USF Libraries
USF Digital Collections

Functional nanomaterials with an electrochemistry-based approach to sensing and energy applications

MISSING IMAGE

Material Information

Title:
Functional nanomaterials with an electrochemistry-based approach to sensing and energy applications
Physical Description:
Book
Language:
English
Creator:
Weber, Jessica
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Biosensor
DNA
Nanocrystalline diamond
Carbon nanotube
Thermoelectric
Dissertations, Academic -- Mechanical Engineering -- Masters -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: In the past decade, the use of nanotechnology as a tool to develop and fabricate new structures and devices for biological sensing and energy applications has become increasingly widespread. In this work, a systematic study has been performed on one-dimensional nanomaterials, with a focus on the development of miniaturized devices with a "bottom up" approach. First, members of the nano - carbon family are utilized for biosensing applications; in particular, carbon nanotubes as well as nitrogen - doped and boron - doped nanocrystalline diamond (NCD) films. These carbon - based materials possess several unique electrochemical properties over other conductive materials which make them suitable for biosensing applications. Single walled carbon nanotubes were deposited on a glass carbon electrode and modified for the detection of Salmonella DNA hybridization. Electrochemical impedance spectroscopy (EIS) was used as the method of detection and a detection limit of 10-9 M was achieved. Nanocrystalline diamond was grown using a microwave enhanced plasma chemical vapor deposition method. The diamond electrodes were doped with either boron or nitrogen to provide substrates and characterization was performed using scanning electron microscopy, atomic force microscopy, Raman spectroscopy, Fourier transform infrared spectroscopy, UV-vis spectroscopy, as well as by electrochemical methods. Modified boron - doped NCD was able to detect Salmonella DNA hybridization via EIS and fluorescent microscopy. The detection limit for these genosensors was found to be 0.4 µM complementary DNA. Boron - doped and nitrogen - incorporated nanocrystalline diamond also served as functionalized electrodes for lactic acid detection. It was found that the boron - doped electrodes could detect 0.5 mM lactic acid in a phosphate buffer solution. Second, bismuth antimony nanowires were grown in an anodized alumina template for the fabrication of a thermoelectric cooling device. Bismuth antimony nanowires were chosen due to their high thermoelectric efficiency compared to their bulk material counterpart. The development of a successful anodized template was achieved and EIS was used to diagnose the optimal etch parameters of the barrier oxide layer for nanowire growth. Bismuth antimony nanowires were grown directly on a silicon substrate and a thermoelectric cooling device was fabricated. The nanowires exhibited a thermoelectric efficiency of 0.18 at room temperature.
Thesis:
Dissertation (PHD)--University of South Florida, 2010.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Jessica Weber.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains X pages.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
usfldc doi - E14-SFE0004592
usfldc handle - e14.4592
System ID:
SFS0027907:00001


This item is only available as the following downloads:


Full Text

PAGE 1

Functional Nanomaterials with an Electrochemistry Based Approach to Sensing and Energy Applications by Jessica Eileen Weber A dissertation subm itted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of M echanical Engineering College of Engineering University of South Florida Major Professor: Ashok Kumar Ph.D. Rajiv Dubey, Ph.D. Muhammad Rahman, Ph.D. Ryan Toomey, Ph.D. Garrett Matthews, Ph.D. Date of Approval: June 9, 2010 Keywords: Biosensor, DNA, Nanocrystalline diamond, Carbon nanotube, Thermoelectric Copyright 2010, Jessica Eileen Weber

PAGE 2

DEDICATION For Cailin. May you reach further and soar higher than I can even dream. For Justin for walking beside me. For my parents and family for supporting my academic adventures.

PAGE 3

ACKNOWLEDGEMENTS I would like to extend my deepest thanks to my m ajor professor, Dr. Ashok Kumar, for his guidance and support during my dissertation research. I would also like to thank my committee members, Dr. Rajiv Dubey, Dr. Muhammad Rahman, Dr. Ryan Toomey, and Dr. Garrett Mathews for providing their professional feedback regarding my dissertation and advice on my career path after graduate school Thank you to Dr. Shyam Mohapatra for serving as the Chair of my doctoral defense. There are seve ral people who have helped and supported me during my graduate career. A special thank you to Mr. Bernard Batson, who always was available to provide advice and support on any issue throughout grad school Thank you to Ms. Susan Britte n and Ms. Shirley T ervort of the Mechanical Engineering office for all their administrative help. I would like to acknowledge Mr. Graham Yelton of Sandia National Labs for his guidance during my internship and continued support on any topic relating to electrochemistry. Fi nally, I would like to thank Mr. Humberto Gomez and the rest of my lab mates for all of their support of my research efforts. I am thankful for being supported by the NSF IGERT Fellowship and the NSF GK12 Fellows hip during my graduate career Several grants made my dissertation research possible. This work was financially supported by the following National Science Foundation grants: NIRT #0404137, C REST #0734232, IGERT #0221681 and GK12 #0638709.

PAGE 4

i TABLE OF CONTENTS LIST OF TABLES ............................................................................................................. iv LIST OF FIGURES .............................................................................................................v ABSTRACT ....................................................................................................................... ix CHAPTER 1: INTRODUCTION ........................................................................................1 1.1. Introduction to NanoCarbon ............................................................................2 1.1.1. Carbon Nanotubes ..............................................................................3 1.1.2. Nanocrystalline Diamond ..................................................................6 1.2. Introduction to Nanomaterials for Thermoelectrics ..........................................7 1.3. Motivation and Research Objective ..................................................................9 1.4. Scope of the Dissertation ................................................................................10 CHAPTER 2: BACKGROUND AND LITERATURE REVIEW ....................................13 2.1. Template Directed Nanowire Synthesis ......................................................13 2.1.1. Template Synthesis ..........................................................................13 2.1.2. Electrochemical Deposition .............................................................15 2.1.3. Pressure Injection ..........................................................................16 2.1.4. Sol Gel Deposition ........................................................................17 2.2. Vapor Phase Growth .......................................................................................18 2.2.1. Vapor Liquid Solid Mechanism .................................................18 2.2.2. Carbothermal Growth ......................................................................22 2.2.3. Vapor Solid Growth ......................................................................23 2.2.4. Oxide Assisted Growth .................................................................23

PAGE 5

ii 2.3. Solution Based Growth ...................................................................................23 2.3.1. Solution Liquid Solid Methods ..................................................24 2.3.2. Hydrothermal and Solvothermal Methods .......................................25 2.3.3. Anisotropic 1D Nanostructures .......................................................28 2.4. Other Useful Growth Approaches ..................................................................29 2.5. Chemical and Biological Sensing Applications ..............................................31 2.6. Conclusions .....................................................................................................33 CHAPT ER 3: ELECTROCHEMISTRY THEORY ..........................................................36 3.1. Introduction .....................................................................................................36 3.2. Reduction Oxidation Reactions ...................................................................36 3.3. Electroch emical Impedance Spectroscopy .....................................................37 3.3.1. Electrode Kinetics ............................................................................39 3.3.2. The Electrical Double Layer ............................................................41 3.3.3. The Equivalent Circuit .....................................................................42 3.3.4. Impedance Data Interpretation .........................................................45 3.4. Cyclic Volta mmetry ........................................................................................47 3.4.1. The Electrochemical Cell .................................................................49 CHAPTER 4: NANOCARBON RESULTS AND DISCUSSION ..................................50 4.1. Introduction .....................................................................................................50 4.2. Carbon Nanotube Electrodes ..........................................................................52 4.2.1. Materials and Methods .....................................................................53 4.2.2. Discussion ........................................................................................56 4.3. Nanocrystalline Diamond Electrodes .............................................................65 4.3.1. Growth of Boron Doped Nanocrystalline Diamond ........................66 4.3.2. Growth of Nitrogen Incorporated Nanocrystalline Diamond ..........69 4.3.3. Hydrogenation of Nanocrystalline Diamond ...................................72

PAGE 6

iii 4.3.4. Materials and Methods for DNA Sensing........................................74 4.3.5. DNA Sensor Discussion ..................................................................76 4.3.6. Materials and Methods for Lactic Acid Sensing .............................80 4.3.7. Lactic Acid Sensor Discussion ........................................................81 4.4. Summary .........................................................................................................88 CHAPTER 5: B ISMUTH ANTIMONY N ANOWIRE RESULTS AND DISCUSSION ............................................................................................90 5.1. Introduction .....................................................................................................90 5.2. Material Selection ...........................................................................................91 5.3. Template Fabrication ......................................................................................92 5.3.1. Materials and Methods .....................................................................93 5.3.2. Discussion ........................................................................................97 5.4. Nanowire Growth .........................................................................................106 5.4.1. Materials and Methods ...................................................................106 5.4.2. Fundame ntals of Nanowire Electrodeposition ...............................106 5.4.3. Thermoelectric Measurements .......................................................117 5.5. Summary .......................................................................................................118 CHAPTER 6: CONCLUSIONS ......................................................................................119 REFERENCES ................................................................................................................122 ABOUT THE AUTHOR ....................................................................................... End Page

PAGE 7

iv LIST OF TABLES Table 1.1. Material properties of nano c arbon ..................................................................2 Table 1.2. ZT values of m at erials .........................................................................................9 Table 2.1. Various growth techniques and corresponding nanowire diameter ..................34 Table 3.1. Simple electrical circuit e lements .....................................................................43 Table 4.1. ssDNA probe and c omplementary s trand s equence i nformation ......................55 Table 4.2. Growth c onditions for boron doped NCD f ilms ............................................67 Table 4.3. Growth c onditions f or nitrogen i ncorporated NCD f ilms ..............................70 Table 5.1. Data f rom e quivalent c ircuit f it for s ample a nodized at 15 V for 10 min, n ~ 0.95. .........................................................................................................100

PAGE 8

v LIST OF FIGURES Figure 1.1. The (n,m) nanotube naming scheme can be thought of as a vector (Ch) in an infinite graphene sheet th at describes how to 'roll up' the graphene sheet to make the nanotube. ..............................................................4 Figure 1.2. Unit cell of the diamond cubic structure ...........................................................6 Figure 1.3. Contour plot of the optimal ZT values for ptype Bi( 1 x )Sb( x ) nanowires versus wire diameter and antimony concentration1 ........................8 Figure 2.1. The VLS growth process (adapted) 56 .............................................................19 Figure 2.2. Schematic of a CVD process76. .......................................................................21 Figure 3.1. Typical Nyquist plot ........................................................................................39 Figure 3.2. The electrical double la yer ..............................................................................41 Figure 3.3. Nyquist and Bode plots for a typical Randle s cell ..........................................46 Figure 3.4. Equivalent circuit for a typical Randles cell ....................................................47 Figure 3.5. CV of 0.5 mM [Fe(CN )6]3 /4 ...........................................................................48 Figur e 4.1. Schematic of CNT and DNA attachment chemistry process and DNA hybridization measurement in 5 .0 mM K3Fe(CN)6. .............................53 Figure 4.2. CNT functionalization setup ............................................................................55 Figure 4.3. Raman spectra of CNT electrode ....................................................................57 Figure 4.4. Cyclic voltammograms in 0.5 mM K3Fe(CN)6 in 0.5 M KCl aque ous solution vs. Ag/AgCl for 1.0 L, 5.0 L, 10 L, 15 L and 20 L SWNT COOH deposited on a polished glassy carbon electrode with a scan rate of 100 mV s1 applied from 1.0 to 0.5 V .............................59 Figure 4. 5. Cur rent density profile with an increase in CNTs to electrode surface ...........60

PAGE 9

vi Figure 4.6. Cyclic voltammograms in 0.5 mM K3Fe(CN)6 in 0.5 M KCl aqueous solution vs. Ag/AgCl for (a) polished, bare glassy c arbon electrode (GCE), (b) SWNT COOH modified GCE and (c) NH2ssDNA probe bound to SWNT COOH modified GCE with a scan rate of 100 mV s1 applied from 1.0 to 0.5 V ...........................................................62 Figure 4 .7. Nyquist plot of (a) GCE, (b) SWNT COOH modified GCE, (c) ssDNA/SWNT COOH GCE, and (d f) increasing concentrations of compleme ntary DNA .................................................................................64 Figure 4.8. Bode plot of SWNT COOH/GC electrode after ssDNA probe a ttachment and exposure to complementary DNA sequence as well as unmatched and mismatched DNA sequences. ...........................................65 Figure 4 .9. SEM image of nanocrystalline BDD. ..............................................................68 Figure 4.10. AF M section analysis of nanocrystalline BDD. ............................................68 Figure 4.11. Cyrannus I Iplas MPCVD system for NCD growth .....................................70 Figure 4.12. SEM of nitrogen incorporated NCD ...........................................................71 Figure 4.13. AFM roughness analysis of nitrogen incorporated NCD ...........................72 Figure 4.14. Schematic of HFCVD used for hydrogen plasma treatment of nanocrystalline diamond samples. ..................................................................73 Figure 4.15. Raman spectra after hy drogen treatment of BDD films ................................74 Figure 4.16. Schematic of modification of boron doped NCD films for DNA detection .........................................................................................................75 Figure 4.17. CV s of BDD surface (a) with hydrogen and (b) without hydrogen treatment .........................................................................................................77 Figure 4.18. CVs of (a) BDD COOH and BDD COOHssDNA with a scan rate of (b) 50, (c) 20 and (d) 5 mV/sec. .................................................................78 Figure 4.19. Nyquist plots of BDD (a) without DNA, (b) with ssDNA and (c) with complementary DNA attachment ...........................................................79 Figure 4.20. Fluorescent microscopy images at 400X of BDD with complementary DNA, two different locations on the same sample ...............80

PAGE 10

vii Figure 4.21. Mott Schottky graph of (a) nitrogen incorporated and (b) boron doped NC D .....................................................................................................83 Figure 4.22. FTIR spectra of NCD electrodes : (a) intrinsic, (b) boron doped, (c) n incorporated, (d) nitrogen incorporated with LOX ..........................84 Figure 4.23. CV of nitrogen incorporated NCD in 5 mM lactic acid .............................86 Figure 4.24. CV of boron doped NCD in increasing concentrations of lactic acid : (a) 20 mM, (b) 15 mM, (c) 10 mM, and (d) 5 mM ................................87 Figure 4.25. Peak current density as a function of lactic acid concentration .....................88 Figure 5.1. Schematic of thermoelectric cooler with Bi(1 x)Sb(x) nanowires as the ptype leg. .......................................................................................................91 Figure 5.2. S chematic of anodization setup .......................................................................93 Figure 5.3. Typical current time anodization profile ......................................................95 Figur e 5.4. Side view of EIS setup ....................................................................................96 Figure 5.5. Disas sembled top view of EIS setup ...............................................................97 Figure 5.6. T op view of typical AAO sample ....................................................................99 Figure 5.7. Cross section of AAO template. ...................................................................99 Figure 5.8. Equival en t circuit model of AAO sample .....................................................100 Figure 5.9. High frequency Nyquist data collected at OCP prior to anodization an d after anodization at 15 V for 10 min. and at 2 0 V for 10 min ...............102 Figure 5.10. Bode data (magnitude and phase) collected at OCP prior to anodization and after anodization at 15 V for 10 min and at 20 V for 10 min. ..........................................................................................................103 Figure 5.11. High frequency Nyquist data collected at OCP after anodization with no post etch, 0.5 min, 1.5 min, and 3.5 min post etch. ........................104 Figure 5.12. Bode data (magnitude and phase) collected at OCP after anodization with no post etch, 0.5 min, 1.5 min, and 3.5 min post etch ...............................................................................................................105 Figure 5.13. Schematic of rotating disk electrode stud y. .................................................107

PAGE 11

viii Figure 5.14. Linear voltammogram s with RDE at low agitation. ....................................109 Figure 5.15. Linear voltammograms with RDE at high agitation. ...................................110 Figure 5.16. Cyclic voltammogram overlays of bismuth and antimony in DMSO .........111 Figure 5.17. Nyquist plot f or 50 mM Bi3+ and 50 mM Sb3+ in DMSO ...........................113 Figure 5.18. Schematic of nanowire electrodeposition setup ..........................................114 Figure 5.19. Chronopotentiometric pulse for Bi( 1 x)Sb( x) nanowires in AAO template in 50 mM Bi3+ and 50 mM Sb3+ in DMSO at room temp .............116 Figure 5.20. Top view SEM of Bi( 1 x)Sb( x) nanowires grown out of AAO te mplate at low resolution and same sample at high resolution. ..................116 Figure 5.21. Schematic of bulk na nowire thermoelectric device ..................................117

PAGE 12

ix Functional Nanomaterials with an Electrochemistr y Based Approach to Sensing and Energy Applications Jessica Eileen Weber ABSTRACT In the past decade, the use of nanotechnology as a tool to develop and fabricate new structures and devices for biological sensing and energy applications has become increasingly widespread. In this work a systematic study has been performed on one dimensional nanomaterials, with a focus on the development of mini aturized devices with a bottom up approach. First members of the nano carbon family are utilized for biosensing applications ; in particular, carbon nanotubes as well as nitrogen doped and boron doped nanocrystall ine diamond (NCD) films These carbon based materials possess several unique electrochemical properties over other conductive materials which make them suitable for biosensing applications. Single walled carbon nanotubes were deposited on a glass carbon electrode and modified for the detection of Salmonella DNA hybridization. Electrochemical impedance spectroscopy (EIS) was used as the method of detection and a detection limit of 109 M was achieved. Nanocrystalline diamond was grown using a microwave enhanced plasma chemical vapor deposition method. The diamond electrodes were doped with either boron or nitrogen to provide s ubstrates and c haracterization was performed using scanning electron microscopy, atomic force

PAGE 13

x microscopy, Raman spectroscopy, Fo urier transform infrared spectroscopy, UV vis spectroscopy, as well as by electrochemical methods. Modified boron doped NCD was able to detect Salmonella DNA hybridization via EIS and fluorescent microscopy The detection limit for these genosensors wa s found to be 0.4 M complementary DNA. Boron doped and nitrogen incorporated n anocrystalline diamond also served as functionalized electrodes for lactic acid detection It was found that the boron doped electrodes could detect 0.5 mM lactic acid i n a phosphate buffer solution. Second bismuth antimony nanowires were grown in an anodized alumina template for the fabrication of a thermoelectric cooling device. Bismuth antimony nanowires were chosen due to their high thermoelectric efficiency comp ared to their bulk material counterpart. The development of a successful anodized template was achieved and EIS was used to diagnose the optimal etch parameters of the barrier oxide layer for nanowire growth. Bismuth antimony nanowires were grown directl y on a silicon substrate and a thermoelectric cooling device was fabricated The nanowires exhibited a thermoelectric efficiency of 0.18 at room temperature.

PAGE 14

1 CHAPTER 1: INTRODUCTION Over the past two decades since the discovery of carbon nanotubes2, one dimensional nanostructures have received growing interest. In this manuscript, the term one dimensional shall be used to refer to structures, including nano rods, belt s, tubes, and wires, which have at least one dimension between 1 and 100 nm, with significantly large length to diameter aspect ratios. Due to their unique electrical, thermal, mechanical, and optical properties that vary from their respective bulk counte rparts, fundamental understanding of 1D nanostructures is vital for technological progression. The potential application of these structures has a broad impact in the research fields of medical sensing, drug delivery, microelectronics, bioMEMS, communicat ions, energy storage, and computation technology. While Moores Law continues to push the miniaturization limit of the atomic level, integration of nanowires into electronic devices is still advancing. Furthermore, the bottom up synthesis method is a promising technique for addressing such challenges related to nanotechnology production and application. Unlike the traditional photolithography and etching techniques, the bottom up approach involves direct, controlled growth of nanostructures directly onto the substrate. Publications relating to 1D nanostructures has increased dramatically in the past several years. This growth of research has led to the development of new methods for simple production, growth with precise control over structural proper ties and chemical composition, a growing number of novel 1D materials with unique properties,

PAGE 15

2 improved characterization techniques, as well as a dramatic increase in potential applications relating to biotechnology. 1.1. Introduction to Nano Carbon Until the discovery of fullerenes in 1985, the science and chemistry of the carbon atom was thought to be well known. Previous to this discovery, carbon was known to form graphite and diamond, as well as amorphous materials like charcoal. Perhaps the most imp ortant consequence of the discovery of the fullerene is that it opened the door for matter to be studied at the nanoscale. Six years later, in 1991, another big surprise was found the carbon nanotube. These two forms of carbon have led to a burst of re search in nanomaterials. Today, the nano carbon family includes many recently discovered wonder materials, including C60 (a.k.a. buckyballs), carbon nanotubes, nanocrystalline diamond thin films and most recently, graphene. Depending on the lattice structure of each of these carbon based materials, different material properties are observed at the nanoscale. Here, we focus on carbon nanotubes and nanocrystalline diamond (Table 1.1.). 3 6 Table 1.1. Material p roperties of nano c arbon MATERIAL PROPERTY Single Walled Carbon Nanotube Single Crystal Diamond Density 2.1 gcm 3 3.52 gcm 3 Youngs Modulus ~ 1 5 TPa 1050 GPa

PAGE 16

3 Table 1.1. (Continued) Resistivity ~ 10 4 cm 10 13 10 14 cm Thermal Conductivity 1750 5800 W/m K 2500 W/m K 1.1.1. Carbon Nanotubes A single walled carbon nanotube ( SWNT ) is based on a two dimensional graphene sheet and can be characterized by a chiral vector C The chiral vector is defined on the hexagonal lattice as C = na1 + m a2, where a1 and a2 are unit vectors, and n and m a1 (Figure 1.1 ). When a graphene sheet is rolled up to form the cylinder, the ends of the chiral vector meet each other and connect two crystallographically equivalent si tes7. Thus, the length of the chiral vector is equal to the circumference of the nanotube. The values of (n,m), which govern the diameter and the chirality of the tube, will determine whether the carbon nanotube will behave as a metallic or semiconductor material. The chiral vector one of three possible nanotube structures: armchair, zigzag and chiral. All armchair nanotubes are metallic, as well as one third of all zigzag nanotubes.

PAGE 17

4 Figure 1.1. The (n,m) nanotube naming scheme can be thoug ht of as a vector (Ch) in an infinite graphene sheet th at describes how to 'roll up' the graphene sheet to make the nanotube. T denotes the tube axis, and a1 and a2 are the unit vectors of graphene in real space. Carbon nanotubes are a unique class of one dimensional nanostructures and their mechanical properties are of considerable interest. In 1991 Beck et al .8 reported that when fullerene molecules were collided against graphite and silicon over a wide range of energies that the events were highly inelastic and non fragmenting. This same property of resilience becomes magnified with a carbon nanotube. Due t o its extremely small structure, direct experimental measurements of mechanical properties of carbon nanotubes such as Youngs modulus and tensile strength have been a challenge. Treacy and coworkers9 performed the first experimental data of the Y oungs modulus by isolating a carbon nanotube and measuring the amplitude of its intrinsic thermal vibration in a transmission electron microscope. The thermal vibration at the free ends of the

PAGE 18

5 nanotubes was a function of temperature and Youngs modulus. Assuming the nanotube behaved as a straight cantilever rod with one end fixed and the other vibrating, an average value of 1.8 TPa for the Youngs modulus was obtained. Carbon nanotubes, in particular, are the quintessential electrode material due to th eir excellent mechanical strength, high electrical and thermal conductivity. Additionally, their large length to diameter aspect ratio along with a high surface area to weight ratio is an ideal combination for providing surface functionalization of biomole cules. However, due to the lack of solubility of CNTs in many solutions, integration of CNTs in biosensor design remains a difficult challenge. While covalent modification on the nanotube surface was originally used to solve solubility issues, this techn ique is now used extensively for biological functionalization such as enzyme attachment to the tip of the CNT10, 11. For example, treatment of CNTs with sulfuric and nitric acid under sonication will shorten and open the ends of the nanotubes while introducing carboxylic acid functional groups12. This technique is not only beneficial for nanotube solubility, but for functional group surface attachment as well. It has been shown previously that proteins will covalently attach to the ends of shortened SWNTs, which behave as molecular wires to allow electrical communication between the underlying electro de and the redox protein13. Modification of electrode surfaces with carbon nanotubes has shown to greatly enhance the performance of the sensor for analytes such as lactic acid14, cinnarizine15, antibodies16, and DNA17. In particular, carbon nanotube modified electrodes exhibit

PAGE 19

6 superior electrochemical properties, such as a wide working potential window, and also demonstrate catalytic activity towards many chemical reactions. 1.1.2. Nanocrystalline Diamond Diamond follows the face centered cubic bravais lattice, with eight carbon atoms per unit cell. The carbon atoms are covalently bonded to the four nearest neighboring atoms With a lattice constant (a0) of 3.567 a bond length of 1.54 and an atomic density of 1.7 1023 cm3, diamond exhibits several exceptional material properties. Figure 1 .2. Unit cell of the diamond cubic structure Boron doped microcrystalline and nanocrystalline diamond thin films in particular display a number of electrochemical properties which distinguish them from other carbonbased electrodes, such as a low backgr ound current, a wide working potential in both aqueous and nonaqueous media18, and good responsiveness for several redox analytes19. The importance of the wide working window in diam ond is that

PAGE 20

7 electrochemical reactions may be analyzed over a much larger potential window than for other electrode materials in the carbon family. 1.2. Introduction to Nanomaterials for Thermoelectrics Due to their small size and high surface area, an in depth understanding of thermal stability and conductivity in nanowires is vital before these structures can be implemented into microelectronic or thermoelectronic devices. It is known that thermal conduction is expected to be reduced with decreasing na nowire diameters. The decrease in thermal conductivity of small diameter nanowires is a distinguished advantage for thermoelectronic applications. Nanowires that possess both poor thermal conductivity and high electrical conductivity are candidates for d evices which require highly effective thermal management. Materials are often evaluated by their dimensionless thermoelectric figure of merit, ZT, given by: T S ZT2 where is the electric conductivity, S is the Seeback coefficient, T is the absolute temperature, and is the thermal conductivity. Dresselhaus and coworkers20 developed a theoretical model for Bi nanowires which predicted that under careful selection of nanowire diameter and carrier concentrat ion the thermoelectric efficiency is drastically enhanced. The ZT value increases due to quantum effects as well as phonon scattering at the boundaries. Based on the semiclassical transport model and the band structure model, the ZT of a properly doped B i nanowire oriented along the trigonal crystallographic direction, is expected to reach a value (1)

PAGE 21

8 nm21. However, it is difficult to study the thermoelectronic properties of Bi nanowires due to the difficulty in producing uniform nanowires at such small diameters a nd they are usually randomly dispersed either in solution or on a substrate. Furthermore, it has been known that the ZT values of both bismuth telluride and bismuth antimony alloys are much higher than bismuth alone22. Of particular interest is the Bi( 1 x)Sb( x) alloy, which in bulk form displays a diversity of electronic behavior23. Theoretical predictions indicate that the figure of merit is increased for both ntype and ptype Bi( 1 x )Sb( x ) nanowires at higher diameters at 77 K24 (Figure 1.3.) Table 1.2. sum marizes the thermoelectric figure of merit for several material alloys of interest at both the bulk and nanoscale. Figure 1.3. Contour plot of the optimal ZT values for ptype Bi( 1 x )Sb( x ) nanowires versus wire diameter and antimony concentration1

PAGE 22

9 Table 1.2. ZT Values of Materials Material Thermoelectric Figure of Merit ( ZT ) NANO PbTe PbSeTe 1.3 BULK PbTe PbSe 0.34 NANO Bi2Te3 Sb2Te3 2.4 BULK Bi2Te3 Sb2Te3 1.0 NANO BiSb 1.25 1.5 BULK BiSb 0.88 1.3. Motivation and Research Objective The potential of ideal electrical properties of 1D nanostructures has created a growth in research with the aim of electronic miniaturization. The implementation of the bottom up approach in manufacturing electronic devices is presumed to surpass the limitations imposed by more traditional top down methods. Miniaturization is one ongoing important development in both biosensor and thermoelectric technology It has already been reported that nanostructures can enhance the sensitivity of a biosensor by one to two orders of magnitude, due to the large surface area per unit volume ratio, which

PAGE 23

10 allows the immobilization of a larger amount of enzyme or other functional surface layer. The first objective of this research is to develop nanoelectrodes for the detection of lactic acid or Salmonella DNA. Due to the miniaturization of these biosensors, the goal is to push the sensitivity detection limits to be able to lower levels of analyte than what has currently been achieved in research. The second objective addressed in this dissertation is the development of small, on chip, solid state, active cooling devices for electronic systems that are needed in Nation al Security missions. Current sy s tems are bulky and do not integrate well into miniature electronic systems. The goal of this section of research is to develop a technique to produce Bi( 1 x )Sb( x ) nanowires for thermoelectric cooling at room temperature w ith high efficiencies, which can be grown directly on a silicon substrate. 1.4. Scope of the Dissertation This dissertation discusses various aspects of electrochemical treatment of one dimensional nanomaterials and their applications for biological se nsors as well as thermoelectric cooling devices. In particular, a comparative study of two members of the nano carbon family, carbon nanotubes and nanocrystalline diamond thin films, were selected as the electrode materials of choice for fabrication of biological sensors for the detection of lactic acid and Salmonella DNA. For on chip cooling, bismuth antimony nanowires were selected, due to their theoretically high thermoelectric figure of merit at nano dimensions. Chapter 1 begins with a brief overview of the selected nanomaterials: carbon nanotubes, nanocrystalline diamond thin films, and bismuth antimony nanowires. The

PAGE 24

11 mechanical, electrical, and thermal properties of the aforementioned materials are discussed, as well as why each is an ideal candidate for the particular chosen application. Chapter 2 presents an extensive literature review on the history and synthesis of one dimensional nanomaterials, with special attention to the methods used to fabricate the nanomateri als used in this research. A review of nanoscale biosensors as well as thermoelectric devices are included as background for the reader. Chapter 3 discusses the basic theory of the science of electrochemistry. Electrode kinetics as well as the Helmholtz diffusion layer are reviewed as well as a detailed examination of Electr ochemical Impedance Spectroscopy (EIS) and Cy c lic Voltammetry (CV ). Data interpretation, the equivalent circuit model, oxidation and reduction, and electrochemical based sensing are all topics highlighted in this chapter. Chapter 4 presents the materials, methods, and results of the functionalized carbon based materials for biological sensing. An approach towards the development of nanoscale electrodes is discussed, as well as electrochemical and fluorescence based detection methods. Several characterization methods are also presented for each electrode. Chapter 5 presents the materials, methods, and results of the development of bismuth antimony nanowires for nanoscale thermoele ctric devices. The Bi( 1 x )Sb( x ) nanowires were patterned in an anodized aluminum oxide template, and a n overview of the fabrication process of the template used for the nanowire growth is also presented

PAGE 25

12 This section concludes with some preliminary data o n the thermoelectric figure of merit for the nanowires. Finally, Chapter 6 concludes the dissertation with a summary of current investigations regarding this research. Some proposed suggestions for future work in this area are also stated.

PAGE 26

13 CHAPTER 2: BACKGROUND AND LITERATURE REVIEW In agreement with the bottom up approach, the control of nano building blocks is central for the realization of future electronic nanodevices. Several methodologies exist, including solution based and gas based growth. Size and shape control can be achieved with a template, which can be employed in quite a few different synthetic routes. In this section, we will discuss the primary growth techniques of 1D nanostructures as well as a few unique approaches and examine trends in the research and technology. 2.1. Template Directed Nanowire Synthesis A simple method for one dimension nanostructure synthesis employs the use of a template such as anodic aluminum oxide (AAO), nanochannel glass or porous polymer films. In this technique, the generated nanostructure has complimentary morphologies to that o f the template in which the template contains very small holes within the host material and these empty spaces are filled with a chosen material to form nanowires. 2.1.1. Template Synthesis The material properties of the template as well as characteristic s such as pore diameter, uniformity and pore density are important considerations for template directed synthesis. While difficult to achieve by photolithographic techniques, templates offer a high channel aspect ratio. OSullivan and Woods25 presented a model describing the

PAGE 27

14 anodization of aluminum films in acid. Under carefully chosen anodization conditions, the resulting oxide film possesses a close packed array of columnar cells, each containing a central pore of which the size and interval can be controlled by changing the forming conditions. The main driving force in the formation of the chann el in the anodic alumina is the electric field, which allows the continuous growth of the ordered channels regardless of crystal orientation. It is believed that the formation of a self ordered hexagonal pore array is due to the mechanical stress associat ed with the expansion of the aluminum during oxide formation.26 Masuda et al .27 reported a growth procedure which enabled longrange ordered channel array archi tecture on the millimeter scale Here, a nanoindentation technique wa s utilized to pretexture the aluminum by a mold of shallow concaves to initialize pore growth with high aspect ratios at the beginning stage of anodization. It has been found that obtaining anodic porous alumina via a two step molding process versus the conventi onal one step embedding process presents distinct advantages such as chemical and thermal stability and higher mechanical strength.28 In Masuda and Fukudas process, fabrication of the negative type of anodic porous alumina and subsequent formation of the positive type structure led to the formation of a porous material with a geometrical structure identical to that of anodic porous alumina. Other groups have modified this process to remove the oxide layer during the first anodization in an acidic soluti on followed by a second anodization under the same conditions.29 In this last step the aluminum film becomes the template for growing ordered pores. Two other materials that have received attention in this field are nanochannel glass and porous polymer films. Nanochannel glass (NCG), a matrix characterized by small, high density uniform channel arrays, has also been widely investigated as

PAGE 28

15 templates for nanowire growth.30, 31 NCG replica membranes are metal thin films which possess the same channel geometry as the underlying matrix. Tonucci et al.32 init ially confirmed that it is possible to use these membranes with channel diameters between 500 GaAs/AlGaAs quantum well by molecular beam epitaxy (MBE). Polymer templates offer good control over nanowire diameter and interwire s pacing.33 The templates can be constructed on any conducting surface and eliminate the need for removal of a barrier oxide layer. ThurnAlbrecht et al.34 created an array template from diblock copolymers of polystyrene and polymethylmethacrylate P(S bMMA). The diblock copolymer films were annealed above t he glass transition temperature between two electrodes, which caused the formation of a hexagonal array of channels perpendicular to the film surface. After removal of the PMMA, the resulting polystyrene film possessed pores with 14 nm diameter and densit ies in excess of 1.9 1011 pores/cm2. 2.1.2. Electrochemical Deposition Electroplating is an ancient science used to deposit a layer of metal on an object and recently has lent itself to the fabrication of nanostructured materials. The use of a template assisted method to deposit metal nanostructures has significantly increased in recent years. Structures that can be realized through this technique include nanowires [Bi35, Ag36 and ZnO37], tubes [carbon38 and Cu39], dots [Co40 and Au41], rods [Ga2O3Al2O3 42], composite [polyaniline/Bi2Te3 43 and Fe Ga alloys44] and superconducting materials [Sn45]. During electrochemical deposition, the template is attached to the cathode for electroplating. When an electric field is applied between the cathode and

PAGE 29

16 anode the cations are attracted to and reduce at the cathode, which results in nanowi re growth in the pores of the template. The length of the nanowires depends on the length of the porous channels, which can be controlled during the electroplating process. In 1996 Routkevitch et al.46 first produced semiconducting nanowires by electrochemical deposition in AAO templates. In this study, CdS nanowires were synthesized with diameters in the range of 9 Single step ac electrolysis was used to deposit CdS nanowires directly in the pores of AAO without the removal of the barrier oxide layer in an electrolyte containing Cd2+ and S in dimethylsulfoxide. Since rectification only occurs inside the pores and not at defects, no material is deposited in any cracks in the template. The CdS nanowires were found to have a preferential c axis crystal orientation along the length of the pores of the AAO template. 2.1.3. Pressure Injection In certain applications it is desirable to produce high crystalline nanowires with a preferred crystal orientation along the wire axis. In these instances, a high pressure injection (HPI) method is used to fabricate such nanowires from low melting point materials or templates w ith exceptionally high mechanical strength. In the HPI method, the nanowires are formed by pressure injecting the desired material in liquid form into the evacuated pores of the template. Due to the heating and the pressurization processes, the templates used for the pressure injection method must be chemically stable and be able to maintain their structural integrity at high temperatures and at high pressures. Huber et al.47 reported on the growth of 200 nm Bi Sb allow wire arrays by HPI of the metal into

PAGE 30

17 the pores of alumina templates. An external pressure is used to overcome the interfacial energy and to impregnate a nanochannel that does not usually wet with the molten metal. This pressure is given by the Washburn48 equation: d P / cos 4 where P is the external pressure needed to fill a channel of diameter is the surface tension of liquid, and is the contact angle between the liquid and the channel walls of the anodic alumina template. In this work it was assumed that = 180 so that for an applied pressure of 4 kbar all channels larger than 3.8 nm would be filled with liquid Bi. 2.1.4. Sol Gel Deposition Traditionally, the sol gel process has allowed the fabrication of a large variety of materials including ultra fine powders, monolithic ceramics and glasses, inorganic membranes, thin films and coatings of metal oxides and recently has evolved into a useful approach for synthesizing one dimensional nanostructure arrays with good crystal line properties. The sol gel process involves the transition of a system of colloidal particles (the sol) into a solid phase (the gel). The foundation of this technique is the hydrolysis of a solution of precursor molecules to obtain a suspension of coll oidal particles and then condensation of such particles to yield a new gel phase. The main advantages of sol gel techniques over conventional synthesis procedures include low temperature of processing, versatility, and easy chemical doping. Several metal oxide nanowires including LiCoO2 4 9, LiMnO2 50, LiNiO3 51, and TiO2 52 have been successfully synthesized via the sol gel process. Precursors for metal (2)

PAGE 31

18 oxide nanostructures are molecules already processing metal oxide bonds such as alkoxides or oxoalkoxides. Cheng and Samulski53 were the first to use the sol gel alumina templating method for the fabrication of In2O3 and Ga2O3 nanotubes. A porous alumina membrane was used as a template by immersing it in a sol of In3+ or Ga3+ and approximately the same as the thickness of the template and the outer diameter was 200 nm, the template pore size Here, the tubes appear to be coagulated due to the solvent surface tension in the template dissolution step. Cubic zirconia nanowire arrays have also been produced using the sol gel template method with a zirconyl chloride pre cursor54. The formation mechanism was caused by the positively charged sol particles being attracted to the negatively charged pore walls of the template. 2.2. Vapor Phase Growth Vapor phase growth is a considerably popular and extens ively used mechanism for the synthesis of one dimensional nanostructures such as nanowires, belts and whiskers. Control of the supersaturation level determines the structural growth morphology. Among the vapor phase growth methods which will be discussed in detail include vapor liquid solid (VLS) and vapor solid (VS) growth. 2.2.1. Vapor Liquid Solid Mechanism The VLS method for nanowire growth has been widely successful. In 1964, Wagner and Ellis described this mechanism for the growth of silicon whiskers.55 In this case, a liquid gold particle is deposited on the surface of a Si wafer and heated, forming

PAGE 32

19 an Au Si alloy. This liquid alloy/solid interface promotes the anisotropic crystal growth. The liquid becomes supersaturated with Si and as it precipitates out the whiskers are formed. Generally, 1D growth is induced by the dissolution of gaseous reactants into liquid droplets of a catalyst material, followed by nucleation and growth of single crystalline nanostructures. The primary steps in a typical VLS growth process (metal alloying, crystal nucleation and axial growth) are shown schematically ( Figure 2.1.). It is shown that the metal liquid alloy forms at the eutectoid temperature. Wu and Yang56 reported the first real time in situ TEM growth studies of Ge and Si nanowires. Nanowire nucleation begins once the liquid droplet is supersaturated with Ge, usually at about 50 60 wt% Ge. Once nucleation begins, further dissolution of Ge vapor increases the amount of Ge precipitation fr om the alloy. These experiments also determined that there is a direct linear relationship with respect to the initial catalyst particle size and the final nanowire diameter. Gudiksen and Lieber confirmed the correlation by showing that selective size di ameter GaP nanowires can be synthesized by controlling the diameter of gold catalyst nanoparticles.57 Figure 2.1. The VLS growth process (adapted)56

PAGE 33

20 In the past 5 years, the VLS method has become widely used for the generation of 1D inorganic nanostructures, including oxides [ZnO, SnO2, ITO, MgO]58 61, IIIV semiconductors [GaN, GaAs, InAs, InP]62 65, IIVI semiconductors [ZnS, ZnSe, CdS, CdSe]66 69 and recently CdS/Si coaxial nanowires.70 These new CdS/Si nanowires possessed a crystalline CdS core and a Si sheath. They were prepared with an Au catalyst and had average diameters of 100 nm and lengths up to a few hundred microns. In 2004 Wu et al.71 reported on molecular size silicon nanowires grown by VLS mechanism. The silicon nanowires were grown with silane and hydrogen as a carrier gas and exhibited little or no amorphous oxide layer down to 3 nm diameter due to passivation of the growth surface with H2. The authors also report that the SiNWs demonstrate a clear preference for growth along the <110> direction in the smallest (3 10 nm) nanowires and along the <111> direction in larger (20 30 nm) nanowires. Further study indicates that surface energy plays an important role in the VLS growth mechanism of these SiNWs. Other vapor liquid solid mechanisms include pulsed laser deposition (PLD), chemical vapor deposition (CVD), metal organic chemical vapor deposition (MOCVD) and physical vapor deposition (PVD). In general, PLD includes a laser beam which strikes a target while inside a vacuum chamber. A bit of the target material is vaporized and sub sequentially deposited on a substrate that is facing the target. Morales and Li eber72have reported an approach to the synthesis of singl e crystal nanowires that exploits laser ablation to prepare nanometer diameter catalyst clusters that subsequently define the size of wires produced by a VLS mechanism. The catalysts were prepared by a pulsed, frequency doubled Ndyttriumaluminum garnet laser that was used to ablate

PAGE 34

21 the targets that contain the element desired in the nanowire and the metal catalyst component. Chemical vapor deposition (CVD) is a form of VLS with nanoscale metal catalysts. In the simplest form, this type of system involv es a catalyst which is heated to high temperatures in a vacuum furnace while chemical precursors in gaseous form flow through the tube reactor for a period of time Materials grown over the catalyst are collected upon cooling the system down to room tempe rature (Figure 2.2.) Recently, MOCVD has been utilized to grow catalyst free ZnO nanowires directly on a Si substrate73, 74. A typical ZnO nanostructure growth process occurs in a low pressure chamber with highpurity diethyl zinc (DEZn) and N2O as the zinc and oxygen sources, respectively, and nitrogen as the carrier gas. ZnO nanostructures can be grown via a twostep process, wherein the first step produces a thin nucleation layer of ZnO which is then annealed and the nanostructures are grown on this nucleation site. The PVD process can be used to deposit nanowires and other structures onto a substrate by physical means, unlike a chemical deposition process. Wu and Tao75 have reported on cubic and hexagonal CdS nanowires grown by PVD of CdS powders. These powders were placed in an alumina boat and heated in a horizontal furnace with Ar gas flow. The nanowires were about 100 nm in diameter and up to 10 microns long. Figure 2.2. Schematic of a CVD process76

PAGE 35

22 2.2.2. Carbothermal Growth Nanowires of metal oxides in particular have been shown to grow favorably with the use of carbon during synthesis. This te chnique details the heating of a metal oxide in the presence of carbon to produce a metal suboxide nanowire. Al2O3 nanowires and nanotubes were synthesized via such a procedure involving the use of a mixture of Al and graphite or active carbon powders77. In this method a finely ground mixture of Al with (a) graphite powder or (b) activated carbon were placed in a zirconia boat and heated under argon gas flow. The result produced white wood like structures from (a) and fine gray structures from (b). The procedure that produced the Al2O3 nanostructures can be understood based on the following vapor solid mechanism reactions: ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) (3 2 2 2s O Al g O v AlO g CO v AlO g O s C s Alx x Lin and Lin78 have recently shown that the growth of SiONWs via the carbothermal reduction of metal oxides is a viable production mechanism. Here powders of CuO and graphite were mixed and placed in an alumina boat and the oxide was removed. The substrates were then placed 2 mm above the CuO/C mixed powders in the furnace. The SiONWs grew without the presence of a catalyst under Ar gas flow and at elevated temperatures of 1000 1100 C. TEM analysis proved the nanowires were amorphous and free from Cu. The reactions for this case are as follows: (3) (4)

PAGE 36

23 ) ( 2 1 ) ( ) ( ) ( ) ( ) ( ) ( 2 22 2 2 2s SiO O g SiO g CO g SiO s Si g CO g CO C C CuO 2.2.3. Vapor Solid Growth Vapor solid growth has been used extensively to produce nanostructures, including oxide nanowires in particular. In a typical VS process, the vapor species is generated by evaporation, reduction, or other gaseous reactions. These species are then condensed onto the surface of a solid substrate in a temperature zone lower than that of the source material. 1D growth will proceed without t he need of a metal nanoparticle catalyst if the supersaturation is kept at a controlled, low level. 2.2.4. Oxide A ssisted Growth Lee et al.79 presented an oxide assisted growth mechanism for the synthesis of silica nanowires. Silica nanoparticles acted as nucleation catalysts as well as provided oxygen and sil icon for the SiO NW growth. A graphitic carbon layer formed around the catalytic nanoparticles and the silica nanowires nucleated from this site, indicative of the VS growth mechanism. The Fe films act as a catalyst decomposing CH4 gas into carbon and hydrogen atoms. 2.3. Solution Based Growth An alternative to chemical based methods is solution based growth of 1D nanost ructures. The primary advantage of solution based methods as opposed to the (5) (6) (7)

PAGE 37

24 vapor phase option is the ability to perform the growth at lower temperatures on a wide variety of substrates. Another advantage is the ability to control the size and shape of t he nanostructure, which can often be controlled by solutionliquid solid (SLS), solvothermal, and hydrothermal growth mechanisms. 2.3.1. Solution Liquid Solid Methods Buhro and coworkers80, 81 developed a SLS growth process that is similar to the VLS process for production of crystalline III V semi conductors (InP, InAs, GaAs) They determined that the distinguishing features of SLS growth are a solution dispersion of small liquid flux droplets, a solution phase that feeds the elements of the crystal phase into the flux drople ts, and pseudoone dimensional growth of the crystal phase from the flux droplets after supersaturation is achieved. During SLS the precursors are delivered and react in the solution rather than the vapor phase. A simple method for crystallizing the III V compounds utilizes metal catalysts (i.e. Bi, Sn, In) with the desired nanomaterial produced by organometallic reactions at low temperatures in hydrocarbon solvents. The products had small crystal dimensions with whisker morphologies. The organometallic reactions are similar to those that take place during typical organic metal chemical vapor deposition (OMPVD) at higher temperatures. The SLS method was modified by Holmes and coworkers82 to a supercritical fluid liquid solid (SFLS) approach f or Si nanowires growth. The ability to precisely self assemble Si nanowires in solution was achieved by using solvent dispersed, size monodispersed, alkanethiol capped gold (Au) nanocrystals to direct the nanowire growth with narrow wire diameter distribu tions. In this procedure, the sterically stabilized Au

PAGE 38

25 nanocrystals and a Si precursor, diphenylsilane, were co dispersed in hexane that was heated at high temperatures where the diphenylsilane was able to decompose to form Si atoms. The Si Au phase diag ram indicates that Si and Au can form an alloy phase in equilibrium with pure solid Si when the Si concentration with respect to Au is greater than 18.6 mol% and the temperature is above 363 C. Under these reaction conditions, the Si atoms dissolved into sterically stabilized Au nanocrystals until supersaturation, at which point they were then expelled from the particle as a thin Si nanowire. The produced nanowires had highly crystalline cores, aspect ratios greater than 100, and tunable crystallographic orientation. 2.3.2. Hydrothermal and Solvothermal Methods Hydrothermal and solvothermal synthesis mechanisms can provide precise control over nanoscale morphologies by varying the parameters of the system. Both methods produce nanowires at low temperatu res when compared to vapor phase methods. One of the primary advantages of hydrothermal methods is that it simply uses water as the solvent. ZnO nanowires grown on nanostructured thin film via a hydrothermal route was first demonstrated by Vayssieres83. The synthesis was c onducted on a nanostructured ZnO film by the thermal decomposition of a ZnII anime complex in an aqueous solution of zinc nitrate and methenamine (HMT) heated at 95 C for several hours. The resulting single crystalline hexagonal nanorods were about 10 20 nm in diameter and up to 10 microns long. Sun et al.84 has since demonstrated growth of high density arrays of ZnO nanowires on a PLD ZnO coated thin film. Gao et al.85 demonstrated a facile route to synthesize MnO2 nanowires by hydrothermal treatment of KMnO4 and NH4Cl. A

PAGE 39

26 typical procedure involved mixing 1 mmol each of the previously mentioned compounds i n distilled water and placing the solution in an autoclave maintained at 140 C for 24 hr. In this procedure K+ and Clexisted in the solution the entire time while NH4 + and MnO4 were consumed completely by the end of the reaction. More research is still needed to completely understand the role Clplays in the structure formation. The MnO2 nanowires had diameters of 10 30 nm and lengths up to 6 10 microns. Considerable progress has been made in the area of hydrothermal synthesis of other one dimensional nanostructures, including ZnS86 and TiO87. Similar to the hydrothermal mechanism, the solvothermal method utilizes organic solvents instead of water. This solvent is main tained at relatively high pressures and temperatures above its critical point in order to increase the solubility of the solid and to speed up reactions between solids. In a typical solvothermal process, such a solvent is mixed with metal precursors and c rystal growth regulating or templating agents, such as amines. This solution mixture is placed in an autoclave kept at high temperatures and pressures to allow the reaction to proceed and to carry out the nanowire growth. The solvothermal mechanism is app ropriate for most types of solid materials due to the advantage that most materials can be made soluble in a specific solvent under proper heating and pressurizing of the solution. Heath and LeGoues88 first used this method to synthesize germanium nanowires with high aspect ratios by reducing a mixture of GeCl4 and phenyl GeCl3 at high temperature and high pressure. Qingqing and coworkers89 have reported a simple, reproducible, nontoxic solvothermal method to produce CeS nanowires which does not require any solid templates or complicated surfactants and can be used to synthesize other sulfide nanostructures. In this process CdCl2 and S were mixed in an

PAGE 40

27 organic solvent and placed in an autoclave at 200 C for 12 hr. After cooling the resulting nanostructures were filtered off and characterized. The CdS nanowires grew along the c axis because the <001> faces have the fasted growing rate due to the closed packing factor. X ray diffraction (XRD) and TEM verified that the CdS n anowires are hexagonal in structure and have diameters of 40 nm and lengths up to 10 microns. The solvothermal process can also be used to produce a variety of nonoxides. Solvothermal based growth for III V semiconducting nanostructures provides the advantage of a simple growth process that does not require extreme environment conditions without the use of organometallic or toxic precursors nor the need for post treatment at elevated temperatures for crystallization to occu r. Qian and coworkers90 92 have demonstrated the solvothermal method for the preparation of nanocrystalline III V semiconductors InP, GaN, and InAs. The following liquidsolid reactions take place in the autoclave for each respective III V semiconducting nanostructure: 2 3 3 3 3 3 33 3 3 3 ZnCl InAs Zn AsCl InCl LiCl GaN N Li GaCl NaCl InP P Na InCl The solve nt used in a typical solvothermal growth mechanism is chosen due to its specific ability to dissolve the desired compound. In the case of nanocrystalline InP, 1,2dimethoxyethane (DME) was used as the solvent to dissolve InCl3 in an autoclave at 180 C fo r 12 hr. The resulting InP nanostructures were about 12 nm in diameter and spherical in shape. Benzene was selected as the solvent for GaCl3 and Li3N and the (8) (9) (10)

PAGE 41

28 solution was autoclaved at 280 C for 12 hr. From reaction ( 9) above, hexagonal GaN nanoc rystal lites were formed. Last InCl3, AsCl3 and Zn powders were dissolved in xylene and positioned in an autoclave at 150 C for 48 hr. InAs nanostructures with particle size about 15 nm were produced via this simultaneous coreduction route. XRD verified tha t there was no presence of indium oxide nor arsenic oxide. Recently, Wang et al.93 reported that the size and shape of CdSe and CdTe nanocrystals posses a direct relationship with the initial precursor concentration during solvothermal based growth. It was found that at lower initial monomer concentrations, dot shaped nanoc rystals were only obtained with relatively narrow size distribution, while higher initial monomer concentrations could give rise to elongated nanocrystals and their increase resulted in the increase in quantity of the multi armed rods. The simplicity and convenience of the solvothermal route lends the procedure to generate a wide variety of one dimensional nanostructures while the low cost involved is promising for practical industry production. 2.3.3. Anisotropic 1D Nanostructures Shape control of nanostr uctures can be achieved by manipulation of the growth kinetics. Peng and coworkers94 demonstrated that the growth of CdSe nanocrystals with the wurtzite structure is highly anisotropic when the system is kinetically overdriven by an extremely high monomer concentration. The intrinsically anisotropic structure of wurtzite CdSe, with a unique c axis is enhanced when the overall growth rate is fast and is generally faster along this preferred axis. Furthermore, Gates and coworkers95, 96 displayed that trigonal nanowires of Se ( t Se) were synthesized based on anisotropic

PAGE 42

29 growth of single crystalline Se seeds in solution. The seeds were generated in situ through t he solutionsolid phase reaction: O H N Se aq H N aq SeO H2 2 4 2 3 23 ) ( ) ( After the addition of selenious acid, a brick color formed in the solution indicative of aSe spherical colloids. Upon cooling, small amounts of Se dissolved in the solution precipitated out, forming nanocrystallite t Se. In the new mixture of colloids of aSe and nanocrystallites of t Se, the colloids of aSe would slowly dissolve into the solution due to their higher free energies as compared to the seeds of t Se. This dissolved selenium subsequently grew as crystalline nanowires on the seeds. The produced pure Se nanowires possessed uniform diameters as small as 10 nm and lengths up to hundreds of microns. 2.4. Other Useful Growth Approaches There are several potentially useful approaches to one dimensional nanostructure synthesis that need to be further investigated before becoming an economical tool for large scale growth. These mechanisms are promising methods for precise control of a wide range of morphologies of crystalline nanomaterials. S everal demonstrations of the novel template method has been shown to produce 1D nanowires and will be discussed further. A positive template method has the advantage that nanowire diameters are not restricted by the size of the template; rather, the diame ters are controlled by the amount of metal deposited. By removing the templates after deposition nanostructures can be revealed. Braun and coworkers97 first constructed a DNA based positive template to (11)

PAGE 43

30 serve as a scaffold for th e growth of a silver nanowire. The first step in their procedure was the self assembly of DNA between two gold electrodes microns apart. DNA bridged the electrode pair. Afte r DNA hybridization silver metal was deposited along the DNA molecule. The formation of complexes between the silver and the DNA bases as well as the Ag+ / Na+ ion exchange contributed to selective localization of Ag+ ions along the DNA. The resulting si pinnacle study provided a step towards the development of a DNA template based on a self assembly process that can be exploited for metal nanowire synthesis to be utilized in electronic device appl ications. Following this approach, Richter and coworkers98 were able to develop a DNA template for metallic nanowires which displayed ohmic transport behavior. The metallization of DNA templates also presents new opportunities for applications that require high temperatures that untreated DNA could not withstand. Instead of using anodic aluminum oxide or polymeric templates for nanowire growth, carbon nano tube or fiber based templates are also feasible. CNT and CNF templates have been used for the synthesis of metal99 100, metal oxide101, 102, nitride103, phosphide104, and carbide105 nanostructures. Wu and coworkers106 have filled the hollow cores of CNTs with ZnO nanowires with diameters 20 40 nm and lengths 250 1000 nm. The CNT templates were first treated with acid and then stirred in a saturated zinc nitrate solution for 48 hrs. Once filtered and dried the as prepared samples were underwent calcination in argon at 500 C for 6 hr. The final step was a heat treatment in air to remove the CNT template. Unlike the previous technique, metal nanotubes can be patterned around the outer diameter of carbon nanofibers. Recently Xie and

PAGE 44

31 coworkers107 have shown metal nanowire growth on carbon nanofiber templates via electroless deposition. The CNFs were prepared by a typical CVD route, treated, and the suspended in a solution of sodium dodecyl sulfate (SDS). They were then sensitized and activated before deposi tion. For Ni P electroless deposition, the CNFs were placed in a solution containing nickel sulfate, sodium hypophosphite as reducing agent, sodium acetate and lactic acid as a stabilizer. The coated nanofibers were annealed to remove the template and th en heated under hydrogen flow to remove any oxide layer, resulting in hollow Ni P nanotubules. The advantage of this method is nanoscale size manipulation: inner diameter of the nanotubes can be precisely controlled by the diameter of the nanowire templat e while the outer diameters can be controlled by the deposition time. One novel approach to the development of 1D nanostructures is the use of a virus based template. Mao et al.108 designed such a scaffold for a diversity of single crystalline nanomaterials. The incorporation of substrate specific peptides that exhibited control of si ze, composition, and phase during nanoparticle nucleation on a bacteriophage template promoted directional growth of semiconducting and magnetic materials. The workers introduced a wide variety of materials (II VI semiconductors as well as ferromagnetic a lloys) to demonstrate the universality of the virus template as opposed to more classical growth mechanisms. 2.5. Chemical and Biological Sensing Applications One dimensional nanostructured chemical and biological sensors are an attractive, versatile application for several reasons. Nanowire sensing probes possess extremely sensitive electrical properties due to their high surface to volume ratio. Nanoscale

PAGE 45

32 se nsors are also smaller, require less power and detect analytes faster than their macroscale counterparts. Sensors based on one dimensional nanostructures are being devel oped for lab ona chip devices, for the detection of analytes ranging from those used for biological warfare to indicators of human diseases. Nanowire chemical sensors operate based on the absorption of analyte molecules, which consequently affects the conductance of the nanosensor. One major fallback that remains is in making nanoscale sensors more selective so that they can differentiate between analytes in complex solutions. Besteman et al.109 opened the door for biomolecular diagnostics via 1D nanostructure sensors by demonstrating the first biosensor based on single walled carbon nanotubes. Controlled immobilization of the enzyme glucose oxidase (GOX) on the SWNTs indicated a clear decrease in the conductance of the tube, which can be attributed to a change in the total capacitance of the tube. A typical experiment involves the immobilization of GOX via a linking molecule which binds through van der Waals coupling with a pyrene group on one side and on the other side covalently binds the enz yme through an amide bond. Changes of conductance of the GOX coated semiconducting SWNTs upon addition of glucose indicated that an enzyme activity sensor can be constructed at the single molecule level of an individual SWNT. Cui et al.110 modified Si nanowires with amine and oxide groups to create highly sensitive c hemical and biological sensors. For the construction of a pH sensor, a Si NW was functionalized by modification of the silicon oxide NW surface with 3 aminopropyltriethoxysilane (APTES). Variations in the pH of the solution into which the nanowire was im mersed caused protonation and deprotonation of the NH2 and SiOH groups on the surface of the nanowire, where changes of the surface

PAGE 46

33 charge would chemically gate the nanowire. At low pH, the NH2 is protonated to NH3 + and behaves as a positive gate which decreases the conductance, while at high pH the SiOH is deprotonated to SiO-, which would correspond to an increase in conductance. The SiNWs displayed a linear response for pH 2 9, which suggests that they are capable as nanoscale sensors. Similarl y, biotin modified nanowires demonstrated high sensitivity (down to 10 pM) towards streptavidin. The concept of using nanowires as FETs can be extended in many directions; for example, monitoring several protein expressions for medical diagnostics with an array of nanowires each functionalized separately to detect a specific analyte. 2.6. Conclusions Table 2.1. summarizes different methods to grow nanostructures and the diameter obtained. Due to their small size and high surface area, these structures can be implemented into microelectronic, thermoelectronic or biosensing devices. Finally, in spite of the significant amount of research being carried in the area of one dimension nanostructures, there is still a long way to the commercial use of ODNS becaus e of scaling up the production and retaining the properties during mass production. Especially in biological applications, toxicity and biocompa tibility are major issues. To date there is no practical device available using 1 D nanostructures but hopes a re still high for the development of significant practical devices from the integration of these structures with conventional microand nanoelectronics.

PAGE 47

34 Table 2.1. Various growth techniques and corresponding nanowire diameter Nanowire/ Nanorods Growth Process Source Diameter (nm) Application CdS Electrochemical deposition in AAO templates CdCl 2 elemental sulfur 9 35 In 2 O 3 and Ga2O3 Sol gel deposition in AAO templates Indium nitrate, gallium nitratehydrate 200 Gas s ensor, Opto elect onics Si CVD SiH 4 3 10 N ano devices Zn 2 SnO 4 VLS ZnO, SnO 2 100 Opto electronics MoO 3 H ydrothermal synthesis MoO 3 H 2 O, tetradecylamine 50 150 Gas s ensor GaN Magnatron sputtering Ti, Ga 2 O 3 50 100 ZnO Thermal evaporation Zn Powder 50 Opto electronic devices ZnO Solution route Zn[CH 3 COOH] 2.2H2O, DBS 95 Gas s ensor MnO 2 Sol gel KMnO 4 Fumaric acid 100 Li ion battery LiV 3 O 8 Hydrothermal method CH 3 COOLi.2H 2O, NH4VO3 150 Li ion battery

PAGE 48

35 Table 2.1. (Continued) MnV 2 O 6 Hydrothermal method Mn[CH 3 COO] 2.4H2O, H2O2, V2O5 20 30 Li ion battery SnO 2 Hydrothermal method SnCl 4 NaOH 4 15 Gas s ensor

PAGE 49

36 CHAPTER 3: ELECTROCHEMISTRY THEORY 3.1. Introduction A branch of chemistry, electrochemistry studies chemical reactions which take place in a solution. These reactions take place at the interface between an electrode and an electrolyte and involve the electron transfer between the two. The history of this branch of science dates back to the late 1700s when the Italian physician Luigi Galvani proposed a nervo electrical substance in animal tissue which is responsible for the contraction on muscles when exposed to an electrical current. From these experiments, the study of electro chemistry took birth and the elect rolysis of water atoms as well as the electroplating of metals were discovered soon afterwards. Electrochemistry is responsible for batteries, photovoltaics, metal plating, chemical and biological sensors, and corrosion technology. 3.2. Re duction Oxidation Reactions Reduction oxidation (redox) reactions are chemical reactions where atoms have their oxidation number changed. In short, oxidation refers to the loss of electrons or an increase in oxidation state and reduction refers to the gain of electrons, or a decre ase in oxidation state. Each reaction by itself is called a half reaction because two half reactions are needed to form a complete reaction. The oxidation number is typically defined as an effective charge of an atom in a compound. Chemists use a set of rules to

PAGE 50

37 determine the oxidation number of compounds: (1) For atoms in their elemental form, the oxidation number is 0, (2) F or ions, the oxidation number is equal to their charge (3) For single hydrogen, the number is usually +1 but in some cases it i s 1 (4) For oxygen, the number is usually 2 and ( 5) The su m of the oxidation number of all the atoms in the molecule or ion is equal to its total charge For example, consider the case of anodization of aluminum metal to form aluminum oxide. The two ha lf reactions are as follows: Al ( s ) Al3 ( s ) 3 eO2( g ) 4 e 2 O2( s ) Combining these two half reactions and balancing the electrons on both sides, the final redox reaction is: 4 Al ( s ) 3 O2( g ) 2 Al2O3( s ) 3.3. Electrochemistry Impedance Spectroscopy The theory of Electrochemical Impedance Spectroscopy (EIS) and its data interpretation through Nyquist and Bode plots is discussed in this section. EIS is a non destructive material characterization technique and is advantageous over other characterizat ion techniques due to it being economical ly favorable, simplistic, portable, automated, provides time dependent data and can operate in harsh environments. Impedance spectroscopy is useful in providing data relating to real world individual components in the system of question. Equivalent circuits are used to model impedance data and are constructed from simple circuit elements such as resistors, capacitors and inductors to understand the electrochemical behavior of a particular system. (12) (13) (14)

PAGE 51

38 During an impedimetric measurement, a frequency response analyzer is used to impose an alternating current (AC) sinusoidal signal across a sample and the result ing current and voltage response is measured. When this method is applied over a broad range of frequenci es, the impedance spectrum is obtained and can be used to identify and quantify processes occurring within the electrochemical system. Impedance is typically defined as the opposition to AC flow in a complex system. If a system is purely resistiv e, then this value is simply resistance, represented by an ideal resistor. However, very few real world systems are ideal and most exhibit complex behavior. Ohms law, as follows: R V I where V = voltage (V), R = resistance ( ), and I = current (A) o nly applies for non complex systems. A modified version of Ohms law is used to determine the impedance of a complex system: Z V ( t ) I ( t ) V0cos(t ) I0cos(t ) Z0cos(t ) cos(t ) where Z = impedance, t = time (s), = radial frequency (radians/s), and = phase shift. The impedance can be represented as a complex number: Z V I Z0exp( j) Z0(cos j sin) This equation can be expressed with a Nyquist plot, where the real part of the impedance can be plotted on the x axis and the imaginary part on the y axis. Each point on the Nyquist plot is the imp edance at a particular frequency, with low frequency data (15) (16) (17)

PAGE 52

39 occurring on the right side and high frequency data occurring on the left side. Note that the impedance can be represented as a vector of length |Z| and the angle between the impedance vector and t he x axis is the phase shift (Figure 3.1.) Figure 3.1. Typical Nyquist plot 3.3.1. Electrode Kinetics The different rates of electron transfer can give rise to different electrochemical impedance behavior. Electrical energy can be supplied to a system by the application of a voltage to the electrode. This applied voltage may alter the Fermi level of a metal, making it favorable to reduce or oxidize a species in a solution. In an electrochemical reaction, there are various ways in which a material may move within the solution. This

PAGE 53

40 type of kinetics is called mass transport and is typically divided into three subjects: diffusion, convection, and migration. Movement of ionic species in and out of the electrode/solution interface is also limited by the above mentioned mass transport issues. Diffusion, driven by a concentration gradient, arises from uneven concentrations of species. Diffusion is particularly important in an electrochemical reaction because the reaction only takes place at the electrod e surface. The concentration of the reactant will be lower at the electrode surface than in the bulk solution. Similarly, a higher concentration of the product will be found near the electrode surface than in the bulk solution. In practice diffusion is usually the most significant mass transport issue for most electrochemical reactions. Convection is the movement of molecules within fluids and is the result of a force on the solution. This force may exist in the form of gravity, a pump, gas flow, etc. Natural convection occurs in all liquids and is the result of very small thermal or d ensity differences within the solution. Forced convection may be introduced into a liquid in order to surpass any effects of natural convection. In electrochemistry, t echniques exist such as the use of a rotating disk electrode to introduce forced convection in a systematic manner. A rotating disk electrode will create a laminar flow profile. More details on rotating disk electrode studies are discussed in Chapter 5. Finally, the third mass transport issue is migration. Migration occurs from the application of a voltage on electrode surfaces and creates a charged interface. Most electrochemical measurements are performed in a background electrolyte (typically a sal t solution such as KCl ) in order to help protect a species from being attracted or repelled

PAGE 54

41 by electrostatic forces. The background electrolyte also increases the conduction of the solution. 3.3.2. The Electrical Double Layer Figure 3.2. illustrates the electrical double layer of a charged surface when placed in a liquid. The solution is composed of the Inner Helmholtz Plane, Outer Helmholtz plane, and diffuse layer. Figure 3 .2. The electrical double layer As seen in the figure, the Inner Helmholtz Plane is the layer closest to the electrode that may molecules specifically absorbed onto the electrode surface. The Outer Helmholtz Plane contains solvated ions, which are nonspecifically absorbed. The diffuse layer constitutes solvent molecules as well as solvated ions in distribution. The characteristic thickness of the double layer is the Debye length, which is reciprocally proportional to the squar e root of the ion concentration:

PAGE 55

42 where I = ionic strength of the electrolyte (mole/m30 r = dielectric constant, = Boltzman constant, T = temperature (K), NA = Avogadro number, and e = elementary charge. Most of the voltage drop across the electrode electrolyte interface occurs in the electrical double layer. 3.3.3. The Equivalent Circuit Equivalent circuit modeling of electrochemical impedance spectroscopy data is very useful because this technique allows scientists to extract physically meaningful information from modeling the data in terms of ideal electrical circuits composed of resistors (R), capacitors, (C), and inductors, (L). For example, most equivalent circuit models c ontain a resistor that represents the electrochemical cells solution resistance. Resistors are also used to represent the resistance to charge transfer at the electrode surface. The electrical double layer is characterized by capacitors and inductors which represent space charge polarization regions. In certain instances real world systems do not behave ideally, so we also use specialized circuit components such as the constant phase element (CPE) and the Warburg element (Zw). The Warburg element is used to represent the diffusion or mass transport impedance of the cell. Table 3.1. lists common circuit elements, their current versus voltage relationship, and their impedance. (18)

PAGE 56

43 Table 3.1. Simple e lectrical c ircuit e lements COMPONENT RELATIONSHIP I MPEDANCE Resistor V = IR Z R = R Capacitor Inductor Often when a capacitor does not behave ideally in an EIS experiment, it acts as a constant phase element. This is usually the case for the electrical double layer capacitance. It is seen in the previous table that an ideal capacitance has an impedance repres ented by f is the angular frequency f = frequency (Hertz), and C = capacitance. The impedance of a constant phase element takes a form of this equation: where Y0 is a constant equal to the ideal capacitance, n is a parameter (0 < n< 1, n = 1 for Sometimes, it is more convenient to characterize a n electrochemical cell in terms of admittance rather than in terms of impedance. Admittance is the measure of how (19)

PAGE 57

44 easily a circuit will allow current to flow and is mathematically represented as the inverse of impedance. For a constant phase element, the admittance is as follows: where Y0 is t he magnitude of the real part of the CPE and n is a parameter ( n = 1 for ideal behavior). Other than the constant phase element, there are several physical properties that can be represented by equivalent circuit elements The solution resistance of th e electrolyte is a function of ionic concentration and the geometry of the electrode area. This value is calculated from the experimental data. In general, solution resistance is defined as: l is the length carrying a uniform current, and A is the electrode area. The double layer capacitance is a function of electrode potential, ionic concentration, oxide layers, surface roughness, impurities on the electrode surface, temperature, and other fa ctors. As ions stick to the electrode surface, the double layer is formed. Polarization resistance is formed with an electrode is polarized. This happens when a potential is applied to an electrode that is different than its open circuit potential. Pol arization resistance is modeled using a simple resistor. In many electrochemical reactions, a current density must be supplied that is large enough to overcome the charge transfer resistance. The equation for charge transfer resistance is: (20) (21)

PAGE 58

45 where i0 = current density, R is the gas constant, T = temperature (K), n = number of electrons, and F = Faradays constant. The Warburg impedance is related to impedance caused by diffusion and is frequency dependent. The equation for inf inite Warburg impedance is: 3.3.4. Impedance Data Interpretation Nyquist and Bode plots are used to represent EIS data. Nyquist plots are drawn in the complex plane and show the imaginary impedance versus the real impedance of the electrochemical cell. Nyqu i st plots often contain one or more semicircles and it is the shape of this arc that provides information into the physical characteristics of the analyzed system. The primary disadvantage to the Nyquist plot is that the fr equency dependence is implicit. On the other hand, Bode plots explicitly illustrate the frequency dependence of the impedance. Bode plots demonstrate the magnitude of the impedance and the phase angle as a function of frequency. Figure 3.3. is an ex ample of a Nyquist and Bode plot for a typical Randles circuit, which is one of the simplest cell models It contains a solution resistance, a double layer capacitor, and a charge transfer resistance. The solution resistance is determined by the x axis i ntercept at the left hand side (high frequency side) of the semicircle. The diameter of the semicircle is the polarization resistance. The equivalent circuit model for the Randles cell is shown in Figure 3.4. (22) (23)

PAGE 59

46 Figure 3.3. Nyquist and Bode plots for a typical Randles cell

PAGE 60

47 Figure 3.4. Equivalent circuit for a typical Randles cell 3.4. Cyclic Voltammetry Cyclic voltammetry (CV) is a type of electrochemical measurement where the potential of the working electrode is ramped in a linear fashion versus time. After the end potential is reached, the potential is inverted. In a cyclic voltammogram, the current at the working electrode is plotted versus the applied potential. Depending on the analysis needed, one full cycle or a series of cycles is perfor med. The reduction or oxidation at the surface of the working electrode at a particular applied potential, results in mass transport of material to the electrode surface. The analytical advantages of cyclic voltammetry include a wide dynamic range, extreme sensitivity to low concentrations of ionic species, ease of use, and is a nondestructive method for characterizing electron transfer mechanisms. Figure 3.5. is an example of a cyclic voltammogram of 0.5 mM potassium ferri cyanide in 0.5 M KCl supporti ng electrolyte with a polished glassy carbon working electrode at a scan rate of 100 mV/sec. Notice that the current increases as the

PAGE 61

48 potential reaches the reduction potential and then decreases as the concentration of ions is depleted close to the electr ode surface. Also, the oxidation peak (Epc) and reduction peak ( Epa) have a similar shape and current density magnitude, indicating that the reaction is nearly ideally reversible, meaning that the product is reoxidized from the first reduction reaction. Reversible redox couples will display a ratio of peak currents at oxidation and reduction that is nearly unity (ipa/ipc = 1) Figure 3.5. CV of 0.5 mM [Fe(CN)6]3 /4 E pa i pa i pc E pc

PAGE 62

49 3.4.1. The Electrochemical Cell The experimental setup for electrochemical measurements takes place in what is referred to as the electrochemical cell. A three electrode system is usually used and is composed of (1) the working electrode, (2) the auxiliary (counter) electrode, and (3) the reference el ectrode. The working electrode is where the process to be studied occurs and the auxiliary electrode is needed to complete the circuit in which one electrode emits electrons and the other receives them. The reference electrode acts a reference in measuri ng the working electrode potential and does not pass any current. The three electrode system must be arranged so that the impedance measured is primarily from the working electrode and is negligible from the counter electrode. In order to achieve this, the counter electrode must have a significantly larger surface area than the working electrode. With a large surface area, the auxiliary electrode will possess a smaller resistance and a larger capacitance. In practice, auxiliary electrodes are usually platinum mesh. Working electrodes include glassy carbon, gold, and platinum. In the case of the following research the working electrode was either a modified carbon nanotube or nanocrystalline diamond based electrode. Reference electrode materials are typically chosen depending on the analyte measured and for the case of this research is a silver chloride electrode (E = 0.197 V). All of these electrodes are arranged equidistance from one another in a solution with a background electrolyte.

PAGE 63

50 CHAPTER 4: NANO CARBON RESULTS AND DISCUSSION 4.1. Introduction The development of a highly sensitive device for the detection of specific biological analytes (i.e. proteins and DNA) remains the foremost challenge in biosensor production. In particular, the advancement of miniaturized DNA and protein sensors remains the subject of intense research today. Salmonella induced enterocolitis an inflammation of the colon and small intestine, is the single most common cause of death from food borne illnes s in the U nited S tates According to the CDC, the estimated human Salmonella infections range from 800,000 to 4 million cases every year, with 800 4000 deaths. The cost estimates including lost income and medical costs average from 726 million to 3.7 billion US dollars annually. Rapid detection biosensors will enable the early detection of S. Typhimurium from food and water which can prevent food borne illnesses, losses to the food industry, and reduce the threat of bioterrorism. The most promising materials for realizing next generation nanotechnology are carbon based materials. CNT s and nanocrystalline diamond can amplify DNA or protein recognition and transduction events, which may be used as an ultrasensitive method for electrical biosensing of such molecules

PAGE 64

51 Lactic acid is an important molecule in several biological processes. Sweat lactate is a function of sweat gland energy metabolism. Because lactate is a product of the sweat gland itself, a decrease in oxygen supply induces a rise in sweat lactate concentration and a decrease in sweat gland activity. For example, pressure applied to soft tissue will cause a rise in sweat lactate concentration with respect to the rest of the bodys sweat lactate concentration. The development of pressure sores, or bedsores, has implications on the health of a bedridden individual as well as requirements for health care professionals. Previous studies have evaluated the reduction in oxygen delivery in the tissue of patients with peripheral arterial occlusive disease111. This research concluded that lactate in calf sweat is a good indicator in the evaluation of the severity of peripheral occlusive arterial disease and in assessing the efficiency of vasoactive drug treatment. Lactate oxidase is a readily available enzyme that is sensitive only to lactic acid and was applied to boron doped and nitr ogen incorporated NCD films in order to study their electrochemical activity Lactic acid was chosen due to its versatility. The blood level of lactic acid exceeding 8 mM can be an indication of several conditions. Electrochemical impedance spectroscopy (EIS) enables the complex electrical resistance of a system to be analyzed. This analytical method is very sensitive to changes on the electrode surface as well as in the bulk solution and therefore is an appropriate application method in biosensor de sign112. The EIS technique is inherently a label free detection method, which is especially beneficial due to the fact there is no need to additionally modify the biomolecules of interest with markers, such as fluorescent dyes, enzymes, or other redox labels.

PAGE 65

52 4.2. Carbon Nanotube Electrodes When taking measurements with surface modified electrodes, such as DNA attached to modified CNT electrodes, redox active compounds are usual ly added to the electrolyte solution, resulting in a welldefined charge transfer resistance (Rct). If such a redox active compound is blocked by adding a blocking layer to the electrode, the Rct value will become larger and a more capacitive impedance behavior will be observed. In this section, the use of single walled carbon nanotubes with a diameter of 2030 nm as the platform for DNA attachment and hybridization is demonstrated. The carbon nanotubes were modified with carboxyl groups and the oligonuc leotide probes with amino groups on the 3 end were covalently bonded to the functionalized nanotubes via N Ethyl N (3 dimethylaminopropyl) carbodiimide hydrochloride (EDAC) chemistry. Once hybridization was achieved, electrochemical impedance spectroscopy was used to measure the change in capacitance and charge transfer resistance of the electrode to the redox active compound Fe(CN)6 3/ 4. If the ssDNA probe does not hybridize to its complimentary strand, then the electrode will continue to behave as though it has been blocked and there will not be a noticeable shift in the Rct. This is due to the inherent nature that ssDNA is more negatively charged with respect to dsDNA and will consequently repel more of the redox active compound. In this study, we chose to use Salmonella specific probes, because Salmonella infections remain one of the most common foodborne illnesses in the United States and perhaps even globally113. This method of genosensing is a quick, facile appr oach to detecting DNA without the use of additional labels.

PAGE 66

53 4.2.1. Materials and Methods Single walled carbon nanotubes (SWNTs) were obtained from Cheap Tubes, USA. The electrolyte used in all electrochemical measurements was 0.5 mMK3Fe(CN)6 in 0.5 M KCl (Sigma Aldrich). DNA probe attachment took place in an acetate buffer of 0.3 M sodium acetate (Sigma Aldrich) and 0.3 M acetic acid (purity Fisher Scientific). DNA hybridization took place in a 0.1 M phosphate buffer solution (PBS), which was made in d eionized water with K2HPO4 (purity 98%) and KH2PO4 (purity 99%), both from Sigma Aldrich. The label free impedance based detection method for DNA hybridization is illustrated in Figure 4.1. Figure 4.1. Schematic of CNT and DNA attachment chemistry process and DNA hybridization measurement in 5.0 mM K3Fe(CN)6

PAGE 67

54 Single walled carbon nanotubes were chemically shortened and oxidized in a solution of 3:1 sulfuric and nitric acids under ultrasonication for 8 hrs. This trea tment causes carboxylic acid groups to form on the ends of the CNTs. The functionalized nanotubes were then filtered under vacuum and rinsed to clear any excess acid (Figure 4.2.) The CNTs were collected from the filter paper and sonicated in dimethylfo rmamide ( DMF ) for an additional 4 hrs. The new CNT/DMF solution had a concentration of approximately 0.1 g CNT in 3.0 mL DMF. A 3mm diameter glassy carbon electrode was polished with 1.0 m alpha alumina powder, rinsed with deionized water and dried in a N2 stream. The same electrode was polished again with 0.3 m alpha alumina powder, rinsed, and dried. A certain amount of the functionalized CNT suspension (1 20 l) was applied onto the surface of the polished glassy carbon electrode and allowed to dry overnight at room temperature. Electrochemical impedance and cyclic voltammetry were measured on the modified glassy carbon electrode with the carboxylated carbon nanotubes (CNT COOH) in 0.5 mMK3Fe(CN)6 in 0.5 M KCl before and after modification. Next, the NH2ssDNA probe was attached to the CNT COOH electrode using N Ethyl N (3 dimethylaminopropyl) carbodiimide hydrochloride (EDAC) chemistry. The electrode was incubated in the NH2ssDNA probe solution for 2 hours at room temperature under gentle agitation. The DNA hybridization took place in complimentary probe phosphate buffer solution for 20 min. at room temperature under gentle stirring. Nyquist plots and cyclic voltammograms were obtained before and after each modification step.

PAGE 68

55 Figure 4.2. CNT functionalization setup The Salmonella specific probe based on the wecE gene was selected from a previous report on detection of Salmonella from water114. The ssDNA probe, complimentary and mismatched ssDNA were purchased from Life Technologies Corporation (Carlsbad, CA). The sequences of the various analytes are provided in Table 4.1. Table 4.1. ssDNA probe and complementa ry strand sequence information Sequence Function 5 TACCGCAGCTAATTGACGTTAC 3 NH Salmonella specific ssDNA probe 5 GTAACGTCAATTAGCTGCGGTA 3 Compl e mentary ssDNA strand 5 GTAACGTCAATTAGCTGCGGTG 3 One base pair mismatched ssDNA strand

PAGE 69

56 Table 4.1. (Continued) 5 TAGGGAACGATCGGTCACATCGG 3 Unrelated ssDNA strand Micro Raman spectr oscopy was conducted on the CNT electrode with a Renishaw 1000 Raman spectrometer using an argon laser (514.5 nm) at a laser power of 24.8 mW lens. The Raman scattering was collected with an exposure time of 10 s to the samp le. Cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS) were performed with a Radiometer Analytical Voltalab 40 potentiostat and the data was analyzed with the corresponding Voltmaster4 software. The standard three electrode system consisted of a modified glassy carbon electrode with a surface area of 7.07 mm2, an Ag/AgCl (3M KCl) reference electrode, and a platinum wire (CH Instruments) as the counter electrode. The electrochemical measurements were carried out in a 10 mL cell at r oom temperature. The cyclic voltammetry experiments had a potential scan rate of 100 mV s1, step height of 1.0 mV and applied a potential from +1 V to 0.5 V. The electrochemical impedance experiments applied a frequency range of 50 k Hz 100 mHz with a n AC sine wave amplitude of 10 mV. 4.2.2. Discussion Raman scattering is one of the most useful and powerful techniques available to characterize carbon nanotube samples. For carbon nanotubes, the G mode corresponds to

PAGE 70

57 the stretching mode in the graphite plane and is centered around 1580 cm1. As seen in Figure 4.3., the modified electrode shows the G mode at about 1590 cm1. The D mode (the disorder band) is located between 1330 1360 cm1. While this band is expected to appear in multi wall carbon nanotubes, it is usually attributed to defects in the tubes when observed in single wall tube samples. Figure 4.3. shows that this band appears at 1351 cm1 for the modified sample and the poor intensity of this peak can be interpreted as an indic ation of the high purity of the functionalized SWNTs. The radial breathing mode is unique to single walled carbon nanotubes and is directly related to the diameter of the tube. This mode usually appears around 200 cm1. The Raman peaks centered at 174 c m1 and 1590 cm1 on the treated sample indicates that surface condensation o f carboxylated carbon nanotubes. Figure 4.3. Raman spectra of CNT electrode 0 500 1000 1500 2000Intensity (a.u.)Raman Shift (cm 1) 1590 174 1351

PAGE 71

58 Electrochemical characterization relating to the performance of the modified glassy carbon electrode was evaluated. The effect of the amount of SWNTs placed on the bare, polished glassy carbon electrode was studied in a solution of 0.5 mM K3Fe(CN)6 in a supporting electrolyte of 0.5 M KCl. Cyclic voltammograms were recorded with the systematic addition of more SWNTs to the electrode surface and a definite increase in the reduction and oxidation peaks appeared at approximately 0.3 and 0.2 V, respectively. In comparison to the performance of the bare glassy carbon electrode, the modified SWNTs COOH/GC e lectrode with a higher concentration of nanotubes displayed a significant increase in current density. This phenomenon verifies that the SWNTs COOH not only enhance the electrode response, but also serve as an active binding site of the oligonucleotide probes by providing a larger effective electrode surface area. Therefore, it can be concluded that the carbon nanotubes extend outwards on the glassy carbon electrode, providing a rich matrix of active area for the ssDNA to bind to and assist in direct el ectron transfer. The important role that the modified nanotubes play can be seen by the increase in the oxidation peak with respect to the gradual increase of nanotubes on the glassy carbon surface. Figure 4.4. shows the results of increasing the amount of SWNTs COOH in the DMF solution onto the bare, polished glassy carbon surface. There is a nearly linear increase in current density while increasing the amount of SWNT COOH/DMF solution from 5 L to 15 L on the glassy carbon surface. It is noted t hat Figure 4. 5. demonstrates that the current density levels off with either extremely low levels of SWNTs (1 L) and extremely high levels of SWNTS (20 L).

PAGE 72

59 Figure 4. 4. Cyclic voltammograms in 0.5 mM K3Fe(CN)6 in 0.5 M KCl aqueous solution vs. Ag/AgCl for 1.0 L, 5.0 L, 10 L, 15 L and 20 L SWNT COOH deposited on a polished glassy carbon electrode with a scan rate of 100 mV s1 applied from 1.0 to 0.5 V.

PAGE 73

60 Figure 4. 5. Current density profile with an increase in CNTs to electrode surface Figure 4.6. displays typical cyclic voltammograms of the (a) bare, polished glassy carbon, (b) SWNTs COOH/GC, and (c) ssDNA SWNTs COOH/GC electrodes. All voltammograms were cycled three times in order to verify the stability of the signal. The anodic to c athodic peak current ratio approaches unity for both bare GC and SWNT COOH/GC electrodes, indicating a reversible reaction for Fe(CN)6 3 -. There is an increase in oxidation peaks from the bare electrode to the nanotube electrode, as discussed above, and then an oxidation peak decrease is visible with the binding of the ssDNA probe to the functionalized carbon nanotubes. The decreased current response can be attributed to the negatively charged ssDNA molecules, which will dampen the redox reaction.

PAGE 74

61 A Ran dles equivalent circuit may be modeled for the modified CNT electrode in contact with the redox compound. This circuit contains the solution resistance Rs, the charge transfer resistance Rct, the double layer capacitance Cdl and the Warburg impedance W However, for analytical purposes the Warburg impedance can be neglected in the overall equivalent circuit by choosing a frequency range where no 45 line is observed in the Nyquist plot. The determination of the Rct was used as the impedimetric detection method of analyte binding. This approach was chosen because it is of particular interest when the conductivity of the recognition layer changes due to a binding event such as DNA hybridization.

PAGE 75

62 Figure 4. 6. Cyclic voltammograms in 0.5 mM K3Fe(CN)6 in 0.5 M KCl aqueous solution vs. Ag/AgCl for (a) polished, bare glassy carbon electrode (GCE), (b) SWNT COOH modified GCE and (c) NH2ssDNA probe bound to SWNT COOH modified GCE with a scan rate of 100 mV s1 applied from 1.0 to 0.5 V The electrochemical impedance of the functionalized electrode was studied in order to determine the suitability of such an electrode for DNA sensing applications. The Nyquist plots (Figure 4.7) were obtained prior to binding of the NH2ssDNA probe onto th e CNT matrix of the glassy carbon electrode for use as reference. It is clearly visible that the bare polished glassy carbon electrode exhibits a large charge transfer resistance of about 95.4 cm2. Upon the addition of the functionalized SWNTs COOH on the glassy carbon surface, the diameter of the Nyquist plots semicircle drastically reduced, which equates to a reduction in the Rct. Next, the NH2ssDNA probe was attached to the

PAGE 76

63 CNT matrix. The addition of the ssDNA shows an increase in Rct due to the fact that ssDNA has negative charges repelling the Fe(CN)6 3/ 4, which is represented in the Nyquist semicircle diameter becoming larger than that of the nanotube modified electrode. After hybridization in different concentrations of complimentary DNA the semicircle diameter decreased in small increments. However, the charge transfer resistance never decreased to the same amount as the SWNT COOH/GC electrode. It appears that the double stranded DNA (dsDNA) has the ability to transfer electrons bet ter than ssDNA. This method of detection is very sensi tive and is able to sense comple mentary target DNA concentration at 10 1010 mol L1. The modified CNT COOH glassy carbon electrode was tested for efficiently specificity to the target DNA sequence as well as genosensor sensitivity. The electrode was prepared by attaching the ssDNA probe onto the modified electrode surface as before and exposing it to different strands of DNA, each with a concentration of 1 106 mol L1. The signals of a comp letely unmatched sequence and a onebase mismatched sequence were compared to that of the hybridized complimentary sequence. The Bode plot shown in Figure 4.8 shows that an appreciable change in Z was only obs erved with the hybridized comple mentary target DNA sequence. In fact, the chan ge in impedance for the comple mentary target DNA is similar to that of the impedance of the CNT COOH/GC electrode. Very little change is shown in the signals of the ssDNA probe with the unmatched and one base mismatched DNA. Therefore, it can be concluded from the data that this type of modified carbon nanotube/glassy carbon electrode is capable of detecting target DNA strands with acceptable sensitivity and selectivity.

PAGE 77

64 Figure 4.7. Nyquist plot of (a) GCE, (b) SWNT COOH modified GCE, (c) ssDNA/SWNT COOH GCE, and (d f) increasing concentrations of comple mentary DNA

PAGE 78

65 Figure 4.8. Bode plot of SWNT COOH/GC electrode after ssDNA probe a ttachment and exposure to comple mentary DNA sequence as well as unmatch ed and mismatched DNA sequences 4.3. Nanocrystalline Diamond Electrodes Conductive diamond films possess several unique properties such as a large electrochemical potential window, chemical robustness, high hardness, high corrosion resistance as well as excellent biocompatibility115, which make it an ideal platform as a biosensing electrode. However, nanocrystalline diamond (NCD) biosensor applic ations require precise control over the films surface properties, such as wettability and proper

PAGE 79

66 surface chemistry. There are several practical benefits of using nanocrystalline rather than microcrystalline diamond thin films in electrochemistry, including the ability to deposit continuous films at nanometer range, easier coating of substrates with irregular geometries and the unique electrochemical behavior which result s from the NCD films different morphology and electronic properties compared to the m icrocrystalline films Several methods have been studied to control the biological and chemical functionalization of NCD, such as photochemical modification116, covalent functionalization of proteins on hydrogenated diamond surfaces117, a s well as electrochemical reduction11 8. 4.3.1. Growth of Boron Doped Nanocrystalline Diamond Boron doped diamond films on silicon are deposited with a hot filament CVD deposition reactor (sp3 Diamond Technologies, Inc. Model 650); capable of depositing on one 300mm or nine 100 mm wafers in the large industrial chamber with wafer film thickness uniformity better than 5% and wafer to wafer uniformity of typically 3% for a 9 wafers run. The silicon wafers are seeded prior to deposition in an ultrasonically agitated solution containing 450 nm ultra dispersed diamond (UDD) detonationsynthesized nanopowder. The high seed density (>5x1010/cm2) allows these films to be characterized as pinhole free with uniform grain morphology. The grain size of the diamond is varied from large grain micr ocrystalline to small grain nanocrystalline by controlling the CH4 and pressure set points to the required process window. Boron is introduced into the system as the trimethylborate (TMB) gas to produce ptype doping. Increasing the TMB flow during deposition allows more boron to be incorporated into the

PAGE 80

67 diamond film to reduce the sheet resistance. Tung sten wires were heated to ~2200 C to activate the reaction gas a mixture of hydrogen and methane. Film parameters with growth conditions of the borondoped NCD is shown in Table 4.2. and a typical image of the film is s hown in Figure 4.9 with the atomic force microscopy surface analysis shown in Figure 4.10. Table 4.2. Growth condi tions for borondoped NCD films PROPERTY nm BDD Sheet Resistance 1.0 KOhm/sq" Resistivity 0.32 Ohm.cm Watt Density 9.6 W/cm 2 %CH 4 2.2% %TMB 0.007% Wire temp 2255 0 C

PAGE 81

68 Figure 4.9. S EM image of nanocrystalline BDD Figure 4.10. AFM section analysis of nanocrystalline BDD

PAGE 82

69 4.3.2. Growth of Nitrogen Incorporated Nanocrystalline Diamond Figure 4.11. shows the CVD reactor used for growth of nitrogen incorporated NCD. It h as a 6 kW microwave head that can produce plasma up to 100 mm on wafers The substrate holder can heat samples up to 800 C. For incorporation with nitrogen, the proces s recipes are changed to make the films conductive. The grain size of the diamond films can be drastically decreased by changing th e gas chemistry during growth. Also, when nitrogen is introduced, the growth rate increases which in turn a ffects the growt h morphology of the conductive NCD films. Before the deposition, 0 to 0.5 m diamond powders were used to polish the sample surface to increase the nucleation rate and the samples were ultrasonically cleaned in m ethanol for 10 min. The nitrogen incorpor ated NCD films were grown using CH4/Ar/N2 gas chemistry for 3 hr. Table 4.3. summarizes the growth conditions for these films. Figure 4.12. shows a typical nitrogen incorporated NCD sample with cauliflower like grains. From Figure 4.13., surface roughness information about the samples were obtained. The mean roughness was about 14.5 nm for a 10 m 10 m scan size. The conductivity of the diamond films measured by four point probe method at room temperature was found to be ~ 100 ohm.cm1.

PAGE 83

70 Figure 4.11. Cyrannus I Iplas MPCVD system for NCD growth Table 4.3. Growth conditions for nitrogen incorporated NCD films PROPERTY nm NCD Gas Flow 200 sccm Power 800 W Pressure 100 Torr %CH 4 1 %

PAGE 84

71 Table 4.3. (Continued) %Ar 79 % %N 2 20% Substrate Temp. 750 C Figure 4.12. SEM of nitrogen incorporated NCD

PAGE 85

72 Figure 4.13. AFM roughness analysis of nitrogen incorporated NCD 4.3.3. Hydrogenation of Nanocrystalline Diamond Diamond hydrogenation was included as a step in the surface modification of all samples, regardless of the target analyte. Hydrogenation serves as a platform for carboxylic functionalization and eventually, enzyme or DNA attachment. For all samples, diamond hydrogenation took place in a hot filament chemical vapor deposition (HFCVD) system with a flow rate of 90 sccm hydrogen gas at a temperature of about 1200 C, as shown in Figure 4.14. The Raman spectra shown for BDD exposure to hydrogen plasma at different times is shown in Figure 4.15. After hydrogenation, the sp2 peak decreases because hydrogen etches the sp2 graphite bonds on the surface, resulting in a film that is highly conductive and hydrophobic. The most desirable surface is the one that has a low sp2 graphite peak while the sp3 peak has high intensity and these

PAGE 86

73 conditions are met when the hydrogen treatment is perf ormed for 30 minutes on the BDD. Figure 4.14. Schematic of HFCVD used for hydrogen plasma treatment of nanocrystalline diamond samples

PAGE 87

74 Figure 4.15. Raman spectra after hydrogen treatment of BDD films The nanocrystalline NCD shows a broad G band centered around 1500 cm1. The G bands are usually associated with disordered sp2 carbon119. The diamond band occurs at about 1330 cm1. 4.3.4. Materials and Methods for DNA Sensing Carboxylic acid dimers ( COOH) had to be attached to the hydrogenated BDD in order to transition the film from hydrophobic back to hydrophilic as well as to use as a platform for ssD NA attachment. The electrodes were immersed in a 0.3 M acetic acid solution and 25 c ycles of cyclic voltammetry were conduc ted under the potential range of 200 to 800 mV The newly modified electrodes were then subjected to NH2ssDNA. A

PAGE 88

75 mixture of acet ate buffer ( 0.3 M sodium acetate and 0.3 M acetic acid) EDAC and NH2ssDNA was deposited on top of the nano BDD and was left to dry in a refrigerator at a temperature of less than 20 C for two days. The EDAC aids in the chemical reaction between the car boxyl group on the diamond surface and the NH2ssDNA. After the ssDNA deposition, a mixture of phosphate buffer solution and FITC labeled compl e mentary Salmonella DNA (compDNA) was deposited on the surface. The electrode was left in the refrigerator for two days for the compDNA to bind to the NH2ssDNA attached to the diamond surface. Figure 4.16. shows a schematic of the electrode modification process. Figure 4.16. Schematic of modification of boron doped NCD films f or DNA detection Electrochemical measurements, were performed using a Radiometer Analytical Voltalab 40 potentiostat. All electrochemistry was performed in a standard three

PAGE 89

76 electrode system. The modified borondoped NCD acted as the working electrode, an Ag/AgCl (3M KCl) acted as the reference electrode, and a Pt mesh acted as the auxiliary electrode. The impedance spectra were taken over a wide frequency range from 1 MHz to 50 mHz, with a 10 mV excitation signal superimposed onto the electrochemical sys tem. 4.3.5. DNA Sensor Discussion Cyclic voltammograms were taken in between surface modification s of the boron doped NCD electrodes to analyze electrochemical activity at the diamond surface. Interestingly, while hydrogen treatment of NCD increases the conductivity of the diamond, the electrochemical activity actually decreases. Surface hydrogen applied from hydrogen plasma, in which the hydrogen atoms bond to terminal carbon atoms, do not desorb quickly. The physiochemical properties of boron doped NCD are very influential over the electrode kinet ics. Figure 4.17. shows CVs with and without surface hydrogenation in a phosphate buffer solution. Clearly, the background current for the as grown, oxygen terminated BDD electrode is much higher than t he hydrogen terminated electrode. The oxygen termination increases the hydrophilic characteristics of the surface and it is this characteristic that causes an increase in current density by an order of magnitude.

PAGE 90

77 Figure 4.17. CVs of BDD surface (a) with hydrogen and (b) without hydrogen treatment Mass transport issues need to be taken into account when using electrochemical techniques to characterize the boron doped NCD sample with ssDNA attachment. As mentioned above, the transfer of electrons to and from the diamond surface is highly dependent on the termination of atoms at the surface. Figure 4.18. shows cyclic voltammograms of the prepared modified BDD electrode prior to deposition of NH2ssDNA and immediate ly after at different scan rates in Fe(CN)6 3/ 4. Note that the higher scan rates produce highly asymmetric, disordered CVs, while the lower scan rates show the CV becoming more stable and reversible. The addition of the ssDNA shows a decrease in total current density, as expected, due to the fact that ssDNA has negative (b) (a)

PAGE 91

78 charges repelling the Fe(CN)6 3/ 4. Upon addition of the ssDNA, the reaction is diffusion limited at the electrode/electrolyte interface. Figure 4.18. CVs of (a) BDD COOH and BDD COOH ssDNA with a scan rate of (b) 50, (c) 20 and (d) 5 mV/sec. Similar to the CNT modified electrode for Salmonella DNA detection, electrochemical impedance spectroscopy was also used on the nanocrystalline BDD modified electrode as a method of detection. Upon addition of the ssDNA to the BDD electrode surface, the charge transfer resistance increased to about twice the charge transfer resistance of just the electrode without any presence of DNA. As before, this is expected. In Figure 4.19. (c), the eff ect of the complementary DNA binding to the ssDNA can be observed. The complementary DNA once again causes a decrease in the

PAGE 92

79 diameter of the semicircle of the Nyquist plot, indicating that more electrons are allowed to get shuttled through to the conducti ve surface. This can be viewed as a positive detection method of DNA. Figure 4.19. Nyquist plots of BDD (a) without DNA, (b) with ssDNA and (c) with complementary DNA attachment As a secondary method of complementary DNA detection, fluorescence spectroscopy was used. The complementary DNA strand was labeled with a fluorescein isothiocyanate (FITC) tag. FITC has excitation and emission spectrum peak wavelengths of about 495 nm and 521 nm, respectively. When this molecule is placed under a fluorescence microscope and excited at the correct frequency, it will glow green. Several boron doped diamond electrode samples were analyzed in this manner. It appears as

PAGE 93

80 though the complem entary DNA binds mostly uniformly over the entire functionalized diamond surface. It is seen in Figure 4.20. that the complementary DNA seems to follow the surface characteristics and does not bind where there is a crack or an area that was possibly over etched during hydrogen treatment. Figure 4.20. verifies the results shown in the Nyquist plots that the complementary DNA does bind to the modified diamond surface and shows a high extent of hybridization with the ssDNA. Figure 4.20. Fluores c ent mic roscopy images at 400X of BDD with complementary DNA, two different locations on the same sample 4.3.6. Materials and Methods for Lactic Acid Sensing The method of covalent immobilization of enzymes on diamond surfaces has been established elsewhere and was followed120. Both boron doped and nitrogen incorporated NCD was first electrochemically modified with nitrophenyl groups by performing cyclic voltammograms in a solution of 0.1 M tetrabutylammonium

PAGE 94

81 tetrafluroborate and 1 mM 4nitrophenyl diazonium tetrafluroborate. These surface groups were then reduced to aminophenyl groups in a 0.1 M KCl solution of 10% methanol at 1.0 V vs. Ag/AgCl. The electrode was then placed in a solution of 0.1 M succinic anhydride in dimethylformamide (DMF) for a few hours. Once dried, the samples were immersed wtih constant stirring in 0.1 M 2morpholinoethanesulfonic acid containing 1ethyl 3 [3 dimethylaminopropyl] carbodiimide hydrochloride and N hydroxysulfosucc inimide for 1 hr. About 10 IU of the enzyme lactate oxidase (LOX, E.C. 1.12.12.4 from Pediococcus species, 49 U/mg, Sigma Aldrich) was dissolved in 0.1 M acetate buffer. A certain amount (about 50 l) of the enzyme buffer solution was pipetted onto the m odified NCD films and refrigerated overnight. The electrodes were rinsed with deionized water to remove any unbound enzyme and subsequently dried in a nitrogen stream prior to use. The exposed surface area of the electrode was about 0.8 cm2 and the data h as been normalized to this surface area. Fourier transform infrared spectroscopy (FTIR) analysis was performed on a Perkin Elmer Spectrum One Spectrometer. UV Vis spectroscopy was performed on the samples immediately prior to cyclic voltammetry sensing u sing a Jasco UV Vis Spectroscope. 4.3.7. Lactic Acid Sensor Discussion Boron doped and nitrogen incorporated nanocrystalline films were studied for electrochemical activity towards lactic acid. Based on the following reaction, electrochemical detection occurs:

PAGE 95

82 Functionalized electrodes were constructed with both types of NCD to determine which doping method provided a more sensitive electrode. To underst and the effect of the dopant on the NCD, the Mott Schottky plot was evaluated for both types of films. It is a well known fact that boron is introduced uniformly within the diamond lattice, while nitrogen incorporation takes place mainly at the grain boundaries The Mott Schottky plot (Figure 4.21.) shows a drastic change in the slope of the left hand side of the curve for the nitrogen incorporated NCD. This change in slope represents non uniform donor distribution within the film. On the other ha nd, the slope on the left hand side of the curve for the boron doped NCD is nearly linear. Due to the uniform arrangement of boron in the NCD, it is predicted that this type of film will be better for the electrochemical detection of lactic acid. (24) (25) (26)

PAGE 96

83 Figure 4.21. Mott Schottky graph of (a) nitrogen incorporated and (b) boron doped NCD (a) (b)

PAGE 97

84 FTIR analysis was performed on all samples. First, a baseline for intrinsic diamond was established. Then, FTIR spectra were taken for boron doped, nitrogen incorporated and samples with lactate oxidase immobilized on the surface (Figure 4.22). Ther e is little difference between intrinsic diamond and n doped diamond, as to be expected. However, for bdoped diamond we see the pres ence of a peak at about 3700 cm1. The NCD with LOX shows an amino group at about 3500 cm1 a nd peak widening at 1250 cm1, which correspond to the enzyme lactate oxidase. Figure 4.22. FTIR spectra of NCD electrodes : (a) intrinsic, (b) boron doped, (c) n incorporated, (d) nitrogen incorporated with LOX Wavelength (cm 1 ) A (a) (b) (c) (d)

PAGE 98

85 UVVis was performed on the NCD electrode immediately before detection to determine the stability of the sensor. A 10 minute time study was performed to determine the activity level of the electrode prior to use. The activity of the enzyme was measured even minute for 10 minutes at the wavelength of 585 nm. It was found that the activity of LOX continued to increase from 1.0109 units/mg for about six minutes to 0.0192 units/mg. After six minutes, the activity peaked and then became stable. UVVis was p erformed before every experiment to also gauge the shelf life of the electrode. It was found that after 3 months, the activity of the electrode decreased to about 6 0% of its original measurement. Cyclic voltammetry was measured on both types of NCD electrodes in PBS buffer solutions with increasing concentrations of lactic acid. The scan rate for all CVs was 50 mV/s. As shown in Figure 4.23, the CV for the nitrogen doped NCD electrode has poor sensitivity to lactic acid. A slight reduction peak is n oted at around 200 mV; however, there is no noticeable oxidation peak. Due to the asymmetry of the voltammogram, the electrochemical reaction is not reversible. It is believed that this poor response is due to the properties of the nanocrystalline diamond when it is doped with 20% nitrogen. The nitrogen tends to be incorporated at the grain boundaries, resulting in a non uniform conductive film. As a result, the entire surface area is not completely utilized for lactic acid detection and the response that it does provide is not as stable as desired for enzymatic biosensor applications.

PAGE 99

86 Figure 4.23. CV of nitrogen incorporated NCD in 5 mM lactic acid The modified boron doped nanocrystalline diamond electrode provided a much better response to l actic acid. Figure 4.24. shows the CVs for this electrode immersed in lactic acid concentrations ranging from 5 mM to 20 mM. Note that the higher concentrations of lactic acid give a higher current density, which is typical of amperometric detection. Ev en at 5 mM, the sensor still provided a current density of about 1.5 mA/cm2. The voltammograms also appear to be much more symmetrical, indicating that the redox reaction is reversible at the electrode surface. The peak current density was plotted against the lactic acid concentration in Figure 4.25. A nearly linear relationship is observed; as the concentration of lactic acid increases, the current density increases as well. Due to the uniformity of the boron concentration in the NCD, this

PAGE 100

87 electr ode is much more responsive and sensitive to varying lactic acid concentrations in a phosphate buffer solution. Figure 4.24. CV of boron doped NCD in increasing concentrations of lactic acid: (a) 20 mM, (b) 15 mM, (c) 10 mM, and (d) 5 mM

PAGE 101

88 Figure 4.25. Peak current density as a function of lactic acid concentration 4.4. Summary In summary, mo dified carbon based electrodes were developed for the detection of different biological species. Carbon nanotube and boron doped nanocrystalline diamond have been prepared for detection of DNA from Salmonella enterica serovar Typhimurium using impedimetric sensing techniques. While both nano carbon materials proved to be excellent electrodes for detection of DNA hybridization, the carbon nanotube electrode showed more sensitivity. Most likely, this is due to the fact that the functionalized SWNTs deposited on the glassy carbon provided a rich, active, high surface area matrix for the bind ing of the aminated ssDNA probe and consequentially allowing for more target hybridization sites on the electrode surface. It was found that simply by increasing the concentration on carbon nanotubes on a glass carbon surface, the current density response increases very nicely. Target DNA sensing

PAGE 102

89 was accomplished by measur ing the change in the overall impedance of the system as well as measuring the charge transfer resistance. Fluorescent microscopy was also performed on the BDD electrode. While fluorescence is a good method to verify DNA attachment, it only provides qual itative and not quantitative results. These images show that the ssDNA and complementary strand DNA bonded fairly uniformly over the diamond surface. Finally, the electrochemical properties of boron doped and nitrogen incorporated NCD thin films was examined using Mott Schottky and their respons e to lactic acid was measured. Due to the non uniform donor concentration of nitrogen in the diamond, these electrodes are not as ideal for sensing in an aquous solution. The boron doped NCD displayed a l inear response to lactic acid in the range of 5 mM to 20 mM.

PAGE 103

90 CHAPTER 5: BISMUTH ANTIMONY NANOWIRE RESULTS AND DISCUSSION 5.1. Introduction The thermoelectric effect is traditionally divided into the Seebeck effect, the Peltier effect and the Thomson effect The Seebeck effect was the first of the three thermoelectric phenomenon discovered in 1821, when Thomas Johann Seebeck realized that a junction of dissimilar metals produces an electric current when exposed to a temperature gradient. In 1834, JeanCharles Peltier discovered the opposite of the Seebeck effect ; an electric current at the junction of two different metals will either heat or cool depending on the direction of the applied current. Finally, the Thomson effect, named fo r William Thomson, describes that a conductor will either absorb or emit heat depending on the material. Combining these effects, the thermoelectric effect describes the conversion of temperature differences to an electric potential and vic e versa. Peltier devices, as called thermoelectric coolers (TECs), operate by applying a voltage to one side of a thermocouple which will cause one side to warm while the other side cools. A schematic of a typical thermoelectric cooler is shown in Figure 5.1. The goa l of this research was to replace the bulk materials used for ptype and ntype legs with oriented arrays of nanowires. In particular, the following work focuses on replacing the ptype leg of the device with ordered Bi(1 x)Sb(x) nanowires of a particular length and diameter.

PAGE 104

91 Figure 5.1. Schematic of thermoelectric cooler with Bi(1 x)Sb(x) nanowires as the ptype leg 5.2. Material Selection The unique characteristic defining an efficient thermoelectric material is that it must be highly electric ally conductive while at the same time not being thermally conductive. These characteristics govern the dimensionless thermoelectric figure of merit, ZT (see Section 1.2.). Identifying materials with high ZT values is a challenge, based on the conflicting interrelated characteristics that are required. One long standing approach to achieve a high ZT is to reduce the lattice thermal conductivity by scatter ing phonons within the unit cell by creating rattling structures or point defects such as interstitials, vacancies or by alloying22. The second strategy is to use complex crystal structures to separate the electron crystal from the phononglass121. T he region responsible for electron transport would be an electron crystal of a highmobility semiconductor, while the phonon glass would be ideal to house disor dered structures

PAGE 105

92 and dopants without disrupting the electron crystal. A third strategy is to scatter phonons at interfaces, leading to the use of multiphase c omposites mixed on the nanometer scale122. High thermoelectric power semiconductor alloys of Bi, Sb, and Te are used si nce they have poor thermal conductivity and can be doped to improve electrical conductivity. Based on theoretical studies, bismuth nanowires doped with antimony were chosen for this project. It has been calculated that Bi(1 x)Sb(x) nanowires can pr oduce a ZT of about 1.2 at 77 K with a wire diameter of about 40 nm. T he enhancement in ZT is attributed to the coalescence in energy of the subband edges of the ten hole pockets of this system and the r esulting high density of states123. In order to replace the semiconductor legs of a standard thermoelectric device the nanowires need to be manufactured in high density (>1010/cm2 over ~ 0.2cm2), oriented, high aspect ratio array s (40 nm diameter by 100 m m length). In order to be useful in miniaturized devices, the fabrication process needs to be compatible with onchip processing. In this section, these manufacturing and growth issues are addressed, as well as data on the thermoelectric efficiency of produced nanowires is presented. 5.3. Template Fabrication The fabrication of well aligned nanowire arrays is a vital project for t he realization of thermoelectric coolers for novel microelectronic and nano electrical mechanical systems (NEMS). The chosen approach used for nanowire growth in this project was to develop an anodized aluminum oxide (AAO) template. Anodization is a proce ss of producing a film of Al2O3 on aluminum when a voltage is applied through an acidic electrolyte. During this process, the aluminum is the anode and a suitable material

PAGE 106

93 such as a titanium or platinum mesh is the cathode. Under precise control of param eters such as acid concentration and applied voltage, ordered pores will be produced. The AAO is usually composed of a thick porous oxide layer on top of a smaller, yet distinct barrier oxide layer. The pores typically have diameters of 10 100 nm with varying wall thickness and depth. For electrochemical nanowire deposition inside such a porous array, complete removal of the barrier oxide layer is vital in order to expose the underlying seed metal. Electrochemical impedance spectroscopy (EIS) is a non destructive technique used to characterize the anodization and etching process. EIS was measured on several samples of anodized alumina films as a method for describing the growth and dissolution of the barrier oxide layers. 5.3.1. Materials and Methods This project has two modules: first, to anodize aluminum samples and second to perform EIS on the as prepared coupons. Anodization of the aluminum films was carried out in a 3 wt % solution of oxalic acid (pH 2) at 2 C with a platinum mesh counter electr ode. A DC voltage was applied between the Al film and the counter electrode. Figure 5.2. shows a schematic representation of the anodization setup. Figure 5.2. Schematic of anodization setup

PAGE 107

94 The anodization area of each sample was approximately 1.5 cm2. Smooth Nddoped Al films were grown on a Si substrate on top of a stress free Pt layer, which bonds to the Si substrate via a W adhesion layer. All metal films were deposited by sputtering and the Al films were 570 nm thick w ith an underlying layer of 50 nm platinum. A two step anodization process was used to obtain the porous templates. The initial anodization was at 50 V for less than 1 minute. This quick anodization step provided the rough template. Immediately following the first anodization, th e films were etched in a 5% H3PO4, CrO3 bath at room temperature. The time of this etch varied from 10 min. to 30 sec in order to achieve an optimal etch of the oxide layer. The second anodization step began at 50 V, 2 C with a systematic potential reduction in order to more efficiently etch the barrier oxide layer. Because the anodization and etch rates were initially unknown, samples were anodized systematically at several voltage and time combinations until the films appeared to become visibly ir idescent (this is a common characteristic of AAO films). As a quick check to verify anodization, the films were tested for conductivity with an ohmmeter. If the anodized section of the sampled showed an infinite resistance, the film was considered anodiz ed and set aside for further investigation with EIS. If the anodized sample still displayed conductivity, it was discarded and a fresh sample was again anodized at the same voltage but for a longer time period until the film completely displayed no conduc tivity (which indicates that the Al had converted to Al2O3) and possessed an iridescent shine. The current density was monitored during the anodization process. Two current contributions can be distinguished: a current density associated with formation of an initial aluminum oxide barrier layer at the interface with the aluminum metal, and a

PAGE 108

95 current density responsible for the subsequent nucleation of pores When the alumina barrier layer is complet ely formed, the current density is known to decreas e abru ptly. C urrent density increases during pore development until the latter becomes stable. The combined effect of these two contributions leads to the overall current behavior shown in Figure 5.3. Figure 5.3. Typical current time anodization profile Foll owing anodization, EIS was used as a diagnostic technique to char acterize the anodized films, including the thickness of the barrier oxide layer in order to determine the appropriate barrier oxide layer etch time. EIS was performed in a three electrode cell with the anodized sample as the working electrode with a Ti wire counter electrode plus a Ti wire reference electrode. A photo of this setup is shown in Figure s 5.4., 5.5. EIS e xperiments were carried out in an aqueous solution of 1 M sodium sulfate at room temperature over a frequency range of 100 kHz to 10 mHz with a Solartron Impedance

PAGE 109

96 Analyzer. EIS was first performed on an aluminum sample that had not been anodized, and the n on the other samples anodized at 15 and 20 V. After a good representation of measurements was conducted, EIS was used to characterize the post anodization etching process. In order to etch away the barrier oxide layer, samples were placed in a bath con sisting of 0.4 M phosphoric acid and 0.2 M chromic acid at room temperature for a measured amount of time. The samples were then transferred back into the electrochemical cell and for EIS testing. After each test, the samples again went through a timed e tch and impedance measurements were taken after each etch. Figure 5.4. Side view of EIS setup

PAGE 110

97 Figure 5.5. Disassembled top view of EIS setup 5.3.2. Discussion A top view of a typical AAO sample is shown in Figure 5.6 and a corresponding c ross sectional view is shown in Figure 5.7. It is evident in the cross sectional view that a barrier oxide layer exists on top of the platinum layer. In order for nanowires to grow in this template, this barrier oxide layer must be etched away as much as possible to expose the underlying platinum. The equivalent circuit for a typical anodized aluminum oxide sample can be modeled as the electrochemical cell solution resistance connected in series with two parallel combinations of a constant phase angle (CPE) and a resistor (Figu re 5.8.). The admittance of the CPE s in the equivalent circuit can be calculated from equation 20. The first parallel resistor/CPE combination can be used to describe the barrier oxide layer, where the capacitance of it is approximately equal to Y0. Hence, the Area exposed to electrolyte O ring Copper foil

PAGE 111

98 EIS data was fit to the equivalent circuit and the barrier oxide thickness of the samples was calculated using the following: d A Cbl 0 where Cbl is the barrier layer capacitance (F) A is the AAO surface area ( cm2) d is the barrier la yer thickness (cm) 0 i s the permittivity of a vacuum ( 8.85 1014 F/cm) and is the dielectric constant of alumina, 9.5. This data is given in Table 5.1. F igure s 5.9, 5.10 represent the Nyquist and Bode data sets collected prior to anodization and immediately after anodization for 10 min. at 15 and 20 V, respectively It can be seen that the diameter of the semicircle gradually decreases with an increase in anodization voltage, holding the time of anodization constant. The high frequency arch also increases as anodization voltage increases. The magnitude of impedance also increases with anodization voltage. The ratio of thickness of the barrier oxide laye r to anodizing dc voltage was found to be 1.015 nm V1, which is consistent with the accepted range in literature of 1.0 1.4124. (24)

PAGE 112

99 Figure 5.6. Top view of typical AAO sample Figure 5.7. Cross section of AAO template

PAGE 113

100 Table 5.1. Data from equivalent circuit fit for sample anodized at 15 V for 10 min, n ~ 0.95. Etch Time (min) Capacitance (F) Barrier Oxide Thickness (nm) 0 1.08 10 7 15.23 0.5 1.13 10 7 14.62 1.5 1.35 10 7 12.27 3.5 1.44 10 7 11.43 Figure 5.8. Equival ent circuit model of AAO sample The behavior of the samples appears to be that of truncated transmission lines. Figure s 5.9. and 5.10. show the impedance response of the AAO after sequential etching times. It is evident that at high frequencies the system acts as a transmission line; however, at lower frequencies Rs<
PAGE 114

101 represents the barrier oxide layer thickness at sequential etching times in the 0.4 M phosphoric acid and 0.2 M chromic acid. Dissolution is evident, although it does not appear to follow a linear rate. It is also important to note that while the barrier oxide layer i s being etched, so is the alumina template as well. A slight change in the color of the sample was noticed from prior to etching and once the etching was complete. Although the template and the barrier layer etch at dif ferent rates, it would be compli men tary to know the thickness of the template after each etching process. The author notes that it may be better to begin with a thicker film of aluminum, such as 1 5 microns, sputtered onto the sample for future tests. The thicker film will compensate for any undesired etching of the template during the dissolution of the barrier oxide layer.

PAGE 115

102 Figure 5.9. High frequency Nyquist data collected at OCP prior to anodization and after anodization at 15 V for 10 min. and at 20 V for 10 min. 0 5000 10000 15000 -15000 -10000 -5000 0 Z' (ohm)Z'' (ohm)Unanodized Anodized at 15 V, 10 min Anodized at 20 V, 10 min

PAGE 116

103 Figure 5.10. Bode data (magnitude and phase) collected at OCP prior to anodization and after anodization at 15 V for 10 min and at 20 V for 10 min. 10-210-1100101102103104105106 102103104105106107108Frequency (Hz)|Z|Unanodized Anodized at 15 V, 10 min Anodized at 20 V, 10 min 10-210-1100101102103104105106 -100 -75 -50 -25 0 Frequency (Hz)theta

PAGE 117

104 Figure 5.11. High frequency Nyquist data collected at OCP after anodization with no post etch, 0.5 min, 1.5 min, and 3.5 mi n post etch 0 5000 10000 15000 -15000 -10000 -5000 0 Z' (ohm)Z'' (ohm)Unanodized Anodized, No etch 0.5 min etch 1.5 min etch 3.5 min etch

PAGE 118

105 Figure 5.12. Bode data (magnitude and phase) collected at OCP after anodization with no post etch, 0.5 min, 1.5 min, and 3.5 min post etch 10-210-1100101102103104105106 102103104105106107108Frequency (Hz)|Z|Unanodized Anodized, No etch 0.5 min etch 1.5 min etch 3.5 min etch 10-210-1100101102103104105106 -100 -75 -50 -25 0 Frequency (Hz)theta

PAGE 119

106 5.4. Nanowire Growth 5.4.1. Materials and Methods Electrochemical experiments were performed using a Radiometer Analytical Voltalab 40 electrochemical analyzer. All electrochemical measurements were executed in a standard three electrode system with the AAO substrate serving as the working electrode, a platinum mesh as the auxiliary electrode, and an Ag/AgCl reference electrode at room temperature. The supporting electrolyte for all nanowire electrodeposition was a solution of dimethylsulfoxide (DMSO) for two reasons: f irst antimony salt has a high solubility in DMSO and second, DMSO does not aggressi vely attack the anodized alumina template in which deposition occurs. Several electrochemical measurements, utilizing c yclic voltammetry impedance spectroscopy, and chronopotentiometry were used to characterize the kinetic limitations of plating Bi3+ Sb3 + into nanoscale pores. 5.4.2. Fundamentals of Nanowire Electrodeposition When using electrodeposition as the method of nanowire growth, the n anowire dimensions (length and diameter) are controlled by the nanopore dimensions of the template. It is impo rtant to address any mass transport concerns when plating into small pores. As mentioned in Chapter 3, the three modes that act resistively to the current flow used to deposit material in the pores are diffusion, c onvection and ionic migration. Resistance due to ionic migration can be easily overcome if a supporting background electrolyte is used. Resistance based on convection is highly limited by the fact that agitation in micro and nanoscale pores is limited. Therefore, the primary mass transport

PAGE 120

107 con cern for electrodeposition of nanowires is diffusion. A rotating disk electrode (RDE) was employed to study the effects of diffusion. A schematic of the experimental setup is shown in Figure 5. 13. The rotating disk, or working electrode is platinum sinc e the nanowires will be plated on a platinum seed layer. A platinum mesh a cts as the counter electrode with an Ag/AgCl reference electrode. The diskss rotation is described in terms of angular velocity. As the disk turns, some of the solution described as the hydrodynamic boundary layer is dragged by the spinning disk and the resulting centrifugal force flings the solution away from the center of the electrode. Solution flows up, perpendicular to the electrode, from the bulk to replace the boundary laye r. The sum result is a laminar flow of solution towards and across the electrode. The rate of the solution flow can be controlled by the electrodes angular velocity and modeled mathematically. This flow can quickly achieve conditions in which the steady st ate current is controlled by the solution flow rather than diffusion. Figure 5. 13. Schematic of rotating disk electrode study

PAGE 121

108 Linear potential voltammograms were plotted from 00 to 500 mV at both low and high convection agitation ( Figures 5.14. and 5.15.) The measurements were made in the plating solution of 50 mM Bi + 30 mM Sb in dimethylsulfoxide (DMSO) at room temperature. Non faradic surface charging of the double layer takes place at lower potentials and transitions to faradaic reduction of bis muth antimony species at higher potentials. The higher agitation reduces the Nernst diffusion layer at the electrode surface, yet very little current is increased by increasing t he electrode RPMs. Furthermore at the highest electrode RPMs, the main diff erence in the current density is the change from double layer charging to activation controlled current. Note that at the highest RPMs the electrical double layer in the area above the working electrode is greatly disturbed. Overall, the rotating disk e lectrode study showed that the deposition of bismuth antimony is not limited by mass transport difficulties. The ability to maintain the correct bismuth antimony concentrations should not be a problem in nanowire growth.

PAGE 122

109 Figure 5.14. Linear voltammo grams with RDE at low agitation

PAGE 123

110 Figure 5.15. Linear voltammog rams with RDE at high agitation Cyclic voltammetry was used to help characterize where current is a function of potential in the electrodeposition setup. Figure 5.16 show overlays of three independent cyclic voltammograms. These graphs show the electroactive ions of 30 mM Sb3+, 50 mM Bi3+, and both Sb3+ + Bi3+ in DMSO at room temperature. From the CV, it is evident that bismuth has a very large reduction potential (3 mA/cm2 at 500 mV) when compared to the reduction potential of antimony ( 0.5 mA/cm2 at 500 mV). When both Bi3+ and Sb3+ ions are reduced, Bi3+ ions dominate the kinetic reaction, depositing at a greater rate than the sluggish Sb3+ ion. In other words, as the potential increases from the open circuit potential, the total cathodic current increases linearly for both bismuth and

PAGE 124

111 antimony with bismuth depositing at a greater rate than antimony. This phenomenon is actually favorable for nanowire growth. Bi(1 x )Sb( x ) nanowires need to possess an Sb content of about 15 percent in order to achieve the highest thermoelectric figure of merit, ZT = 1.2. Since the ionic solution controls the final composition of the nanowires, achieving the proper Bi:Sb ratio was not found to be an issue. Figure 5.16. Cyclic voltammogram overlays of bismuth and antimony in DMSO Electrochemical impedance spectroscopy (EIS) was used to determine the ideal pulse parameters for nanowire growth. This technique was utilized to help explore the electron transfer rate from the electrode (AAO template on Si substrate) to the io n (Bi3+ or Sb3+) EIS was taken with DC signals starting at OCP, then ramping the potential, in 100 mV steps, for each spectrum. Before each scan, the ele ctrochemical system was

PAGE 125

112 polarized at the new potential, and the cell was allowed to stabilize for 120 seconds. Coupled to the each DC potential was a small AC sine wave perturbation with amplitude of 5 mV. The range of the AC frequency scans was initia ted at 100 KHz and finalized at 100 mHz with 10 frequency per decade. The most prominent features in this graph are the decreasing semi circles. This is a sign of the decreasing double layer capacitance and decreasing faradaic resistance as the polarizin g potentials are driven more reducing. These semicircles are characteristic of kinetic control by an electrochemical charge transfer step at the electrodeelectrolyte interface The Nyquist plot ( F igure 5.17.) was used to determine the electrodeposition pulse parameters for nanowire growth. In this case, the charge transfer resistance is the resistance to transfer electrons from the ionic species to the electrode and back again. Activation current is the minimum current needed to get the reaction to star t and for plating to begin. In order to start nanowire growth, the minimum activation current and minimum time constant must be overcome. The double layer cap acitance is formed in front of the working electrode surface. The surface must charge up high enough in order for electrons to pass through the electrical double layer and to the surface for electron trans fer to take place. A large electrical double layer requires a lot of charge, so the pulse needs to be slower to account for this. A sh ort pulse on a large double layer with just charge and discharge the c apacitor and no electrons will be able to get to the plating surface.

PAGE 126

113 Figure 5.17. Nyquist plot f or 50 mM Bi3+ and 50 mM Sb3+ in DMSO The above Nyquist plot was used to determine the diffusion coefficient of Bi3+ Sb3+ using the following equation: red red ox oxD C D C nF RT 1 1 2 1 ) (2 / 1 2 / 1 2 so that, C D nF RT2 / 1 2 / 1 22 ) ( The diffusion coefficient was determined to be 2.4 107 cm/s2. The time constant assume to be equal (25) (26)

PAGE 127

114 begin the nanowire deposition process. A schematic of the electroch emical cell used for Bi(1 x)Sb(x) nanowir e growth is shown in Figure 5.18. The nanowires were deposited via chronopotentiometry. Chronopotentiometry is a controlled current electrochemical method in which a current flows between two electrodes and the potential of the working electrode is monitored as a function of time with respect to the reference electrode. The nanowire applicat ion pulse was at 1.5 mA for 250 ms. A small et ching pulse of 0.25 mA for 2 s. wa s also used as shown in Figure 5.20. Figure 5. 18. Schematic of nanowire electrodeposition setup Chronopotentiometry was utilized to pulse the deposition potential in order to avoid a large Nernst diffusion layer and create more crystalline nanowires. The short onpulse helped emulate nanoscale features during the growth process. It was found that by

PAGE 128

115 including a small etch pulse a better array of nanowires were produced. The reason for this was two fold. First, the 2 sec etch allowed the concentration of ions at the interface to return to the concentration of the bulk solution. This step helped maintain the correct Sb concentration in the nanowires. The 0.25 mA onpulse also aided in the etch of any nanowires that have grown up and out of the porous channels. This additional step kept the surface smooth and the current uniformly distributed in the pores during deposition. Higher deposition pulses create blossoming of Bi(1 x )Sb( x ) over the AAO surface. Once a nanowire reaches the surface of the template the current does not experience any more resistance at that particular pore and increases, while robbing current from the other pores that have not yet completely filled with material. Figure 5.20. shows Bi(1 x )Sb( x ) nanowires grown in an AAO for 3000 cycles.

PAGE 129

116 Figure 5.19. Chronopotentiometric pulse for Bi(1 x )Sb( x ) nanowires in AAO template in 50 mM Bi3+ and 50 mM Sb3+ in DMSO at room temp. Figure 5.20. Top view SEM of Bi(1 x )Sb( x ) nanowires grown out of AAO te mplate at low resolution and same sample at high resolution

PAGE 130

117 5.4.3. Thermoelectric Measurements In order to complete the thermoelectric couple, a hybrid nanowirebulk couple was assembled to measure the properties, as s hown in Figure 5.21. Nanowire lengths determine the magnitude of the thermal gradient. The Sbrich nanowire array described above for ZT measurement produced T = 7 K for only 50 m long samples. This gradient should be greater using optimized nanowires by increasing ZT and length perhaps leading to T never been measured Finally, while typical thermoelectric cooling devices have a T ~ 45 with bulk legs of the correct compositions. At room temperature, the ZT of 0.18 is within the modeled range and would likely increase under completely optimized conditions. Figure 5.21. Schematic of bulk nanowire thermoelectric device

PAGE 131

118 5.5. Summary An odized alumina templates were grown directly on silicon substrates. These templates possessed high density pores which allowed for the nucleation of Bi(1 x)Sbx nanowires. To conclude, fundamental electrochemical studies were carried out on Bi3+, Sb3+, and both cations in order to determine any mass transport issues that may arise during nanowire plating. EIS was used to determine the ideal electrodeposition parameters and the Bi( 1 x )Sb( x ) were successfully fabricated in an anodic aluminum oxide (AAO) template. Bismuth antimony nanowires were deposited using the chronopotentiometry method, where a short etching pulse was used to help maintain nanoscale features of the wires while etching aw ay any overgrowth through the template. The nanowires demonstrated experimental thermoelectric cooling capabilities when fabricated as the p type leg of a thermoelectric device.

PAGE 132

119 CHAPTER 6: CONCLUSIONS A systematic electrochemical based study h as been carried out on one dimensional nanostructures. Nano carbon and bismuth antimony were chosen to represent two examples of the versatility of electrochemical analysis of functional materials at the nanoscale. Nano carbon was chosen as an electrode material for biosensing applications while bismuth antimony nanowires were chosen for the fabrication of a thermoelectric device. A modified carbon nanotube electrode was prepared for detection of DNA from Salmonella enterica serovar Typhimurium using impedimetric sensing techniques. The SWNTs COOH deposited on the glassy carbon provided a rich, active, high surface area matrix for the binding of the aminated ssDNA probe. Target DNA sensing was accomplished by measuring the change in the overall i mpedance of the system as well as measuring the charge transfer resistance. Due to both ssDNA probes and complimentary DNA binding directly onto the electrode surface, the change in charge transfer resistance was a reliable, sensitive activity used to mon itor the performance of the biosensor. The specificity of the functionalized electrode was also investigated by introducing it to both unmatched and one base mismatched sequences. Overall, the impedimetric detection method using a modified carbon nanotube electrode provides a quick, facile label free biosensor which exhibits high sensitivity and selectivity. This electrode was found to be able to detect DNA at 1010 M concentrations.

PAGE 133

120 Boron doped nanocrystalline diamond films were also evaluated for their sensitivity to Salmonella DNA hybridization. They were functionalized in a similar way to SWNTs. First, the BDD was exposed to hydrogen plasma in order to create a surface for carboxyl groups to attach. Once the NH2ssDNA attached to the COOH group s, the electrode was prepared for complementary DNA hybridization. It was found that the modified BDD could detect DNA at 106 M concentrations. This value is not as sensitive as the CNT based electrode because it is believed that the CNTs provide a la rger surface area for the ssDNA to attach. Nonetheless, the BDD still proved to be a reliable DNA sensor. In order to qualitatively observe the complementary strand hybridization on the BDD electrode, fluorescent microscopy was employed. The resulting i mages show that the DNA does not uniformly bond onto cracks or abnormalities in the film, which may be another reason for the less sensitive detection limit of the electrode. Both boron doped and nitrogen incorporated nanocrystalline diamond films were examined for suitability as enzymatic biosensors. Lactic acid was chosen as an appropriate analyte due to its function in many physiobiological processes. The enzyme lactat e oxidase was immobilized onto the functionalized diamond surfaces and amperometric detection was carried out in a phosphate buffer solution. While nitrogen incorporated electrodes did not display a good response, the boron doped electrodes performed very uniformly for lactic acid concentrations of 5 mM to 20 mM. This range is appropriate for lactic acid detection in human blood. Details of the fabrication of anodized aluminum oxide templates and nanowire growth in these templates were demonstrated. Aluminum films on silicon substrates

PAGE 134

121 were successfully anodized and fully characterized using the non destructive method of electro chemical impedance spectroscopy. Equivalent circuit modeling of the EIS data provided useful information about the thickness of the barrier oxide layer of the AAO templates. This information is vital in applying the correct acid concentrations for remova l of the barrier layer and could not be obtained without compromising the sample by other microscopy methods. Fundamental electrochemistry experiments on Bi3+, Sb3+, and both cations in dimethyl sulfoxide w ere carried out to characterize the ideal chronopotential pulse and to determine the thermodynamic, diffusion and mass transport issues when plating Bi( 1 x )Sb( x ) into nano dimension pore structures. Such chronopotentiometry resulted in uniform nanowire growth within porous channels of the AAO template. Finally, the thermoelectric efficiency was measured on the wires to be 0.18, which agrees with the theoretical computational results found in literature.

PAGE 135

122 REFERENCES 1. R. F. Davis, Diamond films and coatings: development, pr operties, and applications (Noyes Pub., Park Ridge, N.J., 1993). 2. S. Iijima, Nature 354, 56 58 (1991). 3. E. W. Wong, P. E. Sheehan and C. M. Lieber, Science 277 (5334), 19711975 (1997). 4. J. Hone, M. Whitney, C. Piskoti and A. Zettl, Physical Revi ew B 59 (4), 25142516 (1999). 5. A. Thess, R. Lee, P. Nikolaev, H. Dai, P. Petit, J. Robert, C. Xu, Y. H. Lee, S. G. Kim, A. G. Rinzler, D. T. Colbert, G. E. Scuseria, D. Tomanek, J. E. Fischer and R. E. Smalley, Science 273 (5274), 483487 (1996). 6. L S. Pan and D. R. Kania, in Diamond: Electronic Properties and Applications The Kluwer international series in engineering and computer science (Kluwer Academic, Boston, 1995). 7. R. Saito, M. Fujita, G. Dresselhaus and M. S. Dresselhaus, Applied Physics Letters 60 (18), 2204 2206 (1992). 8. R. D. Beck, P. S. John, M. M. Alvarez, F. Diederich and R. L. Whetten, J. Phys. Chem. 95, 84028409 (1991). 9. M. M. J. Treacy, T. W. Ebbesen and J. M. Gibson, Nature 381 (6584), 678680 (1996). 10. S. B. Sinnott, Journal of Nanoscience and Nanotechnology 2, 113 123 (2002). 11. X. Yu, D. Chattopadhyay, I. Galeska, F. Papadimitrakopoulos and J. F. Rusling, Electrochemistry Communications 5 (5), 408411 (2003). 12. J. Liu, A. G. Rinzler, H. Dai, J. H. Hafner, R. K. Bradley, P. J. Boul, A. Lu, T. Iverson, K. Shelimov, C. B. Huffman, F. Rodriguez Macias, Y. S. Shon, T. R. Lee, D. T. Colbert and R. E. Smalley, Science 280 (5367), 12531256 (1998).

PAGE 136

123 13. J. J. Gooding, R. Wibowo, Liu, W. Yang, D. Losic, S. Orbons, F. J. M earns, J. G. Shapter and D. B. Hibbert, Journal of the American Chemical Society 125 (30), 90069007 (2003). 14. J. Weber, A. Kumar and S. Bhansali, Sensors and Actuators B: Chemical 117 (1), 308313 (2006). 15. R. N. Hegde, R. R. Hosamani and S. T. Nandibewoor, Colloids and Surfaces B: Biointerfaces 72 (2), 259 265 (2009). 16. C. Lynam, N. Gilmartin, A. I. Minett, R. O'Kennedy and G. Wallace, Carbon 47 (10), 23372343 (2009). 17. C. Batchelor McAuley, G. G. Wildgoose and R. G. Compton, Biosensors and B ioelectronics 24 (11), 31833190 (2009). 18. G. Pastor Moreno and D. J. Riley, Electrochimica Acta 47 (16), 25892595 (2002). 19. G.M. Swain, A.B. Anderson and J. C. Angus, MRS Bulletin 23 (9), 5660 (1998). 20. X. Sun, Z. Zhang and M. S. Dresselhaus, A pplied Physics Letters 74 (26), 40054007 (1999). 21. Y. M. Lin, X. Sun and M. S. Dresselhaus, Physical Review B 62 (7), 4610 (2000). 22. D. M. Rowe, CRC Handbook of Thermoelectrics (CRC Press, New York, 1995). 23. A. L. Jain, Physical Review 114 (6), 1518 (1959). 24. O. Rabina, Y.M. Lin and M. S. Dresselhaus, Appl. Phys. Lett. 79 (1), 8183 (2001). 25. J. P. O'Sullivan and G. C. Wood, Proc. R. Soc. London A 317, 511543 (1970). 26. O. Jessensky, F. Muller and U. Gosele, Applied Physics Letters 72 ( 10), 11731175 (1998). 27. H. Masuda, H. Yamada, M. Satoh, H. Asoh, M. Nakao and T. Tamamura, Applied Physics Letters 71 (19), 27702772 (1997). 28. H. Masuda and K. Fukuda, Science 268, 1466 1468 (1995). 29. F. Li, L. Zhang and R. M. Metzger, Chem. Mat er. 10 (9), 24702480 (1998).

PAGE 137

124 30. A. D. Berry, R. J. Tonucci and M. Fatemi, Applied Physics Letters 69 (19), 28462848 (1996). 31. W. J. Yeh, B. Cheng and B. L. Justus, Physica C: Superconductivity 388389, 433434 (2003). 32. R. J. Tonucci, D. H. Pearson, D. S. Katzer, A. Rosenberg and H. B. Dietrich, Superlattices and Microstructures 20 (4), 627632 (1996). 33. A. Ursache, J. T. Goldbach, T. P. Russell and M. T. Tuominen, presented at the 49th Annual Conference on Magnetism and Magnetic Materials, Jack sonville, Florida (USA), 2005 (unpublished). 34. T. ThurnAlbrecht, J. Schotter, G. A. Kastle, N. Emley, T. Shibauchi, L. KrusinElbaum, K. Guarini, C. T. Black, M. T. Tuominen and T. P. Russell, Science 290 (5499), 21262129 (2000). 35. T. W. Cornelius, J. Brtz, N. Chtanko, D. Dobrev, G. Miehe, R. Neumann and M. E. T. Molares, Nanotechnology 16, S246S249 (2005). 36. Z. a. Hu, T. Xu, R. j. Liu and H. l. Li, Materials Science and Engineering A 371, 236240 (2004). 37. C. Liu, J. A. Zapien, Y. Yao, X. M eng, C. S. Lee, S. Fan, Y. Lifshitz and S. T. Lee, Advanced Materials 15 (10), 838841 (2003). 38. D. Zhou, E. V. Anoshkina, L. Chow and G. Chai, Carbon 44 (5), 10131016 (2006). 39. N. Li, X. Li, X. Yin, W. Wang and S. Qiu, Solid State Communications 132 (12), 841844 (2004) 40. M. V. Rastei, R. Meckenstock, J. P. Bucher, E. Devaux and T. Ebbesen, Applied Physics Letters 85 (11), 20502052 (2004). 41. M. A. Ghanem, P. N. Bartlett, P. de Groot and A. Zhukov, Electrochemistry Communications 6 (5), 447453 (2004). 42. Y. Luo, Z. Hou, D. Jin, J. Gao and X. Zheng, Materials Letters 60, 393395 (2006). 43. X. Xu, L. Chen, C. Wang, Q. Yao and C. Feng, Journal of Solid State Chemistry 178 (6), 21632166 (2005).

PAGE 138

125 44. P. D. McGary and B. J. H. Stadler, present ed at the 49th Annual Conference on Magnetism and Magnetic Materials, Jacksonville, Florida (USA), 2005 (unpublished). 45. M. Tian, J. Wang, J. Snyder, J. Kurtz, Y. Liu, P. Schiffer, T. E. Mallouk and M. H. W. Chan, Applied Physics Letters 83 (8), 1620 1622 (2003). 46. D. Routkevitch, T. Bigioni, M. Moskovits and J. M. Xu, J. Phys. Chem. 100 (33), 1403714047 (1996). 47. T. E. Huber, O. Onakoya and M. H. Ervin, Journal of Applied Physics 92 (3), 13371343 (2002). 48. E. W. Washburn, Physical Review 17, 273283 (1921). 49. Y. Zhou, C. Shen and H. Li, Solid State Ionics 146 (12), 8186 (2002). 50. Y. K. Zhou, J. Huang and H. L. Li, Applied Physics A: Materials Science & Processing 76 (1), 5357 (2003). 51. Z. Yang, Y. Huang, B. Dong and H.L. Li, Journal of Solid State Chemistry 178 (4), 11571164 (2005). 52. Y. Lin, G. S. Wu, X. Y. Yuan, T. Xie and L. D. Zhang, Journal of Physics: Condensed Matter 15, 29172922 (2003). 53. B. Cheng and E. T. Samulski, Journal of Materials Chemistry 11 (12), 29012902 (2001). 54. H. Xu, D. H. Qin, Z. Yang and H. L. Li, Materials Chemistry and Physics 80 (2), 524528 (2003). 55. R. S. Wagner and W. C. Ellis, Applied Physics Letters 4 (5), 8990 (1964). 56. Y. Wu and P. Yang, J. Am. Chem. Soc. 123 (13), 31653166 (2001). 57. M. S. Gudiksen and C. M. Lieber, J. Am. Chem. Soc. 122 (36), 88018802 (2000). 58. M. Wei, D. Zhi and J. L. MacManus Driscoll, Nanotechnology 16 (8), 13641368 (2005). 59. D. Calestani, M. Zha, G. Salviati, L. Lazzarini, L. Zanotti, E. Comi ni and G. Sberveglieri, Journal of Crystal Growth 275 (12), e2083e2087 (2005).

PAGE 139

126 60. Y. Q. Chen, J. Jiang, B. Wang and J. G. Hou, Journal of Physics D: Applied Physics 37 (23), 3319 3322 (2004). 61. Y. Yin, G. Zhang and Y. Xia, Advanced Functional Materials 12 (4), 293298 (2002). 62. H. Shin, D. B. Thomson, R. Schlesser, R. F. Davis and Z. Sitar, Journal of Crystal Growth 241 (4), 404415 (2002). 63. B. A. Wacaser, K. Deppert, L. S. Karlsson, L. Samuelson and W. Seifert, Journal of Crystal Growth 287 (2), 504508 (2006). 64. H. D. Park, S. M. Prokes and R. C. Cammarata, Applied Physics Letters 87 (6), 063110063113 (2005). 65. S. Bhunia, T. Kawamura, Y. Watanabe, S. Fujikawa and K. Tokushima, Applied Physics Letters 83 (16), 33713373 (2003). 66. H. Y. Lu, S.Y. Chu and C.C. Chang, Journal of Crystal Growth 280 (12), 173178 (2005). 67. S. K. Chan, Y. Cai, I. K. Sou and N. Wang, Journal of Crystal Growth 278 (14), 146150 (2005). 68. T. Gao and T. Wang, J. Phys. Chem. B 108 (52), 2004520049 (2004). 69. C. X. Shan, Z. Liu and S. K. Hark, Nanotechnology 16 (12), 31333136 (2005). 70. X. L. Fu, L. H. Li and W. H. Tang, Solid State Communications 138 (3), 139142 (2006). 71. Y. Wu, Y. Cui, L. Huynh, C. J. Barrelet, D. C. Bell and C. M. Liebe r, Nano Lett. 4 (3), 433436 (2004). 72. A. M. Morales and C. M. Lieber, Science 279 (5348), 208211 (1998). 73. Y. J. Zeng, Z. Z. Ye, W. Z. Xu, L. P. Zhu and B.H. Zhao, Applied Surface Science 250 (1 4), 280283 (2005). 74. W. Xu, Z. Ye, L. Zhu, Y. Zeng, L. Jiang and B. Zhao, Journal of Crystal Growth 277 (14), 490495 (2005). 75. X. C. Wu and Y. R. Tao, Journal of Crystal Growth 242 (34), 309312 (2002). 76. K. Balasubramanian and M. Burghard, Small 1 (2), 180192 (2005).

PAGE 140

127 77. G. Gautam, F. L. De epak, A. Govindaraj and C. N. R. Rao, Topics in Catalysis 24 (1), 137146 (2003). 78. Y. C. Lin and W.T. Lin, Nanotechnology 16 (9), 16481654 (2005). 79. K. H. Lee, S. W. Lee, R. R. Vanfleet and W. Sigmund, Chemical Physics Letters 376 (34), 498503 ( 2003). 80. T. J. Trentler, K. M. Hickman, S. C. Goel, A. M. Viano, P. C. Gibbons and W. E. Buhro, Science 270 (5243), 17911794 (1995). 81. T. J. Trentler, S. C. Goel, K. M. Hickman, A. M. Viano, M. Y. Chiang, A. M. Beatty, P. C. Gibbons and W. E. Buhro, J. Am. Chem. Soc. 119 (9), 21722181 (1997). 82. J. D. Holmes, K. P. Johnston, R. C. Doty and B. A. Korgel, Science 287 (5457), 14711473 (2000). 83. L. Vayssieres, Advanced Materials 15 (5), 464 466 (2003). 84. Y. Sun, N. George Ndifor Angwafor, D. Ja son Riley and M. N. R. Ashfold, Chemical Physics Letters In Press, Corrected Proof. 85. Y. Gao, Z. Wang, J. Wan, G. Zou and Y. Qian, Journal of Crystal Growth 279 (34), 415419 (2005). 86. G. H. Yue, P. X. Yan, D. Yan, X. Y. Fan, M. X. Wang, D. M. Qu and J. Z. Liu, Applied Physics A: Materials Science & Processing V84 (4), 409412 (2006). 87. Y. X. Zhang, G. H. Li, Y. X. Jin, Y. Zhang, J. Zhang and L. D. Zhang, Chemical Physics Letters 365 (3 4), 300304 (2002). 88. J. R. Heath and F. K. LeGoues, Che mical Physics Letters 208 (3 4), 263268 (1993). 89. W. Qingqing, X. Gang and H. Gaorong, Journal of Solid State Chemistry 178 (9), 26802685 (2005). 90. Y. Xie, Y. Qian, W. Wang, S. Zhang and Y. Zhang, Science 272 (5270), 19261927 (1996). 91. Y. Xie, Y. Qian, W. Wang and G. Zhou, Chin. J. Chem. Phys. 1, 39 (1997). 92. Y. D. Li, X. F. Duan, Y. T. Qian, L. Yang, M. R. Ji and C. W. Li, J. Am. Chem. Soc. 119 (33), 78697870 (1997).

PAGE 141

128 93. Q. Wang, D. Pan, S. Jiang, X. Ji, L. An and B. Jiang, Journal of Cryst al Growth 286 (1), 8390 (2006). 94. X. Peng, L. Manna, W. Yang, J. Wickham, E. Scher, A. Kadavanich and A. P. Alivisatos, Nature 404 (6773), 5961 (2000). 95. B. Gates, B. Mayers, B. Cattle and Y. Xia, Advanced Functional Materials 12 (3), 219227 (2002). 96. B. Gates, Y. Yin and Y. Xia, J. Am. Chem. Soc. 122 (50), 1258212583 (2000). 97. E. Braun, Y. Eichen, U. Sivan and G. BenYoseph, Nature 391 (6669), 775778 (1998). 98. J. Richter, M. Mertig, W. Pompe, I. Monch and H. K. Schackert, Applied Physics Letters 78 (4), 536 538 (2001). 99. H. Q. Wu, X.W. Wei, M.W. Shao, J.S. Gu and M.Z. Qu, Journal of Materials Chemistry 12 (6), 1919 1921 (2002). 100. C. H. Kiang, J. S. Choi, T. T. Tran and A. D. Bacher, J. Phys. Chem. B 103 (35), 74497451 ( 1999). 101. Y. Zhang, J. Liu, R. He, Q. Zhang, X. Zhang and J. Zhu, Chemical Physics Letters 360 (56), 579584 (2002). 102. Y. Zhang, J. Zhu, Q. Zhang, Y. Yan, N. Wang and X. Zhang, Chemical Physics Letters 317 (35), 504509 (2000). 103. W. Han, S. Fa n, Q. Li, B. Gu, X. Zhang and D. Yu, Applied Physics Letters 71 (16), 22712273 (1997). 104. C. Tang, S. Fan, M. L. d. l. Chapelle, H. Dang and P. Li, Advanced Materials 12 (18), 13461348 (2000). 105. H. Dai, E. W. Wong, Y. Z. Lu, S. Fan and C. M. Liebe r, Nature 375 (6534), 769772 (1995). 106. H. Q. Wu, X.W. Wei, M.W. Shao and J.S. Gu, Journal of Crystal Growth 265 (1 2), 184189 (2004). 107. G. Xie, Z. Wang, G. Li, Y. Shi, Z. Cui and Z. Zhang, Materials Letters In Press, Uncorrected Proof.

PAGE 142

129 108. C Mao, D. J. Solis, B. D. Reiss, S. T. Kottmann, R. Y. Sweeney, A. Hayhurst, G. Georgiou, B. Iverson and A. M. Belcher, Science 303 (5655), 213217 (2004). 109. K. Besteman, J. O. Lee, F. G. M. Wiertz, H. A. Heering and C. Dekker, Nano Lett. 3 (6), 727730 (2003). 110. Y. Cui and C. M. Lieber, Science 291 (5505), 851 853 (2001). 111. N. Fellmann, R. Fabry and J. Coudert, Am. J. Physiol. Heart Circ Physiol. 257, 395398 (1989). 112. F. Lisdat and D. Schfer, Analytical and Bioanalytical Chemistry 391 (5), 15551567 (2008). 113. S. Jain, S. A. Bidol, J. L. Austin, E. Berl, F. Elson, M. Lemaile Williams, M. D. 3rd, M. E. Moll, V. Rea, J. D. Vojdani, P. A. Yu, R. M. Hoekstra, C. R. Braden and M. F. Lynch, Clinical Infectious Disease 48, 1065 (2009). 114. C. Maynard, F. Berthiaume, K. Lemarcharnd, J. Harel, P. Payment, P. Bayardelle, L. Mason and R. Brousseau, Applied and Environmental Microbiology 71, 8548 (2005). 115. L. Tang, C. Tsai, W. W. Gerberich, L. Kruckeberg and D. R. Kania, Biomaterials 16 (6) 483488 (1995). 116. W. Yang, O. Auciello, J. E. Butler, W. Cai, J. A. Carlisle, J. E. Gerbi, D. M. Gruen, T. Knickerbocker, T. L. Lasseter, J. N. Russell, L. M. Smith and R. J. Hamers, Nat Mater 1 (4), 253 257 (2002). 117. A. Hartl, E. Schmich, J. A. Garrido, J. Hernando, S. C. R. Catharino, S. Walter, P. Feulner, A. Kromka, D. Steinmuller and M. Stutzmann, Nat Mater 3 (10), 736742 (2004). 118. J. Wang, M. A. Firestone, O. Auciello and J. A. Carlisle, Langmuir 20 (26), 1145011456 (2004). 119. J. Sc hwan, S. Ulrich, V. Batori, H. Ehrhardt and S. R. P. Silva, Journal of Applied Physics 80 (1), 440 447 (1996). 120. J. Wang and J. A. Carlisle, Diamond and Related Materials 15 (23), 279284 (2006). 121. R. J. Cava, Science 247 (4943), 656662 (1990).

PAGE 143

130 122. M. S. Dresselhaus, G. Chen, M. Y. Tang, R. G. Yang, H. Lee, D. Z. Wang, Z. F. Ren, J.P. Fleurial and P. Gogna, Advanced Materials 19 (8), 10431053 (2007). 123. O. Rabin, Y.M. Lin and M. S. Dresselhaus, Applied Physics Letters 79 (1), 8183 (2001). 124. M. R. Kalantary, D. R. Gabe and D. H. Ross, Journal of Applied Electrochemistry V22 (3), 268276 (1992).

PAGE 144

ABOUT THE AUTHOR Jessica Eileen Weber received her BSME in 2003 and MSME in 2005 from the University of South Florida. In 2005, she began her doctoral research in the synthesis and characterization of functionalized nanomaterials for energy and chemical/biological sensing applications. In particular, she is interested in impedimetric analysis of nanomaterials. In 2006, Jessica obtained a prestigious internship at Sandia National Laboratories in Albuquerque, NM to study the electrochemical growth of Bi( 1 x )Sb( x ) nanowires for thermoelectric applications. She has been the recipient of two National Science Foundation awards: an IGERT Fellowship (2004 2006) and a GK 12 Fellowship (2006 2010). Jessica has also published numerous papers in peer reviewed journals Upon completion of her doctoral degree, Jessica would like to obtain a position as a postdoctoral scholar and eventually become a Professor of mechanical engineering.


xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam 22 Ka 4500
controlfield tag 007 cr-bnu---uuuuu
008 s2010 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0004592
035
(OCoLC)
040
FHM
c FHM
049
FHMM
090
XX9999 (Online)
1 100
Weber, Jessica.
0 245
Functional nanomaterials with an electrochemistry-based approach to sensing and energy applications
h [electronic resource] /
by Jessica Weber.
260
[Tampa, Fla] :
b University of South Florida,
2010.
500
Title from PDF of title page.
Document formatted into pages; contains X pages.
502
Dissertation (PHD)--University of South Florida, 2010.
504
Includes bibliographical references.
516
Text (Electronic thesis) in PDF format.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
3 520
ABSTRACT: In the past decade, the use of nanotechnology as a tool to develop and fabricate new structures and devices for biological sensing and energy applications has become increasingly widespread. In this work, a systematic study has been performed on one-dimensional nanomaterials, with a focus on the development of miniaturized devices with a "bottom up" approach. First, members of the nano carbon family are utilized for biosensing applications; in particular, carbon nanotubes as well as nitrogen doped and boron doped nanocrystalline diamond (NCD) films. These carbon based materials possess several unique electrochemical properties over other conductive materials which make them suitable for biosensing applications. Single walled carbon nanotubes were deposited on a glass carbon electrode and modified for the detection of Salmonella DNA hybridization. Electrochemical impedance spectroscopy (EIS) was used as the method of detection and a detection limit of 10-9 M was achieved. Nanocrystalline diamond was grown using a microwave enhanced plasma chemical vapor deposition method. The diamond electrodes were doped with either boron or nitrogen to provide substrates and characterization was performed using scanning electron microscopy, atomic force microscopy, Raman spectroscopy, Fourier transform infrared spectroscopy, UV-vis spectroscopy, as well as by electrochemical methods. Modified boron doped NCD was able to detect Salmonella DNA hybridization via EIS and fluorescent microscopy. The detection limit for these genosensors was found to be 0.4 M complementary DNA. Boron doped and nitrogen incorporated nanocrystalline diamond also served as functionalized electrodes for lactic acid detection. It was found that the boron doped electrodes could detect 0.5 mM lactic acid in a phosphate buffer solution. Second, bismuth antimony nanowires were grown in an anodized alumina template for the fabrication of a thermoelectric cooling device. Bismuth antimony nanowires were chosen due to their high thermoelectric efficiency compared to their bulk material counterpart. The development of a successful anodized template was achieved and EIS was used to diagnose the optimal etch parameters of the barrier oxide layer for nanowire growth. Bismuth antimony nanowires were grown directly on a silicon substrate and a thermoelectric cooling device was fabricated. The nanowires exhibited a thermoelectric efficiency of 0.18 at room temperature.
590
Advisor: Ashok Kumar, Ph.D.
653
Biosensor
DNA
Nanocrystalline diamond
Carbon nanotube
Thermoelectric
690
Dissertations, Academic
z USF
x Mechanical Engineering
Masters.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.4592