprotein, hepatic triglyceride lipase, and low density lipoprotein receptor in rats, Endocrinology 127 (1990) 1144 1152. [20] H. Hudig, O. Bakker, W.N. Wiersinga, Triiodothyronine pre vents the amiodarone induced decrease in the expression of the liver low density lipoprotein receptor gene, J. Endocrinol. 152 (1997) 413 421. [21] G.C. Ness, D. Lopez, C.M. Chambers, W.P. Newsome, P. Cornelius, C.A. Long, H.J. Harwood, Effects of L triiod othyronine and the thyromimetric L 94901 on serum lipoprotein levels and hepatic low density lipoprotein receptor, 3 hydroxy 3 methylglutaryl coenzyme A

PAGE 307

295 reductase, and apo A I gene expression, Biochem. Pharmacol. 56 (1998) 121 129. [22] G.C. Ness, D. Lopez Transcriptional regulation of rat hepatic low density lipoprotein receptor and cholesterol 7 hydroxylase by thyroid hormone, Arch. Biochem. Biophys. 323 (1995) 404 408. [23] S. Dueland, J. Drisko, L. Graf, D. Machleder, A.J. Lusis, R.A. Davis, Effect of dietary cholesterol and taurocholate on cholesterol 7 hydroxylase and hepatic LDL receptors in inbred mice, J. Lipid Res. 34 (1993) 923 931. [24] P. Mistry, N.E. Miller, M. Laker, W.R. Hazzard, B. Lewis, Individual variation in the effects of dietary cho lesterol on plasma lipoproteins and cellular cholesterol homeostasis in man, Studies of low density lipoprotein receptor activity and 3 hydroxy 3 methylglutaryl coenzyme A reductase activity in blood mononuclear cells, J. Clin. Invest. 67 (1981) 493 502. [ 25] D. Applebaum Bowden, S.M. Haffner, E. Hartsook, K.H. Luk, J.J. Alberts, W.R. Hazzard, Down regulation of the low density lipoprotein receptor by dietary cholesterol, Am. J. Clin. Nutrit. 39 (1984) 360 367. [26] L.K. Hennessy, J. Osada, J.M. Ordovas, R. J. Nicolosi, A.F. Stucchi, M.E. Brousseau, E.J. Schaefer, Effects of dietary fats and cholesterol on liver lipid content and hepatic apolipoproteins A I, B, and E and LDL receptor mRNA levels in cebus monkeys, J. Lipid Res. 33 (1992) 351 360. [27] P.T. Kov anen, M.S. Brown, S.K. Basu, D.W. Billheimer, J.L. Goldstein, Saturation and suppression of hepatic lipoprotein receptors: a mechanism for the hypercholesterolemia of cholesterol fed rabbits, Proc. Natl. Acad. Sci. USA 78 (1981) 1396 1400.

PAGE 308

296 [28] M. Rudling, B. Angelin, Loss of resistance to dietary cholesterol in the rat after hypophysectomy: importance of the presence of growth hormone for hepatic low density lipoprotein receptor expression, Proc. Natl. Acad. Sci. USA 90 (1993) 8851 8855. [29] J.L. Goldstei n, M.S. Brown, Regulation of the mevalonate pathway, Nature 343 (1990) 425 430. [30] T.C. SŸdhof, D.W. Russell, M.S. Brown, J.L. Goldstein, 42 bp element from LDL receptor gene confers end product repression by sterols when inserted into viral TK promoter, Cell 48 (1987) 1061 1069. [31] R.W. Bishop, Structure of the hamster low density lipoprotein receptor gene, J. Lipid Res. 33 (1992) 549 557. [32] M.J.V. Hoffer, M.M. van Eck, F. Petris, A. van der Zee, E. de Wit, D. Meijer, G. Grosveld, L.M. Havekes, M.H. Hofker, R.R. Frants, The mouse low density lipoprotein receptor gene: cDNA sequence and exon intron structure, Biochem. Biophys. Res. Commun. 191 (1993) 880 886. [33] K.D. Mehta, M.S. Brown, D.W. Bilheimer, J.L. Goldstein, The low density lipoprotein rece ptor in Xenopus laevis, II. Feedback repression mediated by conserved sterol regulatory element, J. Biol. Chem. 266 (1991) 10415 10419. [34] T.F. Osborne, Transcriptional control mechanisms in the regulation of cholesterol balance, Crit. Rev. Euk. Gene Exp 5 (1995) 317 335. [35] M.M. Magana, T.F. Osborne, Two tandem binding sites for sterol regulatory element binding proteins are required for sterol regulation of fatty acid synthase promoter, J. Biol. Chem. 271 (1996) 32689 32694. [36] J. Ericsson, S.M. Ja ckson, B.C. Lee, P.A. Edwards, Sterol regulatory element binding protein binds to a cis element in the promoter of the

PAGE 309

297 farnesyl diphosphate synthase gene, Proc. Natl. Acad. Sci. USA 93 (1996) 945 950. [37] R. Sato, J. Inoue, Y. Kawabe, T. Kodama, T. Takano M. Maeda, Sterol dependent transcriptional regulation of sterol regulatory element binding protein 2, J. Biol. Chem. 271 (1996) 26461 26464. [38] X. Hua, C. Yokoyama, J. Wu, M.R. Briggs, M.S. Brown, J.L. Goldstein, X. Wang, SREBP 2, a second basic helix loop helix leucine zipper protein that stimulates transcription by binding to a sterol regulatory element, Proc. Natl. Acad. Sci. USA 90 (1993) 11603 11607. [39] C. Yokoyama, X. Wang, M.R. Briggs, A. Admon, J. Wu, X. Hua, J.L. Goldstein, M.S. Brown, SREBP 1, a basic helix loop helix leucine zipper protein that controls transcription of the low density lipoprotein receptor gene, Cell 75 (1993) 187 197. [40] M.R. Briggs, C. Yokoyama, X. Wang, M.S. Brown, J.L. Goldstein, Nuclear protein that binds sterol regul atory element of low density lipoprotein receptor promoter, I. Identification of the protein and delineation of its target nucleotide sequence, J. Biol. Chem. 268 (1993) 14490 14496. [41] X. Wang, R. Sato, M.S. Brown, X. Hua, J.L. Goldstein, SREBP 1, a me mbrane bound transcription factor released by sterol regulated proteolysis, Cell 77 (1994) 53 62, 1994. [42] R. Sato, J. Yang, X. Wang, M.J. Evans, Y.K. Ho, J.L. Goldstein, M.S. Brown, Assignment of the membrane attachement, DNA binding, and transcriptiona l activation domains of sterol regulatory element binding protein 1 (SREBP 1), J. Biol. Chem. 269 (1994) 17267 17273. [43] H. Shimano, Sterol regulatory element binding proteins (SREBPs): transcriptional regulators of lipid synthetic genes, Prog. Lipid Res 40

PAGE 310

298 (2001) 439 452. [44] X. Hua, J. Sakai, Y.K. Ho, J.L. Goldstein, M.S. Brown, Hairpin orientation of sterol regulatory element binding protein 2 in cell membranes as determined by protease protection, J. Biol. Chem. 270 (1995) 29422 29427. [45] D.J. Shi n, T.F. Osborne, Thyroid hormone regulation and cholesterol metabolism are connected through Sterol Regulatory Element Binding Protein 2 (SREBP 2), J. Biol. Chem. 278 (2003) 34114 34118. [46] C.L. Yu, D.J. Meyer, G.S. Campbell, A.C. Larner, C. Carter Su, J Schwartz, R. Jove, Enhanced DNA binding activity of Stat3 related protein in cells transformed by the Src oncoprotein, Science 269 (1995) 81 83. [47] J.H. Zar, In: McElroy, W.D., Swanson, C.P. (Eds.), Biostatistical Analysis, Prentice Hall, Englewood Cli ffs, NJ, pp. 101 127 (Chapters 9 and 10), 1974. [48] L. Yin, Y. Zhang, F.B. Hillgartner, Sterol regulatory element binding protein 1 interacts with the nuclear thyroid hormone receptor to enhance acetyl CoA carboxylase transcription in hepatocytes, J. Bi ol. Chem. 277 (2002) 19554 19565. [49] Y. Zhang, L. Yin, F.B. Hillgartner, SREBP 1 integrates the actions of thyroid hormone, insulin, cAMP, and medium chain fatty acids on ACC transcription in hepatocytes, J. Lipid Res. 44 (2002) 356 368. [50] D.B. Jump, A.P. Thelen, M.K. Mater, Functional interaction between sterol regulatory element binding protein 1c, nuclear factor Y, and 3,5,3' triiodothyronine nuclear receptors, J. Biol. Chem. 276 (2001) 34419 34427. [51] O. Bakker, F. Hudig, S. Meijssen, W.M. Wiers inga, Effects of

PAGE 311

299 triiodothyronine and amiodarone on the human LDL receptor gene, Biochem. Biophys. Res. Commun. 249 (1998) 517 521.

PAGE 312

300 APPENDIX LDLR $ 4 cDNA Sequence >LDLR_K O_LIVER+ANTI SENSE ATGTGGGAACAGCCACCATTGTTGTCCAAACACTC GTTGGTCTTGCAC TCCTTGATGGGCTCATCCGACCAGTCCTGGCAGTCGCGGGCGGAGTC GCACACCTTGTCCAAGCTGATGCACTCCCCACTGTGACACTTGAACTT GTTGGGGCCATCACACTGTGTCACATTGACGCAGCCGAGCTCGTCGC TCATGTCCTTGCAGTCATGTTCACGGTCACACTGGCGGCTACCGTGA ATGCAGGAGCCATCTGCACACTGGAATTCATCAGGTCGGCAGGTGGC CACCGGA CAGCCTTGTTCGTCTGAGTCATTTTCACAGTCTACCTGTCC ATCACATCTCCAGGAGTCAGGAATGCATCGGCTGACACGGCCTCCAC AGCTGAATTGATTGGACTGACAGGTGACAGACATGCATGTCTCTGGG GACTCATCGGAGCCATCCGGGCACTCGGGGCTGCCATCGCACACCCA CTTGCTAGCGATGCATTTTCCGTCTCTACACTGGAACTCGTTCCTGCT GCATGAGTCTTCTA

PAGE 313

301 >LDLR_K O _LIVER+SENSE GGAAAATGCATCGCTAGCAAGTGGGTGTGCGATGGCAGCCCCGAGT GCCCGGATGGCTCCGATGAGTCCCCAGAGACATGCATGTCTGTCACC TGTCAGTCCAATCAATTCAGCTGTGGAGGCCGTGTCAGCCGATGCAT TCCTGACTCCTGGAGATGTGATGGACAGGTAGACTGTGAAAATGACT CAGACGAACAAGGCTGTCCGGTGGCCACCTGCCGACCTGATGAATTC CAGTGTGCA GATGGCTCCTGCATTCACGGTAGCCGCCAGTGTGACCG TGAACATGACTGCAAGGACATGAGCGACGAGCTCGGCTGCGTCAATG TGACACAGTGTGATGGCCCCAACAAGTTCAAGTGTCACAGTGGGGAG TGCATCAGCTTGGACAAGGTGTGCGACTCCGCCCGCGACTGCCAGGA CTGGTCGGATGAGCCCATCAAGGAGTGCAAGACCAACGAGTGTTTGG ACAACAATGGTGGCTGTTCCCACATCTGCA AGGACCTCAAGATTGGC TCTGAGTGCCTGTA >NORMAL LIVER+ANTI SENSE ATGTGGGAACAGCCACCATTGTTGTCCAAACACTCGTTGGTCTTGCAC

PAGE 314

302 TCCTTGATGGGCTCATCCGACCAGTCCTGGCAGTCGCGGGCGGAGTC GCACACCTTGTCCAAGCTGATGCACTCCCCACTGTGACACTTGAACTT GTTGGGGCCATCACACTGTGTCACATTGACGCAGCCGAGCTCGTCGC TCATGTC CTTGCAGTCATGTTCACGGTCACACTGGCGGCTACCGTGA ATGCAGGAGCCATCTGCACACTGGAATTCATCAGGTCGGCAGGTGGC CACCGCGCAGTGCTCCTCATCTGACTTGTCCTTGCAGTCTGCCTCGCC GTCACAGACCCAGCTGCGATGGATACACTCACTGCTACCACAGTGGA ACTCCAGGGAGGAGCAGGGGCTGCTAACGCCTTTGGAGGCCGTGTC TCGGCCCTGGCAGTTCTGTGGCCACTCA TCGGAGCCGTCAACACAGT CGACATCCCCGTCGCAGGCCCAAAGACTGGGGATGCATATGGATGAG TTGCAGCGGAAGTGGGCGGGGCCACAAGTGGTGGCCTGGCAGTGGG CCTCATCAGAGCCATCTAGGCAATCTCGGTCTCCATCACACACAAACT GCGGGGAGATGCACTTGCCATCCTGGCATCGGAAGTCATCCTGGGA GCACGTCTTGGGGGGACAGCCTTGTTCGTCTGAGTCATTTTCACAGT CTA CCTGTCCATCACATCTCCAGGAGTCAGGAATGCATCGGCTGACA CGGCCTCCACAGCTGAATTGATTGGACTGACAGGTGACAGACATGCA TGTCTCTGGGGACTCATCGGAGCCATCCGGGCACTCGGGGCTGCCAT CGCACACCCACTTGCTAGCGATGCATTTTCCGTCTCTACACTGGAACT CGTTCCTGCTGCATGAGTCTTCTA

PAGE 315

303 >NORMAL LIVER+SENSE GGAAAATGCATCGCTAGCAAGTG GGTGTGCGATGGCAGCCCCGAGT GCCCGGATGGCTCCGATGAGTCCCCAGAGACATGCATGTCTGTCACC TGTCAGTCCAATCAATTCAGCTGTGGAGGCCGTGTCAGCCGATGCAT TCCTGACTCCTGGAGATGTGATGGACAGGTAGACTGTGAAAATGACT CAGACGAACAAGGCTGTCCCCCCAAGACGTGCTCCCAGGATGACTTC CGATGCCAGGATGGCAAGTGCATCTCCCCGCAGTTTGTGTGTGAT GG AGACCGAGATTGCCTAGATGGCTCTGATGAGGCCCACTGCCAGGCCA CCACTTGTGGCCCCGCCCACTTCCGCTGCAACTCATCCATATGCATCC CCAGTCTTTGGGCCTGCGACGGGGATGTCGACTGTGTTGACGGCTCC GATGAGTGGCCACAGAACTGCCAGGGCCGAGACACGGCCTCCAAAG GCGTTAGCAGCCCCTGCTCCTCCCTGGAGTTCCACTGTGGTAGCAGT GAGTGTATCCATCGCAGCT GGGTCTGTGACGGCGAGGCAGACTGCA AGGACAAGTCAGATGAGGAGCACTGCGCGGTGGCCACCTGCCGACC TGATGAATTCCAGTGTGCAGATGGCTCCTGCATTCACGGTAGCCGCC AGTGTGACCGTGAACATGACTGCAAGGACATGAGCGACGAGCTCGG CTGCGTCAATGTGACACAGTGTGATGGCCCCAACAAGTTCAAGTGTC

PAGE 316

304 ACAGTGGGGAGTGCATCAGCTTGGACAAGGTGTGCGACTCCGC CCG CGACTGCCAGGACTGGTCGGATGAGCCCATCAAGGAGTGCAAGACC AACGAGTGTTTGGACAACAATGGTGGCTGTTCCCACATCTGCAAGGA CCTCAAGATTGGCTCTGAG >NORMAL HC+SENSE GCAGCTGAGAGGAATGCATCGCTAGCAGTGGGTGTGCGATGGCAGC CCCGAGTGCCCGGATGGCTCCGATGAGTCCCCAGAGACATGCATGTC TGTCACCTGTCAGTCCAATCAATTCA GCTGTGGAGGCCGTGTCAGCC GATGCATTCCTGACTCCTGGAGATGTGATGGACAGGTAGACTGTGAA AATGACTCAGACGAACAAGGCTGTCCCCCCAAGACGTGCTCCCAGGA TGACTTCCGATGCCAGGATGGCAAGTGCATCTCCCCGCAGTTTGTGT GTGATGGAGACCGAGATTGCCTAGATGGCTCTGATGAGGCCCACTGC CAGGCCACCACTTGTGGCCCCGCCCACTTCCGCTGCAACTCATCCAT ATGCATCCCCAGTCTTTGGGCCTGCGACGGGGATGTCGACTGTGTTG ACGGCTCCGATGAGTGGCCACAGAACTGCCAGGGCCGAGACACGGC

PAGE 317

305 CTCCAAAGGCGTTAGCAGCCCCTGCTCCTCCCTGGAGTTCCACTGTG GTAGCAGTGAGTGTATCCATCGCAGCTGGGTCTGTGACGGCGAGGC AGACTGCAAGGACAAGTCAGATGAGGAGCACTGCGCGGTGGCCACC TGCCGACCTGATGAATTCCAGTGT GCAGATGGCTCCTGCATTCACGG TAGCCGCCAGTGTGACCGTGAACATGACTGCAAGGACATGAGCGACG AGCTCGGCTGCGTCAATGTGACACAGTGTGATGGCCCCAACAAGTTC AAGTGTCACAGTGGGGAGTGCATCAGCTTGGACAAGGTGTGCGACTC CGCCCGCGACTGCCAGGACTGGTCGGATGAGCCCATCAAGGAGTGC AAGGACCAACGAGTGTTTGCGACAACAATTGGTGGCTGTTCCCACA T CTGCAAGGACCCGCAGATTTGGCTCTGGAGTTGCCTGGTAAAA >NORMAL HC+ANTI SENSE ATGTGGGAACAGCCACCATTGTTGTCCAAACACTCGTTGGTCTTGCAC TCCTTGATGGGCTCATCCGACCAGTCCTGGCAGTCGCGGGCGGAGTC GCACACCTTGTCCAAGCTGATGCACTCCCCACTGTGACACTTGAACTT GTTGGGGCCATCACACTGTGTCACATTGACGCAGCCGAGCTCGT CGC TCATGTCCTTGCAGTCATGTTCACGGTCACACTGGCGGCTACCGTGA ATGCAGGAGCCATCTGCACACTGGAATTCATCAGGTCGGCAGGTGGC

PAGE 318

306 CACCGCGCAGTGCTCCTCATCTGACTTGTCCTTGCAGTCTGCCTCGCC GTCACAGACCCAGCTGCGATGGATACACTCACTGCTACCACAGTGGA ACTCCAGGGAGGAGCAGGGGCTGCTAACGCCTTTGGAGGCCGTGTC TCGGCCCTGGCAGTTCTG TGGCCACTCATCGGAGCCGTCAACACAGT CGACATCCCCGTCGCAGGCCCAAAGACTGGGGATGCATATGGATGAG TTGCAGCGGAAGTGGGCGGGGCCACAAGTGGTGGCCTGGCAGTGGG CCTCATCAGAGCCATCTAGGCAATCTCGGTCTCCATCACACACAAACT GCGGGGAGATGCACTTGCCATCCTGGCATCGGAAGTCATCCTGGGA GCACGTCTTGGGGGGACAGCCTTGTTCGTCTGAGTCATTT TCACAGT CTACCTGTCCATCACATCTCCAGGAGTCAGGAATGCATCGGCTGACA CGGCCTCCACAGCTGAATTGATTGGACTGACAGGTGACAGACATGCA TGTCTCTGGGGACTCATCGGAGCCATCCGGGCACTCGGGGCTGCCAT CGCACACCCACTTGCTAGCGATGCATTTTCCGTCTCTACACTGGGAAC TCGTTCCTGCTGCATGGAGTCTTCT >NORMAL CORTEX+ANTI SENSE ACAGCC ACCATTGTTGTCCAAACACTCGTTGGTCTTGCACTCCTTGAT GGGCTCATCCGACCAGTCCTGGCAGTCGCGGGCGGAGTCGCACACC

PAGE 319

307 TTGTCCAAGCTGATGCACTCCCCACTGTGACACTTGAACTTGTTGGGG CCATCACACTGTGTCACATTGACGCAGCCGAGCTCGTCGCTCATGTC CTTGCAGTCATGTTCACGGTCACACTGGCGGCTACCGTGAATGCAGG AGCCATCTGCACACTGGAATTCATCA GGTCGGCAGGTGGCCACCGCG CAGTGCTCCTCATCTGACTTGTCCTTGCAGTCTGCCTCGCCGTCACAG ACCCAGCTGCGATGGATACACTCACTGCTACCACAGTGGAACTCCAG GGAGGAGCAGGGGCTGCTAACGCCTTTGGAGGCCGTGTCTCGGCCC TGGCAGTTCTGTGGCCACTCATCGGAGCCGTCAACACAGTCGACATC CCCGTCGCAGGCCCAAAGACTGGGGATGCATATGGATGAGTTGCAG C GGAAGTGGGCGGGGCCACAAGTGGTGGCCTGGCAGTGGGCCTCAT CAGAGCCATCTAGGCAATCTCGGTCTCCATCACACACAAACTGCGGG GAGATGCACTTGCCATCCTGGCATCGGAAGTCATCCTGGGAGCACGT CTTGGGGGGACAGCCTTGTTCGTCTGAGTCATTTTCACAGTCTACCTG TCCATCACATCTCCAGGAGTCAGGAATGCATCGGCTGACACGGCCTC CACAGCTGAATTGATTGGACTG ACAGGTGACAGACATGCATGTCTCT GGGGACTCATCGGAGCCATCCGGGCACTCGGGGCTGCCATCGCACA CCCACTTGCTAGCGATGCATTTTCCGTCTCTACACTGGGAACTCGTTC CTGCTGCATGGAGGTCTTCTCG

PAGE 320

308 >NORMAL CORTEX+ SENSE GTGTAGAGACGGAAAATGCATCGCTAGCAAGTGGGTGTGCGATGGC AGCCCCGAGTGCCCGGATGGCTCCGATGAGTCCCCAGAGACATG CAT GTCTGTCACCTGTCAGTCCAATCAATTCAGCTGTGGAGGCCGTGTCA GCCGATGCATTCCTGACTCCTGGAGATGTGATGGACAGGTAGACTGT GAAAATGACTCAGACGAACAAGGCTGTCCCCCCAAGACGTGCTCCCA GGATGACTTCCGATGCCAGGATGGCAAGTGCATCTCCCCGCAGTTTG TGTGTGATGGAGACCGAGATTGCCTAGATGGCTCTGATGAGGCCCAC TGCCAGGCCACCACTTGT GGCCCCGCCCACTTCCGCTGCAACTCATC CATATGCATCCCCAGTCTTTGGGCCTGCGACGGGGATGTCGACTGTG TTGACGGCTCCGATGAGTGGCCACAGAACTGCCAGGGCCGAGACAC GGCCTCCAAAGGCGTTAGCAGCCCCTGCTCCTCCCTGGAGTTCCACT GTGGTAGCAGTGAGTGTATCCATCGCAGCTGGGTCTGTGACGGCGA GGCAGACTGCAAGGACAAGTCAGATGAGGAGCACTGCGCGG TGGCC ACCTGCCGACCTGATGAATTCCAGTGTGCAGATGGCTCCTGCATTCA CGGTAGCCGCCAGTGTGACCGTGAACATGACTGCAAGGACATGAGC GACGAGCTCGGCTGCGTCAATGTGACACAGTGTGATGGCCCCAACAA GTTCAAGTGTCACAGTGGGGAGTGCATCAGCTTGGACAAGGTGTGCG ACTCCGCCCGCGACTGCCAGGACTGGTCGGATGAGCCCATCAAGGA

PAGE 321

309 GTGCAAGACCAACGAGTG TTTGGACAACAATGGTGGCTGTTCCCACA TCTGCAAGGACCTCAAGATTGGCTCTGAGTGCCT >LDLR_K O CORTEX+ANTI SENSE ATGTGGGAACAGCCACCATTGTTGTCCAAACACTCGTTGGTCTTGCAC TCCTTGATGGGCTCATCCGACCAGTCCTGGCAGTCGCGGGCGGAGTC GCACACCTTGTCCAAGCTGATGCACTCCCCACTGTGACACTTGAACTT GTTGGGGCCATCACACTGT GTCACATTGACGCAGCCGAGCTCGTCGC TCATGTCCTTGCAGTCATGTTCACGGTCACACTGGCGGCTACCGTGA ATGCAGGAGCCATCTGCACACTGGAATTCATCAGGTCGGCAGGTGGC CACCGGACAGCCTTGTTCGTCTGAGTCATTTTCACAGTCTACCTGTCC ATCACATCTCCAGGAGTCAGGAATGCATCGGCTGACACGGCCTCCAC AGCTGAATTGATTGGACTGACAGGTGACAGACATGCATG TCTCTGGG GACTCATCGGAGCCATCCGGGCACTCGGGGCTGCCATCGCACACCCA CTTGCTAGCGATGCATTTTCCGTCTCTACACTGGAACTCGTTCCTGCT GCATGAGTCTTCT

PAGE 322

310 >LDLR_K O CORTEX+ SENSE GTGTAGAGACGGAAAATGCATCGCTAGCAAGTGGGTGTGCGATGGC AGCCCCGAGTGCCCGGATGGCTCCGATGAGTCCCCAGAGACATGCAT GTCTGTCACCTGTCAGTC CAATCAATTCAGCTGTGGAGGCCGTGTCA GCCGATGCATTCCTGACTCCTGGAGATGTGATGGACAGGTAGACTGT GAAAATGACTCAGACGAACAAGGCTGTCCGGTGGCCACCTGCCGACC TGATGAATTCCAGTGTGCAGATGGCTCCTGCATTCACGGTAGCCGCC AGTGTGACCGTGAACATGACTGCAAGGACATGAGCGACGAGCTCGG CTGCGTCAATGTGACACAGTGTGATGGCCCCAACAAGTTC AAGTGTC ACAGTGGGGAGTGCATCAGCTTGGACAAGGTGTGCGACTCCGCCCG CGACTGCCAGGACTGGTCGGATGAGCCCATCAAGGAGTGCAAGACC AACGAGTGTTTGGACAACAATGGTGGCTGTTCCCACATCTGCAAGGA CCTCAAGATTGGCTCTGAGTGCCTGT >LDLR_K O -HC+ANTI SENSE ATGTGGGAACAGCCACCATTGTTGTCCAAACACTCGTTGGTCTTGCAC

PAGE 323

311 TCCTTGAT GGGCTCATCCAACCAGTCCTGGCAGTCGCGGGCGGAGTC GCACACCTTGTCCAAGCTGATGCACTCCCCACTGTGACACTTGAACTT GTTGGGGCCATCACACTGTGTCACATTGACGCAGCCGAGCTCGTCGC TCATGTCCTTGCAGTCATGTTCACGGTCACACTGGCGGCTACCGTGA ATGCAGGAGCCATCTGCACACTGGAATTCATCAGGTCGGCAGGTGGC CACCGGACAGCCTTGTTCGTCTGAGTCA TTTTCACAGTCTACCTGTCC ATCACATCTCCAGGAGTCAGGAATGCATCGGCTGACACGGCCTCCAC AGCTGAATTGATTGGACTGACAGGTGACAGACATGCATGTCTCTGGG GACTCATCGGAGCCATCCGGGCACTCGGGGCTGCCATCGCACACCCA CTTGCTAGCGATGCATTTTCCGTCTCTACACTGGAACTCGTTCCTGCT GCATGAAGTCTTCT >LDLR_K O -HC+ SENSE GTGTAGAGA CGGAAAATGCATCGCTAGCAAGTGGGTGTGCGATGGC AGCCCCGAGTGCCCGGATGGCTCCGATGAGTCCCCAGAGACATGCAT GTCTGTCACCTGTCAGTCCAATCAATTCAGCTGTGGAGGCCGTGTCA GCCGATGCATTCCTGACTCCTGGAGATGTGATGGACAGGTAGACTGT GAAAATGACTCAGACGAACAAGGCTGTCCGGTGGCCACCTGCCGACC

PAGE 324

312 TGATGAATTCCAGTGTGCAGATGGCTCCTGC ATTCACGGTAGCCGCC AGTGTGACCGTGAACATGACTGCAAGGACATGAGCGACGAGCTCGG CTGCGTCAATGTGACACAGTGTGATGGCCCCAACAAGTTCAAGTGTC ACAGTGGGGAGTGCATCAGCTTGGACAAGGTGTGCGACTCCGCCCG CGACTGCCAGGACTGGTCGGATGAGCCCATCAAGGAGTGCAAGACC AACGAGTGTTTGGACAACAATGGTGGCTGTTCCCACATCTGCAAGGA CCTCAAGA TTGGCTCTGAGTGCCTGT

PAGE 325

About the Author Jose Abisambra was born in Miami, FL and raised in Santa Marta and Buenaventura, Colombia. He graduated high school from el Colegio San Carlos and nurtured his interest in neuroscience at la Pontificia Uni versidad Javeriana. In 2000, he relocated to Florida, where he earned a Bachelor's of Science degree in Biology from Saint Leo University (2002) and a Master's of Science degree from the University of South Florida (2004) for his work on LDLR activation by thyroid hormone. Jose joined Dr. Huntington Potter's Alzheimer's research laboratory in 2004 to pursue a Doctoral degree in Medical Sciences. During his time in Dr. Potter's lab, Jose investigated the links between cholesterol and Alzheimer's disease fr om the perspective of the LDLR. He presented his work in national and international conferences such as the Society for Neuroscience Conferences ev ery year since 2007, in the Cole gio Colombiano de Neurociencias Conference in Bogota, Colombia in 2008, as a guest seminar speaker at the Mayo Clinic, Jacksonville, FL in 2009, La Universidad Jorge Tadeo Lozano in Santa Marta, Colombia, and finally in La Academia de Medicina de Cartagena, Colombia in 2010 where he was inducted as a member.