USF Libraries
USF Digital Collections

Characterization of cannabinoid receptor 2 transcript expression in b cells

MISSING IMAGE

Material Information

Title:
Characterization of cannabinoid receptor 2 transcript expression in b cells
Physical Description:
Book
Language:
English
Creator:
Sherwood, Tracy
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Delta9-tetrahydrocannabinol
Cannabis sativa
Endocannabinoid
Gene regulation
Promoter
Dissertations, Academic -- Molecular Medicine -- Doctoral -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: Cannabinoids and cannabinoid receptors have been shown to play important roles in immune regulation particularly as modulators of anti-inflammatory cytokines and antibody production. The predominant cannabinoid receptor involved in this immune regulation is cannabinoid receptor 2 (CB2), which is robustly expressed in B cells. Utilizing a combination of bioinformatics, 5' RACE, real time RT-qPCR, and reporter assays, we showed that human B cells from peripheral blood mononuclear cells (PBMC) expressed one CB2 transcript while mouse B cells from spleen express three CB2 transcripts. Alignment of the sequenced B cell RACE products to either the mouse or human genome, along with the GenBank mRNA sequences, revealed that the transcripts isolated in this study contained previously unidentified transcriptional start sites (TSSs). In addition, expression construct testing of the genomic region containing the TSSs of the mouse CB2 exon 1 and 2 transcripts showed a significant increase of promoter activity. Bioinformatics analysis for cis-sequences in the promoter regions identified DNA binding sites for NF-kB, STAT6, and Elk1 transcription factors activated by LPS, IL-4 and anti-CD40. Regarding variations in CB2 transcript expression among the immune cell subtypes, RACE analysis showed that the exon 1b transcript is seen in B cells but not in T cells, dendritic cells or macrophages. Furthermore, RT-qPCR showed variations in transcript expression during B cell development as well as in resting versus LPS or IL-4/anti-CD40 stimulated B cells. The exon 1a transcript was predominant in pre-, immature and resting B cells whereas the exon 1b and 2 transcripts were enhanced in mature and activated B cells. These data showed for the first time that human B cells use one TSS for CB2 expression while mouse B cells use multiple TSSs for the expression of three CB2 transcripts, in which the expression of the individual transcript is related to immune cell type and/or cell activation state. Additionally, this is the first report in mouse B cells defining TSSs that are in genomic areas with promoter activity thus suggesting the location of two promoter regions. Defining the CB2 transcript expression during various stages of B cell activation provide clues to therapeutic
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2010.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Tracy Sherwood.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains X pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
usfldc doi - E14-SFE0003405
usfldc handle - e14.3405
System ID:
SFS0027720:00001


This item is only available as the following downloads:


Full Text

PAGE 1

Characterization of Cannabinoid Re ceptor 2 Transcript Expression in B Cells by Tracy Sherwood A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Molecular Medicine College of Medicine University of South Florida Major Professor: Thomas W. Klein, Ph.D. George Blanck, Ph.D. Ed Seto, Ph.D. Andreas Seyfang, Ph.D. Raymond Widen, Ph.D. Date of Approval: March 29, 2010 Keywords: delta9-tetrahydrocannabinol, Cannabis sativa, endocannabinoid, gene regulation, promoter Copyright 2010, Tracy Sherwood

PAGE 2

DEDICATION I would like to dedicate this work to three important people that I lose during my time in the Ph.D. program here at the University of South Florida; my life partner William “Joe” Best, father Robert D. Sherwood, and grandmother Violet Ma y Sherwood, may they all rest in peace. Thank you all for supporting me in all my life efforts. I would also like to dedicate this work to my mother Londa Sherwood for her never ending support and faith in me. Finally, I would like to thank my sister Deborah Parrott for without her love and support during the difficult times of losing my loved ones I would have never made it through this program.

PAGE 3

ACKNOWLEDGEMENTS I would like to acknowledge my mentor Dr. Thomas Klein, for his never ending support, guidance and mentorship. Mostly I would like to thank him for his patience and underst anding during some of the most difficult times of my life and for not giving up on me. I would also like to acknowledge some of the other lab members for helping me through the program, Dr. Marisela Agudelo, Cathy Newton, and Dr. Liang Nong. In addition I would like to acknowledge my committee members Drs George Blanck, Ray Widen, Ed Seto and Andreas Seyfang. Finally I would like to th ank all the support staff of the Department of Molecular Medicine.

PAGE 4

i TABLE OF CONTENTS LIST OF TABLES iv LIST OF FIGURES v ABSTRACT vii INTRODUCTION 1 Cannabinoids and Cannabinoid Receptors 1 B Cells 3 Cannabinoid Effects on B Cells 7 Gene Regulation 8 PROJECT SIGNIFICANCE 11 OBJECTIVES 13 Aim 1. To Determine the Extent of CB2 Transcript Expression and Transcription Start Sites (TSSs) in B Cells 14 Aim 2. To Characterize the Cnr2 Promoter in B Cells 14 Aim 3. To Determine CB2 Transcript Usage in Activated B cells and Other Immune Cell Subtypes 15 MATERIALS AND METHODS 17 Bioinformatics analysis 17 Mice 17

PAGE 5

ii Isolation of Mouse Sple nocytes, T and B Cells 17 Human Subjects, Isolation of PBMCs and B Cells 18 Phenotypic Analysis of Immune Cell Populations 19 RNA Extraction 20 Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) 20 SMART 5’ RACE 21 PCR and RT-PCR Primer Mapping 22 Quantitative Real Time RT-PCR (RT-qPCR) 24 Promoter Cloning 26 Transfection of B Cells 27 Luciferase Reporter Assay 27 Activation of B Cells 28 RESULTS 29 Aim 1. To Determine the Extent of CB2 Transcript Expression and TSSs in B cells 29 Bioinformatics Analysis of the CB2 Gene ( Cnr2 ) and GenBank™ Clones 29 Phenotype of Lymphocyte Subtypes 33 Mouse and Human B Cells Di ffer in the Number of CB2 TSSs 37 Preferential Usage of the CB2 Exon 1a Transcript Variant in Resting Splenic B Cells 46 Aim 2. To Characterize the Cnr2 Promoter in B Cells 48 Bioinformatics Analysis for Core Promoter Elements Near the TSSs 48

PAGE 6

iii Bioinformatics Analysis to Id entify Putative Promoters and cis -Sequences 51 Cloning of the Putative Promoter Regions 55 Determination of Cnr2 Promoter Activity in B Cells 57 Aim 3. To Determine CB2 Transcript Usage in Activated B cells as well as Other Immune Cell Subtypes 61 CB2 Transcript Expression in Activated B Cells 61 CB2 Transcript Expression in Immune Cell Subtypes 66 CB2 Transcript Expression in Development of B Cells 70 DISCUSSION 73 SUMMARY 80 LIST OF REFERENCES 82 ABOUT THE AUTHOR End Page

PAGE 7

iv LIST OF TABLES Table 1. B cell Developmental Stages 6 Table 2. Cytokines Responsible fo r Ig Class Switching in Mouse 6 Table 3. SMART 5’ RACE Primers Used to Identify the TSS 22 Table 4. Primers Used for Mapping the TSSs 23 Table 5. Primers and Taqman Probes Used in This Study 25 Table 6. Promoter Clones and PCR Primers 26

PAGE 8

v LIST OF FIGURES Figure 1. The “Central Dogma” of Biology 8 Figure 2. The Basic Core Ptomoter Elements 10 Figure 3. Computational Analysis of the Mouse Cnr2 Gene 31 Figure 4. Computational Analysis of the Human CNR2 Gene 32 Figure 5. Phenotypic Analysis of Mouse Immune Cell Subtypes 35 Figure 6. Phenotypic Analys is of Lymphocyte Subtypes Isolated from Human PBMCs 36 Figure 7. CB2 Transcripts and TSSs Identified by 5’ RACE 39 Figure 8. 5’ RACE Products Reveal Location of the TSSs 40 Figure 9. The Cnr2 Gene Location of the TSSs and 5’UTR Sequences Identified by 5’ RACE 41 Figure 10. Human CB2 5’RACE Transcripts have a Single TSS and 5’UTR 42 Figure 11. Primer Mapping of the mCB2 TSSs 44 Figure 12. Primer Mapping of the hCB2 TSS 45 Figure 13. Quantitative Real Time RT-PCR (RT-qPCR) for mCB2 mRNA Expression in Resting Splenic B cells 47 Figure 14. Putative Core Promoter Elements Near the TSSs 50 Figure 15. ClustalW Alignmen t of the Mouse and Human Putative Promoters 54

PAGE 9

vi Figure 16. Cloning of the Exon 1 Promoter 56 Figure 17. pGL3Cnr2 Luciferase Activity in IL-4/anti-CD40 Activated B Cells 60 Figure 18. LPS Induces th e Expression of the CB2 Exon 1b and 2 Transcripts in Primary B cells 64 Figure 19. Primary B cells Stimul ated with IL4 and anti-CD40 65 Figure 20. Immune Cell Subtypes 5’ RACE CB2 Transcripts 68 Figure 21. Quantitative RT-qPCR of the CB2 Transcripts in Immune Cell Subtypes 69 Figure 22. CB2 Transcript expression in B cell Lines 72

PAGE 10

vii Characterization of Cannabinoid Re ceptor 2 Transcript Expression in B Cells Tracy Sherwood ABSTRACT Cannabinoids and cannabinoid receptors have been shown to play important roles in immune regu lation particularly as modulators of anti-inflammatory cytokines and antibody production. The predominant cannabinoid receptor invo lved in this immune regulation is cannabinoid receptor 2 (CB2), which is robustly expressed in B cells. Utilizing a combination of bioinformati cs, 5' RACE, real time RT-qPCR, and reporter assays, we showed th at human B cells from peripheral blood mononuclear cells (PBMC) expressed one CB2 transcript while mouse B cells from spleen express three CB2 transcripts. Alignment of the sequenced B cell RACE products to either the mouse or human genome, along with the GenBank mRNA sequences, revealed that the transcripts isolated in this stud y contained previously unidentified transcriptional start sites (TSSs). In addition, expression construct testing of the genomic region containing the TSSs of the mouse CB2 exon 1 and 2 transcripts showed a significant increase of promoter

PAGE 11

viii activity. Bioinformatics analysis for cis -sequences in the promoter regions identified DNA binding sites for NF-kB, STAT6, and Elk1 transcription factors activated by LP S, IL-4 and anti-CD40. Regarding variations in CB2 transcript expression among the immune cell subtypes, RACE analysis showed that the exon 1b transcript is seen in B cells but not in T cells, dendritic cells or macrophages. Furthermore, RT-qPCR showed variations in tr anscript expression during B cell development as well as in restin g versus LPS or IL-4/anti-CD40 stimulated B cells. The exon 1a tr anscript was predominant in pre-, immature and resting B cells wherea s the exon 1b and 2 transcripts were enhanced in mature and activa ted B cells. These data showed for the first time that human B cells use one TSS for CB2 expression while mouse B cells use multiple TSSs for the expression of three CB2 transcripts, in which the expression of the individual transcript is related to immune cell type and/or cell activation state. Additionally, this is the first report in mouse B cells defining TSSs that are in genomic areas with promoter activity thus suggesting the location of two promoter regions. Defining the CB2 transcript expression during various stages of B cell activati on provide clues to therapeutic methods.

PAGE 12

1 INTRODUCTION Cannabinoids and Cannabinoid Receptors The marijuana plant ( Cannabis sativa ) and preparations derived from it have been used for medicinal and recreational purposes for thousands of years. Cannabis produces ~60 unique compounds known as cannabinoids, of which 9-tetrahydrocannabinol (THC) is considered the most important, owing to its abundance and psychoactive component (4, 29). Currently two cannab inoid receptors have been described. Cannabinoid receptor 1 (CB1) the first to be identified (27), also known as the “central” cannabino id receptor is found primarily in the brain and central nervous system (CNS) and is responsible for the psychoactive effect of THC. CB1 is also found in cells of the male and female reproductive system, as well as in some peripheral organs, such as liver, fat and muscle ce lls. Cannabinoid receptor 2 (CB2) (30), known as the “peripheral” cannabinoid receptor is almost exclusively found in the immune system, with highest expression observed in B cells. It is also found in the pe ripheral nervous system and in microglia. CB2 has been shown to be the cannabinoid receptor

PAGE 13

2 primarily responsible for the anti -inflammatory and possible immune therapeutic effects of cannabis (22) (38) (7). The cannabinoid receptors belong to the G protein-coupled receptor (GPCR) superfamily, and are seven-transmembrane domain receptors, which act as a guanine nuc leotide exchange factor (GEF) for associated G-proteins by exchangi ng bound GDP for GTP. The bound GTP activates the G-protein by causing the dissociation of the Gprotein’s -subunit from the and subunits. Two signal transduction pathways are affected by G-protei n activation, the cAMP pathway and the phosphatidylinositol pathway. Cannabinoid receptors signal through a Gi/o-protein, in which dissociation of the -subunit inhibits adenylate cyclase and thereby decreasing the production of cyclic AMP (19) (18) (2). The cannabinoid receptors are ac tivated by three general types of cannabinoids: 1. Phytocannabinoids, also known as the classical cannabinoids, which 66 have been isolated from Cannabis 2. Endocannabinoids, produced endogeno usly by the body, in which two have been well characterized, arac hidonolyethanolamine (Anandamide or AEA) and 2-arachidonynoyl gl ycerol (2-AG) endogenous. 3. Synthetic cannabinoids that are usef ul in experiments to determine receptor function. Numerous agonis ts have been design, some non-

PAGE 14

3 selective, such as CP-55940, that bind CB1 and CB2 with similar affinity, as well as selective agon ists, such as JWH-133, which binds only to CB2. In addition, antagonists have been designed to either selectively block CB1, SR141716, or CB2, SR144528 (38) (24, 29, 31) (6). B cells B cells are antibody producing lymphocytes (white blood cells) that make up part of the adaptive immune system and responsible for the humoral immune response, the portion of immunity that is mediated by antibodies. On the surf ace of every B cell is a membranebound immunoglobulin (Ig) receptor, the B cell receptor (BCR), which binds to specific antigen. It is the BCR and the ability of the receptor to recognize antigen in its native form, as well as the maturation and production of large amounts of antibodies that distinguishes B cells from other types of lymphocy tes. The “B” comes for the b ursa of Fabricius, an organ in birds that is the site of hematopoiesis and B cell development and maturation. In mammals, the bone marrow is the site of hematopoiesis and where B cells are continually produced. Development occurs through several stages, each stage representing a change in the genome content at the Ig loci (Table 1). At the

PAGE 15

4 immature stage B cells migrate to th e spleen where the final stage of maturation occurs (3). Mature B cells express both surface IgM and IgD and are considered nave until activated by antigen, which can occur either in a T cell-dependen t or –independent manner(15). The BCR and secreted antibody are comprised of four polypeptide chains, two identical he avy and two identical light chains with both constant (C) and variable (V) regions. In the heavy chain V region there are three segments; Va riable (V), Diversity (D), and Joining (J), whereas light chain only contains V and J. Germ line DNA has up to 200 V genes, twelve D genes, and four J genes, which during B cell development randomly re arrange and recombine by a mechanism known as VDJ recombination to produce functional VDJ genes. The kappa ( ) and lambda ( ) chains of the Ig light chain loci rearrange similarly, except the lig ht chain lacks a D gene. The first step of recombination for the light ch ain involves joining of V and J to give VJ before the addition C during transcription (14). Translation of the spliced mRNA for either or results in formation of either the Ig or Ig light chain. At this point, the mature B cell is considered nave until it is activated by antigen. The five classes of antibody ; IgA, IgD, IgE, IgG and IgM respectfully, are defined by the consta nt regions of the Ig heavy chain.

PAGE 16

5 Upon exposure to antigen, nave ma ture B cells are activated in the absence of T cell help (T cell-inde pendent) by antigen cross-linking (48) of the IgM BCR and differentiate into functional IgM secreting plasma B cells (primary response). However, most antigens are T celldependent and require T cell help for maximum antibody production. Antigen primed TH2 helper cells activate B cells through T cell Receptor (TCR) recognition of specific antige n presented on B cell MHC II, along with co-stimulation of CD40 on B ce lls by CD40 ligand on T cells (34). Cytokines are then secreted by T cells that bind to cytokine receptors on B cells and trigger B cell prolif eration and differentiation into plasma and memory B cells. In addi tion, some of the functionally responsive IgM and IgD expressing mature B cells will undergo the process of Ig Class Swit ch Recombination (CSR) (46), in which rearrangement of the DNA places th e recombined VDJ gene next to either IgG, IgE or IgA C gene, to pr oduce Ig isotype specific secreting plasma and memory B cells (9). Each isotype has a distinct function, therefore the type of antigen an d cytokines present in the B cell environment will determine which Ig isotype will be expressed in the differentiated plasma and memory B cells (Table 2). The memory B cells, formed from activated B cells, have BCRs that are antigen

PAGE 17

6 specific so when exposed to the sa me antigen, a rapid and effective immune response occurs (secondary response) (45). Table 1. B cell Developmental Stages. Stage Heavy Chain Light Chain Ig Progenitor Germline germline Early Pro D-J rearrangement germline Late Pro V-DJ rearrangement germline Large Pre VDJ rearranged germline IgM in cytoplasm Small Pre VDJ rearranged V-J rearrangement IgM in cytoplasm Immature VDJ rearranged VJ rearranged Surface IgM Mature VDJ rearranged VJ rearranged Surface IgM & IgD Table 2. Cytokines responsible fo r Ig class switching in mouse T cell Cytokine Ig isotypes IgG1 IgG2a IgG2b IgG3 IgA IgE TH2 IL-4 + + IL-5 + TH1 IFN + Treg TGF + + +, indicates Ig that cytokine induces switching from IgM

PAGE 18

7 Cannabinoid Effects on B cells The molecular events of the pe ripheral cannabinoid receptor (CB2) in immune cell function are st ill not fully understood. Nor are the mechanisms that regulate the CB2 gene, Cnr2 during activation of immune cells. CB2 message expression shows a pattern of mRNA expression that is most abundant in B cells followed by macrophages and then T cells (16, 25) Evidence also suggests that anti-CD40 (25), as well as IL-4 through activation of STAT6 (42), up regulate CB2 message expression and that LPS (25) down regulates its message expression in B cells; however the mechanisms are still unclear. Furthermore, CB2 has been implicated in B cell differentiation (8), migration (20, 39), proliferation (1 13) and immunoglobulin isotype switching (1). These findin gs suggest a role of CB2 as an immunomodulator. However, ma ny gaps still exist in our understanding of this receptor’s ro le in immune cell function, and in particular how is CB2 receptor expression regulated in B cells. Gene Regulation The modern working definition of a gene is “a locatable region of genomic sequence, corresp onding to a unit of inheritance, which is associated with regulatory regions, transcribed regions, and

PAGE 19

8 or other functional sequence regions” (35, 36). A gene is basically a DNA sequence that contains the inst ructions for the production of a protein. The basic gene structure consists of a promoter regulatory region, and a transcribe region of exons (coding sequences) and introns (non-coding sequences) (40). Transcription is the first step leading to gene expression result ing in messenger RNA (mRNA), which is translated into protein (28). Duri ng transcription of a gene, the DNA sequence is targeted by RNA polyme rase II (Pol II), which produces a complementary pre-mRNA strand, except that uracil (U) is used instead of thymine (T). The pre-mRNA strand is then spliced to form the mature mRNA strand that tran sports to the cytoplasm to be translated into protein. This proce ss of DNA to RNA to protein is known as the “central dogma” of biology (Figure 1) (11). Figure 1. The “Central Dogma” of Biology. Several steps are involved in gene expression of a protein. Promoters and enhancers regulate what DNA sequence will be transcribed into pre-mRNA, which is then spliced into mRNA and translated into protein. This figure was obtained with permission from Wikimedia Commons.

PAGE 20

9 The promoter is typically upstream adjacent to the gene and contains specific DNA cis -sequences, which provide binding sites for RNA Pol II and transcription factors ( trans -factors). The promoter consists of two interacting compon ents, the core promoter and the proximal promoter (51). The core promoter sequence is the minimal region of DNA required for Pol II to assemble with the basic trans factors and form the pre-initiation complex for initiation of activatorindependent (basal) transcription (17, 43). At the center of the core promoter sequence is the initiator (INR) sequence that contains the transcription start site (TSS), wh ich is defined as the most 5’ nucleotide of mRNA transcribed by Po l II (17, 41). The core promoter also contains the cis -sequences for the basic trans -factor elements, such as the TATA-box, the TFIIB recognition element (BRE) and the downstream promoter element (D PE), in which the TSS (+1) designates their position (Figure 2, provided by Wikimedia Commons) (43) (21). Cis -sequences upstream of the TSS are negative numbers counting back from -1, whereas downstream cis -sequences are positive numbers counting from the TSS (+1). The proximal promoter is the region generally upstream of the gene that contains regulatory elements involved in increasing transcription. These regulatory elements, also known as enhanc ers/repressors, can be several

PAGE 21

10 kilobases (kb) away from the TSS. The large protein transcriptional complex, causes the DNA to bend ba ck allowing for the placement of regulatory sequences far from the TSS (51). BREu BREd TATA INR DPE-2 to +5 +1 +28 to +34 -31 to -24-23 to -17 -38 to -32 Figure 2. The Basic Core Promoter Elements. BRE, TFIIB recognition element, u upstream, d downstream TATA-box; DPE, downstream promoter element; INR, initiator; TATA, TATA-box

PAGE 22

11 PROJECT SIGNIFICANCE For centuries marijuana has been used recreationally and as a therapeutic for many ailments. However, little research was done investigating the beneficial medica l effects of marijuana, until the discovery of the cannabinoid re ceptors and the endocannabinoid system. Since their discovery re search in the field has grown exponentially. In which, recent developments have shown cannabinoids to be potent anti-i nflammatory and immunosuppressive agents that mediate beneficial effe cts for many inflammatory diseases, including multiple scleros is (10, 32, 33) rheumatoid arthritis, as well as allergy, an area of cannabinoid re search in lab. Previous work done in our lab by Agudelo et al. 2008, showed that cannabinoids enhanced the IL-4/anti-CD40 mediated isotyp e switching from IgM to IgE in purified mouse B cells. In which, CB2 was implicated as the main cannabinoid receptor mediating the observed enhanced increase of IgE in IL-4/anti-CD40 stimulated B cells. The gene encoding for CB2 is the CNR2 gene, however the regulatory elements such as the pr omoter, transcriptional start site

PAGE 23

12 (TSS), and cis/trans -factors have not been described in B cells. Therefore, research is needed to identify these gene regulatory elements responsible for the expression of CB2 in B cells. The identification of the gene regula tory elements will lead to a better understanding of the pathways of CB2 expression and the mechanisms of increased receptor expression with changes in B cell activity. Identification of CB2 regulatory elements may also provide clues to how gene and protein expression can be therapeutically regulated in B cells. We propose to identify the lo cation and sequence of the core promoter region(s) of the CNR2 gene in mouse and human B cells as well as some of the associated pr oximal promoter elements. Because CB2 is expressed highest in B cells, it is possible these cells contain unique features of the promoter contributing to enhanced CB2 transcription.

PAGE 24

13 OBJECTIVES The focus of this project is to determine the Cnr2 gene transcription start site (TSS) and associated promoter and cis sequences involved in CB2 mRNA expression in B cells as well as investigate transcript usage in rest ing and activated cells. Previous studies suggest a role of CB2 in the immune regulation of B cells by demonstrating involvement in B cell differentiation, migration, proliferation, and immunoglobulin cl ass switching to IgE. A preliminary computational analysis of the murine Cnr2 gene and GenBank CB2 mRNA clones revealed that two alternate transcripts containing different 5’UTR first exons (1 and 2) were reported. Three clones from immune tissues contained the exon 1 5’UTR, whereas clones originating from bone and liver co ntained the exon 2 5’UTR. This analysis indicated that more than one transcript is produced from the Cnr2 gene, and that the transcripts may be related to cell type or function. From this, we hypothesize that the Cnr2 gene encodes multiple transcripts in B cells and other immune cells, which

PAGE 25

14 are varied following changes in cell function. In order to test this hypothesis, we propose the following aims: Aim 1. To Determine the Extent of CB2 Transcript Expression and TSSs in B cells Evidence in the genomic databases suggested the occurrence of multiple CB2 transcripts utilizing different first exons in various mouse tissues, as mentioned above. It is well known that the TSS is located either at the beginning of the first exon or upstream from it. Since 2 first exons (exon 1 and 2) have been reported, B cells possibly express multiple TSSs and CB2 transcripts employing different first exons. Therefore, we will explore this possibility in resting B cells. To accomplish this aim, we will use the S witching M echanism A t 5’ end of R NA T ranscript – R apid A mplification of c DNA E nds (SMART 5’ RACE) to identify the number and location of the CB2 TSSs in splenic and PBMC B cells. Aim 2. To Characterize the Cnr2 Gene Promoter in B Cells It has been well established that accurate identification of the TSS leads to the location of the co re promoter, which is usually -40 bp upstream to +40 bp downstream of the TSS. The basic elements that comprise the core promoter are th e TATA-box, INR (Initiator), DPE

PAGE 26

15 (downstream promoter element) and BRE (TFIIB recognition elements) (41). Identifying the promoter will lead to a better understanding of how the Cnr2 gene is regulated in B cells, which in turn will lead to the elucidation of the mechanisms involved in the immunobiology of CB2 and B cells. We will start with a bioinformatics analysis using web based analytical to ols, such as Genomatix, to locate the putative promoter regions of the Cnr2 gene. These will then be cloned into luciferase reporter gene expression vectors and transfected into purified splenic B cells to test for promoter activity. Truncations of the clones will be performed to identify core promoter and cis regulatory sequences. Aim 3. To Determine CB2 Transcript Usage in Activated B cells as well as Other Immune Cell Subtypes Since CB2 is abundant in B cells and implicated in the involvement of various B cell function s, an understanding of transcript usage under varying conditions of B cell activation will be of value in designing future studies to regulate CB2 expression. The GenBank data show that multiple CB2 transcripts exists therefore, some of these could be unique to B cells and the va rious associated 5’ UTR sequences could provide useful targets for se lectively suppressing or enhancing receptor expression in B cells. In this aim, we will compare CB2

PAGE 27

16 transcript usage in resting and stim ulated B cells. The literature shows that stimulation of B cells with an ti-CD40 and/or IL-4, through STAT6 activation, increases CB2 expression (8) (25) (1, 42), whereas, LPS stimulation suppresses expression (26). Therefore, to examine CB2 transcript usage, we will stimulate puri fied B cells with stimuli reported to increase CB2 expression, such as IL4 th at activates STAT6, antiCD40 that increases NF B, and LPS, a known B cell mitogen, that binds to TLR4 and activates NF B and/or IRF3. However, LPS has been shown to decrease CB2 message, therefore results from these experiments may uncover possible repressor elements. To perform these experiments, B cells will be isolated and cultured alone or with the various stimuli, and analyzed by RT-qPCR at various time points following B cell stimulation. Since we would like to know if any of the CB2 transcripts are unique in B cells, we will also anal yze other immune cell subtypes, such as T cells, dendritic cells an d macrophages for the presence of CB2 transcript variants.

PAGE 28

17 MATERIALS AND METHODS Bioinformatics Analysis The bioinformatics programs used for this study include the Genetics Computer Group (GCG) SeqWeb v3.1 software package, Primer3, the Genomatix Suite, Consit e, the Database of Transcriptional Start Sites (DBTSS), Ensembl and NCBI databases. Mice C57BL/6 mice, 8 to 10 wks old, and of mixed gender where obtained from NCI (Fredericksburg, MD) and housed and cared for in the University of South Florida Health Science Center animal facility, which is fully accredited by the Am erican Association for Accreditation of Laboratory Animal Care. Isolation of Mouse Splenocytes, T and B cells Mice were euthanized by CO2 asphyxiation, followed by removal of the spleens, which were placed in 12 ml of Hanks balanced buffer saline (HBBS) then pulverized with a Seward Stomacher 80 (Lab

PAGE 29

18 System, England) to release the sp lenocytes. The splenocytes where collected by centrifugation at 1100 rpm for 10 minutes at 10 C, and washed once with PBS. The T and B cells were then isolated by magnetic negative selection using the EasySep mouse T or B cell enrichment Kits (StemCell Technologies, Canada) following the manufacturer’s protocol. Total RNA was extracted from the lymphocytes immediately following isolation, except for B cells activated by LPS (5 g/ml) for up to 8 hrs. Human Subjects, Isolation of PBMCs and B cells Human subjects recruited for this study were male and female laboratory workers at the Universi ty of South Florida, who gave informed consent. Venous blood (25 ml) was drawn into 4 K3 EDTA vacutainer tubes (Becton Dickinson, Franklin Lakes, NJ), then diluted 1:1 or 1:2 with RPMI 1640 medium (S igma, St Louis, MO). The PBMCs were isolated from blood using Hi sopaque-1077 (Sigma Diagnostics, Inc.) following the manufacturer’s protocol. B cell isolation was performed by magnetic negative se lection using the EasySep human B cell enrichment kit (StemCe ll Technologies, Canada).

PAGE 30

19 Phenotypic Analysis of Immune Cell Populations Mouse T and B cell subtypes were analyzed for enrichment by PCR and FACS analysis. RACE cDNA of the T and B cell samples was analyzed by PCR amplification us ing specific primers for the CD3 chain of the T cell receptor and for the B cell marker CD19 (50). Enrichment of the B cell preparation is dete rmined by the absence of CD3 while T cell enrichment is determined by the absence of CD19. PCR amplification was performed using 1 l of RACE cDNA, 500 nM of each primer and Taq polymerase supplied with the SMART RACE cDNA Amplification kit (Clontech Inc., Madison, WI) in a final volume of 25 l. Amplification was for 28 cycles using the MyCycler™ thermal cycler (Bio-Rad Laboratories, Hercules, CA). -actin was used as a loading control. FACS analysis of the puri fied mouse T and B cell populations was done by labeling 106 cells with fluorochrome-conjugated antimouse mAbs; CD19-PE, CD3-PerCP, NK-pan-FITC and F/480-APC (BD Pharmingen, San Jose, CA). The human B cell populations were analyzed for enrichment by labeling 105 cells with fluorochromeconjugated anti-human mAbs; CD 19-PE, CD3-FITC and CD14-APC (BD Pharmingen, San Jose, CA). All flow cytometric analysis was conducted using a FACS Caliber flow cytomete r and Cell Quest software (Becton Dickinson, San Diego, CA, USA).

PAGE 31

20 RNA Extraction Total RNA was extracted from the cell populations by standard techniques using Tri-reagent (Sigma; 1 ml per 107 cells) and quantitated using the RiboGreen RNA Quantitation Kit (Molecular Probes, Eugene, OR). Just prior to cDNA synthesis, residual DNA was removed by treatment with Turbo DNAfree ™ (Ambion Inc., Austin, TX) following manufacturer’s protocol. Reverse Transcriptase-Polymera se Chain Reaction (RT-PCR) To synthesize the cDNA, 1.0 g of the DNAse treated RNA was primed with 1 l of random primers for 5 minutes at 70C, then reverse transcribed (RT) at 37 C for 1hr using 15 U avian myeloblastosis virus (AMV), 40 Units RNasin (Promega, Corp., Madison, WI ) and 1.25 mM mix of dNTPs (Promega Corp., Madison, WI) in a volume of 20 l. The PCR reaction was carried out in 25 l containing 1 l cDNA, 500 nM of each primer (see Table 2), with 12.5 l GoTaq Green Master Mix (Pro mega Corp., Madison, WI) and amplified using the MyCycler™ therma l cycler (Bio-Rad Laboratories, Hercules, CA). The PCR amplificatio n conditions were as follows; for the initial denaturation step, 95C fo r 1 min, followed by 32 cycles at

PAGE 32

21 95C for 20 sec, 55C for 30 sec, 72C for 45 sec, with a final elongation at 72C for 3 min. SMART-5’-RACE To identify the TSS we em ployed the technique; S witching M echanism A t 5’ end of R NA T ranscript R apid A mplification of c DNA E nds (SMART™ RACE cDNA Amplification kit, Clontech Inc., Madison, WI) following manufacturer’s protocol. Two reverse gene specific primers (GSP) were designed, for both mouse and human CB2 using the GCG SeqWeb v3.1 software (see Table 3 for primer sequences). The mGSP1 (mCB2-R301) binds within the ORF 301bp downstream of the ATG, while the hGSP1 (hCB2-R298) binds 298bp downstream of the ATG. These were used with the universal primer mix (UPM) that anneals to the SMART sequence at th e 5’ end of the cDNA supplied by the kit for the initial PCR reaction. A second GSP2 (mCB2-R217 and hCB2-R163), located 84bp upstream of mGSP1, and 74bp upstream of hGSP1, was used with UPM in a nested PCR for CB2 confirmation. RACE products were run on a 2% agaros e gel, visualized with ethidium bromide and purified using the Perfectprep Gel Cleanup kit (Eppendorf, North America) followi ng manufacturer’s protocol, and sent to the Moffitt/USF Molecule Biology Core lab for DNA sequencing.

PAGE 33

22 The SeqWeb PileUp program was used to compare the RACE sequences with the GenBank m Cnr2 and h CNR2 sequences to confirm CB2 identity, exon usage, and location of the TSSs (Figures 8, 9, and 10). Table 3. SMART 5’ RACE Primers Used to Identify the TSS Gene Specific Primersa Sequence 5’-to-3’ 5’ binding siteb mGSP1-R301 CGACCCCGTGGAAGACGTGGAAGATGACAA 301 bp mGSP2-R217 TGAACAGGT ACGAGGGCTTTCT 217 bp hGSP1-R298 GCCAGGAAGTCAGCCCCAGCCAAGCTGCCAA 298 bp hGSP2-R163 GCACAGCCACGT TCTCCAGGGCACTTAGCA 163 bp a GSP, gene specific primer; 1 denotes for the initial RACE PCR, 2 used for nested PCR. b The number of base pairs from the start of translation in which the 5’ end of the GSP binds for amplification of CB2. PCR and RT-PCR Primer Mapping Genomic DNA was extracted fr om mouse splenic and human peripheral B cells using the Wizard Genomic DNA Isolation System (Promega Corp., Madison, WI) follo wing manufacturer’s protocol. RNA was extracted, DNAse treated and re verse transcribed from mouse and human B cells as stated above. Us ing Primer3, forward primers were designed to flank the TSSs identified by 5’RACE (Figures 11 & 12) 2 to

PAGE 34

23 10bp in either direction. Forward primers upstream the TSS should only amplify genomic DNA, wherea s forward primers downstream of the TSS should amplify genomic DNA as well as cDNA derived from the CB2 transcripts. The PCR reaction was carried out in 25 l containing either 1 l cDNA or 1 l DNA, 500 nM of each primer (see Table 4), with 12.5 l GoTaq Green Master Mix (Pro mega Corp.) and amplified using the MyCycler™ thermal cycler (Bio-Rad Laboratories, Inc). The PCR amplification conditions were as stated in section 2.6 with minor adjustments, the cycle number was increased to 35 and for the mouse samples elongation was increased to 1.5 minutes. Table 4. Primers Used for Mapping the TSSs Primer Groupa Sequence 5’-to-3’b Assayc Size of amplicon mE1b DNA A mRNA B C G ggaggaggcatgaggca ACACATAGCCTGGCACA GCGGTTGAATTCTCTCTTC GACAAAGTTGCAGGCGAAGATCAC PCR RT-PCR 189 bp 171 bp 755 bp mE2 DNA D mRNA E F G atacatcaaacacatccttg TTCTAGAAGGCACCCATGT CCTCTGCTCATTCAGGTACA GACAAAGTTGCAGGCGAAGATCAC PCR RT-PCR 224 bp 189 bp 567 bp hE1 DNA J mRNA I H gcaagagaaagctggctt TCAACAGGTGCTCTGAGTG CTGAGGAGTCCCAGTTGTT PCR RT-PCR 99 bp 71 bp a m, mouse; h, human; E1b, exon 1b; E2, exon 2; A, D, J, DNA forward primers; B, E, I, forward primers for amplification of mRNA derived cDNA; C, F, G, H, reverse primers. b Primers designed to bind genomic DNA 5’ of the TSSs are in lower case. c RT-PCR, r everse t ranscription p olymerase c hain r eaction.

PAGE 35

24 Quantitative Real Time RT-PCR (RT-qPCR) mCB2 transcript exonal usage in resting, LPS (5 g/ml) and IL4/anti-CD40 (3ng/ml, 0.5 g/ml) stimulated splenic B cells was measured by RT-qPCR, in which we employed a duplex Taqman PCR strategy; 4 mCB2 exon specific primer sets and probes were designed, one each for the mCB2 exons (1a, 1b, 2, and 3) and 1 primer and probe set for the endogenous -actin control using Primer3 (see Table 5 for primer/probe sequences). The real-time PCR was carried out in 20 l containing 1 l cDNA, 300 nM -actin and 500 nM CB2 primers, 250 nM fluorescent probe (6-FAM for mCB2 exon, ROX for -actin), with 10 l IQ™ Multiplex Powermix, and performed in the iCycler IQ™ Real-Time PCR detection system (Bio-R ad Laboratories, Inc). In brief, the reaction was performed in duplic ate for each RT cDNA product (see above). Samples were heated for 10 min at 95 C, followed by 50 cycles of amplification for 15 s at 95 C and 1 min at 60 C.

PAGE 36

25 Table 5. Primers and Taqman Probes Used in This Study Primer pairsa and probe Sequence 5’-to-3’b Size of amplicon mCB2-E3 F R P GCCGTGCTCTATATTATCCTGTCCTC GACAAAGTTGCAGGCGAAGATCAC 6FAM-AGAAAGCCCTCGTAC CTGTTCATCAGCA-BHQ1 120 bp mCB2-E1a F R P TCATCTGCGAAAGTGTGA TTGTCCTGGCTATTCTGTATC 6FAM-CTGGAGCTGCAGCTCTTGGGAC-BHQ1 112 bp mCB2-E1b F R P ACACATAGCCTGGCACA GCGGTTGAATTCTCTCTTC 6FAM-TCAAGTGAGTTGCAGGACAGCATAC-BHQ1 171 bp mCB2-E2 F R P TTCTAGAAGGCACCCATGT CCTCTGCTCATTCAGGTACA 6FAM-CTTCCTGTTGCTGTGTGCATCCT-BHQ1 189 bp -actin F R P GGGAATGGGTCAGAAGGACT AGGTGTGGTGCCAGATCTTC ROX-ATGTGGGTGACGAGGCCCAGAGCAA-BHQ2 134 bp a E3, exon 3; E1a, exon 1a; E1b, exon 1b; E2, exon 2; F, forward primer; R, reverse primer; P, Taqman probe. b 6FAM, 6-carboxyfluorescein; BHQ1 or 2, Black Hole Quencher-1 or 2.

PAGE 37

26 Promoter Cloning Using genomic DNA extracted from B cells (see above) and the pGL3-enhancer vector (Promega), clones were constructed to test for promoter activity surrounding the TS Ss of the mouse exon 1 and 2 CB2 transcript variants. The clones incl uded the region from -359 bp to +205 bp of the TSS (+1) of exon 1a, whereas the exon 2 clones spanned the region from -189 bp to +205 bp of the exon 2 TSS (+1). The DNA regions were PCR amplified (see table 6 for primer sequences) and initially cloned into the pTOPO-Blue TA vector (Invitrogen) following manufacturer ’s protocol, then sub-cloned by standard methods, into the pGL3 -enhancer vector via the Hind III restriction enzyme site. Table 6. Promoter Cl ones and PCR Primers Promoter clone Primers Sequence 5’-to-3’ Promoter region cloned Size (bp) pGL3-E16 E1-352F E1+123R GGCACATGTCACAGACAA GCGAAGAGTTAGGGAAGAGT -270 bp to +205 bp exon 1a TSS(+1) 475 pGL3-E19 E1-14F E1+123R CCTGCTGGGTCTCCAGAT GCGAAGAGTTAGGGAAGAGT +68 bp to +205 bp exon 1a TSS(+1) 137 pGL3-E25 E1-441F E1-19R GTTCAATTCCCAGCACCC CCCACGTAGGTCCCAAGAG -359 bp to +63 bp exon 1a TSS(+1) 422 pGL3-P7 E2-F189 E2+R36 CTTGCCAGTTCCCAGTTTCA CAAGTCACATGGGTGCCTTCT -189 bp to +36 bp exon 2 TSS(+1) 225 pGL3-P8 E2-F90 E2+R36 AGAAGAGGGACTTGCCCAAA CAAGTCACATGGGTGCCTTCT -90 bp to +36 bp exon 2 TSS(+1) 126 pGL3-P10 E2+F13 E2+R205 TCTAGAAGGCACCCATGTGA CTGTGCCTCTGCTCATTCAG +13 bp to +205 bp exon 2 TSS(+1) 192 pGL3-P11 E2-F189 E2+R101 CTTGCCAGTTCCCAGTTTCA AACAGGATGCACACAGCAAC -189 bp to +101 bp exon 2 TSS(+1) 290 pGL3-P13 E2-F25 E2+R101 TCAAACACATCCTTGCCCTA AACAGGATGCACACAGCAAC -25 bp to +101 bp exon 2 TSS(+1) 126

PAGE 38

27 Transfection of B cells Primary B cells were cultured fo r 24 to 48 hrs in RPMI medium containing 10% FCS, 10 ng/ml IL-4 and 500 ng/ml anti-CD40, then transfected (107cells/500 l RPMI in 0.4-cm cuvettes) with the pGL3clones (10 g) by electroporation at 250 V and 800 Farads using the Gene Pulser (BioRad). The transfected B cells were collected within 18 to 24 hrs after electroporation. For each cell sample a 50 l aliquot was removed and mixed with an equal volume of Trypan Blue to obtain cell number and check viability. Cells were counted using a hemocytometer and compo und light microscope. Luciferase Reporter Assay Cell lysates of the transfected cells were analyzed for luciferase activity using Promega’s Luciferase Assay System, following manufacturer’s protocol. In brief, cells were collected by centrifugation at 600 RCF for 10 minutes and washed 1X with PBS. Cells were lysed using 200 l of CCLR, of which 20 l was used for the luciferase assay and the remaining lysate was stored at -80 C. Each sample was in duplicate and luciferase activi ty was measured using the MLX luminometer (Dynex Technologies Inc., Chantilly, VA). A standard

PAGE 39

28 curve was used to measure the amount of lucerifase protein in each sample. Activation of B Cells To activate B cells we used th e B cell mitogen, LPS, and known inducers of immunoglobulin cla ss switching IL-4 and anti-CD40. Purified primary splenic B cells were cultured in RPMI medium containing 10% FCS with either 5 g/ml LPS or 3 ng/ml IL-4 and 0.5 g/ml anti-CD40 for 1, 3, and 8 hrs. Total RNA was isolated at each time point and analyzed for transcrip t expression by RT-qPCR. Relative transcript expression was determined by the 2Ct method, in which actin was the endogenous control and time 0 (un-stimulated) was the calibrator.

PAGE 40

29 RESULTS Aim 1. To Determine the Extent of CB2 Transcript Expression and TSSs in B cells. Bioinformatics Analysis of the CB2 Gene (Cnr2) and GenBank™ Clones. Since the discovery of CB2, several cDNA clones from various mouse and human tissues, as well as the complete gene sequence have been submitted to GenBank and available to researchers. We therefore took advantage of this reso urce to gain initial insight as to how the CB2 receptor gene is expressed in B cells. Initially we explored genome databases, such as Ensembl and NCBI, to obtain the location and gene structure of mouse and human CNR2 The mouse Cnr2 (m Cnr2 ) was reported to be located on chromosome 4, 24.7 kb in size, and produce at least two transcripts containing different 5’ untranslated region (UTR) first exons (Figure 3A & 3B). Whereas human CNR2 (h CNR2 ) was reported on chromosome 1, 39.4 kb in size, and express a single transcrip t (Figure 4A & 4B). A consensus was reported among the mouse and human clones in which the ORF,

PAGE 41

30 encoding CB2 protein, was within a single exon -exon 3 for mouse and exon 2 for human (Figures 3 and 4). Further computational analysis using the GCG SeqWeb pa ckage to align the 5’UTR of the GenBank™ clones, revealed the mo use clones from various immune tissues share a similar 5’ UTR first exon (exon 1) that differed in length at their most 5’ nucleotide. Similarl y, the clones reported from bone and liver share a second common 5’UT R first exon (exon 2) yet differ in length at the 5’ nucleotide (Fig ure 3C). Analysis of human data (Figure 4C) showed only one full length human CB2 clone containing a 5’UTR first exon (exon 1). This analysis suggested that m Cnr2 utilizes multiple TSSs to produce at least two CB2 transcript variants whereas the human gene utilizes only one. Ho wever, none of this existing data provided information as to the location of the TSS and CB2 transcript variants utilized in B cells. Therefor e, we began to investigate the TSS and CB2 transcripts in B cells purifi ed from mouse splenocytes and human PBMCs.

PAGE 42

31 exon 2 68Mouse chromosome 4; D3NC_000070 135451398135476122 124724m Cnr2 gene, 24.7 kbBone NFS107mCB2exon 1 Transcripts mCB2exon 2 TranscriptsA B Cexon 1exon 3 ORF exon 2 exon 3 ORF exon 1exon 3 ORF ORF ORF Thymus Spleen ORF Liver 1 16369 16369 -89 16334 5’3’ Figure 3. Computational Analysis of the Mouse Cnr2 Gene. A Chromosome location of the m Cnr2 (GenBank accession no. NC000070). B The m Cnr2 gene structure. Boxes represent exons, whereas white boxes are the untranslated region (UTR) and the dark grey shaded area is the protein coding region. ORF = open reading frame. Dotted lines are introns, which are spliced out to form mature mRNA. C GenBank CB2 mRNA transcripts; mCB2 exon 1 transcripts are expressed in the murine leukemic cell line NFS107 (GenBank accession nos. X93168, NM009924), the spleen and thymus (GenBank accession nos. X86405, and AK037898), whereas mCB2 exon 2 transcripts are expressed in liver and bone (GenBank accession nos. BC024052 and AK036658).

PAGE 43

32 ORF exon 2exon 1Human chromosome 1; 1p36.11NC_000001 24112404 24073047 1 39358 ORF exon 2 exon 1 HL60hCB2Transcripts h CNR2 gene, 39.3 kb ORF ORF ORF Leukocyte HEK293 Brain 1 3’5’ 37665 37656 37648 37620A B C Figure 4. Computational Analysis of the Human CNR2 Gene. A Chromosome location of the h CNR2 (GenBank accession no. NC000001). B The h CNR2 gene structure. Boxes represent exons, whereas white boxes are the untranslated region (UTR) and the dark grey shaded area is the protein coding region. ORF = open reading frame. Dotted lines are introns, which are spliced out to form mature mRNA. C GenBank hCB2 mRNA transcripts are expressed in the human promyelocytic leukemic cell line HL60, human embryonic kidney cell line HEK293, brain, and leukocytes (GenBank accession nos. NM001841, AV430063, BC074767, and AM1568546).

PAGE 44

33 Phenotype of Lymphocyte Subtypes Studies have shown that CB2 mRNA is most abundant in mouse and human B cells (8, 16, 25) and the bioinformatic analysis performed above revealed that the m Cnr2 produces at least two transcripts, whereas the h CNR2 produces only one (Figures 5 and 6). However, from the database we could not find any information pertaining to the location of the TSS or CB2 transcript usage in purified mouse and human B cells. Therefore, we began an analysis for CB2 transcript initiation and usage in unstimulated, resting purified B cells from mouse splenocytes and human PBMCs. T and B cells were purified using the EasySep negative selection kits for mouse and human. Splenocytes from mice and blood mononuclear cells from humans were processed over antibody affinity columns to remove all lymphoid subtypes with the exceptio n of B cells and T cells. We then employed RT-PCR and flow cytomet ry to determine enrichment of the lymphocyte subtypes. RT-PCR dete rmined either the presence or absence of the T cell specific CD3 message or the B cell specific message, CD19. Enrichment of the B cell preparation was determined by the presence of CD19 and absence of CD3 whereas T cell enrichment was determined by the presence of CD3 and absence of CD19. PCR amplification was performed using CD3 and CD19 specific

PAGE 45

34 primers (50) for 28 cycles, in which weak to no visible CD19 bands were seen in the T cell populations and weak CD3 bands were seen in the B cell population (Figure 5A). Be cause of the weak bands seen in the lymphocyte subtypes, we were unable to determine the percent purification of the lymphocyte subt ypes. Therefore, to determine more precisely the purity of the subtyp es, we performed flow cytometry analysis using CD19 and CD3 fluorescent labeled antibodies and demonstrated that the mouse B and T cell populations as well as the human B cell populations were enrich ed to greater than 95% (Figures 5 and 6). These results show that the purified lymphocyte subtypes were indeed highly enriched.

PAGE 46

35 BT B T B T MW 500 bp SSSA 93 0.4 22 41 98 0 CD3 CD19SPLENOCYTESB CELLST CELLSB 0Percent cell populationSplenocytes B cells n = 5100 50CCD3 200 bp CD19, 169 bp -actin, 133 bp Figure 5. Phenotypic Analysis of Mouse Immune Cell Subtypes. Mouse B and T cells isolated from sple nocytes by affinity purification (EasySep) A RT-PCR for the presence of the CD3 message in T cells and for B cell specific marker CD19; -actin used as loading control. B Flow cytometry analysis of lymphocytes treated with CD19-PE, CD3-PerCP, NKpan-FITC and F/480-APC anti-mouse mAbs (FITC and APC data not shown) to determine lymphocyte enrichment. C Graph represents data of 5 independent B cell purification procedures (black bar). Grey bars are CD3+ cells.

PAGE 47

36 52 10 97 1 CD19CD3 B CELLS PBMCsA BPBMCsB cellsPercent cell population n = 3100 50 0 Figure 6. Phenotypic Analysis of Lymphocyte Subtypes Isolated from Human PBMCs. A Human B cells isolated from PBMCs by affinity purification were analyzed with CD19-PE, CD3-FITC and CD14-APC anti-human mAbs (CD14 data not shown) to determine B cell enrichment. B Graph represents data from 3 human donors. Black bars are B cells and grey bars are T cells.

PAGE 48

37 Mouse and Human B cells Differ in the Number of CB2 TSSs. To determine the location of the m Cnr2 TSS in purified B cells, we employed the SMART 5’ RACE technique. Figure 7 shows RACE results of RNA isolated from mo use and human B cells. For mouse cells, we used the GSP1, mCB2-R301, along with the UPM primer supplied with the kit. RACE PCR yielded three mCB2 transcripts that were confirmed as CB2 RACE products by nested PCR (Figure 7A). RACE was also performed on human B cell RNA using the hCB2-R298 GSP1 with the UPM, followed by nested PCR using hCB2-R163 GSP2, resulting in the demonstration of on ly one transcript (Figure 7B). In order to determine the relative gene location of the TSSs and 5’UTR structure of the CB2 transcripts in B cells, the RACE products were isolated, sequenced and the nucleotides aligned for analysis. The location of the TSS was revealed by alignment of the 5’ end of the RACE sequences with the UPMSII oligo primer sequence and genomic DNA (Figure 8). Furthermore, a lignment of the sequenced RACE products to either the mouse or human genome, along with the GenBank submitted mRNA sequences revealed several new aspects of CB2 transcript expression in B cells. First the mouse transcripts were homologous to the Cnr2 as well as the existing CB2 mRNA data, with the exception that exons 1 and 2 in the transcripts we isolated were

PAGE 49

38 longer by 14 to 294 nucleotides, respectively, indicating they contained previously unidentified T SSs. Mouse B cells also expressed and additional transcript, exon 1b, with three TSSs (Figure 9). Regarding transcript usage in human B cells, data obtained from three human subjects showed expression of only one first exon (Figure 10). To our knowledge, this is the first report identifying TSSs in B cells from mouse and human and these se quences have been submitted to GenBank (accession nos. FJ357033-6).

PAGE 50

39 A Mouse exon1a exon2 exon1b 500 bp 1 2 exon1a exon2 exon1b 500 bp 1 2 B Human exon1 1 2 500 bp exon1 1 2 500 bp Figure 7. CB2 Transcripts and TSSs Identified by 5’ RACE. Gel electrophoresis of the 5’ RACE products visualized on a 2% agarose gel stained with ethidium bromide. primary PCR (1 ), nested PCR (2 ). A Mouse 5’ RACE products, 1 product length; exon 1b, 778-788 bp; exon 2, 614 bp; exon 1a, 543 bp. 2 size; exon 1b, 697-707 bp; exon 2, 533 bp; exon 1a, 459 bp B Human 5’ RACE product, 1, 455 bp; 2, 381 bp.

PAGE 51

40 Mouse exon 1a RACE products +1 Cnr2 C A CC A G A CC T CC T C T C A TT C A C T C A T C T G C G AAA G T G T G A G A G C AA G Spleen AACGCAGAGT ACGCGGG G A T C T G C G AAA G T G T G A G A G C AA G Spleen AACGCAGAGT ACGCGG T G A T C T G C G AAA G T G T G A G A G C AA G B cell AACGCAGAGT ACGCGGG G A T C T G C G AAA G T G T G A G A G C AA G B cell AACGCAGAGT ACGCGG T GA T C T G C G AAA G T G T G A G A G C AA G B cell AAGGCAGAGT AGGGG G T C A T C T G C G AAA G T G T G A G A G C AA G B cell AACGCAGAGT ACGCGGG G A T C T G C G AAA G T G T G A G A G C AA G B cell A T C T G C G AAA G T G T G A G A G C AA G Mouse exon 1b RACE products +1 +1 +1 Cnr2 A GG C A T G A GG C A C A C A C A T A G CC T GG C A C A T G T C A C A G A C AAAA GG A T G T Spleen AACGCAGAGT ACG A CGGG A C A G A C A G AA GG A T G T B cell ACGCAGAGT ACGCGGG G A C A G A C AAAA GG A T G T B cell CGCAGAGT ACGCGGG G A C A G A C AAAA GG A T G T B cell ACGCAGAGT ACGCGGG G A C A T G T C A C A G A C AAAA GG A T G T B cell CA AGCAGGG G T A T A C A T A CC G T G T C A C A T G T C A C A G A C AAAA GG A T G T B cell T A C A T A G CC T GG C A C A T G T C A C A G A C AAAA GG A T G T B cell AC AGCATGGG T A T A C A T A G C G T GG C A C A GG T C A C A G A C AAAA GG A T G T Mouse exon 2 RACE products +1 Cnr2 T A T A C A T C AAA C A C A T CC TT G CCC T A G AAA T A GG T C TT C T A G AA GG C A Spleen AAGCAGAGT ACGCGGG G A G AAA T A GG T C TT C T A G AA GG C A Spleen GGG GG A G AAA T A GG T C TT C T A G AA GG C A B cell AAGCCGAGTT C G GCGGG A G AAA T A GG T C TT C T A G AA GG C A B cell ACGCAGAGT AC G GCGGG A G AAA T A GG T C TT C T A GAA GG C A B cell GGG G A G AAA T A GG T C TT C T A G AA GG C A Human RACE products +1 CNR2 A G C AA G A G AAA G C T GG C TT GGGG T G G C A C T C AA C A GG T G C T C T G A G T G B cell T ACGCGGG G G G C A C T C AA C A GG T G C T C T G A G T G B cell CGGG G G G C A C T C AA C A GG T G C T C T G A G T G B cell ACGCAGAGT CGCGGG G G C A C T C AA C A GG T G C T C T G A G T G Figure 8. 5’ RACE Products Reveal Location of the TSSs. To determine the TSS, the GCG SeqWeb PileUp progra m was used to align the 5’ end of the RACE products with the CNR2 gene and the UPM (AACGCAGAGT)-SII Oligo (ACGCGGG) sequences supplied with the RACE kit. TSSs are bold underlined and marked as +1. Shaded grey indicates the kit primers.

PAGE 52

41 exon1 exon2 exon3 exon1b, 652-62bp exon1a, 414bp exon2, 488bp ORF -14 -294,-282,-275 5’ 3’ Exon1a: 151 bpA TCTGCGAAAGTGT G AGAGCAAGAAACCCCAGGCTGGAGCTGCAGCTCTTGGGACCTACG TGGGGGTCCCTGCTGGGTCTCCAGATCTGGATACAGAATAGCCAGGACAAGGCTCCACAA GACCCTGGGGCCCAGCGGCTGACAAATGACA -14Exon1b: 412, 419, & 431 bpA CATAGCGTGGCA CATGTCA CAGACAAAAGGATGTAAACTTTACAGAGGTCAAGTGAGTT GCAGGACAGCATACACCCGGGGCCAGATTAGAACCCAAGTTTCTGGAGTCTAAGGTCTAT GCCTATGCCCTCCCCTGGCCAGAGTTCCTAGGAAGAGAGAATTCAACCGCAGGGCAAGAA CACTGTGGCACTGAGGACCCAGAGGGGAAGTGGTAACCGGTACGGAAGGCCAGATCTCCT CTCACTCACTTATCTGCACCAGACCTCCTCTCATTCACTCATTTGCGAAAGTGT G AGAGC AAGAAACCCCAGGCTGGAGCTGCAGCTCTTGGGACCTACGTGGGGGTCCCTGCTGGGTCT CCAGATCTGGATACAGAATAGCCAGGACAAGGCTCCACAAGACCCTGGGGCCCAGCGGCT GACAAATGACA -294-275 -282Exon2: 253 bpA GAAATAGGTCTTCTAGAAGGCACCCATGTGACTTGCAGAGGGTATCTCTATCTTCGTGG AGACAGGGAGCCGGGCTTCCTGTTGCTGTGTGCATCCTGTTGTTCTCTTGTTAGGATGTC CATCAAATGCATGCATTTCCTTTCCTAACTCTGGACAGTAACAGTCGTCTGC G GCCAAGC TGTGCCTGAATGAGCAGAGGCACAGGCACCAGCCGTGGCCACCCAGCAAACATCTCTGCT GACTCAGACTGGG -172 exon1 exon2 exon3 exon1b, 652-62bp exon1a, 414bp exon2, 488bp ORF -14 -294,-282,-275 5’ 3’ Exon1a: 151 bpA TCTGCGAAAGTGT G AGAGCAAGAAACCCCAGGCTGGAGCTGCAGCTCTTGGGACCTACG TGGGGGTCCCTGCTGGGTCTCCAGATCTGGATACAGAATAGCCAGGACAAGGCTCCACAA GACCCTGGGGCCCAGCGGCTGACAAATGACA -14Exon1b: 412, 419, & 431 bpA CATAGCGTGGCA CATGTCA CAGACAAAAGGATGTAAACTTTACAGAGGTCAAGTGAGTT GCAGGACAGCATACACCCGGGGCCAGATTAGAACCCAAGTTTCTGGAGTCTAAGGTCTAT GCCTATGCCCTCCCCTGGCCAGAGTTCCTAGGAAGAGAGAATTCAACCGCAGGGCAAGAA CACTGTGGCACTGAGGACCCAGAGGGGAAGTGGTAACCGGTACGGAAGGCCAGATCTCCT CTCACTCACTTATCTGCACCAGACCTCCTCTCATTCACTCATTTGCGAAAGTGT G AGAGC AAGAAACCCCAGGCTGGAGCTGCAGCTCTTGGGACCTACGTGGGGGTCCCTGCTGGGTCT CCAGATCTGGATACAGAATAGCCAGGACAAGGCTCCACAAGACCCTGGGGCCCAGCGGCT GACAAATGACA -294-275 -282Exon2: 253 bpA GAAATAGGTCTTCTAGAAGGCACCCATGTGACTTGCAGAGGGTATCTCTATCTTCGTGG AGACAGGGAGCCGGGCTTCCTGTTGCTGTGTGCATCCTGTTGTTCTCTTGTTAGGATGTC CATCAAATGCATGCATTTCCTTTCCTAACTCTGGACAGTAACAGTCGTCTGC G GCCAAGC TGTGCCTGAATGAGCAGAGGCACAGGCACCAGCCGTGGCCACCCAGCAAACATCTCTGCT GACTCAGACTGGG -172Exon2: 253 bpA GAAATAGGTCTTCTAGAAGGCACCCATGTGACTTGCAGAGGGTATCTCTATCTTCGTGG AGACAGGGAGCCGGGCTTCCTGTTGCTGTGTGCATCCTGTTGTTCTCTTGTTAGGATGTC CATCAAATGCATGCATTTCCTTTCCTAACTCTGGACAGTAACAGTCGTCTGC G GCCAAGC TGTGCCTGAATGAGCAGAGGCACAGGCACCAGCCGTGGCCACCCAGCAAACATCTCTGCT GACTCAGACTGGG -172 Figure 9. The Cnr2 Gene Location of the TSSs and 5’UTR Sequences Identified by 5’ RACE. CB2 transcripts are labeled with their corresponding exon along with the number of nucleotides sequenced for each RACE product. The upward arrows represent the Cnr2 gene location of the TSSs (underlined nucleotide) relative to position 1 (bold underlined nucleotide) of the Genbank™ accession nos. NM009924 for exons 1a & 1b and BC024052 for exon 2. Small black arrows mark the re lative location of the GSPs. The 5’UTR exon sequences of the mCB2 transcripts submitted to GenBank (accession nos. FJ357033-5).

PAGE 53

42 Exon1: 117 bpGGGTGTGTTGTGGGTGGCTGGGCACTGGGAGCTGCCGGGGGGTGAGGAGTCCC AGTTGTTTTTTGTCCTCTCCCAGGACCT G GCCGTGGGTGCCACTCAGAGCACC TGTTGAGTGCC -35 exon1, 410bp ORF exon2exon1 -35 3’5’ Exon1: 117 bpGGGTGTGTTGTGGGTGGCTGGGCACTGGGAGCTGCCGGGGGGTGAGGAGTCCC AGTTGTTTTTTGTCCTCTCCCAGGACCT G GCCGTGGGTGCCACTCAGAGCACC TGTTGAGTGCC -35Exon1: 117 bpGGGTGTGTTGTGGGTGGCTGGGCACTGGGAGCTGCCGGGGGGTGAGGAGTCCC AGTTGTTTTTTGTCCTCTCCCAGGACCT G GCCGTGGGTGCCACTCAGAGCACC TGTTGAGTGCC -35 exon1, 410bp ORF exon2exon1 -35 3’5’ exon1, 410bp ORF exon2exon1 -35 3’5’ Figure 10. Human CB2 5’RACE Transcripts have a Single TSS and 5’UTR. The CNR2 gene location of the TSS (upward arrow). Number below the arrow represents the location of th e TSS (underlined nucleotide) relative to position 1 (bold underlined nucleotide) of Genbank™ accession no. NM001841. Small black arrows mark the relative location of the GSPs. The CB2 5’UTR exon 1 sequence submitted to GenBank (accession no. FJ357036).

PAGE 54

43 To verify the relative location of the TSSs, we designed specific forward primers for PCR of either genomic DNA or cDNA reverse transcribed from 1 g of total RNA. The strategy for these experiments is illustrated in figures 11A and 12A. In brief, the forward primers were designed so that either the 3’ or 5’ end borders the TSS. Consequently, the forward primer in which the 3’ end is adjacent to the TSS will only amplify genomic DNA and not the cDNA derived from the mRNA transcripts, whereas the forward primer that adjoins the TSS at the 5’ end will amplify both genomic DNA and cDNA. There is some limitation with this approach in that it is not as sensitive as 5’ RACE in determining the TSS, but it does help confirm the relative location of the TSS and approximate 5’ end of the transcripts. Therefore, using this approach we were able to confirm the TSS location of mCB2 exons 1b and 2 (Figure 11B), as well as the hCB2 exon 1 transcript (Figure 12B). Anot her limitation with the assay was that mouse exons 1a and 1b shar e identical sequences with the exception that exon 1b is 280 nuc leotides longer at the 5’ end. Consequently, primers designed to adjoin the TSS of exon 1a would not be able to distinguish genomic DNA from cDNA derived from exon 1b and would amplify both. Therefore, we could not use this approach

PAGE 55

44 to verify the location of the TSS for transcripts containing exon 1a in B cells. B ACnr2 11 22 33 exon1b exon2 500 bp exon1a CG A Genomic DNA mRNA B exon2 D EF exon1b ORF exon3 AGGC A C A CA CAT 5’3’CCTT G CCCTA GAAATAGGT C TTCT +1+1 5’ 5’ 3’ 3’ E+G E+F D+F A+C B+C B+G 500 bp B ACnr2 11 22 33 exon1b exon2 500 bp exon1a CG A Genomic DNA mRNA B exon2 D EF exon1b ORF exon3 AGGC A C A CA CAT 5’3’CCTT G CCCTA GAAATAGGT C TTCT +1+1 5’ 5’ 3’ 3’ E+G E+F D+F A+C B+C B+G 500 bp Figure 11. Primer Mapping of the mCB2 TSSs. A Illustration of the strategy for primer mapping of the mCB2 TSSs. Forward primers A and D (black arrows) only amplify genomic DNA while forward primers B and E (grey arrows) amplify both genomic DNA and cDNA derived from CB2 mRNA. The reverse primers C, F, and G (gre y arrows) are shown. The blown out sequences illustrate where the forward primers bind in relation to the TSSs. The bold letters are the 3’ and 5’ end of the forward primers, and underlined nucleotides are the TSS B Gel electrophoresis of the mapped CB2 transcripts, where in lane 1 contains cDNA derived from 1 g of total RNA from mouse splenic B cells, lane 2 is genomic DNA extracted from B cells, and lane 3 contains the no template control. The bands are labeled with the primer pair (white letters) used for PCR amplification. The panels are labeled with the exon TSS tested.

PAGE 56

45 CNR2 exon1 HI J 5’ 3’ +15’3’TGAGT G CCA CCCC A AGCB A1 12 23 3 exon1 500 bp H+J H+I CNR2 exon1 HI J 5’ 3’ +15’3’TGAGT G CCA CCCC A AGCB A1 12 23 3 exon1 500 bp H+J H+I Figure 12. Primer Mapping of hCB2 TSS A Forward primer J (black arrow) only amplifies genomic DNA and forward primer I (grey arrow) amplifies both genomic DNA and the cDNA derived from CB2 mRNA. The reverse primer H (grey arrow) is shown. The blown out sequence illustrates where the forward primers bind in relation to the TSSs. The bold letters are the 3’ and 5’ end of the forward primers, and the underlined nucleotide is the TSS. B Gel electrophoresis of the mapped hCB2 transcript, where in lane 1 contains cDNA derived from 1 g of total RNA from human PBMC B cells, lane 2 is genomic DNA extracted from B cells, and lane 3 contains the no template control. The primers used for each PCR are labeled in white above the bands.

PAGE 57

46 Preferential Usage of the CB2 Exon 1a Transcript Variant in Resting Splenic B Cells The 5’ RACE data revealed that resting splenic B cells expressed several CB2 transcripts. Therefore, in order to determine which transcript was most abundant we used RT-PCR to quantify the transcripts. Using exon specific pr imers, semi-quantitative RT-PCR showed exon 3-containing transcripts and those containing variants of exon 1 rather than ex on 2 predominated in resting B cells (Figure 13A). To better define these results we used quantitative real time RTPCR (RT-qPCR). The primers and CB2 exon specific taqman sequences, listed in table 5 and located as black boxes in the diagram of figure 13, were used in conjunction with -actin primers and taqman probe in a duplex RT-qPCR. Since all three tr anscripts include exon 3, primers designed for this exon will amplify all the transcripts regardless of the first exon. In addition primers design ed for exon 1a should amplify all transcripts containing exon 1, wher eas primers for exon 1b and 2 were designed to specifically amplify transcripts containing only these exons. Our results show that the exon 1a transcript variant was the most abundantly expressed transcrip t in un-stimulated resting splenic B cells (Figure 13B).

PAGE 58

47 A. -actin, no RT 32 cyclesexon 1b exon 3 exon 1aexon 2 0.00 0.05 0.10 0.15 0.20 0.25 0.30n = 5B.CB2transcript/ -actinexon 1b exon 3exon 1aexon 2m Cnr2 gene exon 1b exon 2 exon 3 ORFexon 1a 5’ Figure 13. Quantitative real time RT-PCR (RT-qPCR) for mCB2 mRNA Expression in Resting Splenic B cells. A Semi-quantitative RT-PCR of the mCB2 transcripts using exon specific pr imers and 2 separate mouse B cell samples. The samples were collected after 32 cycles of amplification and run on a 2% agarose gel visualized with ethidium bromide. B Using taqman probes; RT-qPCR was performed to determine the major CB2 transcript utilized in mouse B cells at basal transcription. Results were normalized with -actin and expressed as a ratio of CB2 transcript/ -actin. Data are means S.E.M. of five independent experiments.

PAGE 59

48 Aim 2. Characterize the Cnr2 Promoter in B Cells Bioinformatics Analysis for Core Promoter Elements Near the TSSs It has been well established that identification of the TSS will lead to the location of the core promoter, which is usually -40 bp upstream to +40 bp downstream of the TSS. The basic elements that comprise the core promoter are th e TATA-box, INR (Initiator), DPE (downstream promoter element) and BRE (TFIIB recognition elements) (41). Therefore, we perf ormed a bioinformatics analysis for the presence of consensus sequence of the core promoter elements in the vicinity of our RACE TSSs to te ntatively identify the structure and location of the Cnr2 core promoter. Using GCG SeqWeb, we aligned the 5’ ends of the RACE sequences with that of previously described CB2 mRNA sequences (GenBank a ccession nos. NM009924 for mouse, and NM001841 for human) as well as the Cnr2 genomic region spanning -45 bp to +50 bp of the RA CE TSSs (positions +1, Figure 13), followed by in silico analysis for core element consensus sequences. For exon 1a, we identifi ed an INR sequence spanning the area -2 bp to +5 bp surrounding th e TSS (+1), a TATA-like sequence at position -25 bp as well as mult iple DPEs and DCEs at positions +10,18,31,36,38, and +44 bp. The RA CE results for the exon 1b

PAGE 60

49 transcript identified 3 TSSs, which fr om this analysis appear to have INR-like sequences. In addition, a GC/GAGA-box spanning 24 bp is present that is -24, -25, -26 bp as well as multiple DPE sites at +30,33,29, and +35 bp from its respective TSS. The exon 2 RACE transcript has an INR-like sequence, a TATA-box at -21 bp as well as DCE at +11 bp and a DPE at + 25 bp (Figure 14A). The RACE transcripts from human also contain an INR-like sequence, as well as a TATA-box at -31 bp, a BREd -24 bp and a DPE at +35 bp (Figure 14B). From this analysis it appears that the consensus sequences for core promoter elements are in the vicinity of the TSSs identified by the 5’ RACE experiments. Furthermore, the analysis suggested that m Cnr2 has three potential core promoters for the pre-initiation complex to assemble for transcription initiation, whereas h CNR2 has a single putative core promoter.

PAGE 61

50 5’ GC-box and GAGA-box INRINRINR DPE DPEDPE3’ exon 1b (n=3) A CAGACAAAAGGATGTAAACTTTACAGAGGTCAAGTGAGT exon 1b (n=1) A CATGTC A CAGACAAAAGGATGTAAACTTTACAGAGGTCAAGTGAGT exon 1b (n=3) A CATAGCCTGGC A CATGTC A CAGACAAAAGGATGTAAACTTTACAGAGGTCAAGTGAGT DNA C TCAAAGCTCTGGGCG AGAGGGAGGAG GCATGAGG CACAC A CATAGCCTGGC A CATGTC A CAGACAAAAG GATGTAAACTTTACA GAG GTCAAG TGAGT -40-25 -26 -24 +1 +1 +1 +30 +33 +29+35+40 5’ TATA-box INR DPE DCE DPE DCE/DPE DCE 3’ NM_009924 gagagcaagaaaccccaggctggagctgcagctctt exon 1a (n=11) A TCTGCGAAAGTGTGAGAGCAAGAAACCCCAGGCTGGAGCTGCAGCTCTT exon 1a (n=4) TC A TCTGCGAAAGTGTGAGAGCAAGAAACCCCAGGCTGGAGCTGCAGCTCTT DNA T CCTCTCACTTATCTG CACCAGACCTCCTCTCATTCACTC A TCTGCGAAA GTGTGAGA GCAAGAAACCCCA GGCTG GA GCTGCA GCTCTT -40 -25 +1 +10 +18 +31 +36/38 +44 +50 A.5’ TATA-box INR DCE DPE 3’ exon 2 (n=5) A GAAATAGGTCTTCTAGAAGGCACCCATGTGACTTGCAGA DNA C CCAGAGCAGCTACTTATAC ATCAAACACATCCTTGCCCT A GAAATAGGTC TTCTAGAAGGCACC CATGTGACTTGCAGA -40 -21 +1 +11 +25 +40 B.3’ DPE INR BREdTATA-box 5’ NM_001841 gacctg exon 1 (n=3)GACCTGGCCGTGGGTGCCACTCAGAGCACCTGTTGAGTGC C DNA GA CCTGG CCGTGGGTGCCACTCAGAGCACCTGTTGAGTGC C ACCCCAAGCCAGCTTTCTCTTGCT TTTGTAC TTTCTCACA +40 +35 +1 -24 -31 -40 Figure 14. Putative Core Promoter El ements Near the TSSs. The gene region spanning approximately -40 bp to +40 bp of the TSSs was analyzed for core promoter elements. A The putative core promoters of the three mCB2 transcripts. For exon 1b the numbers for the TSSs (+1) ar e color coordinated with their respective core promoter element. B The h CNR2 gene putative core promoter. INR, Initia tor (consensus sequence YYANWYY). DPE, Downstream promoter element (consensus sequence RGWCGTG) BREd, TFIIB recognition element downstream the TATA-box (consensus sequence RTDKKKK).

PAGE 62

51 Bioinformatics Analysis to Identi fy Putative Promoters and cisSequences It is well accepted that the prom oter consists of two interacting components; the core promoter, in which the basic transcription factors join with Pol II at the TSS to form the pre-initiation complex and the regulatory elements that are involved in activated transcription (51). These regulatory elements consist of proximal elements, next to the core prom oter, and enhancers/repressors elements, which can be located seve ral kbs upstream or downstream the TSS. These regulatory elements, known as cis -sequences are the DNA binding sites for transcript ion factors. Identifying the Cnr2 promoter and cis -sequences will provide insigh t into how this gene is regulated in B cells during diffe rent states of activation. Bioinformatics has become a useful tool in identifying sequences that may be involved in regulating gene transcription that can then be experimentally tested. Therefore, to increase our understanding of the functional regulatory regions that control CB2 transcription we utilized several web-base programs to tentatively locate the Cnr2 promoter and cis -sequences. Functional regulatory regions tend to be close to the TSS, therefore our first analysis was to locate putative promoters near our 5’ RACE TSSs. To accomp lish this we used the Genomatix suite to analyze 1 kb of the Cnr2 genomic sequence (obtain from

PAGE 63

52 GenBank) surrounding the TSSs fo r exons 1 and 2. The analysis yielded two predicted promoter regions for the m Cnr2 and one for the h CNR2. The first m Cnr2 predicted promoter is 690 bp and spans the region -574 bp to +115 bp from the mCB2 exon 1a TSS (+1). The second mCnr2 promoter is 601 bp and spans -362 bp to +238 bp from the mCB2 exon 2 TSS (+1). The single h CNR2 predicted promoter is 601 bp spanning -406 bp to +135 bp of the TSS (+1). To identify putative cis -sequences, we used the same 1 kb genomic regions as above and th e MatInspector program of the Genomatix suite, which this analysis yielded numerous cis -sequences that hampered us to decipher th e true positives from the false. Therefore, we used the process of phylogenetic footprinting, in which ClustalW was used to align the entire Cnr2 gene of mouse and human to find conserved regulatory regions A lignment of the orthologous genes paralleled the Genomatix prom oter prediction for the exon 1 region (Figure 15A). In addition, the orthologous alignment of the genomic region near the mouse exon 2 showed high conservation between mouse and human suggesting the possibility of an exon 2 for human CNR2, which the Genomatix analysis did not reveal (Figure 15B). Exon 1 and 2 regions were fu rther analyzed using the Consite web-base program for conserved cis -sequence regions. The exon 1

PAGE 64

53 alignment revealed conserved cis -sequences for Elk-1 and c-REL, as well as DNA binding sites for STAT 6 and NF-kBp50 for mouse, GATA and STAT for human. Similar result s were obtained for the exon 2 alignment indicating a conserved NF-kB, p65, c-REL cis -sequence and single STAT6 DNA binding sites for both mouse and human (Figure 15). The results obtained from these analyses exemplified the usefulness of employing bioinformatics as a tool to direct research in locating candidate Cnr2 gene regulatory regions that can then be experimentally tested for functionalit y, as well as guide future research in understanding the interplay between the cis -sequences and trans factors that regulate Cnr2 in B cells.

PAGE 65

54 A. Exon 1 alignment Mus_musculus CAGGAGCCAGCAGCGTTCATTCATGTCATCTGCCAACACCTGCAGGCATTTGCATCTCAA Homo_sapiens CAGGATCCATCACC---CATTATGTTAATCTGCC------TGTAGGCATTTGCATTTCAA +1 Mus_musculus AGCTCTGGGCGAGAGG-GAGGAGGCATGAGGCACACA CAT -------------------Homo_sapiens AGCTCTGGCCTAGTGGTGAAGAGGCATTGGAATGGCATGTCCTTTTAGGTGATCTACTGT +1 +1 GATA STAT Mus_musculus AGCCTGG --------CA CATGTCA CAGACAAAAGGATGTAAACTTTACAGAGGTCAAG Homo_sapiens AATGTTGGTGCATTATCCCCATTTTACA GATA AAGAAACTTGC-CTTTGG GGAA GTTAAG Mus_musculus TGAGTTGCAGGACAGCATACACCCGGGGCCAGATTAGAACCCAAGTTTCTGGAGTCTAAG Homo_sapiens TGAAT-------CAACATTTTAACGAGGCTGTATTAGAACCCAAGTCCCTTGACTCCAGG STAT6 GATA Mus_musculus GTCTATGCCTATGCCCTCCCCTGGCCAGAG TTCCTAGG AAGAGAGAATTCAACCGCAGGG Homo_sapiens GTCTAGGCCCATGCCCCACCCTGGCCAGAGTTCGTTGTAAGA GATA ACTCAACCGCAGGG Elk-1, c-REL Mus_musculus CAAGAACACTGTGGCACTGAGGACCCAGAGGGGAAGTGGTAACC GGTACGGAAGGCCAG Homo_sapiens GCAAGAGCATTGTGGCACCAGGGACCTGGAGGGGAAGTGGTAACA GGCACGGAAGGCCAG GATA +1 Mus_musculus ATCTCCTC TCACTCACT TATCTGCACCAGACCTCCTCTCATTCACTCA TCTGCGAAAGTG Homo_sapiens ACCTCCTCA CACTCACTC ATCTG---------------------------TGAGAAAGTA NF-kBp50 Mus_musculus TGAGAGCAAGAAACCCCAGGCTGGAGCTGCAGCT --CTTGGGACCTACGT GGGGGTCC C Homo_sapiens CAAAAGCAAGAGAAAGCTGGCTTGGGGTG GCACTCAACAGGTGCTCTGAGTGGCACCCAC +1 Mus_musculus TGCTGGGTCTCCAGATCTGGATACAGAATAGCCAGGAC ---AAGGCTCCACAAGACCCT Homo_sapiens GGCCAGGTCCTGGGAGA-GGACAGAAAACAACTGGGACTCCTCAGCCCCCGGCAGCTCCC Mus_musculus GGGGCCCAGCGGCTGACAA-ATGACA GTGAGTGTAACTTCCTTTGTTGTTTTACTTCAGA Homo_sapiens AGTGCCCAGCCACCCACAACACAACC GTGA--GTAGCTTTTTTTGTTG-TTTATTTTAGG B. Exon 2 alignment NF-kB,c-REL Mus_musculus .ATGGGGGGGGGGTATTGTTATTGTCTCTTCACAAGTGAGAAGA GGGACTTGCC CAAAGT Homo_sapiens ............................................................ Mus_musculus CACATGATGAGAGTGACAGCATTGGACCCAGAGCAGCTACTTATACATCAAACACATCCT Homo_sapiens ............................................................ STAT6 +1 STAT6 STAT6 Mus_musculus TGCC C TAGAA ATAGGTC TTCTAGAA GGCACCCATGTGACTTGCAGAGGGTATCTCTATCT Homo_sapiens . ................................. TGACTCCGAAAGGG-AT TTCT ATCT STAT6 NF-kB,p65,c-REL Mus_musculus TC ----GTGGAGACAGGGAGC CGGGCTTCCT GTTGCTGTGTGCATCCTGTTGTTCTCT T Homo_sapiens G TCGAA AGGGAAGACAGGGAGC TGGGTTTCCT GTTGCTCTGTGCGTCCTGACGTTGGCTT Mus_musculus GTTAGGATGTCCAT-CAAATGCATGCATTTCCTTTCCT----AACTCTGGACAGTAACAG Homo_sapiens GTTAAGACCTGCATCCAAATGCCCATATTTCCTGCCCTTACCTACTTTGGTTAATAACCA Mus_musculus T --CGTCTGCGGCCAAGCTGTGCCTGAATGAGCAGAGGCACAGGCACCAGCCGTGGCCA Homo_sapiens CGCATGTTGGTGGCCATGCCGGGGCTAGGT-----GAGGCCCAAA-GCCAGCCACCGCCA Mus_musculus CCCAGCAAACATCTCT -------GCTGACTCAGACTGGG GTAAGGCATTCCCTAACAGT Homo_sapiens CCC--CCAACATCCCTCTTCTAGGGTGGATTCTACATGGAGTAAGCCATATCTTGAC... Figure 15. ClustalW Alignment of the Mouse and Human Putative Promoters. Nucleotides highlighted in blue represent the conserved regions of m Cnr2 and h CNR2 enabled prediction of the promoter region and cis sequences (labeled and underlined). The 5’ RACE TSSs (+1) are bold and purple nucleotides represen t the 5’ UTR exons.

PAGE 66

55 Cloning of the Putati ve Cnr2 Promoters From the bioinformatics analys is, the regions surrounding the TSSs for mouse exons 1 and 2 appe ared to have core promoter elements, as well as enhancer elements, therefore we wanted to evaluate these regions for promoter activity. To test for promoter activity, we used genomic DNA from purified B cells to PCR amplify select regions of exon 1 (Figure 16A) spanning -359 bp to +205 bp of exon 1a TSS (+1) as well as the re gion from -189 bp to +205 bp of exon 2 TSS (+1). During PCR amplif ication, the Taq polymerase adds an adenosine nucleotide at the end of elongation thereby creating an A-tail that can be easily cloned into a TA-cloning vector, such as the TOPO-blue vector. Therefore, the PCR amplified DNA fragments were gel purified and initially TA-cloned into the TOPO-blue vector then subcloned into the pGL3-enhancer vector via the Hind III site by standard methods (Figure 16B). PCR screenin g was performed to determine insertion of the Cnr2 clones into the pGL3-enhancer vector (Figure 16C). In total, three exon 1; pGL3-E16(-270,+205), E19(+68,+205), and E25(-359,+63) as well as five exon 2; pGL3-P7(-189,+36), P8(90,+36), P10(+13,+205), P11(189,+101), and P13(-25,+101) experimental Cnr2 clones were chosen for evaluation of promoter activity.

PAGE 67

56 A.ME16E19E25 E16 E19E25B. C.M MM M E16E19E25 Figure 16. Cloning of the Exon 1 Promoter. A. PCR amplification of Cnr2 promoter regions TA-cloned into the TOPO-blue vector. B. Hind III digest of TOPOCnr2 clones for sub-cloned into the pGL3-enhancer vector. C. PCR amplification of Cnr2 clones in the pGL3-enhancer vector.

PAGE 68

57 Determination of Cnr2 Prom oter Activity in B cells The pGL3Cnr2 constructs were transfected by electroporation into IL-4/anti-CD40 stimulated primary B cells and 24 hrs later luciferase activity was determined fo r each construct. For exon 1 five constructs were analyzed, two control and three experimental vectors. The pGL3-enhancer vector does not have a promoter and contains only the SV40 enhancer downstream of th e luciferase gene and therefore served as baseline activity. The pGL3-c ontrol vector contains both the SV40 promoter and enhancer and therefore exhibits full promoter activity. The pGL3-E25 experimental vector spans the region -359 bp to +63 bp (exon 1a, TSS +1) and contains all the TSSs and core promoter elements for exons 1a and 1b. The pGL3-E16 experimental vector spanning -270 bp to +205 bp contains the core promoter of exon 1a and a portion of the exon 1b core promoter. The GAGA-box and 1 TSS at -280 bp were exclud ed. The pGL3-E19 experimental vector spans from +68 bp to +205 bp and therefore did not contain either the exon 1a or exon 1b TSSs and core promoter cis -elements. Luciferase activation analysis for the exon 1 putative promoter demonstrated significant promoter activity for the pGL3-E25(359,+63), pGL3-E16(-270,+205) and pGL3-control vectors, but not for pGL3-E19(+68, +205), indicating th at the RACE TSSs we identified

PAGE 69

58 were in Cnr2 genomic regions that exhibited characteristics of a gene promoter (Figure 17A). In additi on, pGL3-E25 had greater promoter activity then pGL3-E16 indicating that the GAGA-box and possibly the TSS at -280 bp are important for fu ll promoter activity under these conditions. The five exon 2 experimental clon es used to evaluate promoter activity were pGL3-P11, which spans the genomic region -189 bp to +101 bp (exon 2, TSS +1) and cont ained the core and enhancer cis elements. The truncated pGL3-P7 spanned -189 bp to +36 bp, was designed to exclude the 3’ NF-kBp65, cREL cis -elements yet contained the core and 5’ enhancer cis -elements. The pGL3-P8 was further truncated at the 5’end to span -90 bp to +36 bp and contained only core promoter cis -elements along with the 5’ cREL enhancer cis element. The pGL3-P13(-25,+101) trunc ated at the 5’ end to include a third of the TATA-box an d 3’ core and enhancer cis -elements. The pGL3-P10(+13,+205) clone truncated at the 5’ end to exclude the TATA-box and INR core cis-elements but extended at the 3’ end to include a portion of the GenBank designated exon 2 sequence. The reporter assay for the exon 2 clon es demonstrated that the core promoter vector pGL3-P8 was su fficient to produce significant promoter activity. However, increase d promoter activity was seen with

PAGE 70

59 the pGL3-P7 clone, which contained the 5’ Sp1 cis -element as well as the pGL3-P11 clone that contained the 5’ Sp1 and the 3’ NF-kBp65, cREL cis -elements. No significant prom oter activity was observed for either the pGL3-P10 or -P13 clones demonstrating that the TATA-box as well as the INR are needed for fu ll promoter activity (Figure 17B). In all, these results demonstrated that the Cnr2 genomic region containing the TSSs as well as core promoter cis -elements for exons 1a, 1b and 2 contained strong promoter activity as judged by these luciferase expression studies.

PAGE 71

60 A. +1 exon 1b TSSs exon 3 ORFexon 1a +68 +205 -359 +68 +31 -25 +10 +1 -270 -270 SV40P +205+63 +205 -359 L+ E L+ E L+ E L+ E L+ E 020406080 E16 E25 E19* * B.P11 P7 P8 P13 P10 -90 +13 +205 +101 -189 -25 +101 +36 +36 -189 051015 +252 +205 +101 +70 +25 -21 -90 -189 +11 +1 SV40P L+ E L+ E L+ E L+ E L+ E L+ E L+ E exon 3 ORF exon 2+1 * * STAT6 Key: INR TATA-box DCE DPE NF-Kb, p50 GAGA-box CORE ELEMENTS; ENHANCERS; p65 cREL Sp1 Elk-1 Figure 17. pGL3Cnr2 Luciferase Activity in IL-4/anti-CD40 Activated B Cells. A. Exon 1 putative Cnr2 promoter pGL3-clones. B. Exon 2 putative Cnr2 promoter pGL3-clones.

PAGE 72

61 Aim 3. To Determine CB2 Transcript Usage in Activated B Cells as well as Other Immune Cell Subtypes CB2 Transcript Expression in Mouse Activated B cells Since CB2 is abundant in B cells and implicated in the involvement of various B cell function s, an understanding of transcript usage under varying conditions of B cell activation is of interest. The literature shows that stimulation of B cells with anti-CD40 and/or IL-4, through STAT6 ( cissequence found in both CB2 putative promoter regions) activation, increases CB2 expression (8) (25) (42), whereas, LPS stimulation suppresses expression (26). LPS through TLR4 triggers an intracellular signaling cascade, similar to anti-CD40/CD40 binding, that activates the trans -regulatory factors Elk1 and NF-kB (found in the CB2 putative promoters). Both IL 4/anti-CD40 and LPS promote B cell maturation and isotype switching. Therefore, to gain a better understanding of CB2 transcipt usage in activated B cells, we stimulated pr imary B cells with either LPS ornd the co-stimulatory molecule anti-C D40. To determine the relative expression of the CB2 transcript variants, total RNA was collected at 1, 3, and 8 hrs following stimulation fo r RT-qPCR analysis. We looked at the expression of the CB2 coding exon (exon 3, Figure 18A) and observed a steady increase over time following LPS stimulation.

PAGE 73

62 Furthermore, using exon-specific pr imers and taqman probes revealed that LPS induced significant expressi on of the non-coding exon 1b and 2 transcripts, whereas, the exon 1a transcript remained at baseline (Figure 18B). B cells activated by IL-4 and anti-CD40 undergo class switch recombination (CSR) changing the C region of the H chain to switch from IgM to IgE. Our lab has prev iously shown that IL4/anti-CD40 stimulation increased CB2 expression in B cells at the message (25) and protein level (1). In addition to this, our lab has also shown that co-treatment of the IL-4/anti-CD40 stimulated B cells with the CBR agonist CP55940 increased immunoglobu lin class switching to IgE. To determine the effective dose of IL-4, we initially looked at CB2 the coding exon 3 expression using two concentrations of IL-4 (3 and 10 ng/ml) with anti-CD40 (0.5 g/ml). Exon 3 expression was significantly higher in B cells stimul ated with 3 ng/ml of IL-4 compared to B cells stimulated with 10 ng/ml (Figure 19A). Therefore, we used the 3 ng/ml concentration of IL-4 with anti-CD40 to investigate CB2 transcript variant expression. Followi ng stimulation exon 3 increased within the first hour and maintain ed a steady state of expression thereafter (Figure 19A). On th e other hand, non-coding exon expression increased increased 1 hr following stimulation with exon 2

PAGE 74

63 continuing to increase over time, while the exons 1a and 1b returned to baseline by three hrs post stim ulation (figure 19B). These results demonstrated for the first time that CB2 transcript usage differs in B cells depending upon the state of activation of the cell with exon 1a predominating under basal conditions and exons 1b and 2 under varying conditions of activation.

PAGE 75

64 0 2 4 6 8 10 12 01 HR3 HRS8 HRS exon 1a exon 1b exon 2A. B. 0 2 4 6 8 10 12 14 exon 3Relative expression Relative expressionn = 3 * * Lps 5 g/ml Figure 18. LPS Induces the Expression of the CB2 Exon 1b and 2 Transcripts in Primary B cells. Primary B cells were cultured for 1, 3, and 8 hrs in RPMI medium containing 5 g/ml LPS. Total RNA was isolated and 1 g was used for RT-qPCR A Total CB2 message expression (exon 3) increases over time with LPS stimulation. B Exon 1b and 2 transcripts expression is significantly increased overtime whereas the exon 1a transcript remains at baseline. Results were obtained by the 2CT method in which actin is the endogenous control and un-stimulated B cells (time 0) as the calibrator. Data are means S.E.M. of three independent experiments. Significance at P = 0.05

PAGE 76

65 0 10 20 30 40 50 60 70 0 hrs1 hr3 hrs8 hrs exon 1a exon 1b exon 2 0 3 6 9 12 3 ng/ml IL4 10 ng/ml IL4 A. B. 1a 1b 2Relative expression Relative expression Figure 19. Primary B cells Stim ulated with IL4 and anti-CD40. Primary B cells were cultured for 1, 3, and 8 hrs in RPMI medium containing IL-4 and 500 ng/ml anti-CD40. Total RNA was isolated and 1 g was used for RT-qPCR A Total CB2 expression (exon 3) signific antly increases with 3 ng/ml compared to 10 ng/ml IL-4 and 500 ng /ml anti-CD40. The exon 2 transcript steadily increases with stimulation of 3 ng/ml IL-4.

PAGE 77

66 CB2 Transcript Expression in Immune Cell Subtypes The bioinformatics analysis perf ormed in Aim 1 of the GenBank CB2 clones suggested that expression of the first 5’UTR exon (1 and 2) variants could be related to tissue or cell type, the clones of immune tissue expressed exon 1, and other ti ssue types expressed exon 2. In spite of this, 5’ RACE show ed that B cells expressed CB2 transcripts containing two variants of exon 1 and a single exon 2 variant. Since the previously described GenBank cl ones were obtained from immune tissues, and provided no informat ion on transcript expression in immune cell subtypes, we wanted to investigate CB2 expression in other immune cells other than B ce lls. Total RNA was isolated from purified un-stimulated T cells, dendritic cells, and macrophages for 5’ RACE analysis. The re sults showed that CB2 transcript expression was unique to immune cell subtypes. For example, T cells expressed only the exon 1a variant, whereas dendritic cells and macrophages expressed two transcript variants (exon 1a and 2). Most interesting was that the exon 1b variant was on ly observed in B cells (Figure 20). To confirm the expression of the tr anscript variants in the immune cell subtypes, RT-qPCR using exon spec ific primers and taqman probes was done (Figure 21). Coding exon 3 transcript expression was highest in B cells, followed by dendritic ce lls, then macrophages and T cells

PAGE 78

67 expressing the least (Figure 21A). The exon 1a variant was the major CB2 transcript seen in T cells. Dendritic cells and macrophages expressed both the exon 1a and 2 variants, however the relative expression of exon 2 was much high er in the dendritic cells (Figure 21B). The expression of the exon 1b variant was exclusive to B cells, though a negligible amount was ob served in dendritic cells, which could be from amplification of residual genomic DNA. These results showed for the first time that the CB2 transcript expression profile is different among the immune cell subt ypes and that variant expression could be related to cell type and/or cell function. In addition, among these immune cell subtypes, the exon 1b variant was observed only in B cells and therefore could potentially be a cell specific target for CB2 expression in this cell type.

PAGE 79

68 S BTN exon 1a exon 2 exon 1b MW DM N MW exon 1a exon 2 500 bp 500 bp Figure 20. Immune Cell Subtypes 5’ RACE CB2 Transcripts. Gel electrophoresis of the RACE products isolated from Splenocytes, B cells T cells (top panel) dendritic cells and macrophages (bottom panel).

PAGE 80

69 0 10 20 30 40 50 exon 3 0 10 20 30 40 B cellT cellDCMo exon 1a exon 1b exon 2 Figure 21. Quantitative RT-qPCR of the CB2 Transcripts in Immune Cell Subtypes. Using 1 g of total RNA isolated from un-stimulated B cells, T cells, Dendritic cells (DC) and macrophages (Mo) CB2 transcript usage was determined. A Total CB2 expression (exon 3) in the immune cell subtypes. B CB2 transcript expression in the immune cell subtypes.

PAGE 81

70 CB2 Transcript Expression in Development of B cells In A recent study investigating CB2 mediation of immature B cell retention in bone marrow sinusoids (37) showed a two-fold higher expression of CB2 in immature B cells compar ed to pre-B cells and that CB2 deficiency led to a lowe r frequency of the Ig light -chain ( +) immature and mature B cells in th e blood and spleen, thus suggesting a role for CB2 in the formation of the B cell repertoire. In addition the results above have shown th at expression of the CB2 transcript variants can be related to immune cell subtype as well as the activation state of B cells. Th erefore, we investigated CB2 transcript expression in three different B cell lines representing B cell development from the pre-B st age to the mature stage. The three mouse B cell lines used were; 18.81, an Abelson virus-transformed pre-B cell line that synthesizes only H chain, no light chain is produced. WEHI-231, an i mmature B lymphoma cell line that lacks Fc receptors and expresses on ly surface IgM and not IgD. K46 a mature B lymphoma cell line that expresses surface IgM and IgD. The 5’ RACE of the different cell lin es showed that the pre-B cell line expressed the exon 1a transcript and that the immature B cell line WEHI-231 and the mature B cell Line K46 express all three transcripts but at different leve ls (Figure 22A). Therefore, we

PAGE 82

71 performed RT-qPCR to dete rmine the predominant CB2 transcript expressed in these B cell lines. CB2 coding exon 3 was observed to be the highest in WEHI-231 (immature) and lower in 18.81 and K46 The predominant CB2 transcript observed in 18.81 and WEHI-231 was the exon 1a transcrip t, whereas the exon 1b transcript was predominant in the mature K46 B cell line (Figure 22B). The data suggested that expression of the CB2 transcript variants could be related to the developmental stage of B cells. In addition these results further support that CB2 transcript usage varies in response to changes in B cell biology.

PAGE 83

72 1kb exon 1b exon 2 exon 1aA. 0 0.1 0.2 0.3 0.4 exon 3 0 0.1 0.2 0.3 18.81WEHI-231K46mu exon 1a exon 1b exon 2B. Figure 22. CB2 Transcript Expression in B Cell Lines. A. Gel electrophoresis of the 5’ RACE prod ucts present in the B cell lines. B RTqPCR for CB2 transcript expression in the B cell lines.

PAGE 84

73 DISCUSSION The relative robust expression of CB2 in human and mouse B cells suggests that this receptor may have an important role in B cell biology. However, only a few reports have investigated the function of CB2 in B cells. Furthermore, examination of the CB2 transcript expression and Cnr2 regulatory elements (i.e. promoter and TSS) in B cells had not been reported. Theref ore, we investigated the genomic sequences involved in transcription of CB2 by identifying the TSSs, mRNA transcripts and core promoter regions in purified resting and activated mouse B cells. Our data provide the first evidence that resting splenic B cells in mice use multiple TSSs and express at least three CB2 transcript variants. Based on present models of transcription initiation it is possible that two mechanisms of tran scription could be involved in the generation of these variants: 1) al ternative splicing of the 5’UTRs in the case of exons 1 or 2, and in fact donor-acceptor sites occur in these regions; and 2) alternative tr anscription initiation (dispersed initiation, see below) generating ex on 1 variants that differ in the

PAGE 85

74 length of their 5’ ends. The latter ev ent may have occurred in the case of exon 1 in that we observed different lengths of the 5’ ends ranging over 295 bps and containing a cluste r of four TSSs. Interestingly, a cluster of TSSs was predicted by the database, DBTSS, in the 5’ flanking regions of exons 1 and 2; furthermore, multiple TSSs were reported in GenBank CB2 clones from various tissues in these same regions. Our RACE products from B cells identified new TSSs for exons 1 and 2 that were not only different than reported in other tissues but for the most part longer at the 5’ ends. Because of these many TSSs spread over hundreds of bps, we analyzed for core promoter sequences in these areas using an in silico approach. Interestingly, we found consensus core promoter se quences such as INR, DPE, DCE along with either TATA or GC boxes in abundance and in proximity to all of the TSSs expressed in mo use and the one TSS expressed in human B cells (see Figure 14). Howe ver, although present, these sequences were in different numbers and relative distances to the TSS position suggesting heterogeneity in core promoter activity under resting and activated conditions. Althou gh the functional significance of multiple TSSs and core promoter s is unknown, previous studies suggested this heterogeneity relates to cell type and/or cell activation state. This was observed in studies on the control of alternative first

PAGE 86

75 exons of the glucocorticoid receptor (GR) which are under the control of specific transcription factors that control both tissue specific and cell activation state specific GR expression (49). This was also observed with adenosine A2A receptor (A2AR) 5’UTR splice variants wherein the long 5’UTR A2AR variants were obse rved in resting PMNs, whereas the short 5’UTRs were expressed to a gr eater extent in LPSstimulated cells suggesting short 5’UTR variants were more efficiently translated (23) and suggesting the length of the 5’UTR can be a factor in determining tissue specificity and cell activation state. In our mouse CB2 studies, different TSSs and transcript expression were observed in different cell types. For example, resting T cells expressed only the exon 1a variant (Figures 20 & 21) and variants of this have been report ed in thymocytes, splenocytes, and the macrophage like cell line, NFS107 (GenBank accession nos. AK037898, X86405, and NM009924). Whereas, bone and liver tissue (GenBank accession nos. BC024052 and AK036658) expressed the exon 2 variant though shorte r at the 5’end than wh at was observed in B cells. Besides T cells, variation of CB2 transcript expression was observed in other immune cell su btypes. For example, purified dendritic cells and macrophages expressed the exon 1a and 2 variants(Figure 20), though in dendri tic cells the expression of the two

PAGE 87

76 variants was more or less equal, wh ereas in macrophages the exon 1a variant was expressed five-fold higher than the exon 2 variant (Figure 21). Furthermore, resting splenic B cells expressed 3 CB2 transcripts with an expression rank order of ex on 1a > exon 2 > exon 1b, and of interest expression of the exon 1b variant was only observed in B cells (Figures 13 and 21). This variation in transcript expression among the various subtypes may be accounted fo r by variations in core promoter activity surrounding the different TSSs. In contrast to the multiple TSSs and transcript variants we saw in mouse cells, human peripheral B ce lls collected from three different donors expressed a single CB2 transcript and TSS (Figure 7). Interestingly, our observations in mouse and human are in line with those showing that two different strategies are employed by Pol II for transcription initiation. The h CNR2 appears to utilize the more common strategy termed “focused initiation” in which a single TSS and the core promoter contains a TATA-box, BREd, INR, and DPE. On the other hand, the m Cnr2 is more like the second strategy that involves multiple weak TSSs dispersed over DNA regions of approximately 50 to 150 bps, thereby dubbed “dispersed initiation” (21). The mechanisms of dispersed initiation are not cl ear but probably involve selective

PAGE 88

77 usage of multiple upstream and do wnstream recognition and promoter elements similar to what we observed surrounding the mouse TSSs. Different mCB2 transcripts are not only associated with different cell types but also with different ce ll activation states. Using RT-qPCR, we showed that the mouse exon 1a transcript was predominantly expressed in resting splenic B cells (Figure 13) but that exons 1b and 2 were more pronounced in the LPS-activated B cells (Figure 18B), and that exon 2 increased in IL-4/ant i-CD40 stimulated B cells (Figure 19B). A possible explanation of the observed variation in CB2 transcript expression is the presence of proximal regulatory cis -sequences to the transcript TSS. Because in addition to core promoter activity, cell activation can lead to gene transcr iption through enhancer elements on the DNA either 5’ or 3’ to the core promoter region (5). Interestingly, the in silico analysis performed in Aim 2 identified proximal NF-kB (-82 and +72 bp) as well as STAT6 (-6 and +12 bp) cis -sequences 5’ and 3’ of the TSS( +1) for exon 2 (Figure 15B), which may account for the observed incr ease expression of the exon 2 variant in B cells activated by LPS or IL-4/anti-CD40 since it is well known that LPS, IL-4 and anti-C D40 activate B cells through an increase in NF-kB (12, 44, 47) and with IL-4 through activation of STAT6. In addition, pGL3Cnr2 reporter plasmid transfected mouse B

PAGE 89

78 cells containing exon 2 genomic DNA constructs spanning -189 to +101 bp showed strong promoter acti vity when stimulated with IL-4 and anti-CD40 antibodies (Figure 17B); non-stimulated cells showed little luciferase activity (data not shown). Which the 5’ NF-kB cis sequence appears to be important for promoter activation, because constructs in which the 3’ NF-kB site has been omitted still exhibit strong promoter activity (Figure 17B ), in contrast to the much lower activity observed reporter constructs in which the 5’ NF-kB site has been deleted (Figure 17B). Furthermor e, it is In addition to NF-kB, STAT6 binding might also be involved in the significant increase of the exon 2 transcript observed in B cells stimulated with IL-4/anti-CD40, because two putative STAT6 sites ar e located at -6 and +12 bp of the TSS(+1) of exon 2 (Figure 15B). Ho wever, as reported previously (Thieu 2007), NF-kB may be required for binding of STAT6, supported by the minimal to no promoter activi ty observed in the exon 2 reporter constructs in which one or both ST AT6 sites are present but the 5’ NFkB site has been deleted (Figure 17B). However, further analysis is required to determine the Cnr2 regulatory relationship of these cis sequences for the trans -factors under these conditions in B cells. In addition to the variation of CB2 transcript expression seen in activated B cells, differences in CB2 transcript expression was also

PAGE 90

79 observed in B cell development. RA CE and RT-qPCR analysis of CB2 transcript expression in three mouse B cell lines representing different stages of development showed that pre-B cells expressed only the exon 1a variant, whereas immature and mature B cells express all three variants, though at varying levels. Expression of the transcript variants was greatest in the imma ture B cells, notably the exon 1a variant, whereas mature B cells expr essed mainly the exon 1b variant (Figure 22). Our results are in line with a recent report in which CB2 transcript expression was higher in immature B cells located in bone marrow sinusoids when compared to other developmental stages and suggested a function for CB2 in the formation of the B cell repertoire (Pereira 2009).

PAGE 91

80 SUMMARY In summary, we have characteri zed for the first time multiple TSSs that define alternative CB2 transcripts in mouse splenic B cells as well as a single TSS and transcript in human PBMC B cells. We were able to confirm by RT-PCR primer ma pping, the relative location of the TSS for mouse exons 1b and 2, as well as the human exon 1. These experimentally defined TSSs directed further in silico analysis and showed that these regions contain consensus sequences for multiple elements such as TATA-box, INR an d DPE. These elements were found at the expected distances from the TSSs and by reporter assay experiments these segments contained significant promoter activity inferring that we correctly identifi ed several of the TSSs in mouse B cells as well as identify the location of two promoters. In addition, we identified CB2 transcript usage in restin g B cells as well as other immune cell subtypes, in which the exon 1b transcript appears to be unique to B cells and therefore may se rve as a therapeutic target in B cells. In addition, CB2 transcript expression wa s different in the mouse B cell lines representing various matu ration stages. Furthermore, we

PAGE 92

81 identified CB2 transcript expression in LPS and IL-4/anti-CD40 activated B cells, in which the exon 1b and exon 2 variants appear to be important. The stimuli used in this study ar e known inducers of class switch recombination (CSR) and previous work done in our lab has suggested a role for CB2 receptor activation in enhancing IL-4/anti-CD40 CSR from IgM to IgE, therefore it is po ssible from our work here, that exon 1b transcripts are unique to B ce lls and therefore provide a gene target for suppressing CB2 expression in only B cells and not other immune cell subtypes. The identification of the CB2 transcripts expressed during these conditions will guide future studies in regulating this receptor at the ge ne level, and provide possible gene targets(i.e. RNA silencing) for the therapeutic application in suppressing CB2 and IgE production in Allergic diseases.

PAGE 93

82 REFERENCES 1. Agudelo, M., C. Newton, R. Widen, T. Sherwood, L. Nong, H. Friedman, and T. Klein. 2008. Cannabinoid Receptor 2 (CB2) Mediates Immunoglobulin Class Switching from IgM to IgE in Cultures of Murine-Purified B Lymphocytes. Journal of NeuroImmune Pharmacology 3:35-42. 2. Alberich Jorda, M., N. Rayman, M. Tas, S. E. Verbakel, N. Battista, K. van Lom, B. Lowe nberg, M. Maccarrone, and R. Delwel. 2004. The peripheral cannabinoid receptor Cb2, frequently expressed on AML blas ts, either induces a neutrophilic differentiation block or confers abnormal migration properties in a ligand-dependent manner. Bl ood 104:526-534. Epub 2004 Mar 2023. 3. Allman, D., B. Srivastava, and R. C. Lindsley. 2004. Alternative routes to maturity: branch poin ts and pathways for generating follicular and marginal zone B cells. Immunological reviews 197:147-160.

PAGE 94

83 4. Basavarajappa, B. S. 2007. Neuropharmacology of the endocannabinoid signaling sy stem-molecular mechanisms, biological actions and synaptic plasticity. Current neuropharmacology 5:81-97. 5. Birney, E., J. A. Stamatoyannopo ulos, A. Dutta, R. Guigo, T. R. Gingeras, E. H. Margulies, Z. Weng, M. Snyder, E. T. Dermitzakis, R. E. Thurman, M. S. Kuehn, C. M. Taylor, S. Neph, C. M. Koch, S. Asthana, A. Malhotra, I. Adzhubei, J. A. Greenbaum, R. M. Andrews, P. Flicek P. J. Boyle, H. Cao, N. P. Carter, G. K. Clelland, S. Davis, N. Day, P. Dhami, S. C. Dillon, M. O. Dorschner, H. Fiegler, P. G. Giresi, J. Goldy, M. Hawrylycz, A. Haydock, R. Humbert, K. D. James, B. E. Johnson, E. M. Johnson, T. T. Frum, E. R. Rosenzweig, N. Karnani, K. Lee, G. C. Lefebvre, P. A. Navas, F. Neri, S. C. Parker, P. J. Sabo, R. Sandstrom, A. Shafer, D. Vetrie, M. Weaver, S. Wilcox, M. Yu, F. S. Collins, J. Dekker, J. D. Lieb, T. D. Tullius, G. E. Crawford, S. Sunyaev, W. S. Noble, I. Dunham, F. Denoeud, A. Reymond, P. Kapranov, J. Rozowsky, D. Zheng, R. Castelo, A. Frankish, J. Harrow, S. Ghosh, A. Sandelin, I. L. Hofacker, R. Baertsch, D. Keefe, S. Dike, J. Cheng, H. A. Hirsch, E. A. Sekinger, J. Lagarde, J. F. Abril, A. Shah ab, C. Flamm, C. Fried, J.

PAGE 95

84 Hackermuller, J. Hertel, M. Lindemeyer, K. Missal, A. Tanzer, S. Washietl, J. Korbel, O. Emanuelsso n, J. S. Pedersen, N. Holroyd, R. Taylor, D. Swarbreck, N. Ma tthews, M. C. Dickson, D. J. Thomas, M. T. Weirauch, J. Gilbert, J. Drenkow, I. Bell, X. Zhao, K. G. Srinivasan, W. K. Sung, H. S. Ooi, K. P. Chiu, S. Foissac, T. Alioto, M. Brent, L. Pachter, M. L. Tress, A. Valencia, S. W. Choo, C. Y. Choo, C. Ucla, C. Manzan o, C. Wyss, E. Cheung, T. G. Clark, J. B. Brown, M. Ganesh, S. Patel, H. Tammana, J. Chrast, C. N. Henrichsen, C. Kai, J. Kawai, U. Nagalakshmi, J. Wu, Z. Lian, J. Lian, P. Newburger, X. Zhang, P. Bickel, J. S. Mattick, P. Carninci, Y. Hayashizaki, S. Wei ssman, T. Hubbard, R. M. Myers, J. Rogers, P. F. Stadler, T. M. Lowe, C. L. Wei, Y. Ruan, K. Struhl, M. Gerstein, S. E. Antona rakis, Y. Fu, E. D. Green, U. Karaoz, A. Siepel, J. Taylor, L. A. Liefer, K. A. Wetterstrand, P. J. Good, E. A. Feingold, M. S. Guye r, G. M. Cooper, G. Asimenos, C. N. Dewey, M. Hou, S. Niko laev, J. I. Montoya-Burgos, A. Loytynoja, S. Whelan, F. Pardi, T. Massingham, H. Huang, N. R. Zhang, I. Holmes, J. C. Mullikin, A. Ureta-Vidal, B. Paten, M. Seringhaus, D. Church, K. Rosenbloom, W. J. Kent, E. A. Stone, S. Batzoglou, N. Goldman, R. C. Hardison, D. Haussler, W. Miller, A. Sidow, N. D. Trinklein, Z. D. Zhang, L. Barrera, R. Stuart, D.

PAGE 96

85 C. King, A. Ameur, S. Enroth, M. C. Bieda, J. Kim, A. A. Bhinge, N. Jiang, J. Liu, F. Yao, V. B. Vega, C. W. Lee, P. Ng, A. Shahab, A. Yang, Z. Moqtaderi, Z. Zhu, X. Xu, S. Squazzo, M. J. Oberley, D. Inman, M. A. Singer, T. A. Richmond, K. J. Munn, A. RadaIglesias, O. Wallerman, J. Komorowski, J. C. Fowler, P. Couttet, A. W. Bruce, O. M. Dovey, P. D. Ellis, C. F. Langford, D. A. Nix, G. Euskirchen, S. Hartman, A. E. Urban, P. Kraus, S. Van Calcar, N. Heintzman, T. H. Kim, K. Wang C. Qu, G. Hon, R. Luna, C. K. Glass, M. G. Rosenfeld, S. F. Al dred, S. J. Cooper, A. Halees, J. M. Lin, H. P. Shulha, X. Zhang, M. Xu, J. N. Haidar, Y. Yu, Y. Ruan, V. R. Iyer, R. D. Green, C. Wadelius, P. J. Farnham, B. Ren, R. A. Harte, A. S. Hinrichs H. Trumbower, H. Clawson, J. Hillman-Jackson, A. S. Zweig, K. Smith, A. Thakkapallayil, G. Barber, R. M. Kuhn, D. Karolchik, L. Armengol, C. P. Bird, P. I. de Bakker, A. D. Kern, N. Lopez-Bigas, J. D. Martin, B. E. Stranger, A. Woodroffe, E. Davydov A. Dimas, E. Eyras, I. B. Hallgrimsdottir, J. Huppert, M. C. Zody, G. R. Abecasis, X. Estivill, G. G. Bouffard, X. Guan, N. F. Hansen, J. R. Idol, V. V. Maduro, B. Maskeri, J. C. McDowell, M. Park, P. J. Thomas, A. C. Young, R. W. Blakesley, D. M. Muzny, E. Sodergren, D. A. Wheeler, K. C. Worley, H. Jiang, G. M. Weinstock, R. A. Gibbs, T.

PAGE 97

86 Graves, R. Fulton, E. R. Mardis, R. K. Wilson, M. Clamp, J. Cuff, S. Gnerre, D. B. Jaffe, J. L. Chang, K. Lindblad-Toh, E. S. Lander, M. Koriabine, M. Nefedov, K. Osoegawa, Y. Yoshinaga, B. Zhu, and P. J. de Jong. 2007. Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project. Nature 447:799-816. 6. Burstein, S. H., and R. B. Zurier. 2009. Cannabinoids, endocannabinoids, and related analogs in inflammation. The AAPS journal 11:109-119. 7. Cabral, G. A., and L. GriffinThomas. 2009. Emerging role of the cannabinoid receptor CB2 in im mune regulation: therapeutic prospects for neuroinflammation. Expert reviews in molecular medicine 11:e3. 8. Carayon, P., J. Marchand, D. Dussossoy, J. M. Derocq, O. Jbilo, A. Bord, M. Bouaboula, S. Galiegue, P. Mondiere, G. Penarier, G. LeFur, T. Defrance, and P. Ca sellas. 1998. Modulation and functional involvement of CB2 pr eipheral cannabinoid receptors during B-cell differentia tion. Blood 92:3605-3615. 9. Casali, P., and H. Zan. 2004. Class switching and Myc translocation: how does DNA break? Nature immunology 5:1101-1103.

PAGE 98

87 10. Clark, A. J., M. A. Ware, E. Yaze r, T. J. Murray, and M. E. Lynch. 2004. Patterns of cannabis use am ong patients with multiple sclerosis. Neurology 62:2098-2100. 11. Crick, F. 1970. Central dogma of molecular biology. Nature 227:561-563. 12. Dadgostar, H., B. Zarnegar, A. Hoffmann, X. F. Qin, U. Truong, G. Rao, D. Baltimore, and G. Cheng. 2002. Cooperation of multiple signaling pathways in CD40-regulated gene expression in B lymphocytes. Proceedings of the National Academy of Sciences of the United St ates of America 99:1497-1502. 13. Derocq, J., M. Segui, J. Marchand, G. LeFur, and P. Casellas. 1995. Cannabinoids enhance human B-cell growth at low nanomolar concentrations. FEBS letters 369:177-182. 14. Dunnick, W. A., J. T. Collins, J. Sh i, G. Westfield, C. Fontaine, P. Hakimpour, and F. N. Papavasiliou. 2009. Switch recombination and somatic hypermutation are co ntrolled by the heavy chain 3' enhancer region. The Journal of experimental medicine 206:2613-2623. 15. Durandy, A. 2003. Activation-ind uced cytidine deaminase: a dual role in class-switch recombinat ion and somatic hypermutation. European journal of immunology 33:2069-2073.

PAGE 99

88 16. Galieque, S., S. Mary, J. Marcha nd, D. Dussossoy, D. Carriere, P. Carayon, M. Bouaboula, D. Shire, G. Le Fur, and P. Casellas. 1995. Expression of central and peripheral cannabinoid receptors in human immune tissues and leuk ocyte subpopulations. Eur. J. Biochem. 232:54-61. 17. Gross, P., and T. Oelgeschlage r. 2006. Core promoter-selective RNA polymerase II transcription. Biochemical Society symposium:225-236. 18. Hornby, P. J., and S. M. Prouty. 2004. Involvement of cannabinoid receptors in gut motility and visceral perception. British journal of pharmacology 141:1335-1345. 19. Howlett, A. C., J. M. Qual y, and L. L. Khachatrian. 1986. Involvement of Gi in the inhibition of adenylate cyclase by cannabimimetic drugs. Molec. Pharmacol. 29:307-313. 20. Jorda, M. A., S. E. Verbakel, P. J. Valk, Y. V. Vankan-Berkhoudt, M. Maccarrone, A. Finazzi-Agro, B. Lowenberg, and R. Delwel. 2002. Hematopoietic cells expressing the peripheral cannabinoid receptor migrate in response to the endocannabinoid 2arachidonoylglycerol. Blood 99:2786-2793.

PAGE 100

89 21. Juven-Gershon, T., J. Y. Hsu, and J. T. Kadonaga. 2006. Perspectives on the RNA polymerase II core promoter. Biochemical Society transactions 34:1047-1050. 22. Klein, T. W., and C. A. Newt on. 2007. Therapeutic potential of cannabinoid-based drugs. Advances in experimental medicine and biology 601:395-413. 23. Kreth, S., C. Ledderose, I. Kaufmann, G. Groeger, and M. Thiel. 2008. Differential expression of 5'-UTR splice variants of the adenosine A2A receptor gene in human granulocytes: identification, characterization and functional impact on activation. Faseb J 22:3276-3286. 24. Lambert, D. M. 2007. Medicina l chemistry endeavors around the phytocannabinoids. Chemistry & biodiversity 4:1707-1728. 25. Lee, S. F., C. Newton, R. Widen, H. Friedman, and T. W. Klein. 2001. Differential expression of cannabinoid CB2 receptor mRNA in mouse immune cell subpopu lations and following B cell stimulation. Eur. J. Pharmacol. 423:235-241. 26. Lee, S. F., C. Newton, R. Widen, H. Friedman, and T. W. Klein. 2001. Downregulation of cann abinoid receptor 2 (CB2) messenger RNA expression during in vitro stimulation of murine

PAGE 101

90 splenocytes with lipopolysaccharid e. Advances in experimental medicine and biology 493:223-228. 27. Matsuda, L. A., S. J. Lolait, M. J. Brownstein, A. C. Young, and T. I. Bonner. 1990. Structure of cannabinoid receptor and functional expression of the cloned cDNA. Nature 346:561-564. 28. Mortazavi, A., B. A. Williams, K. McCue, L. Schaeffer, and B. Wold. 2008. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nature methods 5:621-628. 29. Muccioli, G. G. 2007. Blocking the cannabinoid receptors: drug candidates and therapeutic promises. Chemistry & biodiversity 4:1805-1827. 30. Munro, S., K. L. Thomas, and M. Abu-Shaar. 1993. Molecular characterization of a peripher al receptor for cannabinoids. Nature 365:61-65. 31. Pacher, P., and B. Gao. 2008. Endocannabinoid Effects on Immune Cells: Implications for Inflammatory Liver Diseases. Am J Physiol Gastrointest Liver Physiol. 32. Page, S. A., and M. J. Verhoe f. 2006. Medicinal marijuana use: Experiences of people with mult iple sclerosis. Can Fam Physician 52:65.

PAGE 102

91 33. Page, S. A., M. J. Verhoef, R. A. Stebbins, L. M. Metz, and J. C. Levy. 2003. Cannabis use as described by people with multiple sclerosis. Can J Neurol Sci 30:201-205. 34. Parker, D. C. 1993. T cell-depe ndent B cell activation. Annual review of immunology 11:331-360. 35. Pearson, H. 2006. Genetics: what is a gene? Nature 441:398401. 36. Pennisi, E. 2007. Genomics. DNA st udy forces rethink of what it means to be a gene. Science (New York, N.Y 316:1556-1557. 37. Pereira, J. P., J. An, Y. Xu, Y. Huang, and J. G. Cyster. 2009. Cannabinoid receptor 2 mediates the retention of immature B cells in bone marrow sinusoids. Nature immunology 10:403-411. 38. Pertwee, R. G. 2006. Cannabi noid pharmacology: the first 66 years. British journal of pharmacology 147 Suppl 1:S163-171. 39. Rayman, N., K. H. Lam, J. D. Laman, P. J. Simons, B. Lowenberg, P. Sonneveld, and R. Delwel. 2004. Distinct expression profiles of the periph eral cannabinoid receptor in lymphoid tissues depending on receptor activation status. J Immunol 172:2111-2117. 40. Riccardo, S., G. Tortoriello, E. Giordano, M. Turano, and M. Furia. 2007. The coding/non-codin g overlapping architecture of

PAGE 103

92 the gene encoding the Drosoph ila pseudouridine synthase. BMC molecular biology 8:15. 41. Sandelin, A., P. Carninci, B. Lenhard, J. Ponjavic, Y. Hayashizaki, and D. A. Hume. 2007. Mammalian RNA polymerase II core promoters: insights from genome -wide studies. Nature reviews 8:424-436. 42. Schroder, A. J., P. Pavlidis, A. Arimura, D. Capece, and P. B. Rothman. 2002. Cutting edge: ST AT6 serves as a positive and negative regulator of gene ex pression in IL-4-stimulated B lymphocytes. J Immunol 168:996-1000. 43. Smale, S. T., and J. T. Kadonaga. 2003. The RNA polymerase II core promoter. Annual review of biochemistry 72:449-479. 44. Snapper, C. M., F. R. Rosas, P. Zelazowski, M. A. Moorman, M. R. Kehry, R. Bravo, and F. We ih. 1996. B cells lacking RelB are defective in proliferative respon ses, but undergo normal B cell maturation to Ig secretion and Ig class switching. The Journal of experimental medicine 184:1537-1541. 45. Stavnezer, J., and C. T. Am emiya. 2004. Evolution of isotype switching. Seminars in immunology 16:257-275.

PAGE 104

93 46. Stavnezer, J., J. E. Guikema, and C. E. Schrader. 2008. Mechanism and regulation of clas s switch recombination. Annual review of immunology 26:261-292. 47. Thieu, V. T., E. T. Nguyen, B. P. McCarthy, H. A. Bruns, R. Kapur, C. H. Chang, and M. H. Kaplan. 2007. IL-4-stimulated NF-kappaB activity is required fo r Stat6 DNA binding. Journal of leukocyte biology 82:370-379. 48. Tolar, P., H. W. Sohn, and S. K. Pierce. 2008. Viewing the antigen-induced initiation of Bcell activation in living cells. Immunological reviews 221:64-76. 49. Turner, J. D., A. B. Schote, J. A. Macedo, L. P. Pelascini, and C. P. Muller. 2006. Tissue specific glucocorticoid receptor expression, a role for alternative first exon usage? Biochem Pharmacol. 50. Wang, X., and B. Seed. 2003. A PCR primer bank for quantitative gene expression an alysis. Nucleic acids research 31:e154. 51. Yarden, G., R. Elfakess, K. Gazit, and R. Dikstein. 2009. Characterization of sINR, a strict version of the Initiator core promoter element. Nuclei c acids research 37:4234-4246.

PAGE 105

94 ABOUT THE AUTHOR Tracy Sherwood received a Bach elor’s Degree in Biology from the University of South Florida in 1998. She then worked for Dr Jane Polston at the University of Fl orida’s Gulf Coast Education and Research Center in Bradenton Flor ida from October of 1998 until April of 2003. While there sh e coauthored four peer-reviewed publications investigating Geminiviruses that infe ct some of the major crops in the state. In May of 2003 she ente red the Ph.D. program in the Department of Medical Microbiology and Immunology (Department of Molecular Medicine), College of Medi cine at the University of South Florida. While in the Ph.D. program at th e University of South Florida, Ms. Sherwood published several peer -reviewed articles investigating the Cannabinoid Receptor 2, as well as a book chapter regarding Endocannabinoids and Immunity. In addition, she received three awards for outstanding graduate presentations and the young investigator travel award from the Society of NeuroImmune Pharmacology.


xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam 22 Ka 4500
controlfield tag 007 cr-bnu---uuuuu
008 s2010 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0003405
035
(OCoLC)
040
FHM
c FHM
049
FHMM
090
XX9999 (Online)
1 100
Sherwood, Tracy.
0 245
Characterization of cannabinoid receptor 2 transcript expression in b cells
h [electronic resource] /
by Tracy Sherwood.
260
[Tampa, Fla] :
b University of South Florida,
2010.
500
Title from PDF of title page.
Document formatted into pages; contains X pages.
Includes vita.
502
Dissertation (Ph.D.)--University of South Florida, 2010.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
3 520
ABSTRACT: Cannabinoids and cannabinoid receptors have been shown to play important roles in immune regulation particularly as modulators of anti-inflammatory cytokines and antibody production. The predominant cannabinoid receptor involved in this immune regulation is cannabinoid receptor 2 (CB2), which is robustly expressed in B cells. Utilizing a combination of bioinformatics, 5' RACE, real time RT-qPCR, and reporter assays, we showed that human B cells from peripheral blood mononuclear cells (PBMC) expressed one CB2 transcript while mouse B cells from spleen express three CB2 transcripts. Alignment of the sequenced B cell RACE products to either the mouse or human genome, along with the GenBank mRNA sequences, revealed that the transcripts isolated in this study contained previously unidentified transcriptional start sites (TSSs). In addition, expression construct testing of the genomic region containing the TSSs of the mouse CB2 exon 1 and 2 transcripts showed a significant increase of promoter activity. Bioinformatics analysis for cis-sequences in the promoter regions identified DNA binding sites for NF-kB, STAT6, and Elk1 transcription factors activated by LPS, IL-4 and anti-CD40. Regarding variations in CB2 transcript expression among the immune cell subtypes, RACE analysis showed that the exon 1b transcript is seen in B cells but not in T cells, dendritic cells or macrophages. Furthermore, RT-qPCR showed variations in transcript expression during B cell development as well as in resting versus LPS or IL-4/anti-CD40 stimulated B cells. The exon 1a transcript was predominant in pre-, immature and resting B cells whereas the exon 1b and 2 transcripts were enhanced in mature and activated B cells. These data showed for the first time that human B cells use one TSS for CB2 expression while mouse B cells use multiple TSSs for the expression of three CB2 transcripts, in which the expression of the individual transcript is related to immune cell type and/or cell activation state. Additionally, this is the first report in mouse B cells defining TSSs that are in genomic areas with promoter activity thus suggesting the location of two promoter regions. Defining the CB2 transcript expression during various stages of B cell activation provide clues to therapeutic
590
Advisor: Thomas W Klein, Ph.D.
653
Delta9-tetrahydrocannabinol
Cannabis sativa
Endocannabinoid
Gene regulation
Promoter
690
Dissertations, Academic
z USF
x Molecular Medicine
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.3405