USF Libraries
USF Digital Collections

The fanconi anemia (fa)/brca dna damage repair pathway is reglated by nf-kb and mediates drug resistance in multiple myeloma

MISSING IMAGE

Material Information

Title:
The fanconi anemia (fa)/brca dna damage repair pathway is reglated by nf-kb and mediates drug resistance in multiple myeloma
Physical Description:
Book
Language:
English
Creator:
Yarde, Danielle
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Hematologic malignancies
RelB
P50
Melphalan
Bortezomib
Dissertations, Academic -- Cancer Biology -- Doctoral -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: The Fanconi Anemia (FA)/BRCA DNA damage repair pathway plays a critical role in the cellular response to stress induced by DNA alkylating agents and greatly influences drug response in cancer treatment. We recently reported that FA/BRCA DNA damage repair pathway genes are overexpressed and causative for resistance in multiple myeloma (MM) cell lines selected for resistance to melphalan. We hypothesized that the FA/BRCA DNA damage repair pathway mediates response and resistance to chemotherapeutic agents used to treat multiple myeloma and other cancers, and targeting this pathway is vital to overcoming drug resistance. In this dissertation, we show that FA/BRCA pathway genes are collectively overexpressed in MM, prostate, and ovarian cancer cell lines selected for resistance to melphalan and cisplatin, respectively. Interestingly, cells selected for resistance to topoisomerase II inhibitors selectively overexpress only FANCF. We also show that FA/BRCA pathway expression can be inhibited by the proteasome inhibitor bortezomib. FA/BRCA pathway mRNA expression was inhibited by bortezomib in myeloma cell lines and patient samples. FANCD2 gene and protein expression are downregulated by bortezomib, and remain attenuated in the face of melphalan treatment. Melphalan-induced FANCD2 foci formation was also inhibited by bortezomib, and this drug enhanced melphalan-induced DNA damage, likely via inhibition of FA-mediated DNA damage repair. Next, we analyzed regulation of the FA/BRCA pathway. We demonstrate that NF-kB, specifically the RelB/p50 subunits, transcriptionally regulates members of the FA/BRCA pathway, and inhibition of these subunits by siRNA, BMS-345541, and bortezomib reduces FA/BRCA pathway expression. Furthermore, knocking down RelB and p50 simultaneously attenuates FANCD2 protein expression and results in diminished DNA repair and enhanced sensitivity to melphalan. Importantly, melphalan resistance was restored when FANCD2 was re-expressed in these cells. We also show that bortezomib regulates FANCD2 protein expression directly, by inhibiting FANCD2 synthesis. Finally, we demonstrate that low-dose bortezomib arrests cells in G0/G1 and also overcomes the S-phase arrest induced by melphalan, likely via inhibition of ATR. Overall, our findings provide evidence for targeting the FA/BRCA pathway, either directly or indirectly, via inhibition of NF-kB or ATR, to enhance chemotherapeutic response and reverse drug resistance in multiple myeloma and other cancers.
Thesis:
Dissertation (Ph.D.)--University of South Florida, 2010.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Danielle Yarde.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains X pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
usfldc doi - E14-SFE0003416
usfldc handle - e14.3416
System ID:
SFS0027731:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam 22 Ka 4500
controlfield tag 007 cr-bnu---uuuuu
008 s2010 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0003416
035
(OCoLC)
040
FHM
c FHM
049
FHMM
090
XX9999 (Online)
1 100
Yarde, Danielle.
0 245
The fanconi anemia (fa)/brca dna damage repair pathway is reglated by nf-kb and mediates drug resistance in multiple myeloma
h [electronic resource] /
by Danielle Yarde.
260
[Tampa, Fla] :
b University of South Florida,
2010.
500
Title from PDF of title page.
Document formatted into pages; contains X pages.
Includes vita.
502
Dissertation (Ph.D.)--University of South Florida, 2010.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
3 520
ABSTRACT: The Fanconi Anemia (FA)/BRCA DNA damage repair pathway plays a critical role in the cellular response to stress induced by DNA alkylating agents and greatly influences drug response in cancer treatment. We recently reported that FA/BRCA DNA damage repair pathway genes are overexpressed and causative for resistance in multiple myeloma (MM) cell lines selected for resistance to melphalan. We hypothesized that the FA/BRCA DNA damage repair pathway mediates response and resistance to chemotherapeutic agents used to treat multiple myeloma and other cancers, and targeting this pathway is vital to overcoming drug resistance. In this dissertation, we show that FA/BRCA pathway genes are collectively overexpressed in MM, prostate, and ovarian cancer cell lines selected for resistance to melphalan and cisplatin, respectively. Interestingly, cells selected for resistance to topoisomerase II inhibitors selectively overexpress only FANCF. We also show that FA/BRCA pathway expression can be inhibited by the proteasome inhibitor bortezomib. FA/BRCA pathway mRNA expression was inhibited by bortezomib in myeloma cell lines and patient samples. FANCD2 gene and protein expression are downregulated by bortezomib, and remain attenuated in the face of melphalan treatment. Melphalan-induced FANCD2 foci formation was also inhibited by bortezomib, and this drug enhanced melphalan-induced DNA damage, likely via inhibition of FA-mediated DNA damage repair. Next, we analyzed regulation of the FA/BRCA pathway. We demonstrate that NF-kB, specifically the RelB/p50 subunits, transcriptionally regulates members of the FA/BRCA pathway, and inhibition of these subunits by siRNA, BMS-345541, and bortezomib reduces FA/BRCA pathway expression. Furthermore, knocking down RelB and p50 simultaneously attenuates FANCD2 protein expression and results in diminished DNA repair and enhanced sensitivity to melphalan. Importantly, melphalan resistance was restored when FANCD2 was re-expressed in these cells. We also show that bortezomib regulates FANCD2 protein expression directly, by inhibiting FANCD2 synthesis. Finally, we demonstrate that low-dose bortezomib arrests cells in G0/G1 and also overcomes the S-phase arrest induced by melphalan, likely via inhibition of ATR. Overall, our findings provide evidence for targeting the FA/BRCA pathway, either directly or indirectly, via inhibition of NF-kB or ATR, to enhance chemotherapeutic response and reverse drug resistance in multiple myeloma and other cancers.
590
Advisor: William S. Dalton, Ph.D.
653
Hematologic malignancies
RelB
P50
Melphalan
Bortezomib
690
Dissertations, Academic
z USF
x Cancer Biology
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.3416



PAGE 1

The Fanconi Anemia (FA)/ BRCA DNA Damage Repair Pathway is Regulated b y NF B a nd Mediates Drug Resistance i n Multiple Myeloma by Danielle N. Yarde A dissertation submitted in partial fulfillment of the requirements fo r the degree of Doctor of Philosophy Department of Cancer Biology College of Arts and Sciences University of South Florida Major Professor: William S. Dalton Ph.D., M.D. Lori A. Hazlehurst, Ph.D. Alvaro N. Monteiro, Ph.D. Mic hael J. Schell, Ph.D. Edward Seto, Ph.D. Date of Approval: February 24, 2010 Keywords: Hematologic malignancies, RelB, p50, melphalan, bortezomib Copyright 2010 Danielle N. Yarde

PAGE 2

DEDICATION I w ish to dedicate this dissertation to my family. To my parents for their guidance and unconditional support and encouragement; an d to Isaiah, for helping me to keep sight of what is truly important.

PAGE 3

ACKNOWLEDGMENTS I would first like to thank Dr. William Dalton for his exceptional mentorship and guidance throughout my graduate career. I would like to thank the members of my dissertation committee, Dr. Lori Hazlehurst, Dr. Alvaro Monteiro, Dr. Michael Schell, and Dr. Ed ward Seto, for th eir time, input and advice. I would also like to thank Dr. Maureen Hoatlin for her time and effort serving as my external dissertation committee chairperson. Finally, s pecial thanks to Linda Mathews, Mark Meads, Vasco Oliveira, Ken Shain, and the rest of the Dalton lab for all of their assistance and support.

PAGE 4

i TABLE OF CONTENTS L I ST OF TABLES iv LIST OF FIGURES v LIST OF ABBREVIATIONS vii ABSTRACT ix INTRODUCTION 1 Hematologic Malignancies 2 Multiple Myeloma 3 Multiple Myeloma and Drug Resista nce 5 Multiple Myeloma and NF B 7 The Proteas ome and Proteasome Inhibition 10 DNA Damage 13 Diseases of Defective DNA Damage Repair 1 7 The Fanconi Anemia (FA)/BRCA DNA Damage Repair Pathway 18 Upstream FA Core Complex 19 ID Complex 24 FA Proteins Downstrea m of ID 25 The FA/BRCA Pathway a nd Drug Restance 25 The FA/BRCA Pathway is Regulated by NF B and Mediates Drug Resistance in Multiple M yeloma 27 MATERIALS AND METHODS 31 Cell C ulture 31 Cytotoxicity Assays 31 mRNA Isolation and qPCR Anal ysis 32 Wester n Blot Analysis 34 Immunofluore scent Microscopy 36 Comet Assays 36 Patient Sample Plasma Ce ll Isolati on and Purification 38 Promoter Region Analysis 39 Electrophoretic Mobi lity Shift Assays 39 Combination Index Analysis 40 Transfection of siRNA, P lasmids, and miRNA 41 Chromatin Immunopre cipitation Assays 42 DASH Assa ys 43 Stable Isotopic Labeling of A mino Acids in Culture 44 BrdU/PI Cell Cycle Analysis 46

PAGE 5

ii RESULTS 47 Part I: Fanconi Anemia/BRCA Pathway Expression in Drug Resistant C e ll Lines 47 FA/BRCA Pathway mRNA is Overexpressed in Cells S elected for Resistance to M elpha lan and Cisplatin 47 FANCF is Specifically Overexpressed in 8226 Cells Selected for R esistance to T opoisomeras e II I nhibitors 50 Part I I : Bortezomib Enhances Melphalan Response in Multiple Myeloma Cell Lines and Patient Samples 52 Bortezomib Enhances Mel phalan R esponse in Myeloma Cell L ines 53 Bo rtezomib Downregulates FA/BRCA P a thway mRNA Expression 54 Bortezomib I nhibits FANCD 2 mRNA, Protein Expression and F oci Formation, Even in the Presence of M elphalan 56 Bortezomib Enhances Melphalan Induc ed DNA Damage V ia I nhi bition of FANCD2 64 Bortezomi b Reduces FA/BRCA Pathway Gene Expression in Patient S pecimens 69 Part II I : NF B Regulates the FA/BRCA Pathway 74 Analysis of Promoter Region s of FA/BRCA Pathway Members R eveal s P utative NF B Binding Sites 75 Low Dose Bortezomib I nhibits NF B DNA Binding A ctivity 75 Bortezomib and BMS 345541, a Specific I nhibitor of NF B, ar e A ntagonistic 78 Basal NF B Binding Activity is E nhanced in Melphalan R esis tant C ells 78 RelB and p50 Subunits are Resp onsible for Enhanced FANCD2 S pecific NF B DN A Binding A ctivity 82 BMS 345541 Dow nregulates FA/BRCA Pathway mRNA E xpressio n i n Melphalan Sensitive and R esi stant Myeloma Cells 86 Loss of RelB/p50 Reduces FANCD2 Expression and Re Sensitizes 8226/LR5 C e lls to M elphalan 96 Part IV : Post Tr an s criptional Regul ation of FANCD2 by Bortezomib 103 Bortezomib I nhibit s FANCD2 S ynthesi s 103 Bortezomib Overcomes Melphalan Induced S Phase A rres t 107 FANCD2 E xpression is Not R egulated by Hsa miR 23a or Hsa miR 27 110 DISCUSSION 11 5 Members of the FA/BRCA Pathway are Overexpressed in Drug Resistant Cancer Cells and Can be Inhibited by Bortezomib 11 5 Mechanisms by Which Bortezomib Inhibits FA/BRCA Pathway Expression 119 Futu re Directions 126

PAGE 6

iii REFERENCES 13 1 ABOUT THE AUTHOR End Page

PAGE 7

iv LIST OF TABLES Table 1. Overview of FA pathway members 20 Table 2 Stati stical analysis of FA/BRCA gene expression following bort e zomib treatment in 8226 cells 58 Table 3 Statistical analysis of FA/BRCA gene expression after BMS 345541 t reatment in 8226 cells 89 Table 4 Statistical analysis of FA/BRCA gen e expression after BMS 345541 tre a tmen t in U266 cells 94 Table 5 Statistical analysis of melphalan induced DNA fragmentation in RelB/p50 siRNA treated ce lls 100 Table 6 Statistical analysis of melphalan induced ICL in RelB/p50 depleted cells 101 Table 7 Correlation between melphalan induced ICL an d DNA fragmentation 102

PAGE 8

v LIST OF FIGURES Figure 1. The NF B pathway 8 Figure 2. Ubiquitin ation and the proteasome 11 Figure 3. The FA/BRCA DNA dam age re pair pathway 21 Figure 4. Melphalan and cisplatin resistant cells overexpress FA/BRCA pathway genes 49 Figure 5. Doxorubicin and mitoxantrone res istant myeloma cells overexpress FANCF 51 Figure 6 Low dose bortezomib enhances melphalan response in melphalan sensitive and melphalan resistant myeloma cell lines 55 Figure 7 Bortezomib downregulates FA/BRCA pathwa y mRNA expression 5 7 Fig ure 8 Gene expression levels of B2M, IPO8, and TFRC remain unchanged in 8226/S cells treated with B MS 345541 and bortezomib 59 Figure 9 Bortezomib inhibits FANCD2 mRNA expression, even in the presence of melphalan 61 Figure 10 Bortezomib inhi bits FANCD2 protein expression 62 Figure 11 Bortezomib inhibits melphala n induced FANCD2 foci formation 63 Figure 12 Bortezomib overcomes melphalan induc ed cell cycle arrest 65 Figure 13. Borte zomib enhance s melphalan induced DNA damage 67 Figure 14 Low dose bortezomib does not induce DNA damage 68 Figure 15 Bortezomib modulates FA/ BRCA pathway mRNA expression in myel oma p atient specimens 71 Figure 16 Analysis of FA/BRCA pathway mRNA e xpression in samples taken from bortez omi b treated myeloma patients 72

PAGE 9

vi Figure 17 Schematic view of putative transcripti on factor (TF) binding sites in FA/BRCA promoter regions 76 Figure 18 Bortezomib inhibits NF B DNA binding activity 77 Figure 1 9 Bortezomib and BMS 345541 are antagonistic 79 Figure 20 Basal NF B DNA binding activity is enhanced in melphalan resistant 82 26 cells 81 Figure 21 NF B DNA binding activity is enh anced in the 8226/LR5 cell line using a FANCD2 specific probe 83 Figure 22 RelB and p50 subunits are responsible for enhanced FANCD2 specific NF B DNA binding activi ty in the 8226/LR5 cell line 84 Figure 23 NF B subunits bind to the p romoter region of FANCD2 87 Figure 24 BMS 345541 dow nregul ates FA/BRCA pathway mRNA expression in melphalan sensitive (8226/S) and resistant (8226/LR5) cell lines 88 Figure 25 BMS 345541 reduces FANCD2 protein expression and inhibi ts growth of 8226 cells 92 Figure 26 BMS 345541 reduces FA/ BRCA pathway m RNA expression in U266 and U266/LR6 cell l ines 93 Figure 27 Loss of RelB and p50 re sensitizes 8226/LR5 cells to melphalan treatment and reduce s FAN CD2 protein expression 98 Figure 28 Bortezomib inh ibits FANCD2 protein synthesis 105 Figure 29 Bo r tezomib overcomes melphalan induced S phase arrest and a rrests cells in G0/G1 108 Figure 30. Bortezomib inhibits ATR activation 111 Figure 31 miRNA analysis of bortezomib tr eated 8226/LR5 myeloma cells 113 Figure 32 FANCD2 is not target ed by hsa miR 23a or hsa miR 27 115

PAGE 10

vii LIST OF ABBREVIATIONS AML Acute myeloid leukemia ANOVA Analysis of variance A T Ataxia telangiectasia ATM A taxia telangiectasia mutated ATR Ataxia telangiectasia mutated and rad3 related BER Base excision repai r BCNU Bis chloronitrosourea BMS Bristol Myers Squibb BrdU Bromodeoxyuridine CAM DR Cell adhesion mediated drug resistance CENP E Centromere associated protein E ChIP Chromatin immunoprecipitation CRAB Hypercalcemia, renal insufficiency, anemia a nd bone lesions DASH Diffusion apoptosis slide halo DEB Diepoxybutane DNA Deoxyribonucleic acid Dox Doxorubicin DSB Double strand break EMSA Electrophoretic mobility shift assay FA Fanconi anemia FAAP Fanconi anemia associated protein FANC Fanconi anemia complementation group FGFR3 Fibroblast growth factor receptor 3 FN Fibronectin GSTP1 Glutathione S transferase P1 HCl Hydrochloric acid HDAC Histone deacetylase HSC Hematopoietic stem cell Hsp Heat shock protein HR Homologou s recombination ICL Interstrand crosslink I B Inhibitor of NF B IKK I B kinase L PAM L phenylalanine mustard LR L PAM resistant LRP Lung resistance related protein M Molar MDR Multi drug resistance

PAGE 11

viii MDR1 Multidrug resistance protein 1 MGUS Monoclonal gammopathy of undetermined sign ificance mRNA Messenger RNA miRNA Micro RNA ml Milliliter MM Multiple myeloma MRD Minimal residual disease MRN Mre11, Rad50, and NBS1 MTT 3 (4,5 Dimethylthiazol 2 yl) 2,5 diphenyltetrazolium bromide NBS1 Nijmegen breakage syndrome 1 NER Nu cleotide excision repair NF B Nuclear factor kappa B ng Nanogram NHEJ Nonhomologous end joining P gp P glycoprotein PARP Poly(ADP ribose) polymerase PI Propidium iodide q RT PCR Quantitative reverse transcriptase polymerase chain reaction RNA Ribonucleic acid RPA Re plication protein A SILAC Stable isotopic labeling of amino acids in cell culture siRNA Small interfering RNA STAT Signal transducer and activator of transcription TLS Translesion synthesis TMZ Temozolomide TNF Tumor necrosis factor TNFR Tumo r necrosis factor receptor UBE2T Ubiquitin E2 ligase T USP1 Ubiquitin specific protease 1

PAGE 12

ix THE FANCONI ANEMIA (FA)/DNA DAMAGE REPAIR PATHWAY IS REGULATED BY NF B AND MEDIATES DRUG RESISTANCE IN MULTIPLE MYELOMA DANIELLE N. YARDE ABSTRACT The Fanconi Anemia (FA)/BRCA DNA dam age repair pathway plays a critic al role in the cellular response to stress induced by DNA alkylating agents and greatly influences drug re sponse in cancer treatment. We recently r eported that FA /BRCA DNA damage repair pathway genes are overexpressed and causative for resistance in multiple myeloma (MM) cell lines selected for resistance to melphalan We hypothesized that the FA/BRCA DNA dam age repair pathway mediates response and resistance to chemotherapeutic agents used to treat multiple myeloma and other cancers, and targeting this pathway is vital to overcoming drug resistance In this dissertation we show that FA/BRCA pathway genes a re collectively overexpressed in MM, prostate, and ovarian cancer cell lines selected for resistance to melphalan and cisplatin, respectively. Interestingly, c ells selected for resistance to topoi somerase II inhibitors selectively overexpress only FANCF. We also show that FA/BRCA pathway expression can be inhibited by the proteasome inhibitor bortezomib FA/BRCA pathway mRNA expression was inhibited by bortezomib in myeloma cell lines and patient samples. FANCD2 gene and protein expression are downregul ated by bortezomib, and remain attenuated in the face of melphalan treatment Melphalan induced FANCD2 foci formation was also

PAGE 13

x inhibit ed by bortezomib, and this drug enhanced melphalan induced DNA damage, likely via inhibition of FA mediated DNA damage re pair Next, we analyzed regulation of the FA/BRCA pathway. We demonstrate that NF B, specifically the RelB/p50 subunits, transcriptionally regulates members of the FA/BRCA pathway, and inhibition of these subunits by siRNA, BMS 345541, and bortezomib reduce s FA/BRCA pathway expression. Fu r thermore, knocking down RelB and p50 simultane ously attenuates FANCD2 protein expression and results in diminished DNA repair and enhanced sensitivity to melphalan. Importantly, melphalan resistance was restored when FANCD2 was re expressed in these cells. W e also show that bortezomib regulates FANC D2 protein expression directly, by inhibiting FANCD2 synthesis. Finally, we demonstrate that low dose bortezomib arrests cells in G0/G1 and also overcomes the S phase arrest induced by melphalan, likely via inhibition of ATR. Overall, o ur findings pro vide evidence for targeting the FA/BRCA pathway either directly or indirectly via inhibition of NF B or ATR to enhance chemotherapeutic response and reverse drug resista nce in multiple myeloma and other cancers.

PAGE 14

1 INTRODUCTION Cancer is defined as a malignant growth caused by uncontrolled cell division and lack of programmed cell death In 2000, Hanahan and Weinberg identified six hallmarks of cance r, and suggested that these alterations within the cell dictate the origination of a malignancy (1) sufficiency in growth signals, insensitivity to growth inhibitory signals, evasion of apoptosis, limitless replicative potential, sustained angiogenesis, and tissue invasion an (1) Hematologic malignancies exhibit many, if not all, of these traits, and understanding the mechanisms of tumorigenesis and drug resistance is crucial to both diagnosing and finding a cure for these d iseases. Multiple myeloma is an incurable malignancy arisin g from a clonal population of plasma cells (2) Although response to initial chemotherapy is typical, patients relapse due to the emergence of drug resistance. Our lab and many others have focused extensively on the mechanisms of drug resistance in myeloma. We previously reported that the FA/BRCA DNA damage repair pathway is associated with and causative for resistance to the DNA damaging agent melphalan (3 4) This dissertation analyzes the transcriptional regulati on of the FA/BRCA pathway and highlights the important role that this pathway plays in response and resistance to chem otherapeutic agents commonly used in the clinic to treat myeloma

PAGE 15

2 Hematologic Malignancies The formation of new blood cells is termed hematopoiesis. Pluripotent hematopoietic stem cells (HSCs) can give rise to both lymphoid and myeloid cells. Lym phoid progenitors, in turn, give rise to B and T cell lymphocytes, whereas myeloid and erythroid progenitors are responsible for the generatio n of macrophages, granulocytes and erythrocytes. Hematopoiesis is a dynamic process involving numerous growth factors, cytokines, and microenvironmental stimuli. Importantly, errors involving any of these homeostatic regulators can have detrimental effec ts, causing malignancies of these different cell lineages. H ematologic malignancies account for 9.5 % of all cancers diagnosed in the United States (leukemia lymphoma.org). T hese diseases can be divided into two broad categories based on whether they are derived from lymphoid or myeloid cell lineages. Lymphomas, the most common of the hematopoietic malignancies, are tumors that arise from lympho cytes. Myeloma falls under the category of a lymphoma, as it is a malignancy of plasma cells. Leukemia com prises the second type of hematologic malignancy, and occurs when the blood forming tissues, or leukocytes, grow uncontrollably. Although profound advances have been made in the treatment of hematologic malignancies, many of these cancers remain incurabl e due to the effects of minimal residual disease (MRD) and the emergence of drug resistance. Certain cancer cells can elicit mechanisms, such as the evasion of apoptosis or the overexpression of drug resistance genes to avoid cell death and persist in th e patient even after many rounds of chemot herapy. Unfortunately, these patients relapse and eventually succumb to disease

PAGE 16

3 due to these remaining, often initially undetectable, tumor cells. Some of these cancer cells are intrinsically resistant to chemoth erapeutic agents, while others become resistant to drugs throughout the course of treatment. Multiple Myeloma According to the National Cancer Institute ( http://www.cancer.gov ), 20,580 new cases of multiple myeloma (MM) were diagnosed in the United Sta tes in 2009, and in the same year, 10,580 deaths were associated with this disease. MM comprises nearly 15% of all hematologic malignancies (5) and is associated with roughly 2% of all cancer deaths in the United States (6 7) ranking it the second most common hematologic malignancy in this country. The lifetime risk of someone in the United S tates develo ping myeloma is 1 in 161 (7) with an increased incidence in men versus women (a ratio of 1.4:1, respectively), a nd also in African Americans as compared to Caucasians (8) The median age of diagnosis of MM is 71 years (9 10) and these patients typically present (11) Multiple m yeloma is a neoplasm arising from a clonal population of mature B cells Patients with MM have large numbers of clonal antibody secreting plasma cells in their bone marrow (2) The diagnosis of this disease requires the bone marro w to be comprised of at least 10% plasma cells (11) In comparison, the percentage of plasma (12) Other criteria for diagnosis include secretion of excessive monoclonal immunoglobulin ( Ig; as detected in the urine or serum), and end organ damage I (hyper c alcemia, r enal insufficiency, a nemia and b one lesions and increased i nfection

PAGE 17

4 rate ) (8, 11 12) According to Nair et. al ., the most common Ig isotype (M component) found in MM patients is IgG, and prognostically, IgA and IgD are the least favorable (13) Also, t he 20 30% of patients who pr esent with renal failure are considered to have a poor prognosis (10, 14) The disease of MM is often preceded by a premalignant condition called monoclonal gammopathy of undetermined significance (MGUS). Myeloma progresses in th ese patients, who have less than 10% clonal plasma cells in their bone marrow less than 3 grams/deciliter of paraprotein, and no myeloma related end organ damage (CRABI) at a rate of about 1% annually (8, 11, 15) Once the disease progresses, myeloma can be subdivided into two categories: asymptomatic ( smoldering ) and symptomatic (active) Patients with asymptomatic myeloma display an increase in M protein concentration when compared to MGUS pat ients, but do not have the end organ damage required for the diagnosis of symptomatic myeloma (8, 16) Progression from MGUS to myeloma is believed to coincide with cytogenetic changes (11) and n ewly diagnosed MM patients present with an average of seven chromosomal abnormalities (12) The most common translocation, seen in 50% of patients, involves the immunoglobulin heavy chain locus (17) These translocations usually involve partnering with chromosomes that encode for oncogenes, such as cyclin D1 and D3 fibroblast growth factor receptor 3 ( fgfr3 ) /MMSET c maf and mafB (18 20) Also, c ertain translocations and abnormalities are associated with more aggressive disease. For example, patients with the del(13) or del(17p) abnormalities have shorter time to progression as well as decreased overall survival when compared to patients without these chromosomal deletions (21 22) Recently though, it was found that the

PAGE 18

5 poor pro gnosis associated with del(13) and other high risk translocations could be overcome in relapsed or refractory patients treated with the novel therapeutic agents lenalidomide and bortezomib (23) Therapeutic options for MM patients have changed markedly in recent years. The gold standard for treatment for decades has been melphalan plus prednisone (24) However, new agents such as immunomodula tory drugs (thalidomide and lenalidomide) and proteasome inhibitors (bortezomib and second generation derivatives) have recently been approved for myeloma treatment and have shown promise in the clinic, both alone and in the setting of combination chemoth erapy (2, 25 28) New therapeutic options have nearly doubled the median survival, with the greatest improvements in survival rates seen in younger patients (6, 29) Unfortunately, even with the exciting new options available for the treatment of MM the emergence of drug resistance remains the largest hurdle in curing this disease Therefore, discovering therapeutic agents that target specific pathways aberrantly expressed in drug sensitive and drug resistant cells will be necessary to cure this disease. Multipl e Myeloma and Drug Resistance A number of drug resistance mechanisms have been described in multiple myeloma. These mechanisms of resistance can be intrinsic, due to intercellular ch anges that confer drug resistance, or e xtrinsi c, where growth factors an d physical effectors in microenvironment mediate resistance. Furthermore following chemotherapy, many tumors also become cross resistant to other agents as well, a phenomenon known as the multi d rug resistance (MDR) phenotype (30) MDR in

PAGE 19

6 myeloma has been shown to be mediated by overexpression of the drug transporter proteins P glycoprotein (P gp), multidrug resistance protein 1 (MDR1), and lung resistance related protein (LRP ) (30 32) Drug resistance in myeloma is also known to be mediated by alterations in apoptotic machinery within the cell. For example, overexpression of Bcl 2, an anti apoptotic member of the Bcl 2 family of prote ins, confers resistance to chemotherapeutic agents such as doxorubicin, dexamethasone, and bortezomib (33 34) Additionally, the anti apoptotic proteins Mcl 1 and Bcl X L have also been shown to contribute to drug r esistance (35 37) Aside from changes in apoptotic proteins, i nte rcellular changes in other pathways are also known to influence drug resistance in multiple myeloma For example, myeloma cells selected for resis tance to melphalan by chronically exposing these cells to low doses of the drug display reduced DNA interstrand crosslinks and enhanced glutathione levels (38) Importantly, inhibition of glutathione synthesis in these cells reversed drug resistance (38) Furthermore, microarray an alysis of these same melphalan resistant myeloma cells (8226/LR5 cells) revealed changes in over 1400 genes when compared to the drug sensitive cells (4) Overexpression of members of the glutathione pathway, DNA d amage repair pathways, and cholesterol synthesis pathway were observed in the melphalan resistant cells (4) Adhesion to physical factors in the environment causes a drug resistance phenotype known as cell adhesion mediated drug resistance (CAM DR) (39 40) Adhesion of tumor cells to fibronectin (FN) via 1 integrins causes a G1 cell cycle arrest due to

PAGE 20

7 increased p27 kip1 expression (40) and also enhances degradation of the pro apoptotic Bcl 2 protein bim (40) Adhesion to bone marrow stromal cells (BMSCs) also protects myeloma cells from melphalan induced cell death, and this resistance has been linked to upregulation of the Notch 1 signaling pathway (41) Finally, growth factors are known to influence drug resistance. For example, i nterleukin (IL) 6 and insulin like growth factor I (IGF 1) two cytokines produced in the bone marrow microenvironment, confer resistance to chemotherapeutic agents by blocking apoptotic stimuli and activating the PI3K/AKT MAPK pathways (37) These growth factors are also known to regulate the activity of certain transcription factors, such as STA T3 and NF B, which have been reported to enhance drug resistance (42 44) Multiple Myeloma and NF B The transcription factor nuclear factor B (NF B) consists of two proteins each contain ing an N ter minal Rel homolog y domain (45) NF B can be a hetero or homodimer of the subunits RelA, RelB, c rel, p50 and p52 (46) The NF B dimers remain inactive in the cytoplasm by association with one of three inhibitors of NF B (I B), specifically I B I B or I B or with p105 or p100 (the precursors of p50 and p52, respectively) (47) Following stimulation, I B subunits are phosphorylated at conserved serine residues by the I B kinase (IKK) complex comprised o f IKK IKK and IKK /NEMO (48 49) These phosphorylation events target the I B subunits for proteasomal degr adation, leading to the release of the NF B dimer and subsequent trans location into the nucleus (50) Once inside the nucleus, NF B initiates the transcription of its target genes. (Figure 1).

PAGE 21

8 Figure 1. The NF B pathway. NF B is a homo or hetero dimer of the subuinits Rel A, RelB, c Rel, p50 and p52. I B sequesters these proteins in the cytoplasm. Following stimulation, the IKK complex is activated and phosphorylates IkB, targeting it for proteasomal degradation. NF B is then free to translocate to the nucleus and activ ate transcription of its target genes.

PAGE 22

9 NF B is known to be activated by one of three major pathways. The canonical pathway is typically induced in response to bacterial infection or to tumor necrosis factor (TNF) and other inflammatory cytokines and is usually associated with the activation of the p50/RelA heterodimer (51) The second NF B activating pathway is termed the alternative, or noncanoncial, pathway. This pathway, associated with p52/Rel B activation, is initiated by certain TNF receptor (TNFR) ligands, such as BAFF and lymphotoxin Finally, the atypical pathway provides a much slower and weaker NF B response when compared to activation of the other two pathways, and is induced in response to DNA damage and reactive oxygen spe cies (ROS) (52) NF B has been shown to regulate a plethora of genes involved in inflammation, proliferation, m etastasis, angiogenesis, and apoptosis (53) As such, activation of this family of transcr iption factors is commonly observed in many different cancers (42, 54) For example, NF B has been reported to be constitutively activated in multiple myeloma (55) In two separate reports, Annunzia ta et. al., and Keats et. al., observe d a number of NF B activating gene mutations in myeloma cell lines as well as in primary myeloma patient samples (56 57) Furthermore, the RelB and p50 NF B subunits are upregulated following MM cell adhesion to the extracellular matrix protein fibronectin (FN) (58) This report provides a link between NF B and drug resistance as adhesion to FN is known to cause a transient ( de novo ) drug resistance phenotype in these cells. Also highlighting the important role of the NF B pathway in drug resistance, microarray analysis of the FN adhered cells revealed overexpression of 11 N F B regulated genes (58) Finally, NF B has been found to be overexpressed in MM cell lines that have been selected for resistance to various chemotherapeutic agents (59) and NF B levels have

PAGE 23

10 been found to be elevated in response to chemotherapy as well as in patient samples collected at the time of relapse (37, 60 62) Thus, inhibition of NF B using agents such as the proteasome inhibitor bortezomib, is likely vital for the successful treatment of multiple myeloma. The Proteasome and Proteasome Inhibition Over 80% of proteins within the cell are degraded by the ubiquitin proteasome system (63) Proteins tagged with ubiquitin have different functions, dependent upon the type of ubiquitination. Monoubiquitination, in which a single ubiquitin is atta ched to a single lysine residue, is important for such processes as endocytosis, DNA repair, and nuclear export of the protein (64 67) Proteins can also be multiubiquitinated, or monoubiquitinated on several lysin es, and these proteins can be involved in endocytosis and nuclear export as well (68) Finally proteins ca n also be polyubiquitinated. Proteins covalently bound to a polyubiquitin via lysine 63 characteristically signals DNA repair or endocytosis, whereas a protein linked to an ubiquitin chain via lysine 48 is typically targeted for proteasomal degradation (68) Three enzymes are involved in the ubiquitin tagging of a protein. The E1 enzyme is known as the activating enzyme, as it utilizes ATP to activate the ubiquitin molecule by con verting it to an E1 thiol ester~ubiquitin moiety (69) The ubiquitin conjugating E2 enzyme transfers the active ubiquitin from the E2 to the E3 enzyme. Finally, the E3 enzyme, which functions as a ligase, conjugates ubiquitin t o the target protein (69) (Figure 2).

PAGE 24

11 Figure 2. Ubiquitination and the proteasome. Polyubiquitination of proteins leads to their subsequent degradation by the proteasome. The E1 enzyme activates ubiquitin and tra nsfers this molecule to the E2 conjugating enzyme. E2 then transfers the active ubiquitin to the E3 ligase, which in turn conjugates ubiquitin to the target protein. The E3 ligase also ligates ubiquitin molecules to one another, forming a polyubiquitin c hain. Polyubiquitinated proteins are degraded by the 26S proteasome, which is comprised of the 19S regulatory caps (green) and the 20S core particle (brown), and the ubiquitin is recycled.

PAGE 25

12 Once polyubiquitinated, most proteins are targeted for proteas omal degradation. There are approximately 30,000 proteasomes in a single cell, which are located in the cytosol as well as in the nucleus (70 71) The barrel shaped 26S proteasome is formed by the 20S core particl e and two 19S regulatory particles that cap each end (69) The 20S core particle is responsible for the catalytic activity of the proteasome, and contains two outer rings plus two inner rings (69) 1, 2, and 5 are responsible for the caspase like, tryptic like, and chymotryptic like enzymatic activity of the 20S subunit (70) The 19S caps contain a base of six ATPase subunits and two non ATPase subunits and a lid composed of 12 non ATPase subunits (72) These caps recognize and unfold polyubiquitinated proteins, open the rings of the 20S subunit, and cleave and recycle the polyubiquitin chains (72) (Figure 2). Proteasomal degradation leads to the generation of polypeptides 3 23 amino acids in length which are rapidly hydrolyzed by downstream proteases (69, 73) This controlled degradation of proteins is vital for the regulation of many cellular processes, including apoptosis, cell cycle progression, DNA repair and transcription (72) As mentioned above, NF B activation is dependent upon proteasomal degradation of its inhibitor (50) The proteasome is also responsible for the degradation of p53, the cyclin dependent kinase inhibitors p21 cip1/waf1 and p27 kip1 and the proapoptotic protein bim (70, 74 75) and this degradation is necessary for cancer cell development and progression (76) Therefore, inhibiting the proteasome as a means to sta bilize these and other proteins seems promising for the treatment of cancer. Bortezomib (PS 341; Velcade) a dipeptidyl boronic acid, is a reversible inhibitor of the 26S proteasome (77) Bortezomib is an active, recently approved FDA agent, that

PAGE 26

13 is being studied in combination with othe r drugs (26) Two independent labs have reported that bortezomib enhances melphalan response in myeloma cell lines implicating NF B inhibition due to inhibited I B degradation in this enhanced response (59, 78) Furthermore, bortezomib in combination with melphalan has shown encouraging activity in myeloma patients in a Phase I/II trial (25) Also, in a separate, multicenter Phase I/II study, the combinatio n of bortezomib plus melphalan and prednisone was shown to be highly effective, even in patients with poor prognostic factors, and a Phase III trial is now ongoing (27, 79 80) Although bortezomib shows great pr omise in the clinic for the treatment of MM approximately 20% of newly diagnosed patients are inherently resistant to the drug, and all others will develop resistance over time (29) To this end, second generation drugs such as carfilzomib and NPI 0052, which irreversibly inhibit the proteasome, are curre ntly being tested in the clinic and have been shown to overcome boretezomib resistance (29, 81) Due to the complexity of drug resistance mechanisms, however, it is likely that the most durable responses will result from the development of rational drug combinations that capitalize on synergistic interactions. DNA Damage As mentioned above, bortezomib was only recently approved for the treatment of MM (77) Prior to bortezomib, t he gold standard for tre ating myeloma for many years had been melphalan, and this cytotoxic agent remains the drug of choice for high dose chemotherapy (24) Melphalan, as well as an arsenal of other agents used in the clinic

PAGE 27

14 today to treat cancers such as MM, targets tumor cells by damaging the DNA within these cells. DNA within a cell can be damaged by endogenous means, such as by reactions that produce reactive oxygen and nitrogen species or by spontaneous hydrolysis reactions (82) Furt hermore, DNA can also be damaged by exogenous forces such as ionizing radiation, ultraviolet light, and chemotherapeutic agents (82) In fact, it has been estimated that a single cell receives up to 10 5 lesions per day (83) Fortunately, cells are abl e to efficiently repair DNA via several different mechanisms as a means to maintain genomic integrity. Conversely, genomic instability caused by defective DNA damage repair is a hallmark of cancer, reinforcing the fact that DNA must be repaired properly i n order to maintain cellular homeostasis. A cell can respond to DNA damage using a number of mechanisms to repair the DNA, based on the type and extent of damage. Repair of damage involves activation of repair enzymes, numerous phosphorylation events, an d recruitment of proteins to the site of damage (84) Base excision repair (BER) for example, removes oxi dative lesions and other DNA modifications by removing the erroneous base and recruitin g polymerase and ligase proteins to repair the damaged strand (85) DNA adducts and damage induced by ultraviolet rays, both of which distort the helix, is resolved by nucleotide excision repair (NER) (86) During this process, which involves greater than 30 proteins, the damaged nucleotide is re moved and the complementary strand is used as a template for repair (87 88) Also, lesions can be bypassed by a system termed translesion synthesis (TLS), which is not an ideal method of repair as it induces error and thus is mutagenic (82)

PAGE 28

15 DNA damage causing double strand breaks (DSBs) can induce a cell cycle checkpoint response l eading to cell cycle arrest, and can also activate DNA damage repair or apoptotic pathways (84) If the damage can be reversed, the mechanism of repair is classically either nonhomologous end j oining (NHEJ) or homologous recombination (HR) (89) NHEJ is typically initiated if the damage occurs when cells are in the G1 or early S phase of the cell cycle, wh ereas HR usually occurs during late S and G2 phases (88) As with other DNA damage repair pathways, NHEJ requires a large number of proteins to facilitate effectiv e repair. Briefly, the heterodimer Ku70/Ku80 binds to the site of damage, which leads to the recruitment DNA PK CS and subsequent formati on of a molecular bridge by the two strands (90) Overhangs are then filled in or removed by polymerases o r nucleases, respectively, and a ligase, namely ligase IV/XRCC4, repairs the break (88) Due to the lack of a homologous strand as a template, NHEJ induces more errors than does HR. Homologous recombination, a process integral for DSB repair as well as rec overy of stalled replication forks, tends to be error free as it uses an identical sister chromatid as a template to repair the damage (91 92) Once a DSB is induced, the histone variant H2AX is phosphorylated (a c ommonly used marker of DSBs), and the ATM kinase is activated and phosphorylate s a number of proteins integral to DNA repair (93 94) Also, a complex containing Mre11, Rad50 and NBS1, known as the MRN complex, sens es and binds to the site of damage (94) This complex resects the ends of the DNA, and the single stranded DNA coated with RPA and Rad proteins then invades the homologous, undamaged DNA (94) Finally, DNA synthesis occurs using the homologous strand as the template (82)

PAGE 29

16 The DNA dam age repair pathways described ab ove were explained singularl y. It is important to note however, that there is often much overlap between and among pathways when DNA damage takes place. For example, although NHEJ typically occurs in the G1 and early S ph ases, it has also been shown to be activated at different stages of the cell cycle as well (95) Also, inhibition of proteins known to be involved in the NER pathway led to ineffective DSB repair via NHEJ (88, 96) Finally, the efficient repair of DNA interstrand crosslin ks has been shown to involve the NER, HR and TLS pathways (93) DNA interstrand crosslinks (ICLs) which can be induced by chemotherapeutic agents such as melphalan and cis platin um cause some of the most detrimental damage to the DNA as they covalently link both strands, effectively inhibiting r eplication as well as transcription (97 98) DNA ICLs are first recognized and incised by NER proteins, such as ERC C1/XPF (99) This incision leads to a DSB, which is then resected and strand invas ion occurs, ultimately leading the repair via HR (89) Throughout the process of ICL repair, numerous proteins are assembled at the damaged s ite, and the loading of these proteins onto the chromatin is coordinated by the Fanconi Anemia (FA)/BRCA DNA damage repair pathwa y (89, 93) This pathway and the critical role it plays in DNA damage repair is discu ssed in detail in a later section. Based on the vital role that DNA damage repair mechanisms play in maintaining genomic stability, it is easy to see why toxically damaging the DNA of cancerous cells and inhibiting DNA repair pathways in these cells h as proven to be an effective means of killing tum ors. Conversely, it is understandable that defects in any of these repair

PAGE 30

17 pathways can cause numerous problems, actually giving rise to cancer and other diseases that predispose to cancer Diseases of Defective DNA Damage Repair Defects and mutations in DNA damage repair pathway genes are known to be causative for a number of diseases and, because of the genomic instability inherent in cells with ineffective repair mechanisms, these diseases are known to be associated with a high prop ensity for developing cancer. The cells of a taxia telangiecta sia (A T) patients, for example, do not express ATM, leading to impaired cell cycle checkpoints and genomic instability typically resulting in a translocation b etween chromosomes 7 and 14 (100 101) A T is characterized by such symptoms as progressive ataxia and impaired articulation, as well as a predisposition to lymphoma (101) As another example, patients with Li Fraumeni syndrome develop a wide variety of tumors at an early age (101) This disease is caused by mutations in p53, a protein ac tivated in response to DNA damage and involved in cell cycle regulation as well as in NER (101) Likewise, patients with Xeroderma pigmentosum (XP), caused by mutations in NER pathway genes, develop basal cell carcinoma at a greater than 1000 fold rate than that of the general population; and those with N ijmegen breakage syndrome (NBS), who have MRN complex defects, are predisposed to lymphoma (101 103) Fanconi anemia (FA) was first described in 1927 and is report ed to have a 1 in 300 carrier frequency with a median age of survival of only 23 years (104) This disease an autosomal recessive or X linked disorder is caused by defects in any of 13 known FA genes. As mentioned above, this pathway is integral in coordinating HR,

PAGE 31

18 NER and TLS (93) FA is characterized by congenital malformations, pancyto penia, and hypopigmentation (105) This disease can also detrimentally affect the cardiac, renal and gastrointestinal systems (105) Furthermo re, patients present with hematologic problems at a median age of seven years old, and 90% of these patients develop bone marrow failure by the age of 40 (104) The cells of FA patients are hypersensitive to DNA damaging agents such as diepoxybutane (DEB) or mitomycin c, and chromosomal breakage analysis using these agents is used as a diagnostic tool for t his disease (106) The chromosomal instability seen in FA pati ents predisposes them to cancer, with a median age of onset at just 14 years of age (105) Patients with the FA D1 and N subtypes are the most severely mal (107 108) Conversely, all FA patients who survive past 50 are of the subtype FA A (108) suggesting that this is the least severe genotype. Finally, as a whole, over 50% of FA patients will develop AML by the age of 50, and they also have up to a 700 fold increased incidence of developing head and neck SCC when compared to the overal l population (104, 1 09) The high propensity for cancer development in FA patients underscores the vital role that the FA/BRCA DNA damage repair pathway plays in maintaining genomic integrity. The Fanconi Anemia (FA)/BRCA DNA Damage Repair Pathway Members of the FA/BRCA DNA damage repair pathway have been identified using complementation st udies in patients with Fanconi a nemia. Thirteen FA complementation groups have been identified from these studies, and all 13 genes

PAGE 32

19 (FANC A, B, C, D1, D2, E, F, G, I, J L, M, and N) have since been cloned via complementation cloning, positional cloning or protein association (110 123) As mentioned above, this pathway has been shown to b e important for DNA damage repair via HR, NER and TLS (93) A summary of each of these 13 genes is provided in Table 1, and a depiction of this pathway in relation to HR is portrayed in Figure 3. Upstream FA Core Complex Eight FA proteins (FANC A, B, C, E, F, G, L, and M) two Fanconi anemia associated proteins (FAAP24 and FAAP100) and Hes 1 form a comp lex in the nucleus termed the Fanconi anemia core complex (105, 124 127) The main function of the core complex is to monoubiquitinate FANCD2 and FANCI, and all components of this complex must be int act in order for the monoubiqutination/activation of FANCD2 and FANCI and consequent facilitation of DNA damage repair (99, 128) Furthermore, f unctions for some of these proteins beyond the realm of FA pathway act ivation have also been described FANCA interacts with FANCG and FANCL and phosphorylation of FANCA is required for its accumulation in the nucleus (126, 129) FANCB and FANCL are also important for the nucl ear accumulation of FANCA (126) ATR has been sho wn to phosphorylate FANCA and outside of the FA core complex, this protein has also been found to be associated with the IKK signalsome as well as the SWI/SNF complex, the NER protein XPF and the centromere associated protein E (CENP E) (105, 130 132) Finally, FANCA also associates with the chaperone protein Hsp90, and disruption of this

PAGE 33

20 Table 1. Overview of FA pathway members.

PAGE 34

21 Figure 3. The FABRCA DNA damage repair pathway. Eight FA subunits, two Fanconi anemia associated proteins and Hes1 form the upstream FA core complex (in green). Intact core complex monoubiquitinates and thus activate FANCD2 and FANCI via the E3 ligase activity of FANCL. The ID complex (brown) in turn interact s with FA proteins downstream of the core complex (blue) to initiate DNA damage repair via homologous recombination. Phosphorylation of FANCA, FANCD2, FANCI, and FANCM by ATR is also required for activation of this pathway. UBE2T is the E2 enzyme involve d in the monoubiquitination events, and USP1 functions as a negative regulator of this pathway by deubiquitinating FANCD2 and FANCI. FANCM loads the core complex on the chromatin and also activates ATR.

PAGE 35

22 interaction results in proteasomal degradati on of FANCA an d export to the cytoplasm (133) FANCB, which is the only X li nked FA gene, associates with FANCL in the core complex and, along with FANCG and FANCM, stabilizes the interaction between FANCL and FANCA (116, 126) The stability of both FANCB and FANCL is mediated by associati on with FAAP100 as the formation of a FANCB/FANCL/FAAP100 complex protects all three of the se proteins for degradation (125) FANCC is located primarily in the cytoplasm, but can be recruited to the nucleus via its binding partner FANCE (134 136) Interestingly, the levels of FANCC mRNA are constant throughout the cell cycle, but FANCC protein is proteasomally degraded in a cell cycle dependent manner (137) This protein has been linked to DSB repair mechanisms, as it is necessary for mitomycin c i nduced MRN foc i formation (138) Separate from its role in the FA core complex and MRN foci formation FANCC is also necessary for maintenance of the G2/M checkpoint, is required for optimal STAT activation, has been found to interact with Hsp70, and can prevent apoptosis of hematopoietic cells by enhancing the enzymatic activity of glutathione S transferase P1 1 (GSTP1) (139 142) FANCC nuclear acc umulation is regula ted by FANCE, and the converse is also true (135) FANCE is also a partner of FANCD2, and is known to arbitrate the interaction between this protein and FANCC, as well as between FANCC and FANCF (143) FA NCE and other core complex members must be functional to activate DNA damage repair via the FA/BRCA pathway. Interestingly, following DNA damage, phosphorylation of FANCE at threonine 346 and serine 374 by Chk1 leads to its

PAGE 36

23 degradation (144) Therefore, phosphorylation of FANCE following DNA damage is postulated as one way in which the FA/BRCA pathway is negatively regulated (144) The fifth subunit of the FA core complex is FANCF. Leveille et. al. identified (145) The N terminal region of this protein stabilizes the interaction between FANCA and FANCG and between FANCC and E, and FANCG also binds directly to the C terminal region of FANCF (145) Phosphorylation of the FANCG protein by ATR is required for the direct intera ction between FANCD2 and BRCA2, and FANCG also promotes formation of a complex betwe en these two proteins and the Rad51 paralog XRCC3 (146) Interestingly, Wilson et. al. found that FANCG and XRCC3 were epistatic for mitomycin c sensit ivity, providing another link to the FA/BRCA pathway and HR repair (146) FANCL is one of the key mediators of FANCD2/I monoubiquitination. This prot ein, which binds to other FA core complex proteins via its WD40 repeats, is reported to have E3 ligase activity (115, 147) The PHD/RING finger motifs of FANCL allow it to recruit UBE2T, the E2 enzyme, to facil itat e monoubiquitination (148) Finally, FANCM is the most recently identifie d member of the FA core complex. This protein has an N terminal helicase ATPase domain and a C terminal endonuclease domain (117) FANCM displays a high affinity for branched DNA structures and likely plays a role in replication fork remodeling (149) FANCM forms a stable complex with FAAP24 that binds to chromatin in response to DNA damage or during cell cycle progression and recruits the core complex to the chromatin during S phase (150 151) FANCM is phosphorylated by Plk1, ATM or ATR, and hyperphosphorylation and subsequent degradation of FANCM following replication releases the FA core complex

PAGE 37

24 from the chromatin (151 1 52) In Xenopus egg extracts, Sobeck et. al. found that binding of xFANCM to the chromatin and subsequent phosp horylation of FANCM was dependent upon FANCD2 (151) Conversely, FANCM is required for FANCD2 monoubiquit ination (153) Also, FANCM and FAAP24 interact with the checkpoint protein HCLK2 and regulate ATR signaling in a manner independent of the FA pathway (154) ID Complex Each of the upstream core components described above must be intact and functional in order for the activation/monoubiquitination of FANCD2 and FANCI to occur. These two proteins stabilize one another and are known as the ID complex (120) The ubiquitination of FANCI is important for the maintenance of ubiquitination on FANCD2, and vice versa (120) FANCI phosphorylation by ATR is also necessary for FANCD2 activation (155) and ATR mediated phosphorylation of FANCD2 is necessary for DNA damage induced foci formation (64) Following monoubiquitination, the FANCD2/FANCI complex translocates to sites of damaged chromatin. Here, FANCD2 has been shown to interact with proteins such as BRCA1 and RAD51 in an S phase specific manner (15 6) BRCA2 and PCNA (157) and NBS1 (158) It is believed that FANCD2 and its interaction with these proteins initiates DNA repair via homologous recombination (128, 159) The FA/BRCA pathway has also been implicated in translesion synthesis repair (128, 160) and phosphorylation of FANCD2 by ATM/ATR has also been shown to initiate an inter S phase cell cycle checkpoint (64, 161) FANCD2 is deubiquitinated and thus inactiva ted

PAGE 38

25 by the USP1 enzyme (162) Importantly, DNA crosslink repair occurs only after FANCD2 is deubiquitinated (163) FA Proteins Downstream of ID Finally, t hree FA proteins FANCD1/BRCA2, FANCJ and FANCN, function downstream of the ID complex. Like FANCM, FANCJ also has helicase and ATPase activity (164) Sommers et. al. found that this ATP hydrolysis via FANCJ can destabilize prote in/DNA complexes FANCJ can control HR repair via inhibition of RAD51 strand exchange and may also remove DNA structures that would inhibit efficient repair (165 166) FANCN/PALB2, a breast cancer predi sposition gene interacts with and is essential for the stability of the tumor suppressor gene BRCA2 (167) FANCN also promotes the interaction between BRCA1 and BRCA2 (168) BRCA2 is important for loading RAD51 to the site of DNA damage, thus initiating HR repair (165) In summary, the FA core complex is essential for the monoubiquitination of the ID complex members, and this activation event l eads to interactions with numer ous proteins and the initiation of DNA damage repair. FA/BRCA Pathway and Drug Resistance As described above, the FA/BRCA DNA damage repair pathway is complex and requires the coordinated efforts of numerous proteins for proper function. D efects in the FA/BRCA DNA damage repair pathway lead to genomic instability, which can ultimately give rise to cancers (105) Conversely, e nhanced ex pression of this pathway

PAGE 39

26 can lead to resistance of tumor cells to chemotherapeutic agents Our lab was the first to show overexpression of FA/BRCA pathway genes (4) Gene expression profile analysis perf ormed by our lab revealed that two FA/BRC A DNA damage repair genes ( fancf and rad51c ) were overexpressed in cells selected for resistance to melphalan when compar ed to the drug sensitive parent cell li ne (4) Further investigation of this pathway, using the more sensitive method of q PCR, showed that many FA/BRCA pathway genes are overexpressed in two melphalan resistant myeloma cell lines when compared to the d rug sensitive cell lines (3) Importantly, u sing siRN A techniques to knock down FANCF Chen et. al demonstrated a causal relati onship between levels of FANCF and melphalan response. F urthermore, overexpressing FA NCF in the drug sensitive cell line conferred resistance to melphalan (3) Also, in a separate study using a different melphalan resistant MM cell line, Xiao et. al. found that resistance to melphalan could be reve rsed via inhibition of FANCD2 activation with the natural agent curcumin (169) The FA/BRCA pathway has also been found to be important in drug resistance in other cancer types. Treatment of a FANCF deficient ovarian cancer cell line with temozolomide (TMZ) or BCNU caused enhanced cytotoxicity in these cells when compared to the isogenic FANCF corrected cell line (170) Also, FA proficient glioma cell lines were determined to be more resistant to TMZ and BCNU when compared to a glioma cell line that was FA deficient and inhibition of the FA pathway increased drug sensitivity (170) Furthermore the histone deacetylase (HDAC) inhibitor phenylbutyrate was found to enhance the sensitivity of head and neck cancer cells to cisplatin via inhibition of BRCA1 (171) and non small cell lung cancer cells were sensitized to

PAGE 40

27 cisplatin following transfection with an adenovirus expressing a dominant negative form of FANCA (172) Interestingly, FA/BRCA pat hway inactivation followed by re activation has been reported in tumors when analyzing these cells before and after treatment. Alan FANCF was methylated, and thus inactive, in ovarian tumors, and subsequently d emethylated/activated upon acquisition of cisplatin resistance (173) Also, analysis of ovarian cancer cell lines and patient specimens revealed s econdary mutations in BRCA2 following drug treatment, leading to restored BRCA2 function and cisplatin resistance (174 175) Overall the FA/BRCA pathway has been linked to drug resistance in a variety of tumor types and t hus should be considered an important target for overcoming drug resistance. The FA/BRCA Pathway is Regulated by NF B and Mediates Drug Resistance in Multiple Myeloma Due to the complexity of drug resistance and DNA damage repair mechanisms it is likely that the most durable chemotherapeutic responses will result from the development of rational drug combinations th at capitalize on synergistic interactions. The main hypothesis of all work presented in this dissertation is that the FA/BRCA DNA damage repai r pathway mediates resistan ce to chemotherapeutic agents used to treat mul tiple myeloma and other cancers, and ta rgeting this pathway is vital to overcome drug resistance. As mentioned above, we recently reported that the FA/BRCA DNA damage repair pathway is causative for resistance to melphalan in MM cell lines (3 4) T he goal

PAGE 41

28 of Part I of this d issertation was to determine the extent of FA/BRCA pathway involvement in drug resistance, including both alkylating and non alkylating agents, and in different tumor types. We analyzed FA/BRCA pathway mRNA expression in a prost ate cancer model selected for resistance to melphalan and an ovarian cancer cell line select ed for resistance to cisplatin Substantiating the results that we have seen in the melphalan resistant MM cell lines, we show that both resistant cell lines also overexpress FA/BRCA pathway genes when compared to their respective isogenic drug sensitive parent cell line. Furthermore, we analyzed FA/BRCA pathway expression in 8226 cells selected for resistance to two topoisomerase II inhibitors, doxorubicin and mit oxantrone. Interestingly, we did not see global overexpression of FA/BRCA pathway genes. These drug resistant cells, however, were found to selectively overexpress FANCF. We next wanted to determine if chemotherapeutic agents could be used to downregula te FA/BRCA pathway expression and thus reverse resistance. To this end, we analyzed FA/BRCA pathway expression following treatment with the proteasome inhibitor bortezomib. B ortezomib has been shown to enhance melphalan response both in vitro and in vivo (28, 59, 78) but the mechanism by which this occurs is largely unknown for FA/BRCA pathway activation (176) Based on these findings, we hypothesized that bortezomib enhances melphalan cytotoxicity via inhi bition of the FA/BRCA pathway. The experiments performed in Part I I of this dissertation test this hypothesis. We analyzed FA/BRCA pathway mRN A expression in MM cell lines as well as MM primary specimens following bortezomib treatment and found that bortezomib does indeed inhibit FA/BRCA pathway expression. We also found that bortezomib can inhibit FANCD2

PAGE 42

29 mRNA and protein expression, even in th e presence of melphalan, and it can also inhibit melphalan induced FANCD2 foci formation. Using the alkaline comet assay, we also show that bortezomib enhances melphalan induced ICL formation, likely through inhibition of DNA damage repair mediated by the FA/BRCA pathway. The experiments in Parts II I and IV of this dissertation further investigat e the regulation of the FA/BRCA pathway First we hypothesized that NF B transcriptionally regulates members of the FA/BRCA pathway. This hypothesis is based on our knowledge that NF B activity is constitutively activated in MM cells and is further overexpressed in drug resistant cells as well as at time of relapse (56 59) Also, our lab previously reported that the DNA binding activity of the RelB and p50 subunits is enhanced in MM cells displaying a drug resistance phenotype via ad hesion to fibronectin (58) Part III of this dissertation shows that NF B, specifically the RelB/p50 subunits, does indeed regulate FA/BRCA pathway transcription. Furthermore, inhibition of RelB/p50 reversed melphalan resis tance, and this reversal was overcome by re expressing FANCD2 in these cells. Next, because we found that FA/BRCA pathway mRNA expression was attenuated by bortezomib, but not to the same extent as the inhibition of FANCD2 protein expression, we hypothesi zed that bortezomib has a direct effect on FANCD2 protein expression. Therefore, we analyzed FANCD2 protein stability via stable isotopic labeling of amino acids in cell culture (SILAC) and mass spectrometry. We also analyzed the effects of various miRNA s on the expression of FANCD 2. Finally, we studied ATR activation in cells stimulated with bortezomib, as well as cell cycle regulation by bortezomib in these cells. We show that bortezom ib inhibits FANCD2

PAGE 43

30 synthesis and overcomes m elphalan induced S phase arrest, likely via inhibiton of ATR activity. Overall, the results presented in this dissertation show that drug response and resistance in MM, and possibly other cancers, is mediated by the FA/BRCA DNA damage repair pathway. Therefore, we believe that targeting the FA/BRCA pathway to inhibit DNA damage repair either directly or via inhibition of NF B, is vital for reversing, or possibly circumventing drug resistance in cancers such as multiple myeloma.

PAGE 44

31 MATERIALS & METHODS Cell Culture T he 8226 and U266 human multiple myeloma cell lines were obtained from the American Type Culture Collection (Manassas, VA), and the corresponding melphalan resistant cells (i.e., 8226/LR5 8226/Dox40, 8226/MR20 and U266/LR6) were generated in our laboratory as previously described (38, 177 179) All cell lines were maintained in RPMI 1640 (GIBCO Carlsbad, CA ) supplemented with 5% FBS (Omega Scientific Tarzana, CA ), 1% penicillin/streptomycin, and 100 mM L glutamine (Invitrogen Carlsbad, CA ). The 8226/LR5 and U266/LR6 melphalan resistant cells were passaged weekly in medium containing 5 M or 6 M melphalan (Sigma Aldrich St. Louis, MO ) respectively. The 8226/Dox40 cell line was maintained in 40 M doxorubicin ( Sigma Aldrich), and the 8226/MR20 line was passaged weekly in 20 M mitoxantrone (Sigma Aldrich). All cell lines are routinely tested (every three months) for mycoplama contamination and kappa/lambda expressi on. Cytotoxicity Assays 3 (4,5 Dimethylthia zol 2 yl) 2,5 diphenyltetrazolium bromide (MTT) analysi s was used t o compare levels of sensitivity to melphalan in the absence or presence of bortezomib (Millennium Pharmace uticals, Cambridge, MA). 8226/S, 8226/LR6, U266/S and U266/LR6 c ells were seeded a t 20,000 25,000 cells/well in a 96 well plate These

PAGE 45

32 cells were pre treated for 8 hours with 3x10 9 M bortezomib or vehicle control, followed by a 40 hour treatment with 2 fold serial dilutions of melphalan, ranging from 2x10 4 M to 6.3x10 6 M. Cells wer e maintained at 37C, 5% CO 2 for a total of 48 hours before harvesting. 50 l of MTT dye (2 mg/ml in PBS; Sigma Aldrich) was added to each well and the cells were incubated at 37C for an additional four hours. Plates were then centrifuged, media aspirat ed, and formazan was solubilized by adding 100 l DMSO. Optical density was measured at 540 nm using a Dynex II plate reader (Dynex Technologies, Chantilly, VA). The control used to normalize the bo rtezomib plus melphalan samples w as bortezomib treatment alone. Three independent experiments were performed. IC 50 values were solved for using a probit model (PROC PROBIT in SAS software) and a paired t test was then utilized to test for a significant difference between the IC 50 values in the melphalan trea ted versus combination bortezomib plus melphalan treated groups. MTT analysis was also used to analyze growth inhibition of the 8226/S and 8226/LR5 cell lines following treatment with BMS 345541 (Calbiochem, Gibbstown, NJ). Cells were seeded at 8,000 10,000 cells per well and treated with 1 5 M BMS 345541 for a period of 96 hours. Following incubation with drug, cells were analyzed as described in the previous paragraph. mRNA Isolation and qPCR Analysis Quantitative RT PCR was used to analyze FA/B RCA pathway mRNA expression in 8226 and U266 cells following drug treatment Specifically, 8226/S and 8226/LR5 cells were trea ted with 10 nM bortezomib. S amples were collected and analyzed at 2, 4,

PAGE 46

33 8, and 24 hours post bortezomib For the combination bo rtezomib plus melphalan studies, 8226/LR5 cells were pre treated with 3 nM bortezomib for eight hours followed by 16 hours treatment with 25 M melphalan. In a different study 8226/S, 8226/LR5, U266/S and U266/LR6 cells were treated with 4 M BMS 345541 and analyzed at 2, 4, 8, 12, 16 and 24 hours post drug treatment. Following drug treatment, total RNA was extracted using t he RNeasy Micr o kit (Qiagen Valencia, CA ) and subsequently, cDNA was synthesized using the SuperScript First Strand Sy Quantitative RT PCR was then carried out using either a customized microfluid ic card (Applied Biosystems, Foster City, CA) or an Assay on Demand probe (Applied Biosystems), with the ABI 7900 Sequence Detection System (Applied Biosystems). Results were analyzed using the comparative CT method of analysis and SDS 2.1 software (Appli ed Biosystems). All s amples were standard ized to the endogenous control gene gapdh and externally normal ized to the corresponding vehicle control sample Initial ly, a customized micro fluidic card was used to simultaneously analyze the expression of 11 FA /BRCA pathway related genes, brca1, brca2, fanca, fancc, fancd2, fance, fancf, fancg, fancl, rad51, and rad51c in 8226 cells treated with either 10 nM bortezomib or 4 M BMS 345541 I n order to incorporate recent addition s to the FA/BRCA family later studies were performed using a customized card that allowed for the analysis of 15 FA/BRCA related genes, brca1, brca2, fanca, fancb, fancc, fancd2, fance, fancf, fancg, fanci, fancj, fancl, fancm, fancn and usp1 This updated card was used to analyze the effect of BMS 345541 treatment on U266 cells. Finally, f ancd2 gene

PAGE 47

34 expression was determined using the fancd2 20X Assay o n Demand probe for the combination bortezomib plus melphalan studies T he effect of BMS 345541 and bortezomib on FA/BRCA gene exp ression was statistically analyzed by determining whether relative change of gene expression deviated from 1 for each cell line (e.g., 8226/S, 8226/LR5, U266, and U266/LR6 ). A relative change less than 1 indicates downregulation of mRNA expression compared to the vehicle control Since each gene sh owed a non linear pattern of relative change over time (see Figures 2, 19 and 21 ), instead of using a linear slope for testing a linear model with time as a categorical explanatory variable was used to test the null hypothesis of fold change=1 at each time point. Also, s ince multiple genes related to the FA/BRCA pathway were tested simultaneously, the p value was adjusted based on the false discovery rate to control for simultaneous testin g (180) Western Blot Analysis Immunoblot analysis was used to analyze FANCD2 and NF B family protein expression in 8226/S, 8226/LR5, U266/S and U266/LR6 cells following drug treatment. To analyze the effect of bortezomib on FANCD2 expression, 8226/LR5 and U266/LR6 cells were pre treated with 3 nM bortezomib or vehicle control for eight hours and subsequently stimulated with melphalan or vehicle control for 16 hours (24 hours drug treatment total). Following stimulation with drug, cells were washed twice in ice cold PBS and cell extracts were prepared by r esuspending in high salt lysis b uffer (50 mM Tris HCl [pH 7.4], 1 M NaCl, 0.1% NP 40, 1 mM dithiothreitol) supplemented with 1 Complete, Mini protease inhibitor cocktail tablet (Roche Applied Science, Indianapolis,

PAGE 48

35 IN), 25 mM NaF, 2 mM sodium orthovanadate, and 0.1 M NaP 2 O 4 per 10 mL ly sis buffer. Samples were then sonicated, incubated on ice for 30 min, and lysates were quantified with Bio Rad reagent (Bio Rad Hercules, CA ). 25 g lysate was separated using a 3% to 8% NuPage gel (Inv itrogen) and transferred to Protran nitrocellulose membrane (Whatman, Dusseldorf, Germany) FANCD2 protein levels were examined using an FANCD2 antibody (1:5000; Novus Biologicals, Littleton, CO), which detects both non and mono ubiquitinated FANCD2. Equal loading was determined by probing for the ho usekeeping protein actin (1:10,000; Sigma). Membranes were visualized using Western Lightning Plus ECL chemiluminescence substrate (Perkin Elmer, Waltham, MA). IKK phosphorylation was also examined in 8226/S and 8226/LR5 cells following stimulation wit h 25 and 50 M melphalan, respectively, for 5 120 minutes. Proteins were lysed and analyzed as described above, and phospho IKK /IKK (1:100 Cell Signaling, Danvers, MA ) IKK (1:500 ; Cell Signaling), IKK ( 1250 ; Cell Signaling), and actin anti bodies were used. The phospho IKK /IKK antibody specifically recognizes IKK and IKK after phosphorylation at Ser 176/Ser 180 and Ser 177/Ser 181, respectively. Finally following siRNA transfection of various NF B subunits, protein expression was ana lyzed using FANCD2, p65 (1:1500 ) p50 1:1000 ) c Rel (1:200 ) RelB ( 1:500 ) and p52 (1:1000 ) (Santa Cruz Biotechnology) antibodies TRAF2 (1:500 ; Imgenex, San Diego, CA) and FLIP L (1:200 ; BD Biosciences, San Jose, CA ) antibodies were used as p ositive cont rols, and GAPDH (1:500 ; Cell Signaling ) served as the negative control in these experiments.

PAGE 49

36 Immunofluorescent Microscopy Immunofluorescence techniques were used to analyze nuclear FANCD2 foci formation. Cells were treated with either vehicl e control or bortezomib for 8 h ours followed by 5 h ours treatment with melphalan. A cytospin was performed using 60,000 cells/slide, followed by fixation with 2% paraformaldehyde (Sigma Aldrich ). Slides were washed twice in PBS and cells were permeabilize d using 0.3% Triton X 100 in PBS supplemented with 1% normal goat serum (NGS; Sigma). Following permeabilization, cells were blocked for 30 minutes with 5% NGS, 0.1% Trit on X 100 in PBS. Slides were then stained with FANCD2 antibody (1:1000) for 2 hours in a humidified chamber Next, samp l e s we re washed three times in PBS and incubated for one hour with Alexa Fluor 488 secondary antibody ( 1:1000; Molecular Probes Invitrogen ) Finally, samples were washed three times in PBS and a coverslip was mounted on each slide using VECTASHI ELD Hardset Mounting Medium containing diamidino 2 phenylindole (DAPI; Vector Labs, Burlingame, CA) Fluorescence was detected using the Zeiss Axiovert Upright Fluorescent Microscope, and 100 cells per condition (control ; melphalan; bortezomib; and bortezomib plus melphalan) were scored as having greater or less than 5 foci. Three independent experiments were performed and statistical analysis was employed to compare differences between the four differe nt groups. Comet Assay DNA dam age was assess ed using the Alkaline Come t Assay as previously described (4) 8226/LR5 cells were either pre treated with 3 nM bortezomib or control

PAGE 50

37 for 8 h ours f ollowed by 5 hours treatment with 25 M melphalan. 8226/LR5 cells were also transfected with FANCD2 or control siRNA duplexes and, 48 h later, the cells were exposed to various amounts of 25 M melphalan or vehicle control for 5 h. Following drug treatment, samples were ir radiated at 9 Gy to induce single strand breaks (MARK I model 68A irradiator; J.L. Shepherd and Associates, San Fernando, CA). 5,000 cells were then washed once in PBS at 4 C, and 1% agarose was added to each sample. The agarose/cell suspension was loade d onto a frosted glass microscope slide and allowed to solidify. The slides were then placed in ice cold lysis buffer (2.5 M NaCl, 10 mM EDTA, 1% sodium sarcosinate, 1% Triton X 100, 10% DMSO, and 10 mM Tris; pH 10.0) for 1 hour at 4 C. Following lysis, slides were washed for 1 hour in alkaline wash buffer (0.03 M NaOH, 1 mM EDTA; pH 12.2). The samples were then electrophoresed for 20 minutes at 25 V and re equilibrated with TBE. The DNA was stained with SYBR Green (1:10,000; Molecular Probes, Eugene OR ) and slides were washed twice in TBE. 50 random images per slide were captured using fluorescent microscopy and quantified using Loats Associates comet analysis software (Loats Associates, Inc., Westminster, MD) The percent cross linking was calculated using the equation: % cross linking = 1 [(value mean control no IR )/(mean control IR mean control no IR )]. The control used for the bortezomib plus melphalan studies was bortezomib treatment alone. A hierarchical linear model was fit, with condition ( melphalan or melphalan plus bortezomib) as a fixed effect, and independent experiment as a random effect, to analyze the results of three independent experiments. (Confirmatory analyses were also performed without including the experiment effect). Mean p ercentage interstrand crosslinks (% ICLs) and 95% confidence intervals were generated. Analyses were performed in SAS, PROC MIXED.

PAGE 51

38 To examine the effect of the loss of RelB/p50 on re sensitization of 8226/LR5, cells were co transfected with RelB and p50 siRNAs or siRNA control duplexes for 48 hours, followed by stimulation with 25 100 M melphalan for five hours and irradiated and processed as described above. A linear regression was used to compare differences in melphalan induced ICL formation in 8226/S and 8226/LR5 siRNA transfected cells (i.e., LR5 RelB/p50 and LR5 siControl) relat ive to the 8226/LR5 wild type cell line. Patient Sample Plasma Cell Isolation and Purification FA/BRCA pathway mRNA expression was analyzed in myeloma cells puri fied from patients enrolled in an Institutional Review Board approved clinical trial for pati ents with primary refractory myeloma, after obtaining informed patient consent. As per protocol, patients were treated with 1.3 mg/m 2 bortezomib on days 1, 4, 8, and 11, every three weeks for two cycles. Following completion of the bortezomib cycles, pati ents underwent high dose melphalan treatment immediately followed by one dose of bortezomib as a conditioning regimen for tandem autologous peripheral blood stem cell transplants. Samples were collected and analyzed from three patients at the time of scree ning (baseline controls) and at 24 h after receiving the day 1 of cycle #1 bortezomib dose. Samples analyzed from a fourth patient were collected at screening, after 1 dose of bortezomib, after 2 cycles of bortezomib, three months post transplant, and at relapse. Plasma cells were isolated using a negative selection protocol, providing for >95% purity. Briefly, 1 mL of bone marrow aspirate was centrifuged in a Ficoll Plaque Plus gradient (Amersham Biosciences Piscataway, NJ ), and a cytospin of the isol ated cells was used to determine the initial purity of the plasma cell population. In parallel, 10

PAGE 52

39 Cocktail (Millennium Pharmaceuticals) for 20 minutes, followed by Ficoll extra ction. To assess the efficiency of selection, a new cytospin was prepared from these cells. Once the myeloma cells were isolated, RNA was extracted, cDNA synthesized, and q PCR analysis of FA/BRCA related mRNA expression was performed as d escribed above. Promote r Region Analysis Putative transcription fac tor binding sites on the promote r regions of brca1, brca2, fanca, fancb, fancc, fancd2, fance, fancf, fancg, fanci, fancj, fancl, fancm, and fancn ( 3000 to +1 segments of the genomic sequences) were de tected using a public regulation.com/cgi bin/pub/programs/pmatch/bin/p match.cgi) and the database provided by TRANSFAC ( http://www.gene regulation.com/pub/databases.html ). Matrix scores (>0.990) were determined u sing 3 sets of optimized cut off values. Electrophoretic Mobility Shift Assays NF B DNA binding activity was assessed utilizing the electrophoretic mobility shift assay (EMSA). Nuclear extracts were prepared from 8226 and U266 cells, and EMSAs were carried out as described previously (ref) For gel shifts, nuclear extracts were incuba ted on ice with NF B specific antibodies for 30 min prior to EMSA analysis. NF B DNA binding activity was measured using a probe containing the well described sequence of the TAGTTGAGGGGACTTTCCCAG

PAGE 53

40 indicated, nuclear extracts we re incubated with the following oligonucleotides containing FANCD2 specific consensus NF TTCAGACAGGGGCTCTCCCATTGCAA TTTCCCCAGGAAACCCCAATTTGCAA TTAATATACTAAAAAACCCTGAATAA TTTGAA GTGGGGCTTCCCAGACTGAA As a control for loading, NF 1 DNA binding act ivity was measured using a probe derived from the adenovirus 2 CTTATTTTGGATTGAAGCCAATAT Klenow (exo ) (New England Biolabs, Ipswich, MA) was added to the samples in the presence of [ 32 P]ATP for 30 min utes at 37 C. A gel filtration column (Roche Basel, Switzerland ) was used to remove unincorporated nucleotide, and 20 40 kcpm of probe was incubated with 5 g protein extract plus 1 g poly dI:dC for 20 min utes at room temperature. Protein DNA complexes were resolved on a 5% nondenaturating polyacrylamide gel and detected by autoradiography. Combination Index Analysis As a means to determine if bortezomib and BMS 345541 exact their cytotoxic eff ects by altering the same pathway (ie NF B), the dose effect relationship between these two drugs was analyzed in the 8226/LR5 and U266/LR6 cell lines. Cells were seeded at 15,000 cells per well and drugs were added both alone and in combination, simultaneously for a total of 72 hours. The con centration of bortezomib added to the 8226/LR5 cell line varied from 3 10.5 nM and from 2 5.3 nM in the U266/LR6 cell line. BMS 345541 was added to the 8226/LR5 and U266/LR6 cells at a range of

PAGE 54

41 concentrations from 500 1750 nM and 1500 4000 nM, respectivel y. The drugs were added at a constant molar ratio (1:167 for the 8226/LR5 cell line and 1:750 for the U266/LR6 cells). Following 72 hours incubation with drug, MTT dye was added and samples were processed as described above. Percent survival was determi ned relative to vehicle control treated samples. The dose effect relationship was analyzed using CalcuSyn software (Biosoft, Ferguson, MO), and is based on the Chou Talalay mul tiple drug effect equation (181) A combination index value equal to 1 indicates that the two drugs are ad ditive, >1 indicates synergism, and <1 denotes antagonism. Three independent experiments were performed. Tr ansfection of siRNA, p lasmids and miRNA 8226 cells were seeded in complete medium at a concentration of 2 10 5 cells/ml. After 24 h ours 4 5 10 6 cells/sample were resuspended in 200 l of cytomix buffer (containing 120 mM KCl, 0.15 mM CaCl 2 10 mM K 2 HPO 4 /KH 2 PO 4 25 mM Hepes, 2 mM EGTA, 5 mM MgCl 2 2 mM ATP, and 5 mM glutathione [pH 7.6]), mixed with the siRNA duplexes (Dharmacon, Lafayette, CO ) at a final concentration of 67 nM, and electroporated at 140 V/975 F using the Bio Rad GenePulser XCell (Bio Rad, Hercules, CA) A similar transfection protocol was used for the overexpression of untagged, full length FANCD2 using pIRES neo FANCD2 (exon 44 variant ; 20 g ) plasmid DNA. UGGUUUACAUGUCGACUAA UGGUUUACAUGUUGUGUGA UGGUUUACAUGUUUUCUGA UGGUUUACAUGUUUUC CUA

PAGE 55

42 (siCo ntrol Non CGUACGCGGAAUACUUCGA GUGCCAGGAUCACGUAGAAUU CGAACAGCCUUGCAUCUAGUU GGAUUGAGGAGAAACGUAAUU CUGCGGAUUUGCCGAAUUAUU GGAGACAUCCUUCCGCAAAUU U GGAUAAGUUGUCGUCUAU CAACAUACCUCGACUCAUU GGAUUUACCUGUGAUAAUA GGAGAUUGAUGGUCUACUA Transfected c ells were typi cally used in experiments 24 48 h ours post transfection The effects of hsa miR 16, has miR 23a, an d hsa miR 27 on FANCD2 expression were also analyzed in the 822 6/LR5 cell line The same transfection protocol as described above was used to transfect cells with pre or anti miRNAs at a concentration of 50 nM. Samples were collected at 24, 48 and 72 ho urs post transfection. Chromatin Immunoprecipitation Assays 8226/S and 8226/LR5 cells were cross linked in formaldehyde (20 10 6 cells/sample), lysed in SDS rich buffer, and the resulting nuclear fractions were sonicated until the average chromatin size reached 200 1000 bp (~2 4, 10 sec pulses/sample). The cell extracts were pre cleared with heat inactivated, protein A coated Staphylococcus aureus cells (PANSORBIN cells, Calbiochem), and were immunoprecipitated with normal rabbit IgG or NF B/Rel sp ec ific antibodies. After three washes, DNA/protein cross links were reversed at 65 C; and, a close to pure fraction of DNA was obtained with a ChIP IT mini column (Active Motif) and analyzed by quantitative PCR.

PAGE 56

43 The ChIP DNA was subjected to q uantitative RT PC R using the following primer AATGAATGGGCAGCCGTTA TAGCCTCGCTCCACCTGACT GGGTCTGCAGGAGATCAACTAAGAAA GTGCCTGGCCCTATGCTGTAACTA GAGCCAAGAGGTACCCTGATAAAGTC CAGC TTTGGTTTAATACCTGTCAGAATT B). D iffusion A poptosis S lide H alo (DASH) Assay Apoptosis was analyzed using t he DASH Assay kit (Trevigen Helgerman, CT ) which detects DNA fragmentation. This assay captures and detects damage induced low mole cular weight DNA fragments as diffuse halos in an agarose microgel. After the indicated siRNA transfections, the cells were treated with 25 100 M melphalan or vehicle control for 24 h ours then washed with PBS and embedded in low melting agarose. The emb edded cells were lysed for 10 min utes under alkaline conditions, and DNA was precipitated and visualized with SYBR Green fluorogenic dye. Fifty images were randomly captured per slide, and the logarithmic radius of each nucleoid was calculated using the t ail length parameter of the Loats Associates comet analysis software. A nalysis of variance (ANOVA) was employed to test whether nuclear DNA diffusion after melphalan treatment was different among all experimental groups. The fference method was used to adjust P values for multiple comparisons (182) To examine the relationship between the nuclear DNA diffusion and ICL, Pearson correlation was used to study their association (183)

PAGE 57

44 Stable Isotopic Labeling of Amino Acids in Cell Culture FANCD2 protein half life and doubling time was analyzed via stable isotopic labeling of amino acids in cell culture (SIL AC). 8226/LR5 cells were cultured for six arginine, glutamine, and phenol red, and supplemented with 5% dialyzed FBS, 1% penicillin/streptomycin, 100 mM L glutamine [U 13 C 6 ] L Lysine HCl and [U 13 C 6 15 N 4 ] L Arginine ) Following isotopic labeling, cells were washed twice in PBS and re divided into two flasks, 3 nM bortezomib or vehicle c ontrol was immediately added, and samples were harvested at 0, 4, 8, 12, 24 and 36 hours. Labeling with heavy media followed by a chase with light media allows for the simultaneous analysis of FANCD2 degradation (decrease in isotopically labeled FANCD2) a nd FANCD2 synthesis (incorporation of light/normal amino acids). Samples were harvested in high salt lysis buffer ( 50 mM Tris HCl pH7.4, 0.1% NP 40, 1M NaCl, protease inhibitor cocktail (Roche), 25 mM NaF, 2 mM Na 3 VO 4 and 0.1 M Na 2 HPO 4 ), sonicated and centrifuged at 14,0 00 rpm for 10 minutes Aliquots of the cell lysate (equivalent to 300 ,000 cells) were denatured by boiling in loading buffer and separated by 4 12 % Criterion XT Bis Tris gels for 80 minutes at 150 V. The gel was stained with colloidal Coomassie Brilliant Blue G 250 (Bio Rad). Bands from the mass of interest were excised and destained with 50% MeOH and 50 mM ammonium bicarbonate. Samples were then reduced with 2 mM tris (2 carboxyethyl) phosphine, alkylated with 20 mM iodoacetamide, an d digested with trypsin (Promega, Madison, WI)

PAGE 58

45 overnight at 37C. Following digestion, peptides were extracted and concentrated under vacuum centrifugation. Using a Proxeon nanoLC system, the sample (~150,000 cells) was loaded onto a column (LC packings/Dionex, Sunnyvale, CA) with 75 m inner diameter, 3 m particle size, and 100 pore size. Peptides were eluted on a 35 minute gradient fro m 5% B to 50 % B over 35 minutes at a flow rate of 300 nl/min. The solvent system was composed of aqueous 2% acetonitrile with 0.1% fo r mic acid (A) and aqueous 90% acetonitrile with 0.1% fo r mic acid (B). Peptide precursors were selected in the first quad rupole with a mass window of 0.2 (Q1); fragments were filtered at a resolution of 0.7 (Q3). The scan width was set to 0.002, and 15 milliseconds of acquisition time was used per transition. Collision energy values were calculated using the equation: CE = (0.034 m/z) + 3.314 V, based on the mass to charge ratio of the do ubly charged peptide precursor. Peak areas were identified and calculated using MRMer, which has been implemented as a pipeline in GenePattern (184) The raw data files from the instrument are converted into mzxml format; then, the LC MRM peaks are extracted and visualized for data evaluation. Resulting files were then compared using Post MRMer, developed in house for data visualization and evaluation, as well as comparison of sample groups MRM was performed on a Finnigan TSQ Quantum triple quadrupole mass spectrometer (Thermo Finnigan, San Jose, CA). The internal standard DAFFGNPR was added at a concentration of 20 fmole/injection to the samples after in gel digestion and was us ed as a normalization constant.

PAGE 59

46 BrdU/PI Cell Cycle Analy sis 8226/LR5 cells were pre treated with 3 nM bortezomib for eight hours and subsequently treated with 25 M melphalan. 1x10 6 cells were incubated with 30 g/ml bromodeoxyuridine (BrdU) for 30 minutes after 8, 24, 36, and 48 hours drug treatment. Samples were then washed once in cold PBS and fixed overnight at 4C with 4 ml cold PBS plus 6 ml cold 100% EtOH. Next, samples were centrifuged and 4 ml Pepsin solution (0.04% pepsin, 0.1% HCl) was added. Samples incubated while shaking for 1 hour at 37C. The DNA was then denatured by the addition of 2 N HCl for 30 minutes at 37C, followed by washing once with 0.1 M sodium borate to neutralize the acid. Samples were then washed once in PBTB ( 0.5% Tween 20, 0.5% BSA in PBS), and incubated in the dark for one hour with 10 l FITC conjugated anti BrdU in 200 l PBTB. Next, samples were centrifuged and incubated with 200 l PBTB containing 10 g/ml propidium iodide and 0.25 mg RNase A for 30 minutes at 37C. Finally, samples were centrifuged, re suspended in 400 l PBS, and analyzed using a FACScan flow cytometer (BD Biosciences) and FlowJo software (Tree Star, Ashland, OR).

PAGE 60

47 RESULTS Part I: Fanconi Anemia/BRCA Pathway Expression in Drug Resistant Cell Lines Our lab was the first to report that members of the FA/BRCA DN A damage repair pathway are overexpressed in melphalan resistant myeloma cell lines (3 4) Furthermore, inhibition of FANCF in the melphalan resistant 8226/LR5 cell line partially reversed resistance in these cells and FANCF overexpression in the drug sensitive cells conferred resistance to melphalan (3) Furthermore, members of the FA/BRCA pathway have been shown to mediate sensitivity to cisplatin, BCNU, and TMZ in differ ent tumor types as well (170, 172 175) Based on these reports, we hypothesized that overexpression of FA/BRCA pathway members is a common mechanism by which tumor cells acquire resistance to chemotherapeutic agent s. This section of the dissertation summarizes our findings regarding FA/BRCA pathway mRNA expression in isogenic drug sensitive and drug resistant tumor cell lines. We found that cells selected for resistance to the alkylating agents melphalan and cispl atin overexpress FA/BRCA pathway genes, whereas cells selected for resistance to topoisomerase II inhibitors specifically overexpress FANCF. FA/BRCA P athway mRN A is Overexpressed in Cells Selected for Resistance to Melphalan and C isplatin

PAGE 61

48 The DU 145/M4. 5 prostate cancer cell line was selected for resistance to melphalan by chronically treating the parental DU 145 cell line with low doses of melphalan for a period of three years (1 85) The DU 145/M4.5 cells are approximately 27 fold resistant to melphalan when compared to the drug sensitive parental cells (185) Quantitative RT PCR analysis of FA/BRCA pat hway mRNA expression was performed in these cell lines using a customized microfluidic card to analyze expression of 11 FA/BRCA pathway related genes ( brca1, brca2, fanca, fancc, fancd2, fance, fancf, fancg, fancl, rad51 and rad51c ) Similar to our publis hed results showing overexpression of FA/BRCA pathway genes in melphalan resistant myeloma cell lines (3 4) the DU 145/M4.5 melphalan resistant prostate cancer cell line shows enhanced FA/BRCA pathway expression wh en compared to the drug sensitive parent cell line (Figure 4A). Specifically, nine of 11 genes analyzed ( brca1, brca2, fanca, fancc, fancd2, fance, fancg, rad51 and rad51c ) show at least two fold enhanced expression in the melphalan resistant versus melph alan sensitive cells. We next analyzed FA/BRCA pathway mRNA expression in cells selected for resistance to cisplatin, another alkylating agent. The C13* ovarian cancer cell line was selected for resistance to cisplatin (186) This cell line is approximately 15 fold resistant to cisplatin when compared to the drug sensitive OV2008 cell line, and is also cross resistant to melphalan (186) Analysis of FA/BRCA pathway mRNA expression revealed overexpression of many of these genes, similar to the results seen in cells selected for resistance to melphalan (Figure 4B). Based on these results, we conclude that selectin g tumor ce lls for resistance to alkylating agents typically results in overexpression of

PAGE 62

49 Figure 4. Melphalan and cisplatin resistant cells overexpress FA/BRCA pathway genes. mRNA levels of FA/BRCA pathway genes were analyzed in melphalan and cisplatin resistant cell lines using a customized microfluidic card and q PCR analysis. (A) The DU 145/M4.5 prostate cancer cell line is ~27 fold resistant to melphalan when compared to the drug sensitive DU 145 parental cell line. n=1. (B) C13* cells are ~15 fol d resistant to cisplatin when compared to the drug sensitive OV2008 parental cell line. n=3.

PAGE 63

50 members of the FA/BRCA pathway and targeting this pathway is likely vital for overcoming drug resistance. FANCF is Specifically Overexpressed in Myeloma Cel ls S elect ed for Resistance to Topoisomerase II I nhibitors We next analyzed FA/BRCA pathway mRNA expression in myeloma cells selected for resistance to doxorubicin and mitoxantrone. These two chemotherapeutic agents are classified as topoisomerase II inhi bitors, which function by inhibiting this enzyme, resulting in single and double strand breaks. The 8226/Dox40 cell line was selected for resistance to doxorubicin via chronic stimulation with increasing doses of this drug for a period of 10 months, and t hese cells are approximately 10 fold resistant to doxorubicin when compared to the drug sensitive 8226/S parent cell line (178) Unlike cells selected for resistance to alkylating agents, the doxorubicin resistant myeloma cells do not show global enhanced expression of FA/BRCA pathway gene s (Figure 5A). These cells do, however, specifically overexpress FANCF. FA/BRCA pathway mRNA expression was next analyzed in the mitoxantrone resistant 8226/MR20 cell line. When compared to the drug sensitive parent cell line, these cells are close to 4 0 fold resistant to mitoxantrone. Interestingly, similar to the results seen with the 8226/Dox40 cells, the 8226/MR20 cells show enhanced expression of FANCF (Figure 5B). Collectively, the results presented in this section of the dissertation show en hanced mRNA expression of many FA/BRCA pathway members in tumor cells

PAGE 64

51 Figure 5. Doxorubicin and mitoxantrone resistant myeloma cells overexpress FANCF. mRNA levels of FA/BRCA pathway genes were analyzed in doxorubicin and mitoxantrone resistan t myeloma cell lines using a customized microfluidic card and q PCR analysis. (A) The 8226/Dox40 cell line is ~10 fold resistant to doxorubicin when compared to the drug sensitive 8226/S parental cell line. n=3. (B) 8226/MR20 cells are ~37 fold resistan t to mitoxantrone when compared to the drug sensitive 8226/S parental cell line. n=3.

PAGE 65

52 selected for resistance to melphalan or cisplatin, whereas cells selected for resistance to topoisomerase II inhibitors specifically overexpress FANCF. Part I I: Bor tezomib Enhances Melphalan Response in Multiple Myeloma Cell Lines and Patient Samples Al though there are many options available today for the treatment of multiple myeloma (MM) that did not exist even ten years ago, this disease remains incurable, mainly due to the emergence of drug resistance following chemotherapy. Our laboratory previously reported that members of the FA/B RCA pathway are overexpressed in melphalan resistant cell lines, and causative for this resistance (3 4) Specifically, using siRNA techniques to inhibit FANCF expression in the melphalan resistant 8226/LR5 cell line partially reversed resistance (3) Conversely, overexpression of FANCF in the drug sen sitive 8226/S cell line conferred resistance to melphalan (3) Based on these results, we hypothesized that bortezomib enhances melphalan response by inhibiting FA/BRCA pathway expression. Current MM treatment re gimens include combining different agents to circumvent or overcome drug resistance. Others have reported that the proteasome inhibitor bortezomib enhances melphalan response in vitro (59, 78) as well as in clinic al trials (25, 27 28, 79) However, the mechanism by which this enhanced response occurs remains unclear. Based on our previous reports that the FA/BRCA pathway is involved in melphalan resistance, we hypothesized that bortezomib enhances melphalan response by inhibiting expression and function of the FA/BRCA DNA damage repair pathway.

PAGE 66

53 This hypothesis is further substantiated by a recent report, which found that proteasome function is required for FA/BRCA pathway activation (176) In this portion of the dissertation, we analyze the role of the FA/BRCA pathway in enhanced m elphalan response by bortezomib. We show that bortezomib inhibits mRNA expression of many FA/BRCA path way members. We also demonstrate that FANCD2 mRNA and protein expression is inhibited, even in the presence of melphalan, and that bortezomib inhibits melphalan induced FANCD2 foci formation. Bortezomib also enhanced DNA damage induced by melphalan treat ment, likely via inhibition of FANCD2 expression. Importantly, we also show that bortezomib inhibits FA/BRCA pathway expression in MM patient specimens. Combined, these results show that bortezomib enhances melphalan response via inhibition of the FA/BRC A pathway, and provide a target for overcoming or even circumventing drug resistance in multiple myeloma and possibly other cancers. Bortezomib Enhances Melphalan Response in Myeloma Cell L ines To test our hypothesis that bortezomib enhances melpha lan response via inhibition of the FA/BRCA pathway, we first needed to confirm the work of others that bortezomib does indeed enhance melphalan cytotoxicity. Since we believed that bortezomib enhances melphalan response by inhibiting this pat hway, we firs t treated cells with bortezomib, followed by exposure to melphalan. Using MTT assays, we pre treated two melphalan sensitive cell lines (8226/S and U266/S), and two melphalan resistant cell lines (8226/LR5 and U266/LR6), with a non toxic dose (3nM) of bor tezomib for eight hours followed by treatment with varying doses of melphalan for 40 hours (48 hours

PAGE 67

54 total drug treatment). The results show that pre treatment with bortezomib enhances sensitivity to melphalan when compared to melphalan treatment alone ( Figure 6 ). In all four cell lines, s tatistical analysis of the IC 50 values generated from three independent experiments revealed a statistically significant reduction in the IC 50 values of cells pre treated with bortezomib versus cells exposed only to mel phalan. These results confirm the work of others and show that pre treatment with a non toxic dose of bortezomib enhances melphalan response. Bortezomib D own regulates FA/BRCA Pathway mRNA E xpression We next wanted to determine if bortezomib inhibits FA /BRCA pathway expression and function. To this end, we analyzed FA/BRCA pathway gene expression in the 8226/S and 8226/LR5 cell lines following treatment with 10 nM bortezomib Samples were collected at 2, 4, 8, and 24 hours, and mRNA expression was anal yzed using a customized microfluidic card (which allowed for simultaneous analysis of eight FA genes, fancd1/ brca2, fanca, fancc, fancd2, fance, fancf, fancg, fancl, and three DNA damage response genes, brca1, rad51 and rad51c ) and quantitative RT PCR. Bo rtezomib decreased expression of certain FA/BRCA pathway members in both cell lines in as little as 2 hours, with maximal effect seen at 24 hours (Figure 7 ) Specifically, bortezomib significantly reduced expression of brca2, fancc, fancd2, fance, fancf, fancg, fancl, and rad51c in the drug sensitive 8226/ S cell line at 24 hours (Table 2 ). In the 8226/LR5 melphalan resistant cell line, fancd2, fance, fancf and fancg were reduced significantly following 24 hours t reatment with melphalan (Table 2 ). Importa ntly, the downregulation of mRNA expression seen follo wing treatment with bortezomib is not

PAGE 68

55 Figure 6. Low dose bortezomib enhances melphalan response in melphalan sensitive and melphalan resistant myeloma cell lines. Melphalan sensitivity was studi ed in melphalan sensitive and resistant myeloma cell lines in the absence or presence of a non toxic (3 nM) dose of bortezomib. Percent growth is shown following exposure to melphalan alone or bortezomib plus melphalan treatment, in the (A) 8226/S melphal an sensitive and (B) 8226/LR5 melphalan resistant cell lines, as well as in the (C) U266/S and (D) U266/LR6 cell line pairs. The control used for the bortezomib plus melphalan studies was bortezomib treatment alone. At least 3 independent experiments wer e performed, and the mean of these experiments and SEM are depicted in the growth curve. Mean IC 50 values are also shown. *Statistical significance was determined using a pai red t statistically significant levels in all four cell lines.

PAGE 69

56 due to a global inhibit ion of transcription, as expression of genes not related to the FA/BRCA pathway ( b2m, ipo8 and tfrc ) were un affected b y bortezomib treatment (Figure 8 ). These results suggest that bortezomib may function in part by inhibiting the FA/BRCA pathway. Bort ezomib I nhibits FANCD2 mRNA, Protein E xpression, and Foci F ormation, Even in the Presence of M elphalan Of the FA/BRCA pathway related genes that did change following bortezomib treatment, FANCD2 mRNA expression was most consisten tly and dramatically decreased in both the drug sensitive 8226/S and drug resistant 8226/LR5 cell lines. To further characterize the eff ect of bortezomib on melphalan response, FANC D2 mRNA a nd protein expression was analyz ed in the drug resistant 8226/LR5 and U266/LR6 cell lines Cells were pre treated with either vehicle control or 3 nM bortezomib for eight hours and subsequently exposed to 25 M melphalan for 16 hours. Results showed that melphalan treatment alone did not affect FANCD2 mRNA expression in the 8226/LR5 cell line whereas bortezomib treatment, both alone and in combination with melphalan, decreased expression of FANCD2 (Figure 9 A ) Analysis of the U266/LR6 cell line revealed that melphalan treatment alone enhanced expression of FANCD2, and, comparable to results seen in the 8226/LR5 cell line, bortezomib treatment inhibited FANCD2 gene expression (Figure 9 B ). Importantly, decreas ed FANCD2 mRNA expression seen with low dose bortezomib was maintained even in the presence of melphalan in both cell lines FANCD2 protein expression was also analyzed in the 8226/LR5 and U266/LR6 cell lines following the same method of treatment with bortezomib, melphalan, or the

PAGE 70

57 Figure 7. Bortezomib downregulates FA/BRCA pathway mRNA expression in melphalan sensitive and resistant myeloma cell lines 8226/S and 8226/LR5 cells were treated with 10 nM bortezomib and harvested at indicated times. FA/BRCA gene expression was determined in quadruplicate samples by qPCR using a customized microfluidic card. Results depict fold change normalized to vehicle control samples. Statistical analysis is shown in Table 2. Three independent experiments were performed.

PAGE 71

58 Table 2. Statistical analysis of FA/BRCA gene expression following bortezomib treatment in 8226 cells. To test the effect of bortezomib on FA/BRCA gene expression in 8226/S (A) and 8226/LR5 (B) cells, we examined whether fold change of gene expression deviated away from 1. Since each gene showed a non linear pattern of fold change over time (see Figure 2), a linear model with time as a categorical explanatory variable was used to test the null hypothesis of fold change=1 at each time poi nt for each gene in each cell line. Since we tested 11 FA/BRCA related genes, we adjusted for p value based on the false discovery rate to control for simultaneously testing (Benjamini, 1995).

PAGE 72

59 Figure 8. Gene expression levels of B2M, IPO8 and TFRC remain unchanged in 8226/S cells treated with BMS 345541 and bortezomib 8226/S cells were treated with BMS 345541 or bortezomib as described in Figures 7 and 24 Relative changes in gene expression were obtained by internally standardizing against GAPDH and externally standardizing against the control, equal to 1. Results depict the mean relative change of three independent experiments and SEM. No significant difference in B2M, IPO8 or TFRC gene expression was seen following treatment with BMS 345541 o r bortezomib.

PAGE 73

60 combination ( Figure 10 ). The antibody against FANCD2 recognizes both non ubiquitinated (short, lower band) and monoubiquitinated, activated (long, upper band) FANCD2. Demonstration of the monoubiquitinated form of FANCD2 is evidence for t he presence and activation of the upstream FA complex (187) In this study, we found that in both cell lines melph alan increased FANCD2 monoubiquitination/activation. By compa rison, bortezomib attenuated total FAN CD2 protein levels resulting in a reduced amount of monoubiquitinated protein in the cells when compared to basal monoubiquitinated FANCD2 levels Furthermore, bortezomib effectively reduced FANCD2 levels, in the presence or absence of melphalan, compare d to melphalan alone. These results show that bortezomib impedes FA/BRCA pathway activation by inhibiting FANC D2 mRNA and protein expression. To further determine the effects of bortezomib on FANCD2 activation and function, immunofluorescent microscopy techniques were used to analyze FANCD2 DNA repair foci formation, a hallmark of FA pathway activation. 8226/LR5 cells were treated with vehicle control or bortezomib for 8 hours, followed by a five hour treatment with 50 M melphalan (Figure 11 ). FANCD2 foci formation, as measured by percentage of cells with greater than five foci, was found to be enhanced following melphalan but not bortezomib treatment. However, melphalan induced FANCD2 foci formation was inhibited whe statistical analysis confirmed a difference in foci formation between control and melphalan alone; melphalan alone versus bortezomib alone; and melphalan alone versus the combination of me lphalan and bortezomib. In contrast, no difference in foci formation was seen between the control, bortezomib alone, and the combination of

PAGE 74

61 Figure 9. Bortezomib inhibits FANCD2 mRNA expression, even in the presence of melphalan. 8226/LR5 (A) and U 266/LR6 (B) cells were pre treated with 3 nM bortezomib followed by 16 hours treatment with melphalan. Fold changes were obtained by internally standardizing against GAPDH and externally standardizing against the control, equal to 1 (noted by the solid li ne). Three independent experiments were performed. Data shown are mean value and SEM. *P<0.05.

PAGE 75

62 Figure 10. Bortezomib inhibits FANCD2 protein expression. Immunoblot analysis of 8226/LR5 (A) and U266/LR6 (B) cells were pre treated with 3 nM bor tezomib followed by 16 hours treatment with melphalan. Two distinct bands are seen: the upper, monoubiquitinated band and the lower, non ubiquitinated band. A representative blot of three independent experiments is shown.

PAGE 76

63 Figure 11. Bortezomib in hibits melphalan induced FANCD2 foci formation. Immunofluorescent microscopy was used to detect FANCD2 foci formation. Melphalan induced FANCD2 foci formation was inhibited when cells were pre treated with bortezomib. Inserts demonstrate the foci typica lly observed for single cells in respective treatment groups. Three independent experiments were performed. statistical analysis showed a significant difference between melphalan alone and control; melphalan alone and bortezomib alone; and melphalan alone and the combination of bortezomib plus melphalan. No difference was seen between control, bortezomib alone, and bortezomib plus melphalan.

PAGE 77

64 bortezomib plus melphalan. Based on these results, we conclude that a non toxic dose of borte zomib inhibits FANCD2 gene expression, FANCD2 protein levels and FANCD2 foci formation, even in the presence of melphalan. P revious reports have shown that FANCD2 monoubiquitination and foci formation is S phase specific (156) Furthermore, others have reported that bortezomib can red uce the percentage of cells in S phase (188 189) Therefore, we next wanted to determine if the reduction of FANCD2 protein expression and foci formation following bortezomib treatment was due in part to a lesser n umber of cells in the S phase of the cell cycle. In these studies, 8226/LR5 cells were pre treated with bortezomib for eight hours and subsequently exposed to melphalan for 16 hours. Using BrdU incorporation and PI staining, we observed that 3 nM bortezo mib treatment does indeed decrease the percentage of cells i n S phase, even in the presence of melphalan (Figure 12 ). These results may in part explain the decrease in total FANCD2 protein expression as well as FANCD2 foci formation following bortezomib t reatment. Bortezomib Enhances Melphalan Induced DNA Damage Via I nhibition of FANCD2 Our lab previously reported that DNA interstrand cross links (ICLs) induced by treatment with melphalan were reduced in melphalan resistant cell lines (8226/LR5 and U2 66/LR6) when compared to their respective drug sensitive parent cell lines (8226/S and U266/S) (3) Moreover, DNA damage repair mediated by the FA pathway, as indicated by ICL removal, was enhanced in the melphalan resistant cell lines (3 4) Based on our previous published results and our present observation that bortezomib reduces FANCD2 levels and foci formation, we hypothesized that the amount of DNA damage,

PAGE 78

65 Figure 12. Bortezomib treatment decreases the proportion of cells in S phase. 8226/LR5 cells were pre treated with 3 nM bortezomib followed by treatment with 25 mM melphalan for 16 hours. To determine the effect of bortezomib on cell cycle, cells were then in cubated with BrdU/PI for 30 minutes, fixed, and analyzed using flow cytometric techniques. The mean percentage of cells in each phase of the cell cycle and SEM are depicted, based upon three independent experiments.

PAGE 79

66 as measured by ICLs, would be g reater in cells treated with the combination of bortezomib plus melphalan as compared to cells treated with melphalan alone. Using the alkaline comet assay, DNA damage was measured in 8226/LR5 cells following treatment with 3 nM bortezomib alone 25 M me lphalan alone, or the combination ( Figure 13 ). Bortezomib treatment alone did not induce DNA damage when compared to control cells (Figure 14 ). Melphalan treatment induced DNA damage and DNA interstrand cross links at levels similar to those previously r eported by our lab (3) As predicted, when cells were treated with the combination of bortezomib plus melphalan, DNA damage was enhanced when compared to cells treated with melphalan alone (Figure 13 A ). Because bortezomib by itself did not induce DNA damage, the increase in damage seen when cells are pre treated with bortezomib followed by melphalan treatment (as compared to melphalan treatment alone) is likely due to reduced DNA damage repair. To determine if i nhibition of the FA/BRCA pathway, and in particular FANCD2, could result in enhanced DNA damage, we used siRNA to specifically inhibit expression of FANCD2. 8226/LR5 cells were transfected with either a control siRNA (siControl) or siRNA targeting FANCD2 (siFANCD2). Following transfection, cells were treated with 25 M melphalan for 5 hours, and alkaline comet assays were performed. As shown in Figure 13 B, siRNA mediated inhibition of FANCD2 increased the percentage of melphalan induced ICLs when compar ed to the control cells. Interestingly, similar differences in percentage of ICL formation are observed when comparing bortezomib plus melphalan or siFANCD2 plus melphalan to their respective controls. This observation underscores the role of FANCD2 inhi bition in the ability of bortezomib to enhance melphalan induced DNA damage Taken together, these results

PAGE 80

67 Figure 13. Bortezomib enhances melphalan induced DNA damage. The alkaline comet assay was used to assess DNA damage. (A) 8226/LR5 cells wer e pre treated with borteozmib for eight hours followed by five hours treatment with 25 mM melphalan. (B) FANCD2 expression was inhibited in 8226/LR5 cells using siRNA techniques. These cells were then treated with 25 mM melphalan for five hours and DNA d amage was assessed. Three independent experiments were performed. A significant increase (*p<0.0001) in the percentage of interstrand crosslinks (% ICLs) was seen in cells treated with combination bortezomib plus melphalan when compared to melphalan trea tment alone, and when comparing siControl+M to siFANCD2+M.

PAGE 81

68 Figure 14. Low dose bortezomib does not induce DNA damage. Comet moment analysis of 8226/LR5 cells treated with bortezomib revealed that low dose (3 nM) bortezomib does not induce DNA damage when compared to control treated samples. Three independent experiments were performed.

PAGE 82

69 indicate that bortezomib enhances melphalan induced DNA damage, leading ultimately to enhanced melphalan cytotoxicity, likely by targeting FANCD2 and th e FA/BRCA pathway. Bortezomib Reduces FA/BRCA Pathway Gene Expression in Patient Specimens To extend the results obtained in vitro to a more clinically relevant model, we analyzed FA/BRCA pathway mRNA expression in purified plasma cell s from myelo ma patients prior to and after treatment with bortezomib. As seen in Figure 15 A, a single dose of bortezomib reduced FA/BRCA mRNA expression when compared to basel ine (screening) levels in three patients. Plasma cells were analyzed from a fourth patient prior to therapy, following one dose of bortezomib, two cycles of bortezomib, three months after high dose melphalan and stem cell transplant, and at time of relapse (Figure 15 B) A moderate reduction in FA/BRCA pathway mRNA expression was seen in this pa Certain FA/BRCA genes were highly overexpressed however, at three months post high dos e melphalan (as compared to screening levels ; Figure 15 B ) This patient clinically relapsed only five months after completion of therapy and FA/BRCA pathway mRNA expression levels at this time were similar to levels at the time of screening. Importantly, these preliminary results fully support our hypothesis that bortezomib treatment leads to the in hibition of FA/BRCA gene expression in MM patients. Clinical response in five patients involved in the bortezomib study was compared to modulation of FA/BRCA pathway mRNA expression in these patients following treatment with bortezomib. One patient who showed no response, based on the Blad

PAGE 83

70 multiple myeloma response criteria and as indicated by the levels of IgG in the blood, also showed an increase in FA/BRCA pathway mRNA expressi on levels following one dose as well as after two cycles of bortezomib (Fi gure 16 A). Comparatively, one patient displayed a partial response and another showed complete response, and FA/BRCA gene expression was reduced in both of these patients following one dose of bortezomib treatment (Figure 16 B and C). Finally, mRNA expre ssion levels of two patients were analyzed at the time of relapse and compared to levels post t ransplant. As seen in Figure 16 D, FA/BRCA pathway expression levels showed a general trend of overexpression at the time of relapse. Importantly, these results support our hypothesis that effective bortezomib treatment leads t o the inhibition of FA/BRCA mRNA expression in MM patients. Collectively, the results presented in this section of the dissertation show that bortezomib potentiates melphalan activity b y inhibiting FA/BRCA pathway gene expression, reducing FANCD2 protein expression and foci formation and enhancing DNA damage likely via inhibition of DNA damage repair Importantly, these results appear to translate to the clinic, as bortez omib was also shown to modulate FA/BRCA pathway mRNA expression in multiple myeloma patient specimens.

PAGE 84

71 Figure 15. Bortezomib modulates FA/BRCA pathway mRNA expression in myeloma patient specimens. (A) Bone marrow aspirates were collected in three patients p rior to treatment with bortezomib (screening) and 24 hours post bortezomib. Plasma cells were isolated via negative selection, with >95% purity, and FA/BRCA pathway gene expression was determined using a customized microfluidic card and qPCR analysis. Fo ld changes were obtained by internally standardizing against GAPDH and externally standardizing against the screening sample, equal to 1 (noted by the solid red line). (B) Aspirates from one patient were collected at screening, after one dose of bortezomi b, following two cycles of bortezomib, 3 months post transplant, and at time of relapse. FA/BRCA pathway gene expression was analyzed as described in panel A

PAGE 85

72

PAGE 86

73 Figure 16. Analysis of FA/BRCA pathway mRNA express ion in samples taken from bortezomib treated myeloma patients. Following treatment with bortezomib, FA/BRCA pathway mRNA expression was analyzed in a patient who showed (A) no response, (B) partial response, and (C) complete response to treatment. Respon se was assessed based on the Blad Criteria of response. Fold changes were obtained by internally standardizing against GAPDH and externally standardizing against the screening sample, equal to 1 (noted by the solid red line). (D) Aspirates from two pati ents were collected at time of relapse and externally standardized against corresponding samples taken three months post transplant.

PAGE 87

74 Part II I : NF B Transcriptionally Regulates the FA/BRCA Pathway Our lab previously reported that many FA/BRCA pathway related genes are overexpressed in cells selected for resistance to melphalan (3 4) and others have also imp licated this pathway in the acquisition of drug resistance (170, 173) Furthermore, treatment with bortezomib was shown to inhibit expression of many of these genes in multiple myeloma cell lines as well as in pati ent specimens (190) suggesting that these genes may be co regulated. This portion of the dissertation analyzes the transcriptional regulation of members of the FA/BRCA DNA damage repair pathway Since NF B is constitutively activated in MM (47, 191) and since bortezomib is a known inhibitor of NF B (59, 78) we hypothesized that NF B transcriptional ly regulates FA/BRCA p athway family members. Analysis of the promote r regions of the FA/BRCA family members revealed a number of putative NF B binding sites, and BMS 345541, a specific inhibitor of NF B, was able to significantly reduce expression of the FA/BRCA pathway related genes analyzed. Using EMSAs, siRNA experiments, and ChIP analysis, we determined that two NF B subunits, RelB and p50, can bind to t he promotor region of FANCD2. We also found that inhibiting RelB/p50 caused a reduction in FANCD2 protein levels and sen sitized cells to melphalan. Importantly, re introducing FANCD2 in these cells once again conferred resistance. Taken together, these results indicate that NF B, specifically the RelB and p50 subunits, trancriptionally regulate members of the FA/BRCA pathway.

PAGE 88

75 Analysis of P romote r Regions of FA/BRCA Pathway M embers Reveals P utative NF B Binding S i tes As a means to determine possible transcriptional regul ators of members of the FA/BRCA pat hway, the promoter regions of the 13 FA family members ( fanca, fancb, fancc, fancd1/brca2, fancd2, fance, fancf, fancg, fanci, fancj, fancl, fancm, and fancn ) and brca2 were analyzed. Putative transcription factor bindin g sites within the 3000/+1 segments of the genomic sequences were identified using a public version of P Match and the database provided by TRANSFAC. As seen in Figure 17 the promoter regions of 11 of the 14 genes analyzed contained putative NF B binding sites. Interestingly, this analysis revealed four putative NF B binding sites on the promoter region of fancd2 Low Dose Bortezomib I nhibits NF B DNA Binding A ctivity Using higher doses of bortezomib, others have reported that bortezomib inhibits NF B activity (59, 78) We hypothesized that NF B transcriptionally regulates members of the FA/BRCA pathway, and so treatment with bortezomib reduces FA/BRCA pathway mRNA and protein expression via inh ibition of NF B DNA binding activity. In our system, we wanted to analyze NF B DNA binding activity in the 8226/LR5 cell line following treatment with low dose bortezomib or the combination of bortezomib plus melphalan. Using electrophoretic mobility s hift assays (EMSAs), it was revealed that e xposure to 3 nM bortezomib for 24 hours reduced NF B DNA binding activity, whereas treatment with melphalan e nhanced this activity (Figure 18 ). Interestingly, and correlating with our FANCD2 Western blot data, N F B activity

PAGE 89

76 Figure 17. Schematic view of putative transcription factor (TF) binding sites in FA/BRCA promoter regions. http ://www.gene regulation.com/cgi bin/pub/programs/pmatch/bin/p match.cgi ) and the database provided by TRANSFAC ( http://www.gene regulation.com/pub/databases.html ) were used to identify putat ive TF binding sites within 3000/+1 segments of FA/BRCA genomic sequences. Using 3 sets of optimized cut off values, matrix scores (>0.990) were determined.

PAGE 90

77 Figure 18. Bortezomib inhibits NF B DNA binding activity. 8226/LR5 cells were pre treated with 3 nM bortezomib or vehicle control for eight hours followed by 16 hours treatment with melphalan or control. Samples were collected following eight and 24 hours treatment with bortezomib and s ubjected to an electrophoretic mobility shift assay (EMSA) to analyze NF B DNA binding activity. NF 1 was used as a loading control. A film representative of three independent experiments is shown.

PAGE 91

78 was attenuated in cells pre treated with bortezo mib and subsequently exposed to melphalan when compared to cells exposed only to melphalan as well as to control cells. Bortezomib and BMS 345541, a Specific I nhibitor of NF B, are A ntagonistic We next wanted to determine if bortezomib was exacting its cytotoxic effects via inhibition of NF B. To this end, combination index analysis was performed using bortezomib and BMS 345541 BMS 345541 is a selective inhibitor of the IKK complex and a putative anti tumor agent (192) If bortezomib is functioning through the NF B pathway, then combining it with a specific inhibitor of this same pathway should result in antagonism. 8226/LR5 and U266/LR6 cells were treated simultaneously with varying doses of bortezomib and BMS 345541 at a constant molar ratio for a total of 72 hours Analysis of the dose effect relationship between these two compounds, using the Chou Talalay multiple drug effect equation (181) revealed that these compounds are antagonistic in their c ytotoxic effects (Figure 19 ), suggesting that the effects of both agents are driven by inhibition of the NF B pathway. Basal NF B DNA Binding Activity is Enhanced in Melphalan Resistant C ells Our lab previously reported that melphalan resistant myeloma cells overexpress FA/BRCA pathway genes (3 4) Therefore, we hypo thesized that, if NF B transcriptionally regulates members of this pathway, drug resistant multiple myeloma cells will display enhanced basal levels of NF B activity when compared to the drug sensitive parental cell lines. Using EMSAs to measure DNA

PAGE 92

79 Figure 19. Bortezomib and BMS 345541 are antagonistic. (A) 8226/LR5 and (B) U266/LR6 melphalan resistant myeloma cells were treated with bortezomib and BMS 345541 for 72 hours and combination index analysis was performed. Three independent experim ents were performed, and a representative is shown. The results show that the two drugs act antagonistically in these cell lines, suggesting that both exact their cytotoxic effects through the same (NF B) pathway.

PAGE 93

80 bound NF B complexes, we found that the melphalan resistant 8226/LR5 cells exhibit a higher degree of basal NF B DNA bind ing activity relative to the drug sensitive 8226/S parental cells (Figure 20 A ). We next analyzed NF B DNA binding activity in the 8226/S and 8226/LR5 cell lines following melphalan exposure. We previously reported that interstrand cross link (ICL) accumulation in drug sensitive 8226/S cells is approximately 2 fold higher than that of melphalan resistant 8226/LR5 cell s (3, 38) Therefore, t o assess directly the effect of acute melphalan exposure on NF B activation, we treated 8226/S and 8226/LR5 cells with 25 M and 50 M melphalan, respectively, as a means to induce a similar amount of ICLs. As shown in Figure 20 A, 8226/LR5 cells also exhibit enhanced NF B DNA binding activity following melphalan exposure when compared to melphalan treated 8226/S cells. In both cell lines melphalan stimulation elicited a peak of NF B acti vity after 30 minutes followed by a noticeable decrease in activity at 2 hours post treatment. These findings indicate that acute exposure to melphalan further increases the magnitude, but fails to accelerate the rate, of NF B activation in drug resista nt 8226/LR5 cells relative to drug sensitive cells. Next, c ellular extracts were immunoblotted with a phospho specific IKK / antibody. T he results showed that IKK was constitutively phosphorylated in 8226/LR5 cells, bu t not in 8226/S cells (Figure 20 B ). I nterestingly, after one hour treatment with melphalan, IKK phosphorylation was markedl y reduced in 8226/LR5 cells, and no IKK activation was ever evident in 822 6/S cells. Furthermore, we were unable to detect any basal or melph alan induced IKK pho sphorylation in either cell line. These results indica te that chronic expo sure of myeloma cells to melphalan engages the specific

PAGE 94

81 Figure 20. Basal NF B DNA binding activity is enhanced in melphalan resistant 8226 cells. (A) Nuclear extracts were isolated from melphalan treated 8226 cells at the indicated times and analyzed for NF B DNA binding activity by EMSA using a canonical B site as a probe. Binding to a NF 1 probe was used as a loading control. (B) 8226/S and 8226/LR5 cells were treated w ith 25 M and 50 M melphalan, respectively, to induce comparable amounts of ICLs between sensitive and resistant cell lines. Cells were harvested at the indicated times post treatment and IKK phosphorylation was determined with a phospho IKK /IKK speci fic antibody. Cellular extracts were then immunoblotted sequentially with IKK I B I B and Actin antibodies. Representative blots from three independent experiments are shown.

PAGE 95

82 phosphorylation of IKK leading to a concomitant increase in ba sal NF B DNA binding activity. RelB and p50 Subunits are R esponsi ble for Enhanced FANCD2 S pecific NF B DN A Binding Activity in 8226/LR5 C ells To further explore the possibility that NF B is a transcriptional regulator of the FA/BRCA pathway, we analyzed interactions between NF B and the promoter region of FANCD2. U sing FANCD2 specific NF B binding s ites as probes (denoted as I, II, III, and IV in Figure 21 ), nuclear extracts from 8226 cells were analyzed for NF B DNA binding activity The results revealed that NF B DNA binding activity could only be d etected with probe IV (Figure 21 ). Also, in su pport of our previous experiments that NF B activity is enhanced in drug resistant cells, e xtracts from 8226/LR5 cells exhibited a substantial increase in FANCD2 bound NF B complexes relative to the 8226/S cells (Figure 21 ). We next performed gel shift analyses to determine which specific NF B subunits are required for this enhanced DNA binding activity. I ncubation of cell extracts with p50 or RelB antibodies resulted in a complete loss of probe IV specific electrophoretic signals in both the 8226 /S a nd the 8226/LR5 cells (Figure 22 A ). Ne xt, we examined the ef fects of siRNA inhibition of the diffrent NF B subunits on the binding activity of NF B toward FANCD2 probe IV. In correlation with the gel shift assays, k nockdown of RelB or p50 reduced FANCD2 specific NF B act ivity in the 8226/L R5 cells (Figure

PAGE 96

83 Figure 21. NF B DNA binding activity is enhanced in the 8226/LR5 cell line using a FANCD2 specific probe. Nuclear extracts from 8226/S and 8226/LR5 cells were analyzed for NF B DNA binding activity by EMSA using four FANCD2 sp ecific NF B probes (I, II, III, and IV). The specificity of each binding reaction was demonstrated by competition with a 100 fold excess of unlabeled (cold) NF B canonical probe. 22 B ). Furthermore, direct immunoblotting of the cellular extracts used fo r the EMSA revealed a decrease in FANCD2 protein levels in RelB and p50 depleted cells. A representative of three independent experiments is shown.

PAGE 97

84

PAGE 98

85 Figure 22. RelB and p50 subunits are responsible for enhanced FANCD2 specific NF B DNA binding activity in the 8226/LR5 cell line (A) Nuclear extracts from 8226/S and 8226/LR5 cells were incubated with the indicated antibodies for 30 min prior to EMSA analysis. Binding to FANCD2 Probe IV was used as a measure of NF B activity on FANCD2 promoter region. (B) 8226/LR5 cells were transfected with the indicated siRNAs and examined by EMSA using FANCD2 Probe IV. Binding to the NF 1 probe was used as a loading control. The bottom panel shows expression levels of FANCD2 p65, RelB, c Rel, p50, p52, and Actin at 48 h post transfection.

PAGE 99

86 Using the 8226/S and 8226/LR5 cells we next performed chromatin immun oprecipitation assays to probe for binding between NF B subunits and the newly described NF B binding site on th e FAN CD2 promoter (region IV, Figure 23 ). Quantitative RT PCR analysi s of NF B immunoprecipitates with FANCD2 specific primers revealed that 8226/LR5 cells exhibited a higher degree of coimmunoprecipitation of region IV with RelB, p52, and p50 when com pared to 8226/S cells (Figure 23 ). In c ontrast, the association of region IV of the FANCD2 promoter with p65 and c Rel was found to be comparable in both cell lines. Based on the results presented above, w e conclude that the increase in FANCD2 specific NF B activity observed in melphalan resistant cells is due to the enhanced binding of RelB and p50 to the FANCD2 promoter in these cells. BMS 345541 Downregulates FA/BRCA Pathway mRNA Expression in Melphalan Sensitive and Resistant Myeloma C ells To ex amine the effect of loss of NF B function on FA/BRCA gene expression, we treated 8226 and U266 cells with 4 M BMS 345541 and monitored the level s of mRNA transcripts over time, using a customized microfluidic card similar to the one used in the bortezomi b studies Following BMS 345541 treatment, expression of 9 of 11 genes analyzed in the 8226/S and all 11 genes in the 8226/LR5 cell lines significantly decreased in a time dependent fashion during the first 4 8 hours post treatment (Figure 24 ; Table 3 ). However, after 8 hours, exposure to BMS 345541 resulted in a gradual recovery in the expression of brca1, fancc, fancl, and rad51 to baseline levels in both cell lines. Finally, FANCD2 protein expression in the 8226/S and 8226/LR5 cell lines was

PAGE 100

87 Figure 23. NF B subunit binding to the promotor region of FANCD2. Binding of NF B to the FANCD2 promoter is enhanced in 8226 melphalan resistant cells as determined by chromatin immunoprecipitation analysis. DNA samples were subjected to qPCR using GA PDH and FANCD2 specific primer pairs, schematically represented as Control and IV. Results were obtained from three independent trials, and fold changes in gene expression were normalized to input samples.

PAGE 101

88 Figure 24. BMS 345541 downregulates FA/BRCA pathway mRNA expression in melphalan sensitive and resistant myeloma cell lines 8226/S and 8226/LR5 cells were treated with 4 M BMS 345541 and harvested at the indicated times. FA/BRCA gene expression was determined in quadruplicate samples by qPCR usin g a customized microfluidic card. Results depict fold change normalized to vehicle control (VC; i.e., DMSO) samples. Three independent experiments were performed. Statistical analysis results can be seen in Table 3.

PAGE 102

89

PAGE 103

90 Table 3. Statistical analysis of FA/BRCA gene expression after BMS 345541 treatment in 8226 cells. To test the effect of BMS 345541 on FA/BRCA gene expression in 8226/S (A) and 8226/LR5 (B) cells, we examined whether fold change of gene expression was deviated away from 1. Since each gene showed a non linear pattern of fold change over time (see Figure 19), a linear model with time as a categorical explanatory variable was used to test the null hypothesis of fold change=1 at each time point for each gen e in each cell line. Since we tested 11 FA/BRCA related genes, we adjusted for p value based on the false discovery rate to control for simultaneously testing (Benjamini, 1995).

PAGE 104

91 also analyzed following exposure to 4 M B MS 345541. As seen in Figure 25A FANCD2 protein expression is reduced in both cell lines following exposure to BMS 345541. We next analyzed FA/BRCA pathway mRNA expression in U266 cells using a newly designed microfluidic card to incorporate rec ently added FA members (this card allowed for the analysis of all 13 FA genes as well as brca1 and usp1 ). Similar to results seen in the 8226 cells exposing U266 cells to B MS 345541 resulted in a dramatic decrease in the expression of all 13 FA/BRCA path way genes after 8 hours, followed by a significant recovery in the expression of brca2, fancb, fancc, fancd2, fance, fancf, fancl, fancm and fancn in U266 and/or U266/LR6 cells at 12 hours post BMS 345541 treatment (Figure 26 ; Table 4 ). The biological sig nificance of the latter event remains unclear, and results suggest that compensatory mechanisms in response to a protracted loss of NF B activity are involved in the regulation of the expression of these genes. To further examine the role of NF B in me lphalan resistance, we treated 8226 cells with increasing amounts of BMS 345541 for 96 hours. Relative to sensitive cells, melphalan resistant cells displayed a marked decrease in cell growth after BMS 345541 exposure (Figure 25B ). Taken together, t hese results suggest that NF B regulates FA/BRCA expression and that a sustained reduction in FA/BRCA gene expression is especially cytotoxic to melphalan resistant myeloma cells.

PAGE 105

92 Figure 25. BMS 345541 reduces FANCD2 protein expression and inhibi ts growth of 8226 cells. (A) 8226/S and 8226/LR5 cells were treated with 4 M BMS 345541 for 12, 24, 36, 48, and 72 h. Cellular extracts were harvested, resolved by SDS PAGE, and immunoblotted with the indicated antibodies. Actin served as control for sa mple loading. (B) 8226/S and 8226/LR5 cells were treated with increasing amounts of BMS 345541 for 96 h and the percentage of cell growth was determined using a standard methyl thiazol tetrazolium (MTT) colorimetric assay. Results (mean +/ SEM) were obtai ned from four independent trials.

PAGE 106

93 Figure 26. BMS 345541 reduces FA/BRCA pathway mRNA expression in U266 and U266/LR6 cell lines. U266 and U266/LR6 cells were treated with BMS 345541 as described in Figure 24 A newly designed microfluidic card wa s used to measure the expression of all 13 FA/BRCA genes, as well as brca1 and usp1. Results depict fold change normalized to vehicle control (VC; i.e., DMSO) in triplicate samples. Statistical analysis results can be seen in Table 4.

PAGE 107

94 on next page

PAGE 108

95 Table 4. Statistical analysis of FA/BRCA gene expression after BMS 345541 treatment in U266 cells. To test the effect of BMS 345541 on FA/BRCA gene expression in U266 (A) and U266/LR6 (B) cells, we examined whether fold change of gene e xpression was deviated away from 1. Since each gene showed a non linear pattern of fold change over time (see Figure 21), a linear model with time as a categorical explanatory variable was used to test the null hypothesis of fold change=1 at each time poin t for each gene in each cell line. Since we tested 15 FA/BRCA related genes, we adjusted for p value based on the false discovery rate to control for simultaneous testing (Benjamini, 1995).

PAGE 109

96 Loss of RelB/p50 Reduces FANCD2 Expression and Re Sensitizes 822 6/LR5 Cells to M elphalan To further examine the role of NF B in the regulation of FANCD2 expression and function following treatment with melphalan, we determined whether RelB/p50 double knockdown was sufficient to sensitize 8226/LR5 cells to melph alan. Cells were transfect ed with control or RelB and p50 siRNAs, then exposed to varying doses of melphalan for 24 hours. Apoptosis, as indicated by the amount of DNA fragmentation was determined using the Diffusion Apoptosis Slide Halo (DASH) assay. Treatme nt of 8226/LR5 cells with RelB and p50 siRNAs significantly sensitized these cells to melphalan induced cell death (Fig ure 27 A; Table 5 ). Furthermore, relative to wild type 8226/LR5 cells, RelB/p50 depleted 8226/LR5 cells displayed a dramatic increase in ICLs after exposure to melphalan, with levels of DNA damage significantly surpassing those observed in m elp halan sensitive cells (Figure 27 B; Table 6 ). Statistical analysis also showed that the result s presented in Figures 27A and 27 B were positively corr elated at each dose of melphalan tested, suggesting that loss of cell viability is causally linked to melphalan induced ICL formation ( Table 7 ). Importantly, consistent with the results obtained with RelB a nd p50 depleted cells (Figure 22 ), RelB/p50 doub le knockdown caused a striking decrease in FANCD2 prot ein expression (Figure 27 C ). Finally, re expression of FANCD2 in the RelB /p50 depleted cells restore d melph alan resistance (Figure 27 D ). These results indicate that RelB and p50 protect 8226/LR5 cells from melphalan induced apoptosis, at least in part, by regulating expression of the DNA damage response protein FANCD2. Collectively, the results presented in this section demonstrate that NF B, specifically the RelB and p50 subunits, positively regulat es

PAGE 110

97 FA/BRCA pathway expression and provide evidence for targeting this pathway as a means to overcome or even circumvent drug resistance.

PAGE 111

98

PAGE 112

99 Figure 27. Loss of RelB and p50 re sensitizes 8226/LR5 cells to melphala n treatment and reduces FANCD2 expression. (A) 8226/LR5 cells were treated with the indicated siRNAs for 48 h, stimulated with 25 100 M melphalan or vehicle control for 24 h, and the relative amount of DNA fragmentation was determined by DASH Assay. Wild type 8226/S and 8226/LR5 cells were used as reference samples. (B) At 48 h post transfection, the cells were exposed to 25 100 M melphalan for 2 h, damaged with 9 Gy ionizing radiation, and interstrand cross links were evaluated using the Alkaline Comet Assay. Wild type 8226/S and 8226/LR5 cells were used as reference samples. (C) Representative immunoblots from 8226/LR5 cells transfected with siControl (control) or RelB and p50 siRNAs, as well as from cells transfected with RelB/p50 siRNAs plus pIRES FA NCD2. (D) 8226/LR5 cells were treated with the indicated siRNAs, and after 24 h, the cells were transfected with empty vector or untagged, full length FANCD2 (pIRES FANCD2). At 48 h post siRNA transfection, the cells were stimulated for 24 h with either fragmentation was determined as described in panel A Results (mean S.E) were obtained from three independent trials.

PAGE 113

100 Table 5. Statistical analysis of melphalan induced DNA f ragmentation in RelB/p50 siRNA treated cells. Analysis of variance (ANOVA) was used to compare the radius difference (log scale) of cell death between four groups: (8226/S, LR5 RelB/p50, LR5 siControl, and LR5), at each dose level (0, 25, 50, and 100 M) i n Figure 22A. Multiple Significance Difference method (Miller, 1981). A P value <0.05 was considered significant. These results show that siRNA mediated depletion of RelB and p50 in 8226/LR5 cells significantly increases the magnitude of cell death induced by melphalan stimulation.

PAGE 114

101 Table 6 Statistical analysis of melphalan induced ICL in RelB/p50 depleted cells. A linear regression model was used to analyze the percentage of ICLs obtained from Figure 22B cell populations. Intercept and slope differences were determined using 8226/LR5 cells as a reference cell line. A P value <0.05 was considered significant. These results show that RelB/p50 depleted cells display a signifi cant increase in ICL formation after exposure to melphalan relative to wild type or siControl transfected 8226/LR5 cells.

PAGE 115

102 Table 7. Correlation between melphalan induced ICL and DNA fragmentation. Relationship of DNA fragmentation and ICL was a ssessed by Pearson correlation. Note that a zero correlation indicates no association between the two variables while a correlation close to 1 suggests a strong positive correlation. These results show that ICL formation and DNA fragmentation can be positi vely correlated in 8226 cells after melphalan induced stress.

PAGE 116

103 Part IV : Po st Transcriptional Regulation of FANCD2 by Bortezomib The results presented in Parts II and III of this dissertation show that NF B transcriptionally regulates members of the FA/BRCA DNA damage repair pathway, and that bortezomib can inhibit FA/BRCA pathway mRNA expression, as well as FANCD2 protein expression and foci formation. We also show that bortezomib enhances melphalan induced DNA damage, likely via inhibition of FA/B RCA pathway mediated DNA damage repair. Since we found that FA/BRCA pathway mRNA expression was attenuated by bortezomib, but not to the same extent as the inhibition of FANCD2 protein expression, we analyzed regulation of the FA/BRCA pathway downstream o f transcriptional regulation. We hyp othesized that bortezomib not only reduces FANCD2 protein expression via reduction of FANCD2 mRNA levels, but also by directly targeting FANCD2 protein Therefore, we analyzed FANCD2 protein stability via stable isotop ic labeling of amino acids in cell culture (SILAC) and mass spectrometry. We also analyzed the effects of various miRNAs on the expression of FANCD 2, since miRNAs have been shown to repress translation without cleavage of the mRNA (193 194) Finally, we studied ATR activation and cell cycle progression in cells treated with bortezomib In this section, w e show that bortezomib inhi bits FANCD2 synthesis and ATR activation, and also overcomes melphalan induced S phas e arrest. Bortezomib Inhibits FANCD2 S ynthesis FANCD2 protein stability was analyzed in bortezomib treated 8226/LR5 cells via stable isotopic labeling of amino acids in cell culture (SILAC) and mass spectrometry.

PAGE 117

104 ntaining stable isotopes of lysine and arginine for six doubling times (approximately seven days). The medi a was then replaced with containing the naturally occurring forms of lysine and arginine. At the time of addition of the l ight media, c ells were also treated with vehicle control or 3 nM bortezomib, and samples were collected at 0, 4, 8, 12, 24 and 36 hours post bortezomib treatment synthesis causes a shift in the molecular weight of the protein that can be detected by m ass spectrometry Therefore, we were able to analyze FANCD2 degradation (as fol lowing bortezomib treatment, based on se ven FANCD2 specific peptides. Control and bortezomib treated lysates were separated on a gel (Figure 28A; shows equal loading of lysates), and the FANCD2 bands were excised and analyzed via mass spectrometry. Total FANCD2 protein expression, as indicated by the sum of the heavy and light labeled FANCD2 is reduced at 24 hours in bortezomib treated cells when compared to control treated cells (Figure 28B). These findings are similar to the results seen via Wes tern blot analysis of FANCD2 protein expression following bortezomib treatment protein, is similar in control and bortezomib treated cells up to 12 hours (Figure 28C). A t 24 and 36 hours, however, a slight increase in FANCD2 degradation is seen in the bortezomib treated cells. FANCD2 protein synthesis on the other hand, is drastically inhibited by bortezomib at 24 and 36 hours post treatment (Figure 28D). In total, the se

PAGE 118

105 C

PAGE 119

106 Figure 28. Bortezomib inhibits FANCD2 protein synthesis. Stable isotopic labeling of amino acids in cell culture (SILAC) was performed on 8226/LR5 cells to analyze FANCD2 synthesis and degradation following treatment w ith bortezomib. Cells were doubling times (approximately seven days). The media was then replaced with regular media and cells were immediately treated with control or 3 nM bortezomib for 4,8, 12, 24 and 36 hours. Mass spectrometry was performed using FANCD2 specific peptides. Two independent experiments were performed, both showed the same trend, and a representative is shown. (A) Coomassie Brilliant Blue stained gel to show equal loading. Bands from this gel were excised for analysis. (B) Total FANCD2 protein expression, as detected by mass spectrometry, following bortezomib treatment for indicated times. (C) treatment and based on seven FANCD2 specific peptides.

PAGE 120

107 results show that bortezomib reduces FANCD2 protein expression by inhibiting FANCD2 sy nthesis. Bortezomib Overcomes Melphalan Induced S Phase A rrest We next wanted to determine if the reduction of FANCD2 protein expression and foci formation by bortezomib could be due to induction of a cell cycle arrest. P revious reports have shown that FANCD2 monoubiquitination and foci formation is S phase specific (156) and bortezomib is known to reduce the percentage of cells in S phase (188 189) As shown in Figure 12, melphalan drastically increases the percentage of cells in S phase at 2 4 h ours, but pre treatment with bortezomib reduces this number We next wanted to determine if bortezomib was arresting these cells at a specific phase of the cell cycle and so analyzed cell cycle p rogression at later time points. As shown in Figure 29, melphalan arrests cells in the S phase of the cell cycle. Bortezomib, on the other hand, induces a G0/G1 arrest. Importantly, the melphalan induced S phase arrest is overcome by bortezomib, and cells treated with the combination of these two drugs also arrest at G0/G1 (Figure 29). Following DNA damage, the ATR kinase can be activated and induce an S phase cell cycle checkpoint (195) ATR has also been shown to phosphorylate FANCD2, and this event promotes the monoubiquitination/activation of FANCD2 (64) Based on these studies, we hypothesized that bortezomib inhibits ATR activation as a mechanism to overcome the S phase arrest induced by melphalan. We therefore treated cells with 3 nM bortezomib, and analyzed ATR activation (as indicated by phosphorylated ATR). As sho wn in Figure 30, ATR phosphorylation is reduced in cells treated wi th bortezomib for

PAGE 121

108

PAGE 122

109 Figure 29. Bortezomib overcomes melphalan induced S phase arrest and arrests cells in G0/G1. 8226/LR5 cells were treated with control or 3 nM bortezomib for 8 hours, followed by treatment with 25 mM melphalan, and collected from 24 48 hours post treatment. Cell cycle analysis was performed by labeling with BrdU and PI. The average and SEM of four independent experiments are shown.

PAGE 123

110 eight hours. Futhermore, ATR is known to phosphorylate p53 at serine 15, and this phosphorylation event is also slightly inhibited following eight hours treatment with bortezomib, when compared to control treated cells (Figure 30). Importantly, in the co mbination studies of bortezomib plus melphalan described above cells are pre treated with bortezomib for eight hours before the addition of melphalan. The results presented in th is sectio n show that low dose bortezomib arrests cells in G0/G1 and also ove rcomes the S phase arrest induced by melphalan likely via inhibition of ATR activity. FANCD2 Expression is Not R egulated by H sa miR 23a or H sa miR 27 MicroRNAs (miRNAs) are short RNAs, approximately 22 nucleotides in length, that do not code for prote in but are known to regulate gene expression post transcriptionally (196 197) MiRNAs bind to the untranslated regions of mRNAs and inhibit translation (194) We hypothesized that bortezomib enhances expression of miRNAs that inhibit the t ranslation of FANCD2. To this end, we treated 8226/LR5 cells with vehicle control or 3 nM bortezomib for eight hours, and a microarray of miRNA expression was analyzed. The results revealed that 33 miRNAs were differentially expressed in bortezomib treat ed versus control treated samples (Figure 31). We next wanted to determine if any of the miRNAs altered by bortezomib treatment targeted FANCD2. We analyzed these 33 miRNAs using TARGETSCAN software and determined, based on seq uence homology, that hsa miR 23a could potentially target FANCD2. We next transfected 8226/LR5 cells with pre miR NAs specific for hsa miR 23a. Pre miRNAs are cleaved inside the cell to generate the short, functional miRNA. As indicated by q PCR analysis of hsa miR 23a, transf ection of

PAGE 124

111 Figure 30. Bortezomib inhibits ATR activation. 8226/LR5 myeloma cells were treated with 3 nM bortezomib and samples were collected at 2, 8 and 24 hours post treatment. ATR activation, as indicated by phospho ATR and phospho p53, was analyzed. Three independent experiments were performed and a representative blot is shown.

PAGE 125

112 8226/LR5 cells with pre miR 23a increased expression of miR 23a by approximately 100 fold or greater when compar ed to control transfected cells. This miRNA d id not, however, affect express ion of FANCD2 protein (Figure 32A ). As expected, t ransfection of cells with pre miR 23a did, however, reduce expression of GLS, a known target of miR 23a. W e also analyzed the effect of hsa miR 27 on FANCD2 expression. T his miRNA was one of the most highly expressed following bortezomib treatment. In these experiments, 8226/LR5 cells were transfected with an inhibitor of m iR 27. T ransfection with th e anti miR 27 caused a 2 to 4 fold reduction in hsa miR 27 expression. Western blot analysis revealed overexpression FADD (the positive control) in anti miR 27 transfected cells, but no alteration of FANCD2 expression was observed (Figure 32B ) In total, these results show that treatment with bortezomib modulates miRNA expr ession, but FANCD2 is not a target of hsa miR 23a or hsa miR 27. Based on the work presented in this section of the dissertation, we conclude that reduced FANCD2 protein expression following bortezomib treatment is not du e solely to inhibition of transcription by NF B and reduction of FANCD2 mRNA expression. Bortezomib also inh ibits FANCD2 protein synt hesis and inhibits ATR activation, overcoming melphalan induced S phase arrest.

PAGE 126

113 Figure 31. miRNA analysis of bortezomib treated 8226/LR5 myeloma cells. miRNA expression was analyzed in 8226/LR5 cells treated with vehicle control or 3 nM bortezomib for eight hours. Microarray analysis of miRNAs revealed 33 differentially expressed miRNAs in bortezomib treated cells when compared to control treated cells.

PAGE 127

114 Figure 32 FANCD2 is not targeted by hsa miR 23a or hsa miR 27. (A) 8226/LR5 cells were transfected with 50 nM pre miR 23a oligonucleotide, as a means to overexpress hsa miR 23a in these cells. Western blot analysis of FANCD2 follow ing transfection shows no change in FANCD2 expression in miR 23a overexpressing 8226/LR5 cells when compared to control transfected cells. Lysates were also probed with glutaminase (GLS) antibody as a positive control, and reductions in GLS expression w ere seen 24 72 hours post transfection. (B) Western blot analysis of FANCD2 following transfection shows no change in FANCD2 expression in miR 27 overexpressing 8226/LR5 cells when compared to control transfected cells. Lysates were also probed with FA DD antibody as a positive control, and and increase in FADD expression were se en 72 hours post transfection.

PAGE 128

115 DISCUSSION Members of the FA/BRCA Pathway are Overexpressed in Drug Resistant Cancer Cells and Can be Inhibited by Bortezomib We recently repor ted that the FA/BRCA DNA damage repair pathway is significantly involved in melphalan resistance in MM cells (3 4) Specifically, we showed overexpression of F A/BRCA pathway genes in the melphalan resistant 8226/LR 5 and U266/LR6 cell lines when compared to their respective drug sensitive parental cell lines. Futhermore, this overexpression was determined to be causative for resistance, as inhibition of FANCF in the drug resistant8226/LR5 cells reversed resistance, and overexpression of FANCF in the drug sensitive 8226/S cells conferred resistance to melphalan (3) Similarly, D reported that the FA/BRCA pathway is responsible for resistance of glioma c ells to the alkylating agents TMZ and BCNU, and activation of FANCF has been implicated in cisplatin resistance as well (170, 173) In the first section of this dissertation, we extend the work performed by our lab and others by analyzing FA/BRCA pathway mRNA expression in drug sensitive and drug resistant tumor cell lines. Consistent with previous reports, prostate and ovarian cancer cell lines selected for resistance to the alkylating agents melphalan and cisplat in were found to overexpress many FA/BRCA pathway genes. These results suggest that the FA/BRCA pathway mediates resistance to alkylating agents in a variety of tumor types,

PAGE 129

116 and provide impetus for discovering new agents that target this pathway as a mean s of overcoming or circumventing drug resistance. FA/BRCA pathway mRNA expression was also analyzed in 8226 cells selected for resistance to doxorubicin and mitoxantro ne These drugs inhibit the function of topoisomerase II, resulting in the accumulation of double strand breaks (DSBs). Interestingly, acquired resistance to doxorubicin and mitoxantrone did not result in global overexpression of FA/BRCA pathway genes, but rather a specific enhancement of FANCF expression. The consequence of overexpression of a single FA protein is unknown. A ll FA proteins are required for core complex function and subsequent activation of the ID co mplex, but the stoichiometry of FA core complex subun its is still undetermined (198) FANCF is a flexible adaptor protein, responsible for stabilizing the interaction between FANCA and FANCG and between FANCC and FANCE (145) It is possible that enhanced FANCF expression results in more efficient and/or increased formation of the core complex by increasing the binding of uncomplexed FANC proteins within the nucleus, leading ultimately to enhanced DNA damage repair and drug resistance. Alternatively, FANCF may function outside of the FA/BRCA pathway, interacting with other proteins to mediat e drug resistance in these cells Finally, it is also plausible that overexpression of a single FA/BRCA pathway subuni t may not be causative for resistance to topoisomerase II inhibitors, and FANCF overexpression is not responsible for the drug resistant phenotype observed in these cells. The emergence of drug resistance remains the largest hurdle in the effective treat ment of myeloma. Thus, preventing or reversing drug resistance via combina tion therapy is likely v ital for curing this disease. To this end, it has been reported that

PAGE 130

117 bortezomib enhances sensitivity to chemotherapeutic agents, including melphalan both i n vitro and in patient specimens (28, 59, 78) Based on these observations and our knowledge that FA/BRCA pathway overexpression is responsible for melphalan resistance, we hypothesized that bortezomib enhances mel phalan cytotoxicity by inhibiting DNA repair associated with the FA/BRCA pathway. In support of this hypothesis, the experiments presented in Part II of this dissertation show that bortezomib inhibits FA/BRCA pathway expression and function. First, we sh ow that bortezomib attenuates mRNA expression of FA/BRCA pathway family members in the drug sensitive and drug resistant 8226/S and 8226/LR5 cell lines In addition to reducing gene expression, bortezomib inhibited FANCD2 protein expression and foci forma tion, even in the presence of melphalan, in two melphalan r esistant cell lines. Bortezomib also enhance d melphalan induced DNA damage, likely through inhibition of FANCD2 and thus abrogation of DNA repair. Similar to these results, Jacquemont et al rep orted that proteasome function is required for the monoubiquitination of FANCD2 and FANCD2 foci formation (176) T hese results provide insight into the mechanism by which bortezomib potentiates the cytotoxicity of DNA damaging agents Based on our results we believe that the dose scheduling of bortezomib plus melphalan needs to be considered when attempting to improve therapeutic results. W e speculate that pre treatment with low dose bortezomib followed by melp halan may be necessary to capitalize on the ability of bortezomib to inhibit the FA/BRCA DNA damage re sponse pathway. Conceptually, the cytotoxic effects of m elphalan due to interstrand crosslink formation may be enhanced if DNA damage repair function via the

PAGE 131

118 FA/BRCA pathway is first inhibited. We believ e that this dosing schedule will result in more durable re missions and thus should be explored further. Exploiting the FA/BRCA pathway inhibitory effects of bortezomib by combining this drug with chemo therapeutic agents other than melphalan may also prove effective in treating myeloma. For example, BRCA1 and BRCA2 deficient tu mor cells are sensitive to inhibiton of poly(ADP ribose) polymerase (PARP) (199 200) PARP is a key enzyme involved in base excision repair, and its inhibition leads to the accumulation of double strand breaks (DSBs), which cannot be repaired in cells that are deficient in homologous recombination (HR) repair (201) Therefore, combining PA RP inhibitors with bortezomib, a drug that we show inhibits BRCA1, BRCA2, and other FA proteins involved in HR repair may prove to be an effective strategy to treat patients with myeloma. As another example, combining bortezomib with Imexon may also prov e effective. Imexon is a small molecule that induces accumulation of reactive oxygen species (ROS) (202) ROS accumulation has also been observed in bortezomib treated cells (203) and FA patient cells are hypersensitive to ROS (204) The cytotoxic effects of bortezomib plus Im exon are synergistic in myeloma tumor cell lines (202) and w e postulate that this enhanced cytotoxicity may be due to the detrimental effects of ROS accumulation in FA/BRCA pathway inhibited cells. In summary, the findings presen ted in Parts I and II of this dissertation show that the FA/BRCA DNA damage re pair pathway is upregulated in a variety of tumor types selected for resistance to alkylating agents, and that bortezomib potentiates melph alan cytotoxicity, a t least in part, via suppress ion of this pathway. Based on these studies, we propose that the th erapeutic index of melphalan, and potentially other agents, in myeloma

PAGE 132

119 patients can be greatly enhanced by targeting the FA/BRCA DNA damage repair pathway Mechanisms by Which Bortezomib Inhibits FA/BRCA Pathway Expression The studies present ed in Part I I of this dissertation, and as described in the discussion above, show that bortezomib treatment decreases expression of many FA/BRCA pathway genes in both melphalan sensitive and melphalan resistant cell lines, as well as in MM patient specimens, suggesti ng that these genes m ay be co regulated. Furthermore we and others have shown that bortezomib inhibits NF B activity (59, 78) and combination index analysis studies performed by our lab revealed antagonism when myeloma cells were treated simultaneously with bortezomib and BMS 345541, a specific inhibitor of the NF B pathway The results suggest that both drugs exact their cytotoxic effects via inhibitio n of this pathway, and we therefore hypothesized that N F B i s an upstream mediator of the FA/BRCA pathway. The transcriptional regulation of FA/BRCA pathway genes is largely unk n own. Analysis of the promoter regions of FA/BRCA pathway genes revealed putative N F B binding sites on 12 of these genes ( brca1, brca2, Fanca, fancc, fancd2, fance, fancf, fancg, fanci, fancj, fancl, fancm, and fancn ). In Part III of this dissertation, we report for the first time that NF B functions a s a transcription al regulator of the FA/BRCA pathway Our lab previously reported that FA/BRCA pathway mRNA levels are overexpressed in melphalan resistant myeloma cells Interestingly, th e melphalan resistant 8226/LR5 cells also exhibit an increase in basal NF B DNA binding activity

PAGE 133

120 when compare d to the 8226/S cells, which we hypothesized could explain the enhanced expression of FA/BRCA pathway genes. Gel shift assays and siRNA inhibitio n of NF B subunits identified RelB and p50 as the subunits responsible for this enhanced binding activity. Additionally, c hromatin immunoprecipitation (ChIP) analysis revealed that the level of NF B activity observed in the melphalan resistant 8226/LR5 cells is attributable to increased binding of RelB and p50 to the FANCD2 promoter. As expected, FANCD2 protein expression was drastically decreased in RelB/p50 depleted 8226/LR5 Importantly, these RelB/p50 depeleted cells were no longer melphalan resist ant, as indicated by an increa se in ICL and DNA fragmentation and the onset of apoptosis following acute exposure to melphalan Conversely, re expressing FANCD2 in RelB/p50 depleted cells conferred resistance to melphalan. Collectively, thes e findings in dicate that attenuated FANCD2 expression and function in RelB/p50 depleted cells is responsible for the enhanced melphalan sensitivity seen in these cells Interestingly, we d emonstrate that chronic exposure of 8226 cells to melphalan engages the specifi c phosphorylation of IKK which in turn leads to augmented basal NF B DNA binding activity in these cells. Based on the finding that IKK is constitutively phosphorylate d in melphalan resistant cells, our results suggest that the alternative pathway of NF B activation protects these cells against apoptotic stress imposed by the alkylating agent melphalan. FANCD2 specific NF B activity was greatly enhanced in 82 26/LR5 cells relative to the drug sensitive 8226/S cell line and our results implicate the RelB and p50 subunits in this enhanced binding activity Depletion of RelB or p50 expression abolished the basal DNA binding activity of NF B in 8226 cells We hypothesize that

PAGE 134

121 other NF B subunits may compensate for loss of RelB or p50 in the regulati on of FANCD2 expression in myeloma cells. This model is consistent with our finding th at p65, c Rel, and p52 can also bind to the FANCD2 promoter in 8226 cells. Moreover, relative to control cells, 8226 /LR5 cells also exhibited a higher degree of coimmun oprecipitation of the FANCD2 promoter wi th p52 Since RelB stability requires multi domain interactions with p100/p52 (205) it is also plausible that this NF B precursor/product pair promotes the stable formation of a transcriptionally active Re lB/p50 heterodimer in melphalan resistant cells. The mechanism of p50 activ ation in these cells is unknown, althoug h a recent report indicates that p100 mediates p65/p50 activation in response to noncanonical NF B signaling pathways (206) We speculate that prolonged or hig h intensity replicative stress in myeloma cells trigg er s the t ranscriptional activation of FA/BRCA genes as a means to ameliorate fork progression and repair. In Part III of this dissertation, we demonstrate that NF B can transcriptionally regulate FA/BRCA pathway genes. Stimulation of melphalan sensitive and resistant 8226 and U266 cells with BMS 345541, a kn own inhibitor of NF B activation elicited a rapid decline in FA/BRCA mRNA levels However, at later time points and in some of the FA/BRCA genes analyzed, gene expression was seen to either transie ntly or stably recover to close to baseline levels. It is likely that acquired melpha lan resistance involves t he coordinated effects of a number of DNA damage induced transcription factors, resulting in transient oscillations of FA/BRCA gene expression. For example, Hoskins et. al. reported that FA gene expression is regulated by members of the Rb/E2F family (207) It is plausible that this family of transcription factors can compensate for the loss of NF B following BMS 345541 t reatment and

PAGE 135

122 induce transcription of FA/BRCA pathway genes. A lternative ly, it is possible that FA/BRCA gene expression is regulated by epigenetic modifications of promoter regions. In this regard, chronic exposure of myeloma cells to melphalan may promot e demethylation of FA/BRCA promoter regions granting DNA damage induced transcriptional regulators such as NF B, free access to transcriptional start sites, eventually re sulting in enhanced FA/BRCA pathway expression. NF B is known to play a pivotal role in MM tumorigenesis and drug resistance. NF B is constitutively activated in multiple myeloma is overexpr essed in drug resistant myeloma cell lines, and is elevated in patient specimens following chemotherapeutic treatment and at time of relapse (37, 55 57, 59 60, 62) We postulate that genetic activation of the alter native NF B pathway, specifically the RelB and p50 subunits, allows malignant plasma cells to gain independence from the rich milieu of growth factors and cytokines produced in the bone marrow microenvironment. Interestingly, Landowski et. al. reported t hat these same subunits are upregulated following MM cell adhesion to fibronectin (FN) a component of the bone marrow microenvironment (58) Adhesion to this extracellular ma trix protein induces a transient form of drug resistance in the adhered tumor cells (208) Based on the specific enhancement of RelB and p50 in adh ered cells, it is plausible that the FA/BRCA DNA damage repair pathway is important not only for acquired resistance, but also contributes to the de novo drug resistance phenotype. Furthermore, a recent report demonstrated that HES1, the downstream effect or protein of Notch1, interacts with the FA core complex and is required for FANCD2 monoubiquitination (127) Notch1 signaling is upregulated following cellular adhesion to bone marrow stromal cells and confers resistance in these tumor cells (41)

PAGE 136

123 These reports provide another potential link between the FA/BRCA pathway and de novo drug resistance; upregulation of Notch1 in adhered cells enhances HES1 signaling, and may result in enhanced expression of the FA/BRCA pathway leading to drug resistance. In summary, the results presented in Part III of this dissertation show for the first time that NF B plays an important role in the regulation of FA/BRCA gene expression in human multiple myeloma cells. This conclusion is further substantiated by a recent report that curcumin analogs inhibit the FA pathway via inhibition of NF kB activity (209) The importance of this work is best illustrated by the observation that a sustained reduction in FA/BRCA gene expression is especially cytotoxic to melphalan resistant cells. It is l ikely that these cells have become addicted to FA/BRCA mediated genome surveillance and DNA repair We therefore postulate that targeting the FA/BRCA pathway directly, or indirectly via inhibition of NF B, will enhance the cytotoxic effects of commonly used chemotherapeutic agents. Based on the studies presented in this dissertation we propose that targeting the proteasome accentuates melphalan response by reducing FA/BRCA gene expression via inhibitio n of NF B, and blocking activation of FANCD2, thereby inhibiting DNA damage repair following drug treatment. The observation that FA/BRCA pathway mRNA expression was attenuated by bortezomib, but not to the same degree as the inhibition of FANCD2 prote in expression, suggests that bortezomib not only reduces FANCD2 protein expression via inhibition of NF B activity, but also by regulating FANCD2 post transcriptionally We therefore analyzed bortezomib mediated regulation of the FA/BRCA pathway downstre am of transcription.

PAGE 137

124 We first analyzed FANCD2 protein stability in bortezomib treated cells. Analysis of FANCD2 synthesis and degradation using stable is otopic labeling of amino acids in cell culture (SILAC) and mass spectrometry revealed that the reductio n of FANCD2 protein levels exhibited in bortezomib treated cells is due to a drastic suppression of FANCD2 protein synthesis. Of note, however, is that enhanced degradation of FANCD2 protein was obs erved in bortezomib treated cells as well although the c ontribution of degradation to the decrease in overall FANCD2 protein levels after bortezomib treatment was minor compared to the contribution of inhibited synthesis. W e postulate that FANCD2 degradation in bortezomib treated cells is due to incomplete inh ibition of proteasomal activit y by the low dose of drug utilized in these experiments or due to a non proteasomal mechanism We next analyzed the contribution of cell cycle regulation to the inhibition of FANCD2. FANCD2 monoubiq uitination and foci format ion is reported to be S phase specific (156) and bortezomib is known to reduce the percentage of cells in S phase (188 189) M elphalan was found to arrest cells in the S phase of the cell cycle. Bortezomib, on the other hand, induces a G0/G1 arr est, and can overcome the melphalan induced S phase arrest. Furthermore, ATR activation was inhibited after eight hours treatment with bortezomib, which, incidentally, is the same amount of time that cells are pre treated with bortezomib before the additi on of melphalan in the studies described above ATR is typically activated foll owing DNA damage and induces an S phase cell cycle checkpoint leading to cell cycle arrest (195) This kinase also ph osphorylates FANCA, FANCD2, FANCI, and FANCM, and these phosphorylation events are critical for the activation of the FA/BRCA pathway (64, 151, 155, 210) Based on these results,

PAGE 138

125 we conclude that bortezomib overcom es melphalan induced S phase arrest via inhibition of ATR activation. Curiously, bortezomib treated cells do arrest, and we speculate that ATM kinase activity is not inhibited by bortezomib and can therefore compensate for the lack of ATR function and ind uce the observed G0/G1 cell cycle arrest. In support of this theory, two separate labs have reported that ATM activity is not affected by proteasome inhibition (176, 211) Finally, i n a separate set of studies, w e analyzed miRNA expression following bortezomib treatment MiRNAs bind to mRNA and repress translation without actually cleaving the mRNA itself (193 194) We therefore hypothesized that the drastic decrease in F ANCD2 expression could be due to upregulation of a miRNA that targets and thus represses FANCD2. Based on microarray analysis of miRNA expression in bortezomib versus control tr eated cells, we identified two miRNAs that could potentially target FANCD2 mR NA, specifically, hsa miR 23a and hsa miR 27. Further analysis of these miRNAs revealed that they do not function by targeting FANCD2. A total of 33 miRNAs were differentially expressed in bortezomib treated cells, however, and it is plausible that these miRNAs may indirectly inhibit FANCD2 protein expression by targeting upstream mediators of the FA/BRCA pathway. In summary, we have shown that bortezomib inhibits FA/BRCA pathway expression. FANCD2 protein synthesis is inhibited in bortezomib treated c ells, and this inhibition is likely due to the combined effects of inhibition of NF B, which we determined is a transcriptional activator of the FA/BRCA pathway, and bortezomib induced cell cycle arrest. Overall, the results presented in this dissertatio n show that drug response and resistance in MM, and possibly other cancers, is mediated by the FA/BRCA

PAGE 139

126 DNA damage repair pathway. Therefore, we believe that targeting the FA/BRCA pathway to inhibit DNA damage repair, either directly or indirectly via inhi bition of NF B or ATR activation is vital for reversing, or possibly circumventing, dru g resistance in multiple myeloma and possibly other cancers Future Directions We recently demonstrated that FA/BRCA pathway members are overexpressed in melphala n resist ant cells, and causative for this resistance (3 4) Additionally, other labs have reported that members of the FA/BRCA pathway mediate sensitivity to cisplatin, BCNU, and TMZ in different tumor types as well (170, 172 175) In the Part I of this dissertation, we show that FA/BRCA pathway genes are also overexpressed in prostate and ovarian cancer cell lines selected for resistance to melphalan and cisplatin, respectively. C onversely, we found that cells selected for resistance to topoisomerase II inhibitors do not show this same pattern of global overexpression of FA/BRCA pathway genes. Instead, these resistant cells selectively overexpress FANCF. It is known that all memb ers of the FA core complex must be functional in order for ID complex activation, but the relative contribution of upregulation of one FA protein is unclear. Therefore, we propose experiments that will examine the contribution of overexpression of FANCF t o acquired resistance to topoisomerase II inhibitors. First, we propose to transfect 8226/Dox40 and 8226/MR20 cells with siRNAs specific to FANCF, and subsequently analyze sensitivity to doxorubicin and mitoxantrone, respectively, in siRNA transfected cel ls compared to control transfected cells and the drug sensitive 8226/S cells. If FANCF

PAGE 140

127 does contribute to acquired drug resistance in the 8226/Dox 40 and 8226/MR20 cells, depletion of FANCF should enhance drug sensitivity I t is possible that FANCF is functioning both inside and outside of the FA/BRCA pathway. Therefore, we also propose to examine FANCF protein interactions in drug sensitive and resistant cells by immuno precipitation using a FANCF specific antibody Since FANCF is a flexible adaptor protein important for stabilizing interactions between other core complex proteins, the results may reveal enhanced interactions between FANCF and other FANC proteins in the drug resistant cells. Alternatively, comparison of FANCF binding partners in the drug sensitive and resistant cells may reveal novel interactions between FANCF and n on FA pathway proteins that contribute to drug resistance. Additionally, since demethylation of FANCF is known to contribute to drug resistance (173) we propose to examine the methylation status of FANCF in the drug sensitive and resistant cel l lines Studies are also proposed to analyze the role of the FA/BRCA pathway in cell adhesion mediated drug resistance (CAM DR) In this dissertation, we demonstrate that the NF B subunits RelB and p50 regulate FA/BRCA pathway members. Furthermore, RelB and p50 DNA binding activity is enhanced in cells adhered to fibronectin (FN) (58) We therefore hypothesize that FA/BRCA pathway expression is augmented when cells are adhered to FN and upregulation of this pathway contributes to the CAM DR phenotype First, we propose analyzing FA/BRCA pathway protein expression in cells adhered to FN to determine if basal expression of FA proteins is enhanced upon adhesion. Also, since melphalan activates the FA/BRCA pathway, it will be important to analyze FA prot ein levels in FN adhered myeloma cells treated with melphalan. If FA

PAGE 141

128 proteins are indeed upregulated by FN adhesion, using siRNAs to inhibit expression of these proteins is proposed to determine the contribution of this overexpression to drug resistance. We also propose to analyze the factors that regulate FA/BRCA pathway expression in the absence of NF B. As seen in Part III of this dissertation, inhibition of NF B with the BMS 345541 compound transiently reduced FA/BRCA pathway mRNA expression, but l evels of expression oscillated throughout time. Theoretically, once NF B is inhibited, other transcription factors will take over and transcriptionally activate this pathway. Therefore, we propose stably expressing I B in 8226/S and 8226/LR5 cells to in hibit NF B activation, and analyzing the transcriptional regulation of FA/BRCA pathway members in NF B inhibited cells. It will also be important to determine if these transcriptional regulators can fully compensate for NF B l oss, and we propose analyz ing sensitivity to melphalan in the NF B inhibited cells. We first propose analyzing Rb/ E2F function in these cells, as it has been reported that this family of transcription factors regulates transcription of members of the FA/BRCA pathway (207) Furthermore, inhibiting E2F in the NF B inactive cells would be interesting to determine if FA/BRCA pathway expression can be completely abolished and if inhibition of both NF B and E2F/Rb greatly enhances drug sensitivity. In Part IV of this dissertation, we show that melphalan induces an S phase arrest, wher eas bortezomib caus es an arrest in G0/G1. Furthermore, pre treatment with bortezomib is able to overcome the melphalan induced S phase arrest, and combination treated cells also arrest in G0/G1. We also show that ATR activation is inh ibited in bortezomib treated cells. We hypothesize that ATM is activated by bortezomib, and that

PAGE 142

129 this kinase is responsible for activation of the G1 cell cycle checkpoint leading to the G0/G1 arrest seen in bortezomib treated cells. It will be important to look at ATM activity in bortezomib treated cells. Likewise, ATM and ATR activation should be analyzed in melphalan stimulated cells as well as in cells treated with the combination of bortezomib plus melphalan. Similarly, the activity of Chk1 and Chk2 kinases, two downstream mediators of ATM and ATR, should also be analyzed in cells treated with bortezomib and melphalan. inhibition of the d this activation compensates for lack of FA mediated DNA repair Therefore, we hypothesize that combining bortezomib with Chk1 inhibitors will greatly enhance cytotoxicity by inhibiting both FA and Chk1 mediated repair. We propose analyzing the combine d effects of bortezomib with the Chk1 inhibitor Go6976 via combination index analysis in 8226/S and 8226/LR5 drug treated cells. Along similar lines, we also propose to analyze the combinatorial effects of bortezomib and PARP inhibitors. As mentioned in the discussion, BRCA1 and BRCA2 deficient cells are extremely sensitive to PARP inhibition (199 200) and we believe that exploiting the FA/BRCA pathway inhibitory effects of bortezomib by treatment with PARP inhib itors will greatly enhance the cyctotoxic effects of bortezomib. Analysis of FA/BRCA pathway expression in myeloma cells treated with the second generation proteasome inhibitors carfilzomib and NPI 0052 may also be important. These agents irreversibly i nhibit the proteasome and can overcome boretezomib resistance (29, 81) It is plausible that these drugs can inhibit the FA/BRCA pathway more effectively and for a longer period of time than can bortezomib.

PAGE 143

130 Finally, i t may also prove worthwhile to further analyze miRNA ex pression following bortezomib treatment. Although bortezomib treatment may not alter expression of miRNAs that directly target FA mRNAs, it is conceivable that bortezomib treatment changes expression of miRNAs that target proteins upstream of this pathway Furthermore, miRN A analysis of drug sensitive versus drug resistant cells may be important for determining if differential expression of specific miRNAs contributes to acquired drug resistance

PAGE 144

131 REFERENCES 1. Hanah an, D., and R. A. Weinberg. 2000. The hallmarks of cancer. Cell. 100:57 70. 2. Laubach, J. P., C. S. Mitsiades, A. Mahindra, R. L. Schlossman, T. Hideshima, D. Chauhan, N. A. Carreau, I. M. Ghobrial, N. Raje, N. C. Munshi, K. C. Anderson, and P. G. Richard son. 2009. Novel therapies in the treatment of multiple myeloma. J Natl Compr Canc Netw. 7:947 960. 3. Chen, Q., P. C. Van der Sluis, D. Boulware, L. A. Hazlehurst, and W. S. Dalton. 2005. The FA/BRCA pathway is involved in melphalan induced DNA interstran d cross link repair and accounts for melphalan resistance in multiple myeloma cells. Blood 106:698 705. 4. Hazlehurst, L. A., S. A. Enkemann, C. A. Beam, R. F. Argilagos, J. Painter, K. H. Shain, S. Saporta, D. Boulware, L. Moscinski, M. Alsina, and W. S. Dalton. 2003. Genotypic and phenotypic comparisons of de novo and acquired melphalan resistance in an isogenic multiple myeloma cell line model. Cancer Res 63:7900 7906. 5. Duus, J., H. I. Bahar, G. Venkataraman, F. Ozpuyan, K. F. Izban, H. Al Masri, T. Ma ududi, A. Toor, and S. Alkan. 2006. Analysis of expression of heat shock protein 90 (HSP90) and the effects of HSP90 inhibitor (17 AAG) in multiple myeloma. Leuk Lymphoma. 47:1369 1378. 6. Avet Loiseau, H., J. Soulier, J. P. Fermand, I. Yakoub Agha, M. Att al, C. Hulin, L. Garderet, K. Belhadj, V. Dorvaux, S. Minvielle, and P. Moreau. 2010. Impact of high risk cytogenetics and prior therapy on outcomes in patients with advanced relapsed or refractory multiple myeloma treated with lenalidomide plus dexamethas one. Leukemia 14:14. 7. Jemal, A., R. Siegel, E. Ward, Y. Hao, J. Xu, T. Murray, and M. J. Thun. 2008. Cancer statistics, 2008. CA Cancer J Clin. 58:71 96. Epub 2008 Feb 2020. 8. Katzel, J. A., P. Hari, and D. H. Vesole. 2007. Multiple myeloma: charging to ward a bright future. CA Cancer J Clin. 57:301 318. 9. Greenlee, R. T., M. B. Hill Harmon, T. Murray, and M. Thun. 2001. Cancer statistics, 2001. CA Cancer J Clin. 51:15 36. 10. Qayum, A., A. Aleem, A. R. Al Diab, F. Niaz, and A. K. Al Momen. 2010. Rapid i mprovement in renal function in patients with multiple myeloma and renal failure treated with bortezomib. Saudi J Kidney Dis Transpl. 21:63 68. 11. Kyle, R. A., and S. V. Rajkumar. 2004. Multiple myeloma. N Engl J Med 351:1860 1873. 12. Zhou, Y., B. Barlog ie, and J. D. Shaughnessy, Jr. 2009. The molecular characterization and clinical management of multiple myeloma in the post genome era. Leukemia. 23:1941 1956. Epub 2009 Aug 1946.

PAGE 145

132 13. Nair, B., S. Waheed, J. Szymonifka, J. D. Shaughnessy, Jr., J. Crowley, and B. Barlogie. 2009. Immunoglobulin isotypes in multiple myeloma: laboratory correlates and prognostic implications in total therapy protocols. Br J Haematol. 145:134 137. Epub 2008 Dec 2020. 14. Blade, J., P. Fernandez Llama, F. Bosch, J. Montoliu, X. M Lens, S. Montoto, A. Cases, A. Darnell, C. Rozman, and E. Montserrat. 1998. Renal failure in multiple myeloma: presenting features and predictors of outcome in 94 patients from a single institution. Arch Intern Med. 158:1889 1893. 15. Kyle, R. A., T. M. Therneau, S. V. Rajkumar, J. R. Offord, D. R. Larson, M. F. Plevak, and L. J. Melton, 3rd. 2002. A long term study of prognosis in monoclonal gammopathy of undetermined significance. N Engl J Med. 346:564 569. 16. Blade, J., M. Dimopoulos, L. Rosinol, S. V Rajkumar, and R. A. Kyle. 2009. Smoldering (Asymptomatic) Multiple Myeloma: Current Diagnostic Criteria, New Predictors of Outcome, and Follow Up Recommendations. J Clin Oncol 21:21. 17. Ocio, E. M., M. V. Mateos, P. Maiso, A. Pandiella, and J. F. San Mi guel. 2008. New drugs in multiple myeloma: mechanisms of action and phase I/II clinical findings. Lancet Oncol. 9:1157 1165. 18. Kuehl, W. M., and P. L. Bergsagel. 2002. Multiple myeloma: evolving genetic events and host interactions. Nat Rev Cancer. 2:175 187. 19. Kuroda, Y., A. Sakai, N. Tsuyama, Y. Katayama, S. Munemasa, H. Asaoku, Y. Okikawa, N. Nakaju, M. Mizuno, K. Ogawa, T. Nishisaka, H. Matsui, H. Tanaka, and A. Kimura. 2008. Ectopic cyclin D1 overexpression increases chemosensitivity but not cell p roliferation in multiple myeloma. Int J Oncol. 33:1201 1213. 20. Seidl, S., H. Kaufmann, and J. Drach. 2003. New insights into the pathophysiology of multiple myeloma. Lancet Oncol. 4:557 564. 21. Fonseca, R., E. Blood, M. Rue, D. Harrington, M. M. Oken, R A. Kyle, G. W. Dewald, B. Van Ness, S. A. Van Wier, K. J. Henderson, R. J. Bailey, and P. R. Greipp. 2003. Clinical and biologic implications of recurrent genomic aberrations in myeloma. Blood. 101:4569 4575. Epub 2003 Feb 4566. 22. Tricot, G., B. Barlog ie, S. Jagannath, D. Bracy, S. Mattox, D. H. Vesole, S. Naucke, and J. R. Sawyer. 1995. Poor prognosis in multiple myeloma is associated only with partial or complete deletions of chromosome 13 or abnormalities involving 11q and not with other karyotype ab normalities. Blood. 86:4250 4256. 23. Reece, D., K. W. Song, T. Fu, B. Roland, H. Chang, D. E. Horsman, A. Mansoor, C. Chen, E. Masih Khan, Y. Trieu, H. Bruyere, D. A. Stewart, and N. J. Bahlis. 2009. Influence of cytogenetics in patients with relapsed or refractory multiple myeloma treated with lenalidomide plus dexamethasone: adverse effect of deletion 17p13. Blood. 114:522 525. Epub 2009 Mar 2030. 24. Bergsagel, D. E., C. C. Sprague, C. Austin, and K. M. Griffith. 1962. Evaluation of new chemotherapeutic agents in the treatment of multiple myeloma. IV. L Phenylalanine mustard (NSC 8806). Cancer Chemother Rep 21:87 99.

PAGE 146

133 25. Berenson, J. R., H. H. Yang, K. Sadler, S. G. Jarutirasarn, R. A. Vescio, R. Mapes, M. Purner, S. P. Lee, J. Wilson, B. Morrison, J. Ad ams, D. Schenkein, and R. Swift. 2006. Phase I/II trial assessing bortezomib and melphalan combination therapy for the treatment of patients with relapsed or refractory multiple myeloma. J Clin Oncol 24:937 944. 26. Jagannath, S., B. Barlogie, J. Berenson, D. Siegel, D. Irwin, P. G. Richardson, R. Niesvizky, R. Alexanian, S. A. Limentani, M. Alsina, J. Adams, M. Kauffman, D. L. Esseltine, D. P. Schenkein, and K. C. Anderson. 2004. A phase 2 study of two doses of bortezomib in relapsed or refractory myeloma. Br J Haematol 127:165 172. 27. Mateos, M. V., J. M. Hernandez, M. T. Hernandez, N. C. Gutierrez, L. Palomera, M. Fuertes, J. Diaz Mediavilla, J. J. Lahuerta, J. de la Rubia, M. J. Terol, A. Sureda, J. Bargay, P. Ribas, F. de Arriba, A. Alegre, A. Oriol, D Carrera, J. Garcia Larana, R. Garcia Sanz, J. Blade, F. Prosper, G. Mateo, D. L. Esseltine, H. van de Velde, and J. F. San Miguel. 2006. Bortezomib plus melphalan and prednisone in elderly untreated patients with multiple myeloma: results of a multicente r phase 1/2 study. Blood. 108:2165 2172. Epub 2006 Jun 2113. 28. San Miguel, J. F., R. Schlag, N. K. Khuageva, M. A. Dimopoulos, O. Shpilberg, M. Kropff, I. Spicka, M. T. Petrucci, A. Palumbo, O. S. Samoilova, A. Dmoszynska, K. M. Abdulkadyrov, R. Schots, B. Jiang, M. V. Mateos, K. C. Anderson, D. L. Esseltine, K. Liu, A. Cakana, H. van de Velde, and P. G. Richardson. 2008. Bortezomib plus melphalan and prednisone for initial treatment of multiple myeloma. N Engl J Med. 359:906 917. 29. Cirstea, D., S. Vall et, and N. Raje. 2009. Future novel single agent and combination therapies. Cancer J. 15:511 518. 30. Dalton, W. S., T. M. Grogan, P. S. Meltzer, R. J. Scheper, B. G. Durie, C. W. Taylor, T. P. Miller, and S. E. Salmon. 1989. Drug resistance in multiple my eloma and non Hodgkin's lymphoma: detection of P glycoprotein and potential circumvention by addition of verapamil to chemotherapy. J Clin Oncol. 7:415 424. 31. Cole, S. P., G. Bhardwaj, J. H. Gerlach, J. E. Mackie, C. E. Grant, K. C. Almquist, A. J. Stewa rt, E. U. Kurz, A. M. Duncan, and R. G. Deeley. 1992. Overexpression of a transporter gene in a multidrug resistant human lung cancer cell line. Science. 258:1650 1654. 32. Scheffer, G. L., A. B. Schroeijers, M. A. Izquierdo, E. A. Wiemer, and R. J. Schepe r. 2000. Lung resistance related protein/major vault protein and vaults in multidrug resistant cancer. Curr Opin Oncol. 12:550 556. 33. Gazitt, Y., V. Fey, C. Thomas, and R. Alvarez. 1998. Bcl 2 overexpression is associated with resistance to dexamethasone but not melphalan, in multiple myeloma cells. Int J Oncol. 13:397 405. 34. Tu, Y., F. H. Xu, J. Liu, R. Vescio, J. Berenson, C. Fady, and A. Lichtenstein. 1996. Upregulated expression of BCL 2 in multiple myeloma cells induced by exposure to doxorubicin, etoposide, and hydrogen peroxide. Blood. 88:1805 1812.

PAGE 147

134 35. Brocke Heidrich, K., A. K. Kretzschmar, G. Pfeifer, C. Henze, D. Loffler, D. Koczan, H. J. Thiesen, R. Burger, M. Gramatzki, and F. Horn. 2004. Interleukin 6 dependent gene expression profiles in multiple myeloma INA 6 cells reveal a Bcl 2 family independent survival pathway closely associated with Stat3 activation. Blood. 103:242 251. Epub 2003 Sep 2011. 36. Jourdan, M., J. L. Veyrune, J. De Vos, N. Redal, G. Couderc, and B. Klein. 2003. A major r ole for Mcl 1 antiapoptotic protein in the IL 6 induced survival of human myeloma cells. Oncogene. 22:2950 2959. 37. Yang, H. H., M. H. Ma, R. A. Vescio, and J. R. Berenson. 2003. Overcoming drug resistance in multiple myeloma: the emergence of therapeutic approaches to induce apoptosis. J Clin Oncol. 21:4239 4247. 38. Bellamy, W. T., W. S. Dalton, M. C. Gleason, T. M. Grogan, and J. M. Trent. 1991. Development and characterization of a melphalan resistant human multiple myeloma cell line. Cancer Res 51:995 1002. 39. Damiano, J. S., A. E. Cress, L. A. Hazlehurst, A. A. Shtil, and W. S. Dalton. 1999. Cell adhesion mediated drug resistance (CAM DR): role of integrins and resistance to apoptosis in human myeloma cell lines. Blood. 93:1658 1667. 40. Hazlehurst, L. A., J. S. Damiano, I. Buyuksal, W. J. Pledger, and W. S. Dalton. 2000. Adhesion to fibronectin via beta1 integrins regulates p27kip1 levels and contributes to cell adhesion mediated drug resistance (CAM DR). Oncogene. 19:4319 4327. 41. Nefedova, Y., P. Cheng, M. Alsina, W. S. Dalton, and D. I. Gabrilovich. 2004. Involvement of Notch 1 signaling in bone marrow stroma mediated de novo drug resistance of myeloma and other malignant lymphoid cell lines. Blood. 103:3503 3510. Epub 2003 Dec 3511. 42. Karin, M. Y. Cao, F. R. Greten, and Z. W. Li. 2002. NF kappaB in cancer: from innocent bystander to major culprit. Nat Rev Cancer 2:301 310. 43. Shain, K. H., D. N. Yarde, M. B. Meads, M. Huang, R. Jove, L. A. Hazlehurst, and W. S. Dalton. 2009. Beta1 integrin adh esion enhances IL 6 mediated STAT3 signaling in myeloma cells: implications for microenvironment influence on tumor survival and proliferation. Cancer Res. 69:1009 1015. Epub 2009 Jan 1020. 44. Yu, H., D. Pardoll, and R. Jove. 2009. STATs in cancer inflamm ation and immunity: a leading role for STAT3. Nat Rev Cancer. 9:798 809. 45. Basseres, D. S., and A. S. Baldwin. 2006. Nuclear factor kappaB and inhibitor of kappaB kinase pathways in oncogenic initiation and progression. Oncogene. 25:6817 6830. 46. Solan, N. J., H. Miyoshi, E. M. Carmona, G. D. Bren, and C. V. Paya. 2002. RelB cellular regulation and transcriptional activity are regulated by p100. J Biol Chem. 277:1405 1418. Epub 2001 Oct 1430. 47. Li, Z. W., H. Chen, R. A. Campbell, B. Bonavida, and J. R. Berenson. 2008. NF kappaB in the pathogenesis and treatment of multiple myeloma. Curr Opin Hematol. 15:391 399. 48. Prasad, S., J. Ravindran, and B. B. Aggarwal. 2009. NF kappaB and cancer: how intimate is this relationship. Mol Cell Biochem 8:8.

PAGE 148

135 49. Yaro n, A., H. Gonen, I. Alkalay, A. Hatzubai, S. Jung, S. Beyth, F. Mercurio, A. M. Manning, A. Ciechanover, and Y. Ben Neriah. 1997. Inhibition of NF kappa B cellular function via specific targeting of the I kappa B ubiquitin ligase. Embo J. 16:6486 6494. 50. Weil, R., and A. Israel. 2006. Deciphering the pathway from the TCR to NF kappaB. Cell Death Differ. 13:826 833. 51. Perkins, N. D., and T. D. Gilmore. 2006. Good cop, bad cop: the different faces of NF kappaB. Cell Death Differ. 13:759 772. 52. Janssens, S., and J. Tschopp. 2006. Signals from within: the DNA damage induced NF kappaB response. Cell Death Differ 13:773 784. 53. Karin, M. 2006. Nuclear factor kappaB in cancer development and progression. Nature. 441:431 436. 54. Baldwin, A. S., Jr. 2001. Ser ies introduction: the transcription factor NF kappaB and human disease. J Clin Invest 107:3 6. 55. McConkey, D. J., and K. Zhu. 2008. Mechanisms of proteasome inhibitor action and resistance in cancer. Drug Resist Updat. 11:164 179. Epub 2008 Sep 2024. 56. Annunziata, C. M., R. E. Davis, Y. Demchenko, W. Bellamy, A. Gabrea, F. Zhan, G. Lenz, I. Hanamura, G. Wright, W. Xiao, S. Dave, E. M. Hurt, B. Tan, H. Zhao, O. Stephens, M. Santra, D. R. Williams, L. Dang, B. Barlogie, J. D. Shaughnessy, Jr., W. M. Kuehl and L. M. Staudt. 2007. Frequent engagement of the classical and alternative NF kappaB pathways by diverse genetic abnormalities in multiple myeloma. Cancer Cell 12:115 130. 57. Keats, J. J., R. Fonseca, M. Chesi, R. Schop, A. Baker, W. J. Chng, S. Van W ier, R. Tiedemann, C. X. Shi, M. Sebag, E. Braggio, T. Henry, Y. X. Zhu, H. Fogle, T. Price Troska, G. Ahmann, C. Mancini, L. A. Brents, S. Kumar, P. Greipp, A. Dispenzieri, B. Bryant, G. Mulligan, L. Bruhn, M. Barrett, R. Valdez, J. Trent, A. K. Stewart, J. Carpten, and P. L. Bergsagel. 2007. Promiscuous mutations activate the noncanonical NF kappaB pathway in multiple myeloma. Cancer Cell 12:131 144. 58. Landowski, T. H., N. E. Olashaw, D. Agrawal, and W. S. Dalton. 2003. Cell adhesion mediated drug resis tance (CAM DR) is associated with activation of NF kappa B (RelB/p50) in myeloma cells. Oncogene 22:2417 2421. 59. Ma, M. H., H. H. Yang, K. Parker, S. Manyak, J. M. Friedman, C. Altamirano, Z. Q. Wu, M. J. Borad, M. Frantzen, E. Roussos, J. Neeser, A. Mik ail, J. Adams, N. Sjak Shie, R. A. Vescio, and J. R. Berenson. 2003. The proteasome inhibitor PS 341 markedly enhances sensitivity of multiple myeloma tumor cells to chemotherapeutic agents. Clin Cancer Res 9:1136 1144. 60. Cusack, J. C., R. Liu, and A. S. Baldwin. 1999. NF kappa B and chemoresistance: potentiation of cancer drugs via inhibition of NF kappa B. Drug Resist Updat. 2:271 273. 61. Feinman, R., J. Koury, M. Thames, B. Barlogie, J. Epstein, and D. S. Siegel. 1999. Role of NF kappaB in the rescu e of multiple myeloma cells from glucocorticoid induced apoptosis by bcl 2. Blood. 93:3044 3052.

PAGE 149

136 62. Malara, N., D. Foca, F. Casadonte, M. F. Sesto, L. Macrina, L. Santoro, M. Scaramuzzino, R. Terracciano, and R. Savino. 2008. Simultaneous inhibition of th e constitutively activated nuclear factor kappaB and of the interleukin 6 pathways is necessary and sufficient to completely overcome apoptosis resistance of human U266 myeloma cells. Cell Cycle. 7:3235 3245. 63. Wang, J., and M. A. Maldonado. 2006. The ub iquitin proteasome system and its role in inflammatory and autoimmune diseases. Cell Mol Immunol. 3:255 261. 64. Andreassen, P. R., A. D. D'Andrea, and T. Taniguchi. 2004. ATR couples FANCD2 monoubiquitination to the DNA damage response. Genes Dev 18:1958 1963. 65. Haglund, K., P. P. Di Fiore, and I. Dikic. 2003. Distinct monoubiquitin signals in receptor endocytosis. Trends Biochem Sci. 28:598 603. 66. Hicke, L., and R. Dunn. 2003. Regulation of membrane protein transport by ubiquitin and ubiquitin binding proteins. Annu Rev Cell Dev Biol. 19:141 172. 67. Hoege, C., B. Pfander, G. L. Moldovan, G. Pyrowolakis, and S. Jentsch. 2002. RAD6 dependent DNA repair is linked to modification of PCNA by ubiquitin and SUMO. Nature. 419:135 141. 68. Dikic, K. H. a. I., ed. 2008. Ubiquitin Signaling and Cancer Pathogenesis WILEY VCH Verlag GMBH & Co., Weinheim. 69. Glickman, M. H., and A. Ciechanover. 2002. The ubiquitin proteasome proteolytic pathway: destruction for the sake of construction. Physiol Rev. 82:373 428. 70 Nencioni, A., F. Grunebach, F. Patrone, A. Ballestrero, and P. Brossart. 2007. Proteasome inhibitors: antitumor effects and beyond. Leukemia 21:30 36. 71. Thomas, S. K., T. A. Richards, and D. M. Weber. 2009. Novel agents for relapsed and/or refractory m ultiple myeloma. Cancer J. 15:485 493. 72. Wang, X., C. Guerrero, P. Kaiser, and L. Huang. 2007. Proteomics of proteasome complexes and ubiquitinated proteins. Expert Rev Proteomics. 4:649 665. 73. Nussbaum, A. K., T. P. Dick, W. Keilholz, M. Schirle, S. S tevanovic, K. Dietz, W. Heinemeyer, M. Groll, D. H. Wolf, R. Huber, H. G. Rammensee, and H. Schild. 1998. Cleavage motifs of the yeast 20S proteasome beta subunits deduced from digests of enolase 1. Proc Natl Acad Sci U S A. 95:12504 12509. 74. Adams, J. 2 004. The proteasome: a suitable antineoplastic target. Nat Rev Cancer. 4:349 360. 75. Hazlehurst, L. A., R. F. Argilagos, and W. S. Dalton. 2007. Beta1 integrin mediated adhesion increases Bim protein degradation and contributes to drug resistance in leuka emia cells. Br J Haematol. 136:269 275. 76. Dalton, W. S. 2004. The proteasome. Semin Oncol. 31:3 9; discussion 33. 77. Adams, J., and M. Kauffman. 2004. Development of the proteasome inhibitor Velcade (Bortezomib). Cancer Invest 22:304 311. 78. Mitsiades, N., C. S. Mitsiades, P. G. Richardson, V. Poulaki, Y. T. Tai, D. Chauhan, G. Fanourakis, X. Gu, C. Bailey, M. Joseph, T. A. Libermann, R. Schlossman, N. C. Munshi, T. Hideshima, and K. C. Anderson. 2003. The proteasome inhibitor PS 341 potentiates sensiti vity of multiple myeloma cells to conventional chemotherapeutic agents: therapeutic applications. Blood 101:2377 2380.

PAGE 150

137 79. Mateos, M. V., J. M. Hernandez, M. T. Hernandez, N. C. Gutierrez, L. Palomera, M. Fuertes, P. Garcia Sanchez, J. J. Lahuerta, J. de l a Rubia, M. J. Terol, A. Sureda, J. Bargay, P. Ribas, A. Alegre, F. de Arriba, A. Oriol, D. Carrera, J. Garcia Larana, R. Garcia Sanz, J. Blade, F. Prosper, G. Mateo, D. L. Esseltine, H. van de Velde, and J. F. San Miguel. 2008. Bortezomib plus melphalan a nd prednisone in elderly untreated patients with multiple myeloma: updated time to events results and prognostic factors for time to progression. Haematologica. 93:560 565. Epub 2008 Mar 2005. 80. Miguel, J. F. S., R. Schlag, N. Khuageva, O. Shpilberg, M. Dimopoulos, M. Kropff, I. Spicka, M. Petrucci, O. Samoilova, A. Dmoszynska, K. Abdulkadyrov, R. Schots, B. Jiang, A. Palumbo, M. Mateos, K. Liu, A. Cakana, H. Van de Velde, and P. Richardson. 2007. MMY 3002: A Phase 3 Study Comparing Bortezomib Melphalan P rednisone (VMP) with Melphalan Prednisone (MP) in Newly Diagnosed Multiple Myeloma. ASH Annual Meeting Abstracts 110:76 81. Koreth, J., E. P. Alyea, W. J. Murphy, and L. A. Welniak. 2009. Proteasome inhibition and allogeneic hematopoietic stem cell trans plantation: a review. Biol Blood Marrow Transplant. 15:1502 1512. 82. Hoeijmakers, J. H. 2009. DNA damage, aging, and cancer. N Engl J Med. 361:1475 1485. 83. Lindahl, T. 1993. Instability and decay of the primary structure of DNA. Nature. 362:709 715. 84. Su, T. T. 2006. Cellular responses to DNA damage: one signal, multiple choices. Annu Rev Genet. 40:187 208. 85. Jackson, S. P., and J. Bartek. 2009. The DNA damage response in human biology and disease. Nature. 461:1071 1078. 86. Rechkunova, N. I., and O. I. Lavrik. 2010. Nucleotide excision repair in higher eukaryotes: mechanism of primary damage recognition in global genome repair. Subcell Biochem. 50:251 277. 87. Wang, W. 2007. Emergence of a DNA damage response network consisting of Fanconi anaemia and BRCA proteins. Nat Rev Genet 8:735 748. 88. Zhang, Y., L. H. Rohde, and H. Wu. 2009. Involvement of nucleotide excision and mismatch repair mechanisms in double strand break repair. Curr Genomics. 10:250 258. 89. McCabe, K. M., S. B. Olson, and R. E. Mose s. 2009. DNA interstrand crosslink repair in mammalian cells. J Cell Physiol. 220:569 573. 90. Weterings, E., and D. J. Chen. 2008. The endless tale of non homologous end joining. Cell Res. 18:114 124. 91. Li, X., and W. D. Heyer. 2008. Homologous recombin ation in DNA repair and DNA damage tolerance. Cell Res. 18:99 113. 92. Shrivastav, M., L. P. De Haro, and J. A. Nickoloff. 2008. Regulation of DNA double strand break repair pathway choice. Cell Res. 18:134 147. 93. Cohn, M. A., and A. D. D'Andrea. 2008. C hromatin recruitment of DNA repair proteins: lessons from the fanconi anemia and double strand break repair pathways. Mol Cell. 32:306 312.

PAGE 151

138 94. Nagy, Z., and E. Soutoglou. 2009. DNA repair: easy to visualize, difficult to elucidate. Trends Cell Biol. 19:61 7 629. Epub 2009 Oct 2008. 95. Rothkamm, K., I. Kruger, L. H. Thompson, and M. Lobrich. 2003. Pathways of DNA double strand break repair during the mammalian cell cycle. Mol Cell Biol. 23:5706 5715. 96. Despras, E., P. Pfeiffer, B. Salles, P. Calsou, S. Ku hfittig Kulle, J. F. Angulo, and D. S. Biard. 2007. Long term XPC silencing reduces DNA double strand break repair. Cancer Res. 67:2526 2534. 97. Azarova, A. M., Y. L. Lyu, C. P. Lin, Y. C. Tsai, J. Y. Lau, J. C. Wang, and L. F. Liu. 2007. Roles of DNA top oisomerase II isozymes in chemotherapy and secondary malignancies. Proc Natl Acad Sci U S A. 104:11014 11019. Epub 12007 Jun 11019. 98. Ben Yehoyada, M., L. C. Wang, I. D. Kozekov, C. J. Rizzo, M. E. Gottesman, and J. Gautier. 2009. Checkpoint signaling fr om a single DNA interstrand crosslink. Mol Cell. 35:704 715. 99. Rothfuss, A., and M. Grompe. 2004. Repair kinetics of genomic interstrand DNA cross links: evidence for DNA double strand break dependent activation of the Fanconi anemia/BRCA pathway. Mol Ce ll Biol 24:123 134. 100. Chun, H. H., and R. A. Gatti. 2004. Ataxia telangiectasia, an evolving phenotype. DNA Repair (Amst). 3:1187 1196. 101. Kerzendorfer, C., and M. O'Driscoll. 2009. Human DNA damage response and repair deficiency syndromes: linking ge nomic instability and cell cycle checkpoint proficiency. DNA Repair (Amst). 8:1139 1152. Epub 2009 May 1126. 102. Digweed, M., and K. Sperling. 2004. Nijmegen breakage syndrome: clinical manifestation of defective response to DNA double strand breaks. DNA Repair (Amst). 3:1207 1217. 103. Pollard, J. M., and R. A. Gatti. 2009. Clinical radiation sensitivity with DNA repair disorders: an overview. Int J Radiat Oncol Biol Phys. 74:1323 1331. 104. Auerbach, A. D. 2009. Fanconi anemia and its diagnosis. Mutat Re s. 668:4 10. Epub 2009 Feb 2028. 105. Moldovan, G. L., and A. D. D'Andrea. 2009. How the fanconi anemia pathway guards the genome. Annu Rev Genet. 43:223 249. 106. Auerbach, A. D., and S. R. Wolman. 1976. Susceptibility of Fanconi's anaemia fibroblasts to chromosome damage by carcinogens. Nature. 261:494 496. 107. Alter, B. P., P. S. Rosenberg, and L. C. Brody. 2007. Clinical and molecular features associated with biallelic mutations in FANCD1/BRCA2. J Med Genet. 44:1 9. Epub 2006 Jul 2006. 108. Neveling, K ., D. Endt, H. Hoehn, and D. Schindler. 2009. Genotype phenotype correlations in Fanconi anemia. Mutat Res. 668:73 91. Epub 2009 May 2021. 109. Kutler, D. I., A. D. Auerbach, J. Satagopan, P. F. Giampietro, S. D. Batish, A. G. Huvos, A. Goberdhan, J. P. Sh ah, and B. Singh. 2003. High incidence of head and neck squamous cell carcinoma in patients with Fanconi anemia. Arch Otolaryngol Head Neck Surg. 129:106 112.

PAGE 152

139 110. de Winter, J. P., F. Leveille, C. G. van Berkel, M. A. Rooimans, L. van Der Weel, J. Stelten pool, I. Demuth, N. V. Morgan, N. Alon, L. Bosnoyan Collins, J. Lightfoot, P. A. Leegwater, Q. Waisfisz, K. Komatsu, F. Arwert, J. C. Pronk, C. G. Mathew, M. Digweed, M. Buchwald, and H. Joenje. 2000. Isolation of a cDNA representing the Fanconi anemia com plementation group E gene. Am J Hum Genet 67:1306 1308. 111. de Winter, J. P., M. A. Rooimans, L. van Der Weel, C. G. van Berkel, N. Alon, L. Bosnoyan Collins, J. de Groot, Y. Zhi, Q. Waisfisz, J. C. Pronk, F. Arwert, C. G. Mathew, R. J. Scheper, M. E. Hoa tlin, M. Buchwald, and H. Joenje. 2000. The Fanconi anaemia gene FANCF encodes a novel protein with homology to ROM. Nat Genet 24:15 16. 112. de Winter, J. P., Q. Waisfisz, M. A. Rooimans, C. G. van Berkel, L. Bosnoyan Collins, N. Alon, M. Carreau, O. Bend er, I. Demuth, D. Schindler, J. C. Pronk, F. Arwert, H. Hoehn, M. Digweed, M. Buchwald, and H. Joenje. 1998. The Fanconi anaemia group G gene FANCG is identical with XRCC9. Nat Genet 20:281 283. 113. Levran, O., C. Attwooll, R. T. Henry, K. L. Milton, K. N eveling, P. Rio, S. D. Batish, R. Kalb, E. Velleuer, S. Barral, J. Ott, J. Petrini, D. Schindler, H. Hanenberg, and A. D. Auerbach. 2005. The BRCA1 interacting helicase BRIP1 is deficient in Fanconi anemia. Nat Genet 37:931 933. 114. Lo Ten Foe, J. R., M. A. Rooimans, L. Bosnoyan Collins, N. Alon, M. Wijker, L. Parker, J. Lightfoot, M. Carreau, D. F. Callen, A. Savoia, N. C. Cheng, C. G. van Berkel, M. H. Strunk, J. J. Gille, G. Pals, F. A. Kruyt, J. C. Pronk, F. Arwert, M. Buchwald, and H. Joenje. 1996. Ex pression cloning of a cDNA for the major Fanconi anaemia gene, FAA. Nat Genet 14:320 323. 115. Meetei, A. R., J. P. de Winter, A. L. Medhurst, M. Wallisch, Q. Waisfisz, H. J. van de Vrugt, A. B. Oostra, Z. Yan, C. Ling, C. E. Bishop, M. E. Hoatlin, H. Joen je, and W. Wang. 2003. A novel ubiquitin ligase is deficient in Fanconi anemia. Nat Genet 35:165 170. 116. Meetei, A. R., M. Levitus, Y. Xue, A. L. Medhurst, M. Zwaan, C. Ling, M. A. Rooimans, P. Bier, M. Hoatlin, G. Pals, J. P. de Winter, W. Wang, and H. Joenje. 2004. X linked inheritance of Fanconi anemia complementation group B. Nat Genet 36:1219 1224. 117. Meetei, A. R., A. L. Medhurst, C. Ling, Y. Xue, T. R. Singh, P. Bier, J. Steltenpool, S. Stone, I. Dokal, C. G. Mathew, M. Hoatlin, H. Joenje, J. P. de Winter, and W. Wang. 2005. A human ortholog of archaeal DNA repair protein Hef is defective in Fanconi anemia complementation group M. Nat Genet 37:958 963. 118. Rahman, N., S. Seal, D. Thompson, P. Kelly, A. Renwick, A. Elliott, S. Reid, K. Spanova, R. Barfoot, T. Chagtai, H. Jayatilake, L. McGuffog, S. Hanks, D. G. Evans, D. Eccles, D. F. Easton, and M. R. Stratton. 2007. PALB2, which encodes a BRCA2 interacting protein, is a breast cancer susceptibility gene. Nat Genet 39:165 167.

PAGE 153

140 119. Reid, S., D. Sc hindler, H. Hanenberg, K. Barker, S. Hanks, R. Kalb, K. Neveling, P. Kelly, S. Seal, M. Freund, M. Wurm, S. D. Batish, F. P. Lach, S. Yetgin, H. Neitzel, H. Ariffin, M. Tischkowitz, C. G. Mathew, A. D. Auerbach, and N. Rahman. 2007. Biallelic mutations in PALB2 cause Fanconi anemia subtype FA N and predispose to childhood cancer. Nat Genet 39:162 164. 120. Smogorzewska, A., S. Matsuoka, P. Vinciguerra, E. R. McDonald, 3rd, K. E. Hurov, J. Luo, B. A. Ballif, S. P. Gygi, K. Hofmann, A. D. D'Andrea, and S. J. Elledge. 2007. Identification of the FANCI protein, a monoubiquitinated FANCD2 paralog required for DNA repair. Cell 129:289 301. 121. Strathdee, C. A., H. Gavish, W. R. Shannon, and M. Buchwald. 1992. Cloning of cDNAs for Fanconi's anaemia by functional c omplementation. Nature 358:434. 122. Timmers, C., T. Taniguchi, J. Hejna, C. Reifsteck, L. Lucas, D. Bruun, M. Thayer, B. Cox, S. Olson, A. D. D'Andrea, R. Moses, and M. Grompe. 2001. Positional cloning of a novel Fanconi anemia gene, FANCD2. Mol Cell 7:24 1 248. 123. Wang, X., P. R. Andreassen, and A. D. D'Andrea. 2004. Functional interaction of monoubiquitinated FANCD2 and BRCA2/FANCD1 in chromatin. Mol Cell Biol 24:5850 5862. 124. Ciccia, A., C. Ling, R. Coulthard, Z. Yan, Y. Xue, A. R. Meetei, H. Laghman i el, H. Joenje, N. McDonald, J. P. de Winter, W. Wang, and S. C. West. 2007. Identification of FAAP24, a Fanconi anemia core complex protein that interacts with FANCM. Mol Cell 25:331 343. 125. Ling, C., M. Ishiai, A. M. Ali, A. L. Medhurst, K. Neveling, R. Kalb, Z. Yan, Y. Xue, A. B. Oostra, A. D. Auerbach, M. E. Hoatlin, D. Schindler, H. Joenje, J. P. de Winter, M. Takata, A. R. Meetei, and W. Wang. 2007. FAAP100 is essential for activation of the Fanconi anemia associated DNA damage response pathway. Em bo J 26:2104 2114. 126. Medhurst, A. L., H. Laghmani el, J. Steltenpool, M. Ferrer, C. Fontaine, J. de Groot, M. A. Rooimans, R. J. Scheper, A. R. Meetei, W. Wang, H. Joenje, and J. P. de Winter. 2006. Evidence for subcomplexes in the Fanconi anemia pathwa y. Blood. 108:2072 2080. Epub 2006 May 2023. 127. Tremblay, C. S., F. F. Huang, O. Habi, C. C. Huard, C. Godin, G. Levesque, and M. Carreau. 2008. HES1 is a novel interactor of the Fanconi anemia core complex. Blood. 112:2062 2070. Epub 2008 Jun 2011. 128. Niedzwiedz, W., G. Mosedale, M. Johnson, C. Y. Ong, P. Pace, and K. J. Patel. 2004. The Fanconi anaemia gene FANCC promotes homologous recombination and error prone DNA repair. Mol Cell 15:607 620. 129. Yamashita, T., G. M. Kupfer, D. Naf, A. Suliman, H. Joenje, S. Asano, and A. D. D'Andrea. 1998. The fanconi anemia pathway requires FAA phosphorylation and FAA/FAC nuclear accumulation. Proc Natl Acad Sci U S A. 95:13085 13090. 130. Du, J., L. Chen, and J. Shen. 2009. Identification of FANCA as a protein in teracting with centromere associated protein E. Acta Biochim Biophys Sin (Shanghai). 41:816 821.

PAGE 154

141 131. Otsuki, T., Y. Furukawa, K. Ikeda, H. Endo, T. Yamashita, A. Shinohara, A. Iwamatsu, K. Ozawa, and J. M. Liu. 2001. Fanconi anemia protein, FANCA, associa tes with BRG1, a component of the human SWI/SNF complex. Hum Mol Genet 10:2651 2660. 132. Otsuki, T., D. B. Young, D. T. Sasaki, M. P. Pando, J. Li, A. Manning, M. Hoekstra, M. E. Hoatlin, F. Mercurio, and J. M. Liu. 2002. Fanconi anemia protein complex is a novel target of the IKK signalsome. J Cell Biochem. 86:613 623. 133. Oda, T., T. Hayano, H. Miyaso, N. Takahashi, and T. Yamashita. 2007. Hsp90 regulates the Fanconi anemia DNA damage response pathway. Blood. 109:5016 5026. Epub 2007 Feb 5027. 134. Hoat lin, M. E., T. A. Christianson, W. W. Keeble, A. T. Hammond, Y. Zhi, M. C. Heinrich, P. A. Tower, and G. C. Bagby, Jr. 1998. The Fanconi anemia group C gene product is located in both the nucleus and cytoplasm of human cells. Blood. 91:1418 1425. 135. Leve ille, F., M. Ferrer, A. L. Medhurst, H. Laghmani el, M. A. Rooimans, P. Bier, J. Steltenpool, T. A. Titus, J. H. Postlethwait, M. E. Hoatlin, H. Joenje, and J. P. de Winter. 2006. The nuclear accumulation of the Fanconi anemia protein FANCE depends on FANC C. DNA Repair (Amst). 5:556 565. Epub 2006 Feb 2028. 136. Taniguchi, T., and A. D. D'Andrea. 2002. The Fanconi anemia protein, FANCE, promotes the nuclear accumulation of FANCC. Blood 100:2457 2462. 137. Heinrich, M. C., K. V. Silvey, S. Stone, A. J. Zigle r, D. J. Griffith, M. Montalto, L. Chai, Y. Zhi, and M. E. Hoatlin. 2000. Posttranscriptional cell cycle dependent regulation of human FANCC expression. Blood. 95:3970 3977. 138. Pichierri, P., D. Averbeck, and F. Rosselli. 2002. DNA cross link dependent R AD50/MRE11/NBS1 subnuclear assembly requires the Fanconi anemia C protein. Hum Mol Genet. 11:2531 2546. 139. Cumming, R. C., J. Lightfoot, K. Beard, H. Youssoufian, P. J. O'Brien, and M. Buchwald. 2001. Fanconi anemia group C protein prevents apoptosis in hematopoietic cells through redox regulation of GSTP1. Nat Med. 7:814 820. 140. Fagerlie, S. R., T. Koretsky, B. Torok Storb, and G. C. Bagby. 2004. Impaired type I IFN induced Jak/STAT signaling in FA C cells and abnormal CD4+ Th cell subsets in Fancc / mice. J Immunol. 173:3863 3870. 141. Freie, B. W., S. L. Ciccone, X. Li, P. A. Plett, C. M. Orschell, E. F. Srour, H. Hanenberg, D. Schindler, S. H. Lee, and D. W. Clapp. 2004. A role for the Fanconi anemia C protein in maintaining the DNA damage induced G 2 checkpoint. J Biol Chem. 279:50986 50993. Epub 52004 Sep 50917. 142. Pang, Q., W. Keeble, T. A. Christianson, G. R. Faulkner, and G. C. Bagby. 2001. FANCC interacts with Hsp70 to protect hematopoietic cells from IFN gamma/TNF alpha mediated cytotoxicity. Embo J. 20:4478 4489. 143. Gordon, S. M., N. Alon, and M. Buchwald. 2005. FANCC, FANCE, and FANCD2 form a ternary complex essential to the integrity of the Fanconi anemia DNA damage response pathway. J Biol Chem. 280:36118 36125. Epub 32005 Aug 36126.

PAGE 155

142 144 Wang, X., R. D. Kennedy, K. Ray, P. Stuckert, T. Ellenberger, and A. D. D'Andrea. 2007. Chk1 mediated phosphorylation of FANCE is required for the Fanconi anemia/BRCA pathway. Mol Cell Biol 27:3098 3108. 145. Leveille, F., E. Blom, A. L. Medhurst, P. Bie r, H. Laghmani el, M. Johnson, M. A. Rooimans, A. Sobeck, Q. Waisfisz, F. Arwert, K. J. Patel, M. E. Hoatlin, H. Joenje, and J. P. de Winter. 2004. The Fanconi anemia gene product FANCF is a flexible adaptor protein. J Biol Chem. 279:39421 39430. Epub 3200 4 Jul 39415. 146. Wilson, J. B., K. Yamamoto, A. S. Marriott, S. Hussain, P. Sung, M. E. Hoatlin, C. G. Mathew, M. Takata, L. H. Thompson, G. M. Kupfer, and N. J. Jones. 2008. FANCG promotes formation of a newly identified protein complex containing BRCA2, FANCD2 and XRCC3. Oncogene 147. Gurtan, A. M., P. Stuckert, and A. D. D'Andrea. 2006. The WD40 repeats of FANCL are required for Fanconi anemia core complex assembly. J Biol Chem 281:10896 10905. 148. Machida, Y. J., Y. Machida, Y. Chen, A. M. Gurtan, G. M. Kupfer, A. D. D'Andrea, and A. Dutta. 2006. UBE2T is the E2 in the Fanconi anemia pathway and undergoes negative autoregulation. Mol Cell. 23:589 596. 149. Gari, K., C. Decaillet, M. Delannoy, L. Wu, and A. Constantinou. 2008. Remodeling of DNA replica tion structures by the branch point translocase FANCM. Proc Natl Acad Sci U S A. 105:16107 16112. Epub 12008 Oct 16108. 150. Kim, J. M., Y. Kee, A. Gurtan, and A. D. D'Andrea. 2008. Cell cycle dependent chromatin loading of the fanconi anemia core complex by FANCM/FAAP24. Blood 151. Sobeck, A., S. Stone, I. Landais, B. de Graaf, and M. E. Hoatlin. 2009. The Fanconi anemia protein FANCM is controlled by FANCD2 and the ATR/ATM pathways. J Biol Chem. 284:25560 25568. Epub 22009 Jul 25524. 152. Kee, Y., J. M. Kim, and A. D. D'Andrea. 2009. Regulated degradation of FANCM in the Fanconi anemia pathway during mitosis. Genes Dev. 23:555 560. 153. Xue, Y., Y. Li, R. Guo, C. Ling, and W. Wang. 2008. FANCM of the Fanconi anemia core complex is required for both monoub iquitination and DNA repair. Hum Mol Genet. 17:1641 1652. Epub 2008 Feb 1619. 154. Collis, S. J., A. Ciccia, A. J. Deans, Z. Horejsi, J. S. Martin, S. L. Maslen, J. M. Skehel, S. J. Elledge, S. C. West, and S. J. Boulton. 2008. FANCM and FAAP24 function in ATR mediated checkpoint signaling independently of the Fanconi anemia core complex. Mol Cell. 32:313 324. 155. Ishiai, M., H. Kitao, A. Smogorzewska, J. Tomida, A. Kinomura, E. Uchida, A. Saberi, E. Kinoshita, E. Kinoshita Kikuta, T. Koike, S. Tashiro, S. J. Elledge, and M. Takata. 2008. FANCI phosphorylation functions as a molecular switch to turn on the Fanconi anemia pathway. Nat Struct Mol Biol. 15:1138 1146. Epub 2008 Oct 1119. 156. Taniguchi, T., I. Garcia Higuera, P. R. Andreassen, R. C. Gregory, M. Grompe, and A. D. D'Andrea. 2002. S phase specific interaction of the Fanconi anemia protein, FANCD2, with BRCA1 and RAD51. Blood 100:2414 2420.

PAGE 156

143 157. Hussain, S., J. B. Wilson, A. L. Medhurst, J. Hejna, E. Witt, S. Ananth, A. Davies, J. Y. Masson, R. Mose s, S. C. West, J. P. de Winter, A. Ashworth, N. J. Jones, and C. G. Mathew. 2004. Direct interaction of FANCD2 with BRCA2 in DNA damage response pathways. Hum Mol Genet 13:1241 1248. 158. Nakanishi, K., T. Taniguchi, V. Ranganathan, H. V. New, L. A. Moreau M. Stotsky, C. G. Mathew, M. B. Kastan, D. T. Weaver, and A. D. D'Andrea. 2002. Interaction of FANCD2 and NBS1 in the DNA damage response. Nat Cell Biol 4:913 920. 159. Nakanishi, K., Y. G. Yang, A. J. Pierce, T. Taniguchi, M. Digweed, A. D. D'Andrea, Z. Q. Wang, and M. Jasin. 2005. Human Fanconi anemia monoubiquitination pathway promotes homologous DNA repair. Proc Natl Acad Sci U S A 102:1110 1115. 160. Kennedy, R. D., and A. D. D'Andrea. 2005. The Fanconi Anemia/BRCA pathway: new faces in the crowd. Ge nes Dev 19:2925 2940. 161. Taniguchi, T., I. Garcia Higuera, B. Xu, P. R. Andreassen, R. C. Gregory, S. T. Kim, W. S. Lane, M. B. Kastan, and A. D. D'Andrea. 2002. Convergence of the fanconi anemia and ataxia telangiectasia signaling pathways. Cell 109:459 472. 162. Nijman, S. M., T. T. Huang, A. M. Dirac, T. R. Brummelkamp, R. M. Kerkhoven, A. D. D'Andrea, and R. Bernards. 2005. The deubiquitinating enzyme USP1 regulates the Fanconi anemia pathway. Mol Cell 17:331 339. 163. Oestergaard, V. H., F. Langevin, H. J. Kuiken, P. Pace, W. Niedzwiedz, L. J. Simpson, M. Ohzeki, M. Takata, J. E. Sale, and K. J. Patel. 2007. Deubiquitination of FANCD2 is required for DNA crosslink repair. Mol Cell 28:798 809. 164. Cantor, S. B., D. W. Bell, S. Ganesan, E. M. Kass, R. Drapkin, S. Grossman, D. C. Wahrer, D. C. Sgroi, W. S. Lane, D. A. Haber, and D. M. Livingston. 2001. BACH1, a novel helicase like protein, interacts directly with BRCA1 and contributes to its DNA repair function. Cell. 105:149 160. 165. de Winter, J. P., and H. Joenje. 2009. The genetic and molecular basis of Fanconi anemia. Mutat Res. 668:11 19. Epub 2008 Nov 2014. 166. Sommers, J. A., N. Rawtani, R. Gupta, D. V. Bugreev, A. V. Mazin, S. B. Cantor, and R. M. Brosh, Jr. 2009. FANCJ uses its motor ATPase to destabilize protein DNA complexes, unwind triplexes, and inhibit RAD51 strand exchange. J Biol Chem. 284:7505 7517. Epub 2009 Jan 7516. 167. Xia, B., Q. Sheng, K. Nakanishi, A. Ohashi, J. Wu, N. Christ, X. Liu, M. Jasin, F. J. Couch, and D. M. Livingston. 2006. Control of BRCA2 cellular and clinical functions by a nuclear partner, PALB2. Mol Cell. 22:719 729. 168. Zhang, F., J. Ma, J. Wu, L. Ye, H. Cai, B. Xia, and X. Yu. 2009. PALB2 links BRCA1 and BRCA2 in the DNA damage response. Curr Biol. 19:524 529. Epub 2009 Mar 2005. 169. Xiao, H., Q. Xiao, K. Zhang, X. Zuo, and U. K. Shrestha. 2009. Reversal of multidrug resistance by curcumin through FA/BRCA pathway in multiple myeloma cell line MOLP 2/R. Ann Hematol 15:15. 170. Chen, C. C., T. Taniguchi, and A. D 'Andrea. 2007. The Fanconi anemia (FA) pathway confers glioma resistance to DNA alkylating agents. J Mol Med 85:497 509.

PAGE 157

144 171. Burkitt, K., and M. Ljungman. 2008. Phenylbutyrate interferes with the Fanconi anemia and BRCA pathway and sensitizes head and nec k cancer cells to cisplatin. Mol Cancer. 7:24. 172. Ferrer, M., J. P. de Winter, D. C. Mastenbroek, D. T. Curiel, W. R. Gerritsen, G. Giaccone, and F. A. Kruyt. 2004. Chemosensitizing tumor cells by targeting the Fanconi anemia pathway with an adenovirus o verexpressing dominant negative FANCA. Cancer Gene Ther. 11:539 546. 173. Taniguchi, T., M. Tischkowitz, N. Ameziane, S. V. Hodgson, C. G. Mathew, H. Joenje, S. C. Mok, and A. D. D'Andrea. 2003. Disruption of the Fanconi anemia BRCA pathway in cisplatin se nsitive ovarian tumors. Nat Med 9:568 574. 174. Sakai, W., E. M. Swisher, C. Jacquemont, K. V. Chandramohan, F. J. Couch, S. P. Langdon, K. Wurz, J. Higgins, E. Villegas, and T. Taniguchi. 2009. Functional restoration of BRCA2 protein by secondary BRCA2 mu tations in BRCA2 mutated ovarian carcinoma. Cancer Res. 69:6381 6386. Epub 2009 Aug 6384. 175. Sakai, W., E. M. Swisher, B. Y. Karlan, M. K. Agarwal, J. Higgins, C. Friedman, E. Villegas, C. Jacquemont, D. J. Farrugia, F. J. Couch, N. Urban, and T. Taniguc hi. 2008. Secondary mutations as a mechanism of cisplatin resistance in BRCA2 mutated cancers. Nature. 451:1116 1120. Epub 2008 Feb 1110. 176. Jacquemont, C., and T. Taniguchi. 2007. Proteasome function is required for DNA damage response and fanconi anemi a pathway activation. Cancer Res 67:7395 7405. 177. Bellamy, W. T., R. T. Dorr, W. S. Dalton, and D. S. Alberts. 1988. Direct relation of DNA lesions in multidrug resistant human myeloma cells to intracellular doxorubicin concentration. Cancer Res. 48:6360 6364. 178. Dalton, W. S., B. G. Durie, D. S. Alberts, J. H. Gerlach, and A. E. Cress. 1986. Characterization of a new drug resistant human myeloma cell line that expresses P glycoprotein. Cancer Res. 46:5125 5130. 179. Hazlehurst, L. A., N. E. Foley, M. C Gleason Guzman, M. P. Hacker, A. E. Cress, L. W. Greenberger, M. C. De Jong, and W. S. Dalton. 1999. Multiple mechanisms confer drug resistance to mitoxantrone in the human 8226 myeloma cell line. Cancer Res. 59:1021 1028. 180. Benjamini, Y., and Hochber g, Y. 1995. Controlling the false discovery rate: a pratical and powerful approach to multiple testing. Journal of the royal Statistical Society Series B:289 300. 181. Chou, T. C., and P. Talalay. 1984. Quantitative analysis of dose effect relationships: t he combined effects of multiple drugs or enzyme inhibitors. Adv Enzyme Regul. 22:27 55. 182. Miller, R. G. 1981. Simultaneous Statistical Inference Springer. 183. Fisher, R. A. 1915. Frequency distribution of the values of the correlation coefficient in s amples from an indefinitely large population. Biometrika 10:507 521. 184. Martin, D. B., T. Holzman, D. May, A. Peterson, A. Eastham, J. Eng, and M. McIntosh. 2008. MRMer, an interactive open source and cross platform system for data extraction and visuali zation of multiple reaction monitoring experiments. Mol Cell Proteomics. 7:2270 2278. Epub 2008 Jul 2218.

PAGE 158

145 185. Mulcahy, R. T., S. Untawale, and J. J. Gipp. 1994. Transcriptional up regulation of gamma glutamylcysteine synthetase gene expression in melphala n resistant human prostate carcinoma cells. Mol Pharmacol. 46:909 914. 186. Andrews, P. A., and K. D. Albright. 1992. Mitochondrial defects in cis diamminedichloroplatinum(II) resistant human ovarian carcinoma cells. Cancer Res. 52:1895 1901. 187. Soulier, J., T. Leblanc, J. Larghero, H. Dastot, A. Shimamura, P. Guardiola, H. Esperou, C. Ferry, C. Jubert, J. P. Feugeas, A. Henri, A. Toubert, G. Socie, A. Baruchel, F. Sigaux, A. D. D'Andrea, and E. Gluckman. 2005. Detection of somatic mosaicism and classific ation of Fanconi anemia patients by analysis of the FA/BRCA pathway. Blood 105:1329 1336. 188. Baiz, D., G. Pozzato, B. Dapas, R. Farra, B. Scaggiante, M. Grassi, L. Uxa, C. Giansante, C. Zennaro, G. Guarnieri, and G. Grassi. 2009. Bortezomib arrests the p roliferation of hepatocellular carcinoma cells HepG2 and JHH6 by differentially affecting E2F1, p21 and p27 levels. Biochimie. 91:373 382. Epub 2008 Nov 2012. 189. Schewe, D. M., and J. A. Aguirre Ghiso. 2009. Inhibition of eIF2alpha dephosphorylation maxi mizes bortezomib efficiency and eliminates quiescent multiple myeloma cells surviving proteasome inhibitor therapy. Cancer Res. 69:1545 1552. Epub 2009 Feb 1543. 190. Yarde, D. N., V. Oliveira, L. Mathews, X. Wang, A. Villagra, D. Boulware, K. H. Shain, L. A. Hazlehurst, M. Alsina, D. T. Chen, A. A. Beg, and W. S. Dalton. 2009. Targeting the Fanconi anemia/BRCA pathway circumvents drug resistance in multiple myeloma. Cancer Res. 69:9367 9375. Epub 191. Baud, V., and M. Karin. 2009. Is NF kappaB a good tar get for cancer therapy? Hopes and pitfalls. Nat Rev Drug Discov. 8:33 40. 192. Burke, J. R., M. A. Pattoli, K. R. Gregor, P. J. Brassil, J. F. MacMaster, K. W. McIntyre, X. Yang, V. S. Iotzova, W. Clarke, J. Strnad, Y. Qiu, and F. C. Zusi. 2003. BMS 345541 is a highly selective inhibitor of I kappa B kinase that binds at an allosteric site of the enzyme and blocks NF kappa B dependent transcription in mice. J Biol Chem 278:1450 1456. 193. Hutvagner, G., and P. D. Zamore. 2002. A microRNA in a multiple turno ver RNAi enzyme complex. Science. 297:2056 2060. Epub 2002 Aug 2051. 194. Schmittgen, T. D. 2008. Regulation of microRNA processing in development, differentiation and cancer. J Cell Mol Med. 12:1811 1819. 195. Abraham, R. T. 2001. Cell cycle checkpoint si gnaling through the ATM and ATR kinases. Genes Dev. 15:2177 2196. 196. Lagos Quintana, M., R. Rauhut, J. Meyer, A. Borkhardt, and T. Tuschl. 2003. New microRNAs from mouse and human. Rna. 9:175 179. 197. Singh, S. K., M. Pal Bhadra, H. J. Girschick, and U. Bhadra. 2008. MicroRNAs -micro in size but macro in function. Febs J. 275:4929 4944. Epub 2008 Aug 4927. 198. Gurtan, A. M., and A. D. D'Andrea. 2006. Dedicated to the core: understanding the Fanconi anemia complex. DNA Repair (Amst). 5:1119 1125. Epub 20 06 Jun 1119.

PAGE 159

146 199. Bryant, H. E., N. Schultz, H. D. Thomas, K. M. Parker, D. Flower, E. Lopez, S. Kyle, M. Meuth, N. J. Curtin, and T. Helleday. 2005. Specific killing of BRCA2 deficient tumours with inhibitors of poly(ADP ribose) polymerase. Nature. 434:91 3 917. 200. Farmer, H., N. McCabe, C. J. Lord, A. N. Tutt, D. A. Johnson, T. B. Richardson, M. Santarosa, K. J. Dillon, I. Hickson, C. Knights, N. M. Martin, S. P. Jackson, G. C. Smith, and A. Ashworth. 2005. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature. 434:917 921. 201. Sandhu, S. K., T. A. Yap, and J. S. de Bono. 2010. Poly(ADP ribose) polymerase inhibitors in cancer treatment: a clinical perspective. Eur J Cancer. 46:9 20. Epub 202. Scott, J., R. T. Dorr, B. S amulitis, and T. H. Landowski. 2007. Imexon based combination chemotherapy in A375 human melanoma and RPMI 8226 human myeloma cell lines. Cancer Chemother Pharmacol. 59:749 757. Epub 2007 Feb 2028. 203. Pei, X. Y., Y. Dai, and S. Grant. 2004. Synergistic i nduction of oxidative injury and apoptosis in human multiple myeloma cells by the proteasome inhibitor bortezomib and histone deacetylase inhibitors. Clin Cancer Res. 10:3839 3852. 204. Pearl Yafe, M., D. Halperin, O. Scheuerman, and I. Fabian. 2004. The p 38 pathway partially mediates caspase 3 activation induced by reactive oxygen species in Fanconi anemia C cells. Biochem Pharmacol. 67:539 546. 205. Fusco, A. J., O. V. Savinova, R. Talwar, J. D. Kearns, A. Hoffmann, and G. Ghosh. 2008. Stabililzation of R elB Requires Multi domain Interactions with p100/p52. J Biol Chem 206. Basak, S., H. Kim, J. D. Kearns, V. Tergaonkar, E. O'Dea, S. L. Werner, C. A. Benedict, C. F. Ware, G. Ghosh, I. M. Verma, and A. Hoffmann. 2007. A fourth IkappaB protein within the NF kappaB signaling module. Cell 128:369 381. 207. Hoskins, E. E., R. W. Gunawardena, K. B. Habash, T. M. Wise Draper, M. Jansen, E. S. Knudsen, and S. I. Wells. 2008. Coordinate regulation of Fanconi anemia gene expression occurs through the Rb/E2F pathway. Oncogene. 27:4798 4808. Epub 2008 Apr 4728. 208. Dalton, W. S., L. Hazlehurst, K. Shain, T. Landowski, and M. Alsina. 2004. Targeting the bone marrow microenvironment in hematologic malignancies. Semin Hematol 41:1 5. 209. Landais, I., S. Hiddingh, M. McC arroll, C. Yang, A. Sun, M. S. Turker, J. P. Snyder, and M. E. Hoatlin. 2009. Monoketone analogs of curcumin, a new class of Fanconi anemia pathway inhibitors. Mol Cancer. 8:133. 210. Collins, N. B., J. B. Wilson, T. Bush, A. Thomashevski, K. J. Roberts, N J. Jones, and G. M. Kupfer. 2009. ATR dependent phosphorylation of FANCA on serine 1449 after DNA damage is important for FA pathway function. Blood. 113:2181 2190. Epub 2008 Dec 2124. 211. Murakawa, Y., E. Sonoda, L. J. Barber, W. Zeng, K. Yokomori, H. Kimura, A. Niimi, A. Lehmann, G. Y. Zhao, H. Hochegger, S. J. Boulton, and S. Takeda. 2007. Inhibitors of the proteasome suppress homologous DNA recombination in mammalian cells. Cancer Res 67:8536 8543.

PAGE 160

ABOUT THE AUTHOR Danielle N. Yarde received her Bachelor of Science degree in biology from the University o f Nebraska Lincoln in 2002. Danielle then worked as a research technician at both the University of Nebraska and the H. Lee Moffitt Cancer Center and Research Institute for app roximately three years, in the labs of Dr. David D. Dunigan and Dr. William S. Dalton, respectively. Danielle was accepted into the Cancer Biology Ph.D. Program at the H. Lee Moffitt Cancer Center and Rese arch Insti tute at th e University of South Florida, and began her work as a graduate student in the lab of Dr. Dalton in August of 2005. Under the mentorship and guidance of Dr. Dalton, Danielle has published one first author paper, as well co authored one other publication a nd a book chapter. She has also published abstracts in the American Society of Hematology and the Proceedings of the American Association of Cancer Researchers.