USF Libraries
USF Digital Collections

Characterization of unidentified viruses from florida

MISSING IMAGE

Material Information

Title:
Characterization of unidentified viruses from florida
Physical Description:
Book
Language:
English
Creator:
Dyer, Jessie
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Arbovirus
SISPA
Flanders virus
Mosquito surveillance
Dissertations, Academic -- Global Health -- Masters -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: Public Health and clinical laboratories occasionally obtain viral isolates that cannot be typed by routine methods. Therefore, the sequence-independent, single primer amplification (SISPA) technique was adapted to rapidly identify and characterize viral isolates of unknown etiology. A panel of known (West Nile virus and St. Louis encephalitis virus) and unknown viral isolates (environmental samples collected in Florida) were used to develop and refine the SISPA technique. Selectivity for viral genomic sequences was obtained through enriching viral particles by centrifugation, removal of cellular debris by filtration and removal of host genomic material by benzonase application. The SISPA method successfully amplified the panel of known viruses and a previously unknown environmental viral isolate. The previously unknown environmental viral isolate was determined to be closely related, if not identical, to Flanders virus, a member of Rhabdoviradae. A Flanders virus specific RT-PCR assay identified a total of five previously unknown environmental viral isolates as Flanders virus. Unidentified viral isolates were obtained during arbovirus surveillance efforts in Florida, either from the Florida Department of Health program (BOL-Tampa) during 2005 - 2009, or collected during an ongoing project at the University of vi South Florida studying the ecology of arthropod-borne encephalitis viruses at sites located in Florida. In a concurrent study, SISPA was successfully used to characterize an unidentifiable virus isolate related to members of the Bunyaviradae family which was designated as Infirmatus virus. Natural mosquito population (10,557 mosquitoes) collected in Florida was screened for Flanders virus and members of Bunyaviradae to determine infection prevalence. Although Flanders virus was not detected in this population, Infirmatus virus was identified in 14 mosquito pools with the highest infection prevalence in Cx. quinquefasciatus mosquitoes. The SISPA technique was successful for the genetic identification of unknown viral isolates and application of this method to samples with suspected or unidentified viral etiologies may be used to enhance public health surveillance of emerging or re-emerging viruses in Florida.
Thesis:
Thesis (MSPH)--University of South Florida, 2010.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Jessie Dyer.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains X pages.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
usfldc doi - E14-SFE0004660
usfldc handle - e14.4660
System ID:
SFS0027975:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam 22 Ka 4500
controlfield tag 007 cr-bnu---uuuuu
008 s2010 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0004660
035
(OCoLC)
040
FHM
c FHM
049
FHMM
090
XX9999 (Online)
1 100
Dyer, Jessie.
0 245
Characterization of unidentified viruses from florida
h [electronic resource] /
by Jessie Dyer.
260
[Tampa, Fla] :
b University of South Florida,
2010.
500
Title from PDF of title page.
Document formatted into pages; contains X pages.
502
Thesis (MSPH)--University of South Florida, 2010.
504
Includes bibliographical references.
516
Text (Electronic thesis) in PDF format.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
3 520
ABSTRACT: Public Health and clinical laboratories occasionally obtain viral isolates that cannot be typed by routine methods. Therefore, the sequence-independent, single primer amplification (SISPA) technique was adapted to rapidly identify and characterize viral isolates of unknown etiology. A panel of known (West Nile virus and St. Louis encephalitis virus) and unknown viral isolates (environmental samples collected in Florida) were used to develop and refine the SISPA technique. Selectivity for viral genomic sequences was obtained through enriching viral particles by centrifugation, removal of cellular debris by filtration and removal of host genomic material by benzonase application. The SISPA method successfully amplified the panel of known viruses and a previously unknown environmental viral isolate. The previously unknown environmental viral isolate was determined to be closely related, if not identical, to Flanders virus, a member of Rhabdoviradae. A Flanders virus specific RT-PCR assay identified a total of five previously unknown environmental viral isolates as Flanders virus. Unidentified viral isolates were obtained during arbovirus surveillance efforts in Florida, either from the Florida Department of Health program (BOL-Tampa) during 2005 2009, or collected during an ongoing project at the University of vi South Florida studying the ecology of arthropod-borne encephalitis viruses at sites located in Florida. In a concurrent study, SISPA was successfully used to characterize an unidentifiable virus isolate related to members of the Bunyaviradae family which was designated as Infirmatus virus. Natural mosquito population (10,557 mosquitoes) collected in Florida was screened for Flanders virus and members of Bunyaviradae to determine infection prevalence. Although Flanders virus was not detected in this population, Infirmatus virus was identified in 14 mosquito pools with the highest infection prevalence in Cx. quinquefasciatus mosquitoes. The SISPA technique was successful for the genetic identification of unknown viral isolates and application of this method to samples with suspected or unidentified viral etiologies may be used to enhance public health surveillance of emerging or re-emerging viruses in Florida.
590
Advisor: Thomas Unnasch, Ph. D.
653
Arbovirus
SISPA
Flanders virus
Mosquito surveillance
690
Dissertations, Academic
z USF
x Global Health
Masters.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.4660



PAGE 1

Characterization of Unidentified V iruses from Florida by Jessie L. Dyer A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science in Public Health Department of Global Health College of Public Health Univers ity of South Florida Major Professor: Thomas Unnasch, Ph.D. Lillian M. Stark, Ph.D. Azliyati Azizan, Ph.D. Date of Approval: July 12, 2010 Keywords: Arbovirus, SISPA, Flanders virus, mosquito surveillance Copyright 2010, Jessie L. Dyer

PAGE 2

Dedication To Mary and Steve Dyer, biscuits and Thai food has made everything that much better.

PAGE 3

Acknowledgements T hank you to my major advisor, Dr. Unnasch, for his guidance, time and advice. Sincere thanks to Dr. Christy Ottendorfer. This thesis would not have been possible without her guidance. Thank you to Gregory White for his technical guidance and endless patience. Special thanks to Dr. Stark for providing several of the isolates used in this study and fo r her expertise in Virology and Public Health. I would like to thank Dr. Azizan for her continual support during my time at USF. T hank you to everyone in the TRU lab for their assistance and contributions to this research. Finally, I thank my parents for instilli ng in me confidence a nd curiosity.

PAGE 4

i Table of Contents List of Tables ................................ ................................ ................................ ........ iii List of Figures ................................ ................................ ................................ ....... iv Abstract ................................ ................................ ................................ ........ v Introduction ................................ ................................ ................................ ........ 1 Objectives ................................ ................................ ................................ ...... 12 Materials and Methods ................................ ................................ ....................... 14 Viruses ................................ ................................ ................................ ..... 14 Mosquito trapping and sorting ................................ ................................ .. 14 Mosquito Processing ................................ ................................ ................ 17 RT PCR Screening Panel ................................ ................................ ........ 22 SISPA Sample Prep aration ................................ ................................ ...... 22 Viral Nucleic Acid Isolation and Amplification ................................ .......... 23 Cloning ................................ ................................ ................................ ..... 24 Sequence Anal ysis ................................ ................................ .................. 2 7 Virus Culture Confirmation ................................ ................................ ....... 2 8 Results ................................ ................................ ................................ ...... 31 SISPA Validation ................................ ................................ ..................... 31 SISPA Optimization ................................ ................................ ................. 3 4 Identification of Viral Isolates ................................ ................................ ... 3 5 Flanders Virus ................................ ................................ ............... 3 5 Phl y ogenetic analysis of Flanders virus isolates ........................... 3 9 Infimatus Virus ................................ ................................ ......................... 4 2 Ph y logenetic analysis of Infimatus virus isolates .......................... 44 Discussion ................................ ................................ ................................ ...... 4 7 References ................................ ................................ ................................ ...... 5 7

PAGE 5

ii Appendices ................................ ................................ ................................ ...... 6 6 Appendix A: Media Components ................................ ............................. 6 7 Appendix B: BOL Tampa environmental isolate screening panel for endemic Arboviruses ................................ ..................... 6 9 Appendix C: RT PCR Assays used for identity confirmation .................... 7 1 About the Author ................................ ................................ ..................... End Page

PAGE 6

iii List of T ables Table 1: Unidentified v ir al i solates and control strain s ................................ ....... 15 Table 2: Mosquito abundance at surveillance sites and p ercentage of mosquitoes screened ................................ ................................ ........... 1 7 Table 3: Alignment of SLEV beAN 156204 fragments obtained from SISP A method identified to genomic segments ................................ .. 3 3 Table 4: SISPA Validation using control viral strains ................................ ......... 3 4 Table 5 : Optimization of SISPA using control vira l strains ................................ .. 3 5 Table 6 : Flanders virus positive mosquito pools, BOL Tampa archive .............. 3 8 Table 7 : Estimates of Evolutionary Divergence between Sequences of Members of Rhabdoviradae and Flanders virus isolates ................. 41 Table 8 : Infirmatus virus positive mosquito poo ls iso lates, Field Surveillance (2008 ) ................................ ................................ .............. 4 3 Table 9: Infirmatus virus prevalence at the Ta mpa Bay Downs surveillance site (2008) ................................ ................................ ........ 4 4 Table 10: Estimates of Evolutionary Divergence between Sequences of Members of Bunyaviradae and Infirmatus virus isolates. ................. 4 5

PAGE 7

iv List of F igures Figure1: Sch ematic representation of RT PCR ................................ .................... 7 Figure 2 : Schematic of SISPA ................................ ................................ ............ 10 Figure 3 : Number of mosquitoes collected from Tampa Bay Downs (2008) ....... 19 Figure 4: Number of mosquitoes collected from Eureka Springs (2008) ............ 20 Figure 5 : Number of mo squitoes collected from Walton C ounty (2009) ............. 21 Figure 6: An overview of SISPA application ................................ ........................ 2 6 Figure 7: Evaluation of SISPA Method ................................ ................................ 3 2 Figure 8 : Flanders Virus RT PCR Assay ................................ ............................ 3 7 Figure 9 : Phylogenetic tree of Flanders virus isolates, M gene ........................... 40 Figure 10 : Phylogenetic tree of Infimatus virus isolates, M segment .................. 4 6

PAGE 8

v Characterization of U nidentified V iruses from Florida Jessie L. Dyer Abstract Public Health and clinical laboratories occasionally ob tain viral isolates that cannot be typed by routine methods Therefore, the sequence independent, single primer amplification (SISPA) technique was adapted to rapidly identify and characterize viral isolates of unknown etiolog y. A panel of known (West Nile virus and St. Louis encephalitis v irus) and unknown viral isolates (environmental samples collected in Florida) were used to develop and refine the SISPA technique. Selectivity for viral genomic sequences was obtained through enriching viral particles by centrifugation, removal of cellula r debris by filtration and remov al of host genomic material by benzonase application. The SISPA method successfully amplified the panel of known viruses and a p reviously unknown environmental viral isolate The previously unknown environmental viral isola te was determined to be closely related, if not identical, to Flanders virus, a member of Rhabdoviradae A Flanders virus specific RT PCR assay identified a total of five previously unknown environmental viral isolates as Flanders virus. Unidentified vira l isolates were obtained during arbovirus surveillance efforts in Florida, either from the Florida Department of Health program ( BOL Tampa ) during 2005 2009 or collected during an ongoing project at the University of

PAGE 9

vi South Florida studying the ecology o f arthropod borne encephalitis viruses at sites located in Florida. In a concurrent study, SISPA was successfully used to characterize an unidentifiable virus isolate related to members of the Bunyaviradae family which was desi gnated as Infirmatus virus. N atural mosquito population (10,557 mosquitoes) collected in Florida was screened for Flanders virus and members of Bunyaviradae to determine infection prevalence. Although Flanders virus was not detected in this population, Infirmatus virus was identified in 14 mosquito pools with the highest infection prevalence in Cx. quinquefasciatus mosquitoes The SISPA technique was successful for the genetic identification of unknown viral isolates and application of this method to samples with suspected or unidentif ied viral etiologies may be used to enhance public health surveillance of emerging or re emerging viruses in Florida.

PAGE 10

1 Introduction Glo bal epidemic arboviral activity has increased during the 20 th century M any of these epidemics were caused by viruses that were either thought to have be en controlled and no longer a public health threat, or not considered of public healt h importance (Gubler 2002) Recent identification of previous unknown and re emerging arboviruses has included the resurgence of Dengue fever in the United States in 2009 and the introduction of West Nile virus to North America in 1999 (Nash, Mostashari et al. 2001; CDC 2010) Public health and clinical diagnostic laboratories occasionally obtain environmental samples that fail to be typed by common cell culture, serological methods ( such as hemagglut ination inhibition and com plement fixation assays) or nucleic acid tests. In addition, agents collected during an outbreak may be misdiagnosed based on the presentation of similar clinical findings or cross reactive test results This may occur when closel y related vir uses circulate in the same area such as in the case of West Nile virus and St. Louis encephalitis virus (Calisher, Lazuick et al. 1980; Pesko and Mores 2009) Novel viruses that may cross species barrie rs, such as Influenza A subtype H5N1, and the emergence of antibiotic resistant bacteria, such as Vancomycin resistant Enterococcus faecium (VRE) have also challenged the scientific community, clinicians, and public health professionals to rapidly respond to identify, treat and prevent/control these new pathogens (Jones, Patel et al. 2008) As a result, rapid diagnostic

PAGE 11

2 techniques for clinical and field samples of unknown etiology are needed to safeguard public health. Vir uses are obligate intracellular pa rasites of virtually all living organisms (Levine 2001) Viruses have either DNA or RNA as their geneti c material and can be s ingle or double stranded (Clark 2005) All viruses possess a caps id in which the v iral nucleic acid is enclosed (Clark 2005) The capsid is co nstructed o f identical subunits designated capsomers and can be assembled into different shapes, such as helical and icos a hedral (Clark 2005) Historically, viral tax onomy was classified by disease, clinical symptoms or characterized in regard to their size which can range from 20 nm to 450 nm in diameter (Levine 2001) Currently, molecular techniques have allowed for the reclassification by the comparison of genes and genomic sequences. The International Committee on the Taxonomy of Vir uses (ICTV) has developed an internationally agreed upon taxonomy and nomenclature for viruses based on the hierarchical levels of order, family, subfamily, genus and species (Condit 2001) Viral strains can be classified in subtypes based on antige n ic characteristics. Arboviruses (arthropod borne viruses) are globally distributed and typically found in tropical areas where the climate permits year round trans mission by cold blooded arthropods (Gubler 1996; Gubler 2002) These viruses are of considerable public health importance due to their ability to cause epidemics and produce viremia in humans (Gubler 2002) Arboviruses require a minimum of two hosts and blood sucking arthropods to complete their lifecycle (WHO 1985)

PAGE 12

3 Arboviruses are taxonomically diverse and belong to eight families and fourteen genera. Only a small percent have been documented to cause disease in humans. The arboviruses that ar e medically important for humans belong to three virus families: the Bunyaviridae Flaviviridae and Togaviridae (Gubler 2002) As a result of the extensive arbovirus surveillance program in Florida, several arboviruses, such as Highland s J, Tenesaw, Tamiami, and Keystone virus have been identified (Lewis, Hammon et al. 1965; Jennings, Lewis et al. 1970; Bigler, Lassing et al. 1975) The identification of new arboviruses is a reminder that health professionals must remain vigilant for the emergence or re emergence of infectious diseases. The prevention and control of arboviral disease depends upon identifying and monitoring vertebrate host and vector species involved in spring amplification and mo nitoring the sequence of events and forces that lead to epizootics or epidemics (Moore 1993) Molecular detection and virus isolation methods are frequen tly used to identify arbovirus circulation in the mosquito population (Bae, Nitsche et al. 2003; Ayers, Adachi et al. 2006; Re, Spinsanti et al. 2008) On the other hand, transmission rates to sentinel animals may b e monitored using serological assays to detect exposure (Nemeth, Dwyer et al. 2009; O'Brien, Meteyer et al. 2010) Many states maintain surveillance programs and perform risk assessments to alert the public and impl ement control measures when arbovirus activity is high (Moore 1993) Surveillan ce programs are essential in monitoring the levels of virus activity, vect or populations, infections in vertebrate hosts, human cases, weather, and other factors to detect

PAGE 13

4 or predict changes in the transmission dynamics of arboviruses (Moore 1993) Due to the complex life cycles of arboviruses, simultaneous data collection is needed in order to quantify arbovirus activity. Florida has utilized sentinel chickens to detect arboviral activity throughout the state since 1978 for end emic viruses (Nelson, Kappus et al. 1983) Historically, 2 to 4 day old suckling mice were the primary host system used for recovering virus from mosquito (Bond, Hammon et al. 1966) Currently, p ool screening, which is when adult mosquitoes are sorted by species and sex and placed in one tube, is a commonly utilized method in monitoring for arbovirus infections in field collected mosquitoes (Armstrong, Borovsky et al. 1995; Lanciotti, Kerst et al. 2000; Hadfield, Turell et al. 2001; White, Kramer et al. 2001) Mosquito pool screening also provides in formation on the possible vector of a virus. Many studies have used this knowledge to base their studies on specific mosquito species known to have a role in disease transmission (Ortiz, Wozniak et al. 2003; Chisenha ll, Vitek et al. 2008) This approach eluc idates the mosquito component of the complex lifestyle that all arboviruses maintain. Surveillance programs often base mosquito screening on known vectors of disease. Surveillance agencies effectively prevent arbo virus transmission through mosquito abatement and medical alerts Medical alerts often result in lower operating costs when compared to costs associated with the hospitalization a nd life long debilitation of an encephalitic arbovirus case (Villari, Spielman et al. 1995)

PAGE 14

5 P ublic health and clinical diagnostic laboratories utilize cell culture, serological methods ( such as hemagglutination inhibition and complement fixation assays) or nucleic acid tests for virus isolation and identification (Blackmore, Stark et al. 2003) Current molecular techniques apply a form of the polymerase chain reaction (PCR) in which specific nucleic acids sequence of the template is required and are commonly species specific (Yandoko, Gribaldo et al. 20 07; Re, Spinsanti et al. 2008) [Figure 1] Identification is sometimes not possible when a sample cannot be amplified using a standard PCR screening process for endemic viruses or agent specific primer sets requested by the submitter (based on clinical sy mptoms of the suspected causative agent, such as encephalitis). Thus, a broad assay, in which no knowledge of the template is required, is needed for detection of viruses with unknown etiology. Virus titers may be high or low in clinical and environmental samples, depending on the type of virus and source (tissue, water) of the sample. Virus titer in mosquito pools may also vary depending on field sites and year collected due to variation in the viral strain or susceptibility of the mosquito to the virus (Nasci and Mitchell 1996) M olecular assays are frequently used for viral detection, as they are sensitive and may pick up trace amounts of the agent. I n certain cases, conc entration of viral particles may be necessary for detection with downstream assays. For example, ultracentrifugation has been used with succe ss to concentrate viral particles and allow for specific viral amplification (Djikeng, Halpin et al. 2008) Relatively large viruses (greater than 0.2 m), such as herpes virus, have bee n successfully purified using a cesium chloride gradient designed

PAGE 15

6 to capture known groups of DNA viruses (Breitbart and Rohwer 2005) or by using a sucrose cushion to purify viral particles (Braham, Iturriza Gomara et al. 2009) which require specialized equipment However, ultracentrifugation a nd gradient methods are too complicated time consuming and costly for routine application in a public health laboratory. Consequently, virus isolation remains the gold standard technique for viral diagnostics. Once the viral isolate is purified from the original source, it is inoculated into a susceptible host such as an animal model ( in vivo ) or cell system ( in vitro ). Replication of the virus can be detected by observed clinical findings or by observation of morphological changes in a cellular system k nown as cytopathic effect (CPE ) (Condit 2001) The virus may then be isolated by harvesting tissues from an animal model or by harvesting culture fluid from an infected cell line. Previous studies have used a sequence independent, single primer amplification (SISPA) technique in clinical and public health laboratories to characterize unidentified viruses from environmental and patient samples (Reyes and Kim 1991; Djikeng, Halpin et al. 2008; Re, Spinsanti et al. 2008) An overview of the SISPA methodology can be found in Figure 2. SISPA involves the directional ligation of a linker/adapter oligonucleotide onto both ends of a target population of either double stranded DNA or double stranded cDNA

PAGE 16

7 Forward and Reverse Primers RT Buffer dNTPs Reverse Transcriptase Taq DNA polymerase RNA Viral cDNA Forward Primer Reverse Primer Denatured cDNA Figure1: Schematic r epresentation of RT PCR. The r everse transcriptase polymerase chain reaction (RT PCR) involves two steps. In the first step, RNA is reversed transcribed into its complementary strand (cDNA) using the enzyme reverse transcriptase and utilizing a pair of pri mers which are complementary to a region on the RNA and cDNA. The second step is the same as conventional PCR in which there is a denaturation, anneal ing and extension cycle. During denaturation t he sample is heated until the c DNA separates into single str ands. In the next cycle, the temperature is lowered to allow for primer annealing to the complementary strand. In the last step, the primers are extended through Taq DNA polymerase and the incorporation of nucleotides. The PCR cycle is repeated approximate ly 35 cycles. Each cycle makes a copy of the target sequence and the number o f copies increases exponentially. Sample is heated to 95 for 5 min in order to denature cDNA The temperature is raised to 72 for 5 min for pri mer ex tension Incubate: 50 for 30 min 95 for 5 min Temperature is lowered to 55 for 30 sec to allow for primer annealing Cycle is repeated 35 times followed by a final extension at 72

PAGE 17

8 (Clem, Sims et al. 2007) Primers specific to the linker adapter molecule are used for PCR. The common sequence allows for the amplification of all nucleic acids in the s ample, regardless of sequence content (Allander, Emerson et al. 2001) Earlier applications of SISPA have been successful for the identification of viral nucleic acids from both DNA (Woodchuck hepatitis virus, enter obacteriophage M13, hepatitis B virus) and RNA (enterobacteriophage MS2, bovine leukemia retrovirus, hepatiti s C virus) templates (Reyes and Kim 1991; Allander, Emerson et al. 2001; Djikeng, Halpin et al. 2008) SIS PA works efficiently on viruses purified from a number of sources, including bacterial growth media, plasma, serum, fecal material, and allantoic fluid (Reyes and Kim 1991; Allander, Emerson et al. 2001; Djikeng, Hal pin et al. 2008; Victoria, Kapoor et al. 2008) The original formulation of SISPA (Reyes and Kim 1991) involved aspects of two previously described methods. It was based on a technique referred to as (Akowitz and Manuelidis 1989) as well as the cloning of DNA dissected from specific regions of a chromosome (Johnson 1990) These methods were developed to make cDNA libraries from small amounts of mRNA (Akowitz and Manuelidis 1 989) or involved the digestion of chromosomal DNA by the restriction enzyme Mbo I (Johnson 1990) The original formulation of SISPA (Reyes and Kim 1991) adapted the previously described methodology to include the directional ligation of an asymmetric adapter onto both termini of blunt ended cDNA so that the c ommon end sequence of the adapter is amplified in subsequent PCR using a

PAGE 18

9 single primer. Furthermore, restriction endonuclease sites were located in the adapter to facilitate the cloning of SISPA products. Animal or cell culture models may result in contami nation of the virus sample with host factors. By definition, viruses must exploit host cell molecules and processes (Knipe 2001) This in turn may lead to sample contamination of host factors such as genomic DNA, cellular RNA or by inhibitory substances found in cell culture media. Usually, host contamination does not interfere with downstream mo lecular assays, such as virus gene specific PCR. In contrast, host contamination has been shown to impact SISPA application since this method is designed to amplify any nucleic acid present (Reyes and Kim 1991; Ambro se and Clewley 2006; Braham, Iturriza Gomara et al. 2009) As a result, it is necessary to minimized host contamination of viral filtrates to enhance cloning efficiency and specificity. For example, DNAse I is an endonuclease that nonspecifically cleave s DNA which allows for the removal of contaminating genomic DNA from RNA samples. Previous studies, (Allander, Emerson et al. 2001; Clem, Sims et al. 2007) have shown that the removal of host contaminants by filtra tion and the treatment of samples with DNAse I have resulted in an increase in sensitivity of the amplification of viral genomic sequences. These studies have indicated that DNAse I treatment can degrade most of the host genomic DNA and not affect viral nu cleic acids, which are protected by stable viral capsids (Allander, Emerson et al. 2001)

PAGE 19

10 Random tag primer NNN Unknown viral RNA First strand cDNA synthesis Single stranded cDNA RNase H Klenow reaction Double stranded cDNA Primer tag dNTPS PCR Taq DNA polymerase Figure 2 : Schematic of SISPA Unknown viral RNA is converted to single stranded cDNA u DNA polymerase, in the presence of the random tag primer. Double stranded cDNA is amplified by PCR with the s ame primer tag as before with Taq DNA polymeras e PCR amplicons are then size selected and cloned.

PAGE 20

11 residues. RNase A has been successfully used to confirm RNA characteristics of a viral genome (Valles, Strong et al. 2007) Benzoase is an endonuclease that degrades all forms of DNA and RNA, which are not protected within a viral capsid. Since the genomic status of the unknown viral samples is not known, such as double stranded DN A or single st randed RNA, these enzymes may be used for the removal of host contaminants. As a result, it is necessary to minimized host contamination of viral filtrates to enhance cloning efficiency and specificity. Ultimately, the development of a universal virus dete ction assay will allow for the identification of not only arboviruses, but potential viral bioweapons and emerging viruses. Application of the SISPA technique will allow for the identification of potential emerging infectious disease which will, in turn, safeguard public health.

PAGE 21

12 Objectives Currently, the screening panel utilized by the Florida Department of Health, Bureau of Laboratories ( BOL Tampa ) for identification of arboviruses enzootic to Florida does not identif y some environmental isolates d e novo Therefore, a rapid method to identify unknown viral isolates is needed. The Sequence Independent Single Primer Amplification (SISPA) method may be used to det ermine the genetic ident ity of uncharacterized viruses and can be applied to samples obtai ned from clinical and environmental sources This will allow for the establish ment of a standard protocol criterion to identify previously unidentified a rboviruses. My hypothesis is that standard screening panels utilized in public health laboratories and research facilities for environmental isolates are unable to detect all viruses of public health importance. Therefore, a rapid l aboratory method for diagnosis and identification would be of value This study has three specific aims: 1. To optimize and util ize the SISPA method to determine the genetic identity of previously unknown viral isolates 2. To characterize phylogenetic relationship and nucleotide sequence homology for viruses identified by SISPA to previously reported viruses.

PAGE 22

13 3. To determine prevalence of infection for virus ( es ) identified by SISPA technique in different mosquito species in Florida.

PAGE 23

14 Materials and Methods Viruses Unidentified viral isolates were obtained during arbovirus surveillance studies in Florida, either from the Florida Depar tment of Health program located at the Bureau Of Laboratories Tampa ( BOL ) during 2005 2009 or collected during an ongoing project at the University of South Florida College of Public Health (USF) studying the ecology of enceph alitis viruses in Florida Additional positive control viruses were obtained from the BOL for SISPA validation [Table 1] Mosquito Trapping and Sorting Adult mosquitoes were trapped by dry ice baited CDC light traps from surveillance sites located in Hillsborough and Walton County Florida and stored at 80 until processing During 2008, 41,75 1 mosquitoes were collected at two locations in Hillsborough County (a peri urban location and a rural location). During 2009, 14 sites in Walton County submitted a total of 2,660 mosquitoes. M osquitoes were collected from April to December of 2008 in Hillsborough County and June to August of 2009 in Walton County Mosquitoes were sorted by site, species, sex and date collected, then placed in pools of up to 50

PAGE 24

15 Table 1: Unidentified viral i s olates and control strains. Strain # Host Species Collection Date Location Source M08 343 Cs. melanura 7/16/2008 Escambia County Fl BOL Tampa M03 1427 Cx. N igripalpus 5/21/2003 Palm Beach County Fl BOL Tampa M03 1434 Cx. N igripalpus 6/ 0 4/2003 Palm Be ach County Fl BOL Tampa M06 231 Cx. S alinarius 6/30/2006 Escambia County Fl BOL Tampa M06 280 Cx. N igripalpus 6/30/2006 Pinellas County Fl BOL Tampa SLEV Gallus gallus 1969 Brazil BOL Tampa [beAN 156204] WNV Human 1952 Egypt BOL Tampa [Egypt 1 01] Infirmatus virus Ae. Infirmatus 7/8/2008 Hillsborough County Fl USF SISPA was validated using three control strains (S t. L ouis encephalitis virus [SLEV] beAN 156204 West Nile virus [WNV] Egypt 101 and Infirmatus virus ) as positive controls. M0 8 343, M03 1427, M03 1434, M06 231, M06 280, SLEV beAN 156204 and WNV (Egypt 101) were obtained from the reference collection at BOL Tampa. Infirmatus virus was collected by the University of South Florida (USF).

PAGE 25

16 individuals per tube. Mosquito species tha t were collected with greater than 500 individual mosquitoes from one of the surveillance sites in Hillsborough County (Tampa Bay Downs) were screened to determine virus prevalence of Flanders virus and Infirmatus virus and to determine mosquito species of interest [ Table 2] Mosquito traps at the peri urban location, Tampa Bay D owns, collected a total of 11,37 5 mosquitoes [ Figure 3 ]. Aedes vexans, Aedes infirmatus, and Culex nigripalpus were the three most abundant species collected from the Tampa Bay Down s surveillance site. Mosquito trapping at the rural location, Eureka Springs, collected a total of 30,376 mosquitoes Culex nigripalpus, Culex erraticus, and Aedes infirmatus were the three most abundant species collected from the Eur eka Springs surveillan ce site [Figure 4 ]. During 2009, 2,660 mosquitoes were submitted to USF as part of an ongoi ng arbovirus surveillance study from 14 sites located in Walton County Culiset a melanura, Culex nigripalpus, and Aedes infirmatus were the three most abun dant spec ies collected from the Walton County surveillance site s [Figure 5 ].

PAGE 26

17 Table 2: Mosquito abundance at surveillance sites and percentage of mosquitoes screened Surveillance Site County Mosquitoes collected Percentage of mosquitoes screened Tamp a Bay Downs Hillsborough 11,3 7 5 86% Eureka Springs Hillsborough 30,376 21% Walton Walton 2,660 12% During 2008, 41,751 mosquitoes were collected at two locations in Hillsborough County, Fl (a peri urban location and a rural location) and in 2009, 14 si tes in Walton County, Fl submitted a total of 2,660 mosquitoes. Mosquitoes were collected from April to December of 2008 in Hillsborough County and June to August of 2009 in Walton County using dry ice baited CDC light traps Mosquito Processing Mosquito pools removed from the 80 freezer and thawed on ice. Mosquito pools were homogenized by the addition of a 4.5 mm copper clad steel bead (BB caliber airgun shot, Copperhead brand) and 1 ml of BFD [ Appendix A ] to a 2ml microcentrifuge tube containing up to 50 mosquitoes using a Tissue Lyser (Qiagen ) at 25 Hz for 4 minutes and subsequently centrifuged at 4C for 4 minutes at 10,000 rpm (9,341 rcf) (Eppendorf Centrifuge 5810 R). Samples were kept on ice throughout processing. The homogenate was subsequently f iltered through a Cellulose acetate syringe filter, 0.2 M pore size (Nalgene Cat. No. 0974061A), that had been pretreated with inactivated Fetal Bovine Serum (FBS : Hyclone Cat. No. SH3007003 ) to remove cellular debris A 1.0 ml aliquot of each sample was inoculated into a 25cm 2 tissue culture flask (Nalgene Nunc

PAGE 27

18 International, Cat. No. 156340) of African green monkey kidney ( ATCC, Cat. No. CCL 81, passage 140) [Vero cells] using a sterile 1 ml pipet which were concurrently being maintained Vero cells wer e seeded into a 25cm 2 tissue culture flasks 10 ml outgrowth media and incubated at 37C until confluent (approximately 4 days). The remaining mosquito pool homogenate was stored at 80. The flasks were then rocked at 37 C every 15 minutes for 1 hour and fe d with 10 ml of liquid maintenance media for Vero Cells [Appendix A]. Cultures were incubated at 37 C in a Thermo Scientific Forma Series II Water jacketed 5% CO 2 incubator and cell monolayers were examined daily for fourteen days under a microscope for ev idence of cytopathic effect (CPE ). Cultures which exhibited positive CPE were frozen at 80 C rapidly thawed at 37C. Nucleic acid was isolated using the QI Aamp Viral RNA Mini Kit (Qiagen ) using in the automated QIAcube (Qiagen ) according to s protocol Pools were screened following SISPA identification of unknown viral isolates using the SuperScript III One Step RT PCR System with Platinum Taq DNA polymerase (Invitrogen Karlsruhe, Germany ).

PAGE 28

19 Figure 3 : Number of mosquitoes collected from Tampa Bay Downs (2008) A total of 11,37 5 mosquitoes were collected from the Tampa Bay Downs, peri urban location, surveillance site in western Hillsborough County Aedes vexans, Aedes infirmatus, and Culex nigripalpus were the three most abundant sp ecies.

PAGE 29

20 Figure 4 : Number of mosquitoes collected from Eureka Springs (2008) A total of 30,376 mosquitoes were collected from the Eureka Springs, rural location, surveillance site in central Hillsborough County Culex nigripalpus, Culex erra ticus, and Aedes infirmatus were the three most abundant species.

PAGE 30

21 Figure 5 : Number of mosquitoes collected from Walton County (2009) A total of 2,660 mosquitoes were submitted from 14 surveillance site in Walton County Culiseta melanura, Cul ex nigripalpus, and Aedes infirmatus were the three most abundant species.

PAGE 31

22 RT P CR Screening Panel A total of six primer sets were used to test v iral isolates that were not identified by real time RT PCR as WNV, EEEV or SLEV viruses. This reverse transcipt ase polymerase chain reaction ( RT PCR ) screening panel is used by the BOL Tampa for the detection of additional enzootic arboviruses with known circulation in Florida [members of the Alphaviridae (Powers, Brault et al. 2001) Bunyaviridae (Kuno, Mitchell et al. 1996) and Flaviviridae (Lanciotti, Calisher et al. 1992; Kuno 1998; Lanciotti Kerst et al. 2000) ] [ Appendix B] RT PCR reactions were p e r formed as described in these studies. Viral isolates that tested negative as a result of the screening panel were prepared for SISPA. SISPA Sample Preparation C ulture supernatant s of positive control viruses (1 ml) were centrifuged for 30 seconds at 10,000 rpm (9,341 rcf) (Eppendorf Centrifuge 5810 R) and then filtered through a Cellulose acetate syringe filter, 0.2 M pore size (Nalgene Cat. No. 0974061A), that had been pretreated with inactiv ated Fetal Bovine Serum (FBS: Hyclone Cat. No. SH3007003) in order to enrich virus particles and remove cellular debris [Figure 6] The filtered supernatant was then treated with benzonase ( 1U/ l ) (Novagen Cat. No. 70664 3) at 37C for 1 hour to remove a dditional cellular contaminants and immediately followed by the addition of the Trizol LS reagent (Invitrogen Cat. No. 10296 028 ).

PAGE 32

23 Viral Nucleic Acid Isolation and Amplification Viral nucleic acid was isolated using TRIzol LS reagent (Invitrogen No. 10296 028 ) Sample nucleic acid concentration was determined using a Nanodrop spectrophotometer (Thermo Scientific, Wilmington, DE). Samples with an A260/280 ratio of less than 1.6 were processed. Samples with an A260/280 rati o of greater than 1.6 were discarded due to host/culture contamination. Viral cDNA synthesis was performed in multiple stages [Figu re 2]. Reverse transcription consisted of two stages. First, primer annealing was achieved by incubating ~800ng of the viral RNA, dNTPs, and 20 m of a primer consisting of twenty known nucleotides followed by a span of five degenerate nucleotides (N) from a previously described technique (Djikeng, Halpin et al. 2008) at 95C for 5 min followed by a quick chill on ice. Superscript III Re verse Transcriptase (Invitrogen No. 1808 0 093 ) RNaseOUT RNase Inhibitor, 0.1 M DTT and 5X First Stran d Buffer was added to the reaction mix. Samples were incubated in a MyCycler Thermal Cycler System (BioRad Cat. No. 170 9703) at 25C for 5 minutes, 50C for 30 minutes and 70C for 15 minutes f ollowed by a 4C hold. RNAse H (Thermo Scientific Cat. No. AB 1280A ) was applied to the sample for 20 minutes 37C RNase H is an endonuclease that degrades the RNA portion of DNA RNA hybrids by hydrolyzing the phosphodiester bonds of RNA.

PAGE 33

24 The reverse tra nscript product was diluted and additional primer was added. The product was incubated at 95C for 5 minutes followed by a quick chill on ice. cDNA synthesis was Klenow fragment of DNA polymerase (New England Biolabs, Ipswich, MA Cat. No. M0212L ), Klenow buffer and 10 mM dNTPs. Amplification was performed at 37C for 1 hour and 75C for 10 minutes followed by a 4C hold. Ten microliters of the cDNA reaction was used as a template for PCR. PCR amplicons were produced by incubating the cDNA product, 10X PCR buffer, 10mM dNTPs, Taq DNA polymerase and 20 m of a primer consisting of the known nucleotides present in the primer used for cDNA synthesis at 72C for 5 minutes, 36 cycles of 94C for 3 minutes 94C for 30 seconds, 40C for 1 minute and 72C for 30 seconds followed by 72C for 5 minutes and a 4C hold in a MyCycler Thermal Cycler System Products were analyzed on a 2% agarose gel and the cDNA cleaned using the QIAquick PCR Purification Kit (Qiagen Cat. No. 28104 ). Cloning PCR purification products were then cloned into the pCR 4 TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen Cat. No. K4575 40 ) and OneShot TOP10 Chemically Competent E. coli cells according to ocol. B rief ly 4 l of fresh PCR product, 1l of kit salt solution and 1l of TOPO vector were gently mixed to prepare the TOPO Cloning reaction and incubated for 5 minutes at room temperature. Two microliters of the TOPO

PAGE 34

25 Cloning reaction was then added to a vial of OneShot Chemicall y Competent E. coli and gently mixed. The reaction was then incubated on ice for 5 minutes and heat shocked for 30 seconds at 42C without shaking. The reaction tube was then immediately transferred to ice and 250 l of S.O.C. Medium (2% Tryptone, 0.5% Yea st Extract, 10mM NaCl, 2.5% KCl, 10Mm MgCl 2, 10Mm MgSO 4 and 20mM glucose ) was added to each tube. Each tube was then shaken

PAGE 35

26 Unknown Environmental Viral Isolate Extraction of viral RNA Amplification by SISPA (Figure 2 ) Sequencing of rand omly selected clones Sequence analysis and classification of genome sequences Determination of viral species or genus Development of screening RT PCR assay for newly classified viral isolate S pecies specific RT PCR primer assay developed Nat ural mosquito population assayed for newly classified viral prevalence Figure 6 : An overview of SISPA application This figure outlines the overall methodology of this study. Unidentified e nvironmental viral isolates are i nitially prepared in order to aid in the purification of viral nucleic acids. Viral RNA is then extracted and amplification is achieved by the SISPA methodology Amplicon s are size selected and cloned. Sequences were analyzed by GenBank query and samples were classified by virus species or genus. An RT PCR assay was developed to for the newly classified virus in order to screen a natural mosquito population A species specific confirmation RT PCR assay was then developed to confirm identification Sample Preparation: 1. Enrichment of virus particl es by centrifugation 2. Filter sample to removal cellular debris 3. Removal of host genomic material by benzonase application Cloning

PAGE 36

27 horizontally (200 rpm) at 37C for 1 hou r in a Forma Orbital Shaker (Thermo Scientific) The clones were spread on im Media Amp Agar plates (Invitrogen Cat. No. Q601 20 ) and incubated at 37C overnight. Several c olonies from each dilution were selected and cultured in 5ml of Luria Bertani broth ( 1.0% Tryptone, 0.5% Yeast Extract, 1.0% Sodium Chloride, pH 7.0) (Fisher Scientific Cat. No. BP1421 100; BP1422 100; S640 10) with 50 g/ml amp ic illi n (Fisher Scientific Cat. No. BP902 25) overnight. Plasmid DNA was isolated using a Quick Plasmid Miniprep Kit (Invitrogen Cat. No. K2100 11 ). Sequence Analysis Plasmid DNA was shipped to a commercial laboratory (GeneWiz, New Jersey) for traditional DNA sequencing at room temperature Sequences were evaluated for quality score and contiguous read length. After a manual review of trace files, sequences with quality scores between 25 39 and contiguous read length over 500 were submitted to GenBank and a query search was preformed. Sequences with lower quality scores and contiguous read lengths were discarded. Th e basic local alignment search tool (BLAST) was used to identify or classify virus subtypes by percent homology to the GenBank database [ http://www.ncbi.nlm.nih.gov/genbank/ ] se and optimizing through discontiguous megablast Sequences with homology to the cloning vector were discarded and sequences with homology to arboviruses were further analyzed.

PAGE 37

28 Sequences producing significant alignments within GenBank were downloaded an d used to construct an alignment with sequences derived from SISPA amplicons Sequence alignment using the ClustalW 1.6 method was performed in MEGA 4. 0 (Tamura, Dudley et al. 2007) If the viral isolate was less than 85 % homologous to a known species the classification was determined and related viral species were aligned to determine relatedness. Phylogenetic analysis was computed in MEGA 4.0 (Tamura, Dudley et al. 2007) for viruses cla ssified to infer the evolutionary relationships of v irus strains. The evolutionary history was inferred using the Neighbor joining method with 1000 bootstrap replicates. Phylogenetic trees were evaluated for accuracy of branch points and phyletic clusters Viral Culture Confirmation Once a virus was identified by SISPA, a confirmation RT PCR assay were designed. A gene specific RT PCR primer set was des igned for the classified virus, Flanders virus, in Primer3 (Rozen 2000) and a previously described primer set was employed to target Infirmatus virus. The primer set used to screen for Infirmatus virus was designed to target previously determined and newly derived S segment sequenc es of human pathogens of the Orthobunyavirus Phlebovirus and Nairovirus genera of the family Bunyaviridae (Lambert and Lanciotti 2009) Once a mosquito pool isolate was amplified by the Bunyaviradae primer set, a confirmation primer set was used that targeted the G C glycoprotein of the genus

PAGE 38

29 Orthobunyavirus [Appendix C] These RT PCR assays were utilized to screen mosquito pools collected during 2008 2009 from Hillsborough and Walton County, Florida This allowed f or the estimation of the prevalence of these newly identified viruses of interest Viral isolates were amplified for subsequent nucleotide sequencing using the SuperScript III One Step RT PCR System with Platinum Taq DNA polymerase (Invitrogen Cat. No. 125 74 018 ) per Amplicons derived from mosquito pool screening were visualized using the automated QIAexcel (Qiagen ) ,which allows for the analysis of DNA and RNA fragments. Amplicons were purified using a QIAquick PCR Purification K it Identified samples were then submitted for traditional DNA sequencing to GeneWiz. Phylogenetic analysis was computed using Clustal W1.6 method for viruses classified in MEGA 4.0 to infer the evolutionary re lationships of v irus strains. The evolutionary history was inferred using the Neighbor joining method with 1000 bootstrap replicates. Phylogenetic trees were evaluated for accuracy of branch points and phyletic clusters. The overall mean was determined us ing the Jukes Cantor computation to determine the suitability of the data for a Neighbor joining tree. If the average pairwise Jukes Cantor distance is >1.0 the data is not suitable for a Neighbor joining tree (Tamura, Dudley et al. 2007) PoolScreen was used to calculate

PAGE 39

30 prevalence (Katholi, To et al. 1995) It is a probability based program that calculates infection rates and associate d confidence intervals that account for the potential presence of multiple positive ins ec ts.

PAGE 40

31 Results Tampa has collected and maintained an extensive reference collection of clinical and environmental virus isolates from cultured specimens. As a result, several new arboviruses have been discovered along with a nu mber of unknown environmental viral isolates. Unidentified viral isolates were obtained from historic al arbovirus surveillance studies at the BOL Tampa Florida or collected from April to December of 2008 in Hillsborough County and June to August of 2009 in Walton County by the University of South Florida The unknown viral isolates had not been identified by the BOL Tampa screening panel. Therefore, a new methodology was needed to classify these virus es. A modified SISPA technique was successfully used in t his study to classify unknown viral isolates. Once an unknown viral isolate was classified the natural mosquito population was assayed to estimated viral prevalenc e at surveillance sites in Florida SISPA Validation SLEV and WNV were first amplified by the st andard SISPA technique to validate the method for correct identification or classification of characterized arboviruses [ Table 1 ] The SISPA technique resulted in the amplification of ing sample electrophoresis (1% agarose gel) and EtBr staining [Figure 7 ]. Samples were

PAGE 41

32 size selected and subsequently cloned. Selected colonies were sequenced and submitted to GenBank for query. BLASTn analysis of these sequences correctly identified both control strains [T able 4 ] For example, several clones of SLEV (strain beAN 156204) had high sequence homology to published SLEV strains in GenBank including 98 % identity to the prototype beAN 156204 strain In addition, the success of this random amplifi cation technique was further validated by the identification of sequences with homology to different regions of the SLEV genome [ Table 3 ]. Figure 7 : Evaluation of SISPA Method The SISPA method successfully amplified sequences derived from a panel of known viruses ( West Nile virus [Egypt 101], and St. Louis encephalitis vir us [SLEV strain beAN 156204]). Amplicons can be visualized by smeared banding patterns on a 1% gel after electrophoresis. Lane 1 is a 100 base pair (bp) ladder (New England BioLabs Cat. No. N0467L) which ranges from 100 1,517 bp

PAGE 42

33 Table 3 : Alignment of SLEV beAN 156204 fragments obtained from SISPA method identified to genomic segments Sequences found Number of clones sequenced H omology SLEV Envelope protein 1 93 % SLEV Polyprotein 2 98 % A total of 10 clones were obtained from SISPA applica tion to the control virus SLEV strain beAN 156204. Three clones showed a high homology to genomic segments of SLEV However, the p reliminary validation results for the cont rol arboviruses indicated that only 30% of clones had SLEV specific amplicons inserted into the plasmid [Table 4] The remaining clones were found to have contaminating non SLEV sequences inserted into the cloning vector. Similarly, 60% of the West Nile vi rus clones were WNV specific and 40% of clones had contaminating non WNV sequences inserted into the plasmid. The contaminants were identified as artifacts of the culture system used to amplify the virus (Vero cell specific templates).

PAGE 43

34 Ta ble 4 : SISPA Validation using control viral strains Virus Name Number of clones Number matching viral strain Number matching vector/other % of clones matching viral strain SLEV [ beAN 156204 ] 10 3 7 30% WNV [Egypt 101] 10 6 4 60% Standar d SISPA meth odology was applied to control virus strands St Louis encephalitis virus [SLEV beAN 156204] and West Nile virus [WNV Egypt 101] The results showed a low cloning efficiency and optimization was preformed SISPA Optimization Due to its low cloning efficie ncy of virus specific amplicons, the standard SISPA technique was further optimized [Table 4]. The method was modified to include step s to remove host nucleic acid contamination First, c ulture supernatant of the unknown viral isolates was centrifuged and filtered to enrich virus particles and remove cellular debris. In addition, p revious studies have shown the success of nuclease application, such as DNase I RNase A and benzonase, application to improve the cloning efficiency of virus specific PCR products (Allander, Emerson et al. 2001; Clem, Sims et al. 2007; Valles, Strong et al. 2007) Since the physical properties of the unidentified viral isolates were not known DNase I, RNase A and benzonase were compared f or reaction efficiency. Benzonase was found to remove a greater amount of host

PAGE 44

35 contaminants without damaging the viral genomic material, whereas DNase I and RNase A resulted in lower viral genomic yields following extraction (data not shown). These steps inc reased the proportion of clones derived from the control viral nucleic acids [Table 5]. Table 5 : Optimization of SISPA using control viral strains Virus Name Number of clones sequenced Number matching viral strain Number matching vector/other % of clones matching viral strain SLEV [ beAN 156204 ] 10 5 5 50% WNV [Egypt 101] 10 8 2 80% SISPA methodology was optimized through sample preparation steps of centrifugation, filtration and benzonase application These steps were applied to control virus strands The results showed an increase in cloning efficiency. Identification of Viral Isolates Flanders Virus The SISPA method successfully amplified sequences derived from an unknown viral isolate, M08 343 Sample SISPA amplicons were purified using a QIAquick PCR Purification Kit subsequently cloned and five clones were submitted for sequencing. T wo of the unknown M08 343 clone sequences ( approximately 604 bp ) had a 93% identity to the M gene of Flanders virus ( AF523197.1) and the others were a result of hos t nucleic acid contamination.

PAGE 45

36 An M gene specific primer set for Flanders virus was developed and confirm ed that the identity of the M08 343 sequences derived from SISPA were Flanders virus [Figure 8] This Flanders virus RT PCR assay was then used to rescr een the unidentified viral isolates obtained from the BOL Tampa archive and the University of South Florida [Appendix C] A total of f ive p reviously unknown mosquito pool isolates were successfully iden tified as Flanders virus using these M gene specific p rimers [ Table 6 ] Flanders virus was detected in three pools of mosquito species ( Culiseta melanura, Culex nigripalpus and C ule x salinarius ) submitted to the BOL Tampa A total of 9,623 mosquitoes (416 pools) collected from Hillsborough and Walton County in 2008 and 2009 were screen ed using the M gene primer set for Flanders virus. Flanders virus was not detected.

PAGE 46

37 Figure 8 : Flanders Virus RT PCR Assay A Flanders virus RT PCR assay was developed following sequence analysis of SISPA clones. F ive previously unknown isolates were identified as Flanders virus with this assay and confirmed by DNA sequencing. Lane 1: 100 base pair (bp) ladder (New England BioLabs Cat. No. N0467L) which ranges from 100 1,517 bp ; Lane 2: M06 231; Lane 3: M08 319; La ne 4: M08 28 0; Lane 5: SLEV 12 TRVL 35928; Lane 6: M08 343; Lane 7: H 68; Lane 8: FL 06 S649; Lane 9: Negative Control.

PAGE 47

38 Table 6 : Flanders virus positive mosquito pools, BOL Tampa archive Strain # Host Species # Mosquitoes per pool Collection Date County Source Identity M03 1427 Cx. nigripalpus 50 5/21/2003 Palm B each BOL Tampa Flanders virus M03 1434 Cx. nigripalpus 50 6/ 0 4/2003 Palm Beach BOL Tampa Flanders virus M06 231 Cx. salinarius 12 6/30/2006 Escambia BOL Tampa Flanders virus M06 280 Cx. nigripalpus 17 6/30/2006 Pinellas BOL Tampa Flanders virus M08 343 Cs. melanura 20 7/16/2008 Escambia BOL Tampa Flanders virus

PAGE 48

39 Phylogenetic analysis of Flanders virus isolates A p hylogenetic analysis of approximately 332bp of the M gene from t he newly determined Flanders virus strains was preformed with published M gene sequences downloaded from GenBank of members of the genus Rhabdoviradae [ Figure 9 ] The neighbor joining tree was constructed using a p air wise deletion and the Maximum Composit e Liklihood substitution model. The prototype of Flanders virus, strain 61 7484, was used for sequence comparison (Whitney 1964)

PAGE 49

40 Figur e 9: Phylogenetic tree of Flanders virus isolates, M gene. Previously published sequence data of members of Rhabdoviridae in GenBank (AF523197.1; EF612701.1; AF234533.1) were used to make a multiple sequence alignment and neighbor joining phylogenetic tr ee (1000x bootstrap replicates, consensus tree) along with the previously unknown environmental sample, M06 231, M06 280, M03 1427, M08 343, M03 1434 of approximately 332 bp The previously unknown environmental isolates grouped closely with the publishe d Flanders virus strain.

PAGE 50

41 Table 7 : Estimates of Evolutionary Divergence between Sequences of Members of Rhabdoviradae and Flanders virus isolates Strain BEFV WONV FLAN M03 1434 M06 231 M03 1427 M06 280 BEFV -------WONV 63% ------FLAN 42% 41% -----M03 1434 41% 42% 97% ----M06 231 40% 40% 96% 98% ---M03 1427 40% 40% 96% 97% 96% --M06 280 40% 40% 95% 98% 98% 96% -M08 343 67% 40% 93% 95% 94% 94% 93% Members of Rhabdoviridae (BEFV: Bovine emphermal fever virus, WONV: Wongabel virus, FLAN: Flanders virus) were compared to Flanders viral isolates and percent identity between sequences is shown All results are base d on the pairwise analysis of 8 sequences 329 positions in the final d ataset were included in the dataset and a ll positions containing gaps and missing data were eliminated from the dataset (Complete deletion option).

PAGE 51

42 Infir matu s Virus P As part of an arbovirus ecology study conducted by USF in 2009, the SISPA method was used to ch aracterize an unidentified virus cultured from a pool of Ae. i nfirmatus mosquitoes. This virus was designated as Infirmatus virus. Nucleotide sequence data and phylogenetic analysis indicate that Infirmatus virus is a newly described member of the Ca lifornia serogroup of o rthobunyavirus (Ottendorfer, unpublished data). A previously described RT PCR assay for the detection of members of Bunyaviradae was used to screen the natural mosquito population (Lambert & Lanciotti, 2009). After postive identifcia tion through this assay to a member of Buynaviradae, a species specific primer set for Infirmatus virus was used to determine classification. A confirmation primer set was used that targeted the G C glycoprotein of the genus Orthobunyavirus to confirm the identity of viral isolates [Appendix C] A total of 462 pools (10,557 mosquitoes ) were screened for Infir matus virus and 14 pools we re found to be positive [Table 8 ]. Infir matus virus was isolated from th e surveillance site in Hillsborough County Tampa Ba y Downs and Eureka Springs. Mosquitoes from other locations tested negative. Infirmatus virus was identified in A nopheles c r u cians, A edes infirmatus, Culex nigripalpus and Culex quinquefasciatus mosquito pools in April, May, June and September 2008. The in fection prevalence was determined utilizing PoolScreen, to be the highest in Culex quinquefasciatus ( 3.4 x 10 3 95 % CI 4.75 x 10 4 to 6.87 x 10 3 ) [Table 9]

PAGE 52

43 Ta ble 8 : Infirmatus virus positive mosquito pools isolates, Field Surveillance (2008) Strain # Host Species # Mosquitoes per pool Collection Date Collection Site Source Identity H 198 An. c rucians 35 4/2/2008 Tampa Bay Downs USF Infirmatus virus H 277 Cx. q uinquefasciatus 50 9/27/2008 Tampa Bay Downs USF Infirmatus virus H 371 Ae. i nfirmatus 2 4 /22/2008 Tampa Bay Downs USF Infirmatus virus H 372 Cx. q uinquefasciatus 4 4/22/2008 Tampa Bay Downs USF Infirmatus virus H 472 Cx. n igripalpus 8 5/12/2008 Tampa Bay Downs USF Infirmatus virus H 474 Ae. i nfirmatus 8 5/12/2008 Tampa Bay Downs USF Infirma tus virus H 734 Cx. n igripalpus 50 4/17/2008 Tampa Bay Downs USF Infirmatus virus H 735 Cx. n igripalpus 50 4/17/2008 Tampa Bay Downs USF Infirmatus virus H 736 Cx. n igripalpus 50 4/17/2008 Tampa Bay Downs USF Infirmatus virus H 743 Cx. n igripalpus 50 4 /17/2008 Tampa Bay Downs USF Infirmatus virus H 744 Cx. n igripalpus 50 4/17/2008 Tampa Bay Downs USF Infirmatus virus H 746 Cx. n igripalpus 50 4/17/2008 Tampa Bay Downs USF Infirmatus virus H 747 Cx. n igripalpus 26 4/17/2008 Tampa Bay Downs USF Infirmat us virus S 710 Cx. q uinquefasciatus 4 6/4/2008 Eureka Springs USF Infirmatus virus

PAGE 53

44 Table 9 : Infirmatus virus prevalence at the Tampa Bay Downs surveillance site (2008) Host Species Point Estimate 95% CI Lower Limit Upper Limit Cx. quinquefacia tus 3.4 x 10 3 4.75 x 10 4 6.87 x 10 3 Cx. nigripalpis 2.97 x 10 3 1.22 x 10 3 5.29 x 10 3 Ae. infirmatus 7.9 x 10 4 5.8 x 10 5 2.2 x 10 3 An. crucians 1.01 x 10 3 1.6 x 10 6 3.93 x 10 3 Species collected in excess of 500 individual mosquitoes were sc reened for Infirmatus virus. The infection prevalence was determined to be the highest in Culex quinquefasciatus Phylogenetic analysis of Infirmatus virus isolates A phylogenetic analysis on approximately 392 bp of the M s e gment from the newly determined Infirmatus virus s trains identified in the natural mosquito population of Hillsborough County was performed with additional M gene sequences downloaded from GenBank of members of the Bunyaviradae family ( Figure 10 ) The M gene sequence for the prototype I nfirmatus virus, isolated from a pool of Ae. i nfirmatus collected in July 2008, was used for comparison (Ottendorfer, unpublished data). Based on phylogenetic analysis, Trivittatus virus appears to be the closest relative to Infirmatus virus (Ottendorfer, unpublished data) This finding is supported by BLASTn analysis of Infirmatus positive mosquito pools with 77 78 % max identity to the published Trivittatus virus (AF123491.1)

PAGE 54

45 Table 10 : Estimates of Evolutionary Divergence between Sequences of Member s of Bunyaviradae and Infirmatus virus isolates Strain JCV KEY CEV SSH SDN JS LAC TVT Infirmatus H 198 JCV ----------KEY 78% ---------CEV 72% 73% --------SSH 7 4% 75% 72% -------SDN 77% 76% 71% 74% ------JS 97% 77% 71% 76% 76% -----LAC 79% 75% 76% 80% 77% 78% ----TVT 72% 71% 74% 70% 72% 72% 72% ---Infirmatus 72% 72% 71% 73% 73% 73% 72% 78% -H 198 72% 72% 71% 73% 73% 73% 72% 78% 100% -S 710 72% 72% 71% 73% 73% 73% 72% 78% 100% 99% Members of Bunyaviradae ( JCV: Jamestown Canyon virus, KEY: K eystone virus, CEV: California e ncephelitis virus, SSH: Snowshoe hare virus, SDN: Serra do Navio virus, JS: Jerry Slough virus, LAC: LaCrosse virus, TVT: Trivittatus virus) were compared to the prototype Infi rmatus virus and Infirmatus positive mosquito pools. Percent identity between sequences is shown All results are base d on the pairwise an alysis of 11 sequences 391 positions in the final dataset were included in the dataset and a ll positions containing gaps and missing data were eliminated from the dataset (Complete deletion option).

PAGE 55

46 Figure 10 : Phylogenetic tree of Infirmatus virus isolates, M segment Previously published sequence data of members of Bunyaviradae in GenBank ( AF123491; AF123489.1; JCU88058; AF123487.1; IVU88060; AF123488.1; AF123487.1; MVU88057; U70208.1; AF441119.1) were used to make a multiple sequence alignment a nd neighbor joining phylogenetic tree (1000x bootstrap replicates, consensus tree) along with the previous ly unknown environmental sample H 198, H 747 S 710 The previously unknown environmental isolates grouped closely with the published Trivittatus v irus strain and the prototype Infirmatus virus

PAGE 56

47 Discussion Advances in molecular biology have allowed for the identification of previously u nknown viral isolates that could not be typed through common serological methods (hemagglutination inhibition an d complement fixation assays) or nucleic acid tests Several viruses have been identified using SISPA methodology in previous studies such as an Astrovirus, a Rotavirus, Hepatitis G and several Parvoviruses (Matsui, Kim et al. 1991; Lambden, Cooke et al. 1992; Linnen, Wages et al. 1996; Allander, Emerson et al. 2001; Jones, Kapoor et al. 2005) Difficulties in identifying isolates was overcome by the utilizatio n of SISPA, which can identify viral nucleic acids from b oth DNA (Woodchuck hepatitis v irus, enterobacteriophage M13, H epatitis B virus) and RNA (enterobacteriophage MS2, bovine leukemia retrovirus, hepatiti s C virus) templates (Reyes and Kim 1991; Allander, Emerson et al. 2001; Djikeng, Halpin et al. 2008) Earlier applications of SISPA have successfully amplified viruses purified from a number of sources, including bacterial growth media, plasma, serum, fecal material, and allantoic fluid (Reyes and Kim 1991; Allander, Emerson et al. 2001; Djikeng, Halpin et al. 2008; Victoria, Kapoor et al. 2008) Arbovirus surveillance conducted in Florida by the BOL Tampa and USF has isolated sev eral unidentified viruses The SISPA methodology w as selected as a rapid, flexible technique for the characterization of these agents.

PAGE 57

48 Initially, control viruses (West Nile and St. Louis encephalitis viruses) were amplified by the standard SISPA technique for method validation (Reyes and Kim 1991) However, the random amplification of both host and viral gen omic material in the sample resulted in low clo ning efficiency for the control viruses As a result, this technique was optimized to limit host genomic contamination of the samples. The control viruses showed an increase in cloning efficiency following centrifugation, filtration and benzonase applicati on. T hese sample preparation techniques for SISPA were simple, timely and did not require the expensive equipment typically used for virus purification Thus, the optimized SISPA technique may be adaptable for use in a public health laboratory. Flanders V irus The SISPA method successfully amplified s equences derived from an unidentified virus strain M08 343, isolated from a pool of Culiseta melanura mosquitoes. A query of GenBank database with these sequences identified this isolate as Flan ders virus. Fl anders virus has been previously described and is an u n assigned member of the Rhabdoviradae family of the order Mononegavirales in the Hart Park serogroup Flanders virus has been isolat ed from many different insects and vertebrates including Culiseta mel anura house sparrows, red winged blackbirds and an oven bird (Whitney 1964; Kokernot, Hayes et al. 1969; Rose 2001) It has been shown that close variants of Flanders virus are distributed throughout the United Sta tes (Boyd 1972) T hree genera of R habdoviruses are known to infect mammals: Vesiculovirus Lyssavirus and

PAGE 58

49 Ephemerovirus (van Regenmortel 2000) Only members of the genus Lyssavirus (i.e. R abies) and Vesiculovirus (i.e. Chandipura virus which was recently identified in an encephalitis outbreak in children Andhra Pradesh, India) ar e known to cause disease in humans (Rao, Basu et al. 2004) Flanders virus was originally isolated in New York from mosquitoes and birds in 1961 (Whitney 1964) Flanders vi rus is not believed to be a human pathogen but is of importance due to its temporal relationship with pathogenic arboviruses For example, Flanders virus has been shown to circulate earlier than SLEV in the mosquito breeding sea son in the central Ohio Mississippi Basin (Kokernot, Hayes et al. 1969) In addition, a recent report suggests that this may also be true for West Nile virus and that Flanders virus may be useful as an early indicator of flavivirus amplification i n the southeastern USA (Moncayo, unpublished data ). Furthermore, Flanders virus transmission appeared to decline in the late summer months and is not supported by the hot and dry weather preferred by SLEV (Kokernot, Hayes et al. 1969) Recent Fla nders virus circulation has been detected in Florida based on the newly identified viruses isolated at the BOL Tampa from 2003 to 2008. These five Flanders virus isolates were derived from different regions in Florida. Two of the isolates (M08 343 and M06 231) were derived from mosquito pools collected in the panhandle (Escambia County ). M08 343 was collected in July of 2008 and i nterestingly, Escambia County reported two locally acquired human cases of West Nile virus in September 2008, as well as sentinel chicken WNV

PAGE 59

50 seroconversions in September and October 2008 (C ollins 2008) This relationship was also seen in two of the isolates (M03 1427 and M03 1434) that were derived from pools collected the south Florida (Palm Beach County ) in May and June of 2003. Several sentinel chickens tested positive for WNV in July o f 2003 and several dead birds ( Eurasian Collared Doves, Purple Gallinules, mockingb irds, blue jays, Chinese geese and cockatoos) were collected during the same time frame (Collins 2003) This circumstantial information also suggests that Flanders virus may serve as an early indicator for later West Nile virus transmission in Florida. To assess the prevalence of Flanders virus in the natural mosquito populations in Florida, 9,623 mosqui toes ( total of 416 pools ) comprising of ten different mosquito species were screened for Flanders virus from the Tampa Bay area in 2008 (344 pools) and the panhandle (Walton County ) in 2009 (72 pools) Flanders virus was not detected in these pools, whic h may be due to the fact that a rboviral infections in mosquito populations are low, and observations of zero infection in mosquito samples are common (Gu and Novak 2004) Furthermore, Flanders virus transmission may have limited spatial distribution since it was not detected in the central region despite the identific ation of strain M08 343 in the panhandle (Esc ambia County ) of Florida in 2008 (Collins 2008) Flanders v irus may also have a temporal transmission pattern as it was not detected in the following season ( 2009 ) from 72 p ools collected in the panhandle of Florida (Walton County Fl ). As a result, Fla nders virus likely has

PAGE 60

51 specific temporal and spatial distribu tions in Florida. It is recommended that surveillance studies for Flanders virus analyze a larger mosquito population from several geographic locations within Florida and further analyze the potential temporal association of Flanders virus with Flaviviruse s The Rhabdoviridae M gene organizes the assembly of the virion by interacting with the ribonucleocapsid and mediates the budding of virions from the infected cell (Jayakar, Jeetendra et al. 2004) Proteins derived from the M gene generally share little similarity between members of Rhabdoviradae (Gubala, Proll et al. 2008) However, the M gene has been determined to be a key component in the assembly of virus like particles and may not be subject to immunological pressures that could cause strain divergence (Jayakar, Jeetendra et al. 2004) Thus, this region was targeted due to the differences between members of Rhabdoviradae for strain identification and its relative conservation between strains as a major structural component. Flanders virus strains isolated from Florida during 2003 through 2008 by the BOL Tampa had high homology (range 93 97%) to the prototype strain originally isolated in New York in 1961. The M gene was also highly conserved between these isolates collected from different locations in Florida (range 93 98%). This is supported by p hylogenetic analysis that found minimal divergence of the Florida isolates from the prototype New York strain. A future analysis of the glycoprotein gene is recommended to study the divergence between Flanders virus isolates collected in different locations and time periods. Study of the glycoprotein gene is recommended d ue

PAGE 61

52 to previous studies that proposed that as the external protein it is more likely to undergo genetic variability (Benmansour, Basurco et al. 1997) Orthobunyaviruse s In a concurrent study at USF, the SISPA method was used to characterize a previously unknown viral isolate that was designated as Infirmatus virus. Based on nucleotide sequence identity, Infirmatus virus is considered to be a newly described Orthobunyavirus in the California serogroup Orthobunyaviruses are member s of the diverse Bunyaviradae family which contains important human and veterinary pathogens and is found throughout the world with the exception of Australia (Elliott 1990; Nichol 2001) The Orthobunyavirus genome consists of three segments of negative sense single stranded RNA designated as Large, Medium and Small (Nichol 2001) Several members of the g roup, such as Rift Valley fever and Crimean Congo hemorrhagic fever are considered emerging infectious dise ases (Elliott 2009) This may be due to the ability of RNA to rapidly evolve through mutation or genome segment reassortment or recombi nation. The segmented genome of ortho bunyaviruses allows for the possibility of antigenic shift (Lambert and Lanciotti 2009) The three genome segments of the different genera within the family Bunyaviradae have the same complementary nuc viral species (Schmaljohn 2001) Due to this ability, it is believed that members of Bunyaviradae will continue to be agents of public health importance. Reassorted bunya viru ses have been shown to cause se ve re disease, such as febrile illness

PAGE 62

53 and hemorrhagic fever (Bowen, Trappier et al. 2001; Gerrard, Li et al. 2004; Briese, Bird et al. 2006) Although the pathogenicity of Infirmatus virus is not known, it has the potential for reassortment and emergence as a public health threat based on its segmented genome. Although the SISPA method was instrumental for the characterization of Infirmatus virus, it is not a practical tool for high throughput screening of either clinical or environmental samples for detect ion of the virus. As a result, a traditional RT PCR assay was utilized to detect Infirmatus virus using a p reviously described primer set targeting the S segme nt of the Orthobunyavirus Phlebovirus and Nairovirus genera of the family Bunyaviridae (Lambert and Lanciotti 2009) The S segment encodes for the nucleoprotein, N, and another nonstructural protein, NSs, and has been shown to be highly conserved (Lambert and Lanciotti 2009) However, BLASTn sequence analysis of the 210 bp product of t he RT PCR assay targeting the S segment failed to clearly distinguish members of the California serogroup isolated in Florida and led to misidentification of viral species. This issue was not found in the prior study (Lambert and Lanciotti 2009) Once a putative mosquito pool was detected a confirmation RT PCR assay was preformed with a primer set targeting the G C glycoprotein of the genus Orthobun yavirus (Appendix C). This assay had been shown to detect Infirmatus virus (Ottendorfer, unpublished data). A total of 14 mosquito pools out of 462 mosquito pools tested were confirmed positive for Infirmatus virus. These

PAGE 63

54 mosquitoes were collected in Hills borough County at t wo surveillance sites ( Tampa Bay Downs and Eureka Springs ) Infirmatus virus was not detected in the 72 pools tested from the panhandle (Walton County ) of Florida. Infirmatus virus may not circulate at the other surveillance sites due t o ecological and host constraints. N atural mosquito population s in Florida were assayed to determine the infection prevalen ce of Infirmatus virus in 10,557 mosquitoes ( total of 462 pools) compris ed of 10 different species from the Tampa Bay area in 2008 ( 390 pools) and the panhandle (Walton County ) in 2009 (72 pools). Infection prevalence was determined to be the highest in Culex quinquefasciatus. Culex quinquefasciatus was not collected from the Eureka Springs site in Hillsborough County and were collecte d in relatively few numbers at the Walton County surveillance site. Arbovirus transmission cycle s have a relatively complex relationship between the arbovirus, the arthropod, and the vertebrate. Arbovirus infection at the surveillance sites was found to be relatively low. Previous analysis of blood meals derived from Culex quinquefasciatus have shown that they feed approximately equally on mammals and birds and suggest s that they are opportunistic feeders (Niebylski, Savage et al. 1994; Zinser, Ramberg et al. 2004) Concurrent studies at USF have characterized blood meal data collected at the same surveillance sites used in this study. Results have shown that the reservoir is cottontail rabbits (Hassan, unpublished da ta). It is currently not known if the cottontail rabbits are able to perpetuate the cycle.

PAGE 64

55 Phylogenetic analysis of the M segment from the newly determined Infirmatus virus strains and members of the family Bunyaviradae with published M gene sequences in GenBank showed that the se Infirmatus virus s trains grouped c losely with the prototype virus Infi r matus virus appears to be related to Trivittatus virus (Ottendorfer, unpublished data) Trivittatus vir us is commonly vectored by Ae. i nfirmatus in the southe ast United States and has a widespread distribution in the e astern United States Trivittatus virus has been shown to cause mild neurologic disease in humans (Romero and Newland 2003) The detection of multiple species in the California serogroup of Orthobunyaviruses in Florida is important for arbovirus surveillance pro grams and public health because previous studies have described medically important Orthobunyaviru ses and have shown that several members can cause human infections (Gates 1968; Lambert and Lanciotti 2009) The application of SISPA will allow for better surveillance and rapid detection of an unknown agent Due to the lack of available human vaccines, surveillance programs play a critical role in the reduction of human disease caused by arboviruses. Elucidation o f unknown viral isolates enhances the surveillance efforts employed by clinical and public health laboratories. Recognition of nonpathogenic arboviruses such as Flanders virus, can lead t o better public health measures through an increase in surveillan ce at peak arbovirus transmission months An example can be seen in the discovery of Highlands J virus. Highlands J virus, while non pathogenic to humans, has a

PAGE 65

56 similar distribution and transmission cycle as Eastern Equine Encephalitis virus (EEEV) (Allison and Stallknecht 2009) EEEV is a severe human and equine neuropathogen with apparent case fatality rates of 30% and 90%, respectively (Przelomski, O'Rourke et al. 1988; Dere siewicz, Thaler et al. 1997) Therefore, surveillance efforts that result in Highlands J virus positives are of public health importance since it signifies that transmission of EEEV is possible. S ome studies have suggested that surveillance for Flanders v irus may also be useful as an early indicator of flavivirus amplification of pathogenic arboviruses, such as WNV and SLEV In conclusion, t he opti mized SISPA method was successful ly used for the genetic characterization of two unidentified viruses isola ted in Florida This technique may be useful for the rapid identification of viral agents a nd may have broad applications in biodefense, agricultural and clinical settings for the detection of emerging infectious diseases. Future studies are recommended to assess the risk of human infection and the role of various mosquito species in transmission for these viruses classified by SISPA

PAGE 66

57 References Akowitz, A. and L. Manuelidis (1989). "A novel cDNA/PCR strategy for efficient cloning o f small amounts of undefined RNA." Gene 81 (2): 295 306. Allander, T., S. U. Emerson, et al. (2001). "A virus discovery method incorporating DNase treatment and its application to the identification of two bovine parvovirus species." Proc Natl Acad Sci U S A 98 (20): 11609 11614. Allison, A. B. and D. E. Stallknecht (2009). "Genomic sequencing of Highlands J virus: a comparison to western and eastern equine encephalitis viruses." Virus Res 145 (2): 334 340. Ambrose, H. E. and J. P. Clewley (2006). "Virus di scovery by sequence independent genome amplification." Rev Med Virol 16 (6): 365 383. Armstrong, P., D. Borovsky, et al. (1995). "Sensitive and specific colorimetric dot assay to detect eastern equine encephalomyelitis viral RNA in mosquitoes (Diptera: Cul icidae) after polymerase chain reaction amplification." J Med Entomol 32 (1): 42 52. Ayers, M., D. Adachi, et al. (2006). "A single tube RT PCR assay for the detection of mosquito borne flaviviruses." J Virol Methods 135 (2): 235 239. Bae, H. G., A. Nitsch e, et al. (2003). "Detection of yellow fever virus: a comparison of quantitative real time PCR and plaque assay." J Virol Methods 110 (2): 185 191. Benmansour, A., B. Basurco, et al. (1997). "Sequence variation of the glycoprotein gene identifies three dis tinct lineages within field isolates of viral haemorrhagic septicaemia virus, a fish rhabdovirus." J Gen Virol 78 ( Pt 11) : 2837 2846.

PAGE 67

58 Bigler, W. J., E. Lassing, et al. (1975). "Arbovirus surveillance in Florida: wild vertebrate studies 1965 1974." J Wild l Dis 11 (3): 348 356. Blackmore, C. G., L. M. Stark, et al. (2003). "Surveillance results from the first West Nile virus transmission season in Florida, 2001." Am J Trop Med Hyg 69 (2): 141 150. Bond, J. O., W. M. Hammon, et al. (1966). "California group arboviruses in Florida and report of a new strain, Keystone virus." Public Health Rep 81 (7): 607 613. Bowen, M. D., S. G. Trappier, et al. (2001). "A reassortant bunyavirus isolated from acute hemorrhagic fever cases in Kenya and Somalia." Virology 291 (2) : 185 190. Boyd, K. R. (1972). "Serological comparisons among Hart Park virus and strains of Flanders virus." Infect Immun 5 (6): 933 937. Braham, S., M. Iturriza Gomara, et al. (2009). "Optimisation of a single primer sequence independent amplification ( SP SIA) assay: detection of previously undetectable norovirus strains associated with outbreaks of gastroenteritis." J Virol Methods 158 (1 2): 30 34. Breitbart, M. and F. Rohwer (2005). "Method for discovering novel DNA viruses in blood using viral partic le selection and shotgun sequencing." Biotechniques 39 (5): 729 736. Briese, T., B. Bird, et al. (2006). "Batai and Ngari viruses: M segment reassortment and association with severe febrile disease outbreaks in East Africa." J Virol 80 (11): 5627 5630. Cal isher, C. H., J. S. Lazuick, et al. (1980). "Antigenic relationships among Tacaiuma complex viruses of the Anopheles A serogroup (Bunyaviridae)." Bull Pan Am Health Organ 14 (4): 386 391. CDC (2010). "Locally Acquired Dengue Key West, Florida, 2009 201 0." MMWR 59 : 579 612.

PAGE 68

59 Chisenhall, D. M., C. J. Vitek, et al. (2008). "A method to increase efficiency in testing pooled field collected mosquitoes." J Am Mosq Control Assoc 24 (2): 311 314. Clark, D. P. (2005). Molecular Biology Burlington, Ma, Elseiver Academic Press. Clem, A. L., J. Sims, et al. (2007). "Virus detection and identification using random multiplex (RT) PCR with 3' locked random primers." Virol J 4 : 65. Collins, C., and Blackmore, C. (2003) "Mosquito Borne Disease Summary Through the Wee k Ending December 29, 2003." Florida Department of Health Collins, C., Weis, K., Stanek, D., Blackmore, C. (2008) "Florida 2008 Arbovirus Activity by County Through December 27, 2008." Condit, R. C. (2001). Principles of Virology. Fields Virology P. M. H. D. M. Knipe, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman and S.E. Straus Philadelphia, Pa, Lippincott Willians & Wilkins : 19 51. Deresiewicz, R. L., S. J. Thaler, et al. (1997). "Clinical and neuroradiographic manifestations of eastern equin e encephalitis." N Engl J Med 336 (26): 1867 1874. Djikeng, A., R. Halpin, et al. (2008). "Viral genome sequencing by random priming methods." BMC Genomics 9 : 5. Elliott, R. M. (1990). "Molecular biology of the Bunyaviridae." J Gen Virol 71 ( Pt 3) : 501 5 22. Elliott, R. M. (2009). "Bunyaviruses and climate change." Clin Microbiol Infect 15 (6): 510 517. Gates, E. H., Bond, J.O., Lewis, A.L. (1968 ). "California Group Arbovirus Encephalitis in Florida Children." J Florida Med Ass 55 : 37 40. Gerrard, S. R ., L. Li, et al. (2004). "Ngari virus is a Bunyamwera virus reassortant that can be associated with large outbreaks of hemorrhagic fever in Africa." J Virol 78 (16): 8922 8926.

PAGE 69

60 Gu, W. and R. J. Novak (2004). "Short report: detection probability of arboviru s infection in mosquito populations." Am J Trop Med Hyg 71 (5): 636 638. Gubala, A. J., D. F. Proll, et al. (2008). "Genomic characterisation of Wongabel virus reveals novel genes within the Rhabdoviridae." Virology 376 (1): 13 23. Gubler, D. J. (1996). "Th e global resurgence of arboviral diseases." Trans R Soc Trop Med Hyg 90 (5): 449 451. Gubler, D. J. (2002). "The global emergence/resurgence of arboviral diseases as public health problems." Arch Med Res 33 (4): 330 342. Hadfield, T. L., M. Turell, et al. (2001). "Detection of West Nile virus in mosquitoes by RT PCR." Mol Cell Probes 15 (3): 147 150. Jayakar, H. R., E. Jeetendra, et al. (2004). "Rhabdovirus assembly and budding." Virus Res 106 (2): 117 132. Jennings, W. L., A. L. Lewis, et al. (1970). "Tami ami virus in the Tampa Bay area." Am J Trop Med Hyg 19 (3): 527 536. Johnson, D. H. (1990). "Molecular cloning of DNA from specific chromosomal regions by microdissection and sequence independent amplification of DNA." Genomics 6 (2): 243 251. Jones, K. E. N. G. Patel, et al. (2008). "Global trends in emerging infectious diseases." Nature 451 (7181): 990 993. Jones, M. S., A. Kapoor, et al. (2005). "New DNA viruses identified in patients with acute viral infection syndrome." J Virol 79 (13): 8230 8236. Kat holi, C. R., L. To, et al. (1995). "Determining the prevalence of Onchocerca volvulus infection in vector populations by PCR screening of pools of black flies." Journal of Infectious Diseases 172 : 1414 1417.

PAGE 70

61 Knipe, D. M., Samuel, C.E., and Palese, P. ( 2001). Virus Host Cell Interactions. Fields Virology P. M. H. D. M. Knipe, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman and S.E. Straus Philadelphia, Pa, Lippincott Willians & Wilkins. 1: 133 170. Kokernot, R. H., J. Hayes, et al. (1969). "Arbovi rus studies in the Ohio Mississippi Basin, 1964 1967. 3. Flanders virus." Am J Trop Med Hyg 18 (5): 762 767. Kuno, G. (1998). "Universal diagnostic RT PCR protocol for arboviruses." J Virol Methods 72 (1): 27 41. Kuno, G., C. J. Mitchell, et al. (1996). "D etecting bunyaviruses of the Bunyamwera and California serogroups by a PCR technique." J Clin Microbiol 34 (5): 1184 1188. Lambden, P. R., S. J. Cooke, et al. (1992). "Cloning of noncultivatable human rotavirus by single primer amplification." J Virol 66 (3 ): 1817 1822. Lambert, A. J. and R. S. Lanciotti (2009). "Consensus amplification and novel multiplex sequencing method for S segment species identification of 47 viruses of the Orthobunyavirus, Phlebovirus, and Nairovirus genera of the family Bunyavirida e." J Clin Microbiol 47 (8): 2398 2404. Lanciotti, R. S., C. H. Calisher, et al. (1992). "Rapid detection and typing of dengue viruses from clinical samples by using reverse transcriptase polymerase chain reaction." J Clin Microbiol 30 (3): 545 551. Lancio tti, R. S., A. J. Kerst, et al. (2000). "Rapid detection of west nile virus from human clinical specimens, field collected mosquitoes, and avian samples by a TaqMan reverse transcriptase PCR assay." J Clin Microbiol 38 (11): 4066 4071. Levine, A. J. (2001) The Origins of Virology. Fields Virology P. M. H. D. M. Knipe, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman Philadelphia, Pa, Lippincott Willians & Wilkins. 1: 3 18.

PAGE 71

62 Lewis, A. L., W. M. Hammon, et al. (1965). "Isolation of a California Group A rbovirus from Florida Mosquitoes." Am J Trop Med Hyg 14 : 451 455. Linnen, J., J. Wages, Jr., et al. (1996). "Molecular cloning and disease association of hepatitis G virus: a transfusion transmissible agent." Science 271 (5248): 505 508. Matsui, S. M., J. P. Kim, et al. (1991). "The isolation and characterization of a Norwalk virus specific cDNA." J Clin Invest 87 (4): 1456 1461. Moore, C. G., McLean, R.G., Mitchell, C.J., Nasci, R.S., Tsai, T.F., Calisher, C.H., Marfin, A. A., Moore, P.S. and Gubler, D.J. (1993). "Guidelines for Arbovirus Surveillance Programs in the United States." CDC, http://www.cdc.gov/ncidod/dvbid/arbor/arboguid.pdf Nasci, R. S. and C. J. Mitchell (1996). "Arbovirus titer variation in field collected mosquitoes." J Am Mosq Control Assoc 12 (2 Pt 1): 167 171. Nash, D., F. Mostashari, et al. (2001). "The outbreak of West Nile virus infection in the New York City area in 1999." N Engl J Med 344 (24): 1807 1814. Nelson, D B., K. D. Kappus, et al. (1983). "St. Louis encephalitis -Florida 1977. Patterns of a widespread outbreak." Am J Trop Med Hyg 32 (2): 412 416. Nemeth, N. M., J. F. Dwyer, et al. (2009). "Prevalence of antibodies to West Nile virus and other arboviruses a mong Crested Caracaras (Caracara cheriway) in Florida." J Wildl Dis 45 (3): 817 822. Nichol, S. T. (2001). Bunyaviruses. Fields Virology P. M. H. D. M. Knipe, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman and S.E. Straus. Philadelphia, Pa, Lippincot t Willians & Wilkins. 2: 1603 1634. Niebylski, M. L., H. M. Savage, et al. (1994). "Blood hosts of Aedes albopictus in the United States." J Am Mosq Control Assoc 10 (3): 447 450.

PAGE 72

63 O'Brien, V. A., C. U. Meteyer, et al. (2010). "Prevalence and pathology of West Nile virus in naturally infected house sparrows, western Nebraska, 2008." Am J Trop Med Hyg 82 (5): 937 944. Ortiz, D. I., A. Wozniak, et al. (2003). "Isolation of EEE virus from Ochlerotatus taeniorhynchus and Culiseta melanura in coastal South Caro lina." J Am Mosq Control Assoc 19 (1): 33 38. Pesko, K. and C. N. Mores (2009). "Effect of sequential exposure on infection and dissemination rates for West Nile and St. Louis encephalitis viruses in Culex quinquefasciatus." Vector Borne Zoonotic Dis 9 (3) : 281 286. Powers, A. M., A. C. Brault, et al. (2001). "Evolutionary relationships and systematics of the alphaviruses." J Virol 75 (21): 10118 10131. Przelomski, M. M., E. O'Rourke, et al. (1988). "Eastern equine encephalitis in Massachusetts: a report o f 16 cases, 1970 1984." Neurology 38 (5): 736 739. Rao, B. L., A. Basu, et al. (2004). "A large outbreak of acute encephalitis with high fatality rate in children in Andhra Pradesh, India, in 2003, associated with Chandipura virus." Lancet 364 (9437): 869 8 74. Re, V., L. Spinsanti, et al. (2008). "Reliable detection of St. Louis encephalitis virus by RT nested PCR." Enferm Infecc Microbiol Clin 26 (1): 10 15. Reyes, G. R. and J. P. Kim (1991). "Sequence independent, single primer amplification (SISPA) of co mplex DNA populations." Mol Cell Probes 5 (6): 473 481. Romero, J. R. and J. G. Newland (2003). "Viral meningitis and encephalitis: traditional and emerging viral agents." Semin Pediatr Infect Dis 14 (2): 72 82.

PAGE 73

64 Rose, J. K., Whitt, M.A. (2001). Rhabdovir idae: The Viruses and Their Replication. Fields Virology P. M. H. D. M. Knipe, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman and S.E. Straus. Philadelphia, Pa, Lippincott Willians & Wilkins. 1: 1221 1277. Rozen, S., and Skaletsky, H.J. (2000). Pr imer3 on the WWW for general users and for biologist programmers. Bioinformatics Methods and Protocols: Methods in Molecular Biology M. S. Krawetz S. Totowa, NJ, Humana Press : 365 386. Schmaljohn, C. S., Hooper, J.W. (2001). Bunyaviridae: The Viruses and Their Replication. Fields Virology P. M. H. D. M. Knipe, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman and S.E. Straus Philadelphia, Pa, Lippincott Willians & Wilkins. 2: 1581 1602. Tamura, K., J. Dudley, et al. (2007). "MEGA4: Molecular Evoluti onary Genetics Analysis (MEGA) software version 4.0." Mol Biol Evol 24 (8): 1596 1599. Valles, S. M., C. A. Strong, et al. (2007). "A new positive strand RNA virus with unique genome characteristics from the red imported fire ant, Solenopsis invicta." Viro logy 365 (2): 457 463. van Regenmortel, M. H. V., C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle, and R. B. Wickner (2000). Virus taxonomy: the classification and nomenclature of viruses. The Seventh Report of the International Committee on Taxonomy of Viruses San Diego, CA, Academic Press. Victoria, J. G., A. Kapoor, et al. (2008). "Rapid identification of known and new RNA viruses from animal tissues." PLoS Pathog 4 (9). Vi llari, P., A. Spielman, et al. (1995). "The economic burden imposed by a residual case of eastern encephalitis." Am J Trop Med Hyg 52 (1): 8 13. White, D. J., L. D. Kramer, et al. (2001). "Mosquito surveillance and polymerase chain reaction detection of We st Nile virus, New York State." Emerg Infect Dis 7 (4): 643 649.

PAGE 74

65 Whitney, E. (1964). "Flanders Strain, an Arbovirus Newly Isolated from Mosquitoes and Birds of New York State." Am J Trop Med Hyg 13 : 123 131. WHO (1985). "Arthropod borne and rodent borne v iral diseases." World Health Organization Ser No. 719 (Technical Report). Yandoko, E. N., S. Gribaldo, et al. (2007). "Molecular characterization of African orthobunyaviruses." J Gen Virol 88 (Pt 6): 1761 1766. Zinser, M., F. Ramberg, et al. (2004). "Culex quinquefasciatus (Diptera: Culicidae) as a potential West Nile virus vector in Tucson, Arizona: blood meal analysis indicates feeding on both humans and birds." J Insect Sci 4 : 20.

PAGE 75

66 Appendices

PAGE 76

67 Appendix A Media Components Abbreviations: EMEM ......... FCS .......... Fetal Calf Serum HMEM ........ L 15 .......... Lebowitz Media NCS .......... Newborn Calf Serum Hepes ......... 4 (2 hydroxyethyl) 1 piperazinethanesulfonic acid Outgrowth Media to Passage Vero Cells Reagent ml Vendor Catalog Number 1X HMEM 45 Sigma M 1018 1X L 15 45 Sigma L 4386 NCS (inactivated) 10 HyClone SH30118.03 Penicillin (200,000 U/ml) 0.1 Sigma P 7794 Streptomycin (200 mg/ml) 0.1 Sigma S 9137 Amphotericin B (2.5 mg/ml) 0.1 Sigma A 9258 Kanamyci n (50 mg/ml) 0.1 Sigma K 1377

PAGE 77

68 Appendix A (Continued) Liquid Maintenance Media to Maintain Vero Cells After Inoculation Reagent ml Vendor Catalog Number 1X EMEM 100 Sigma M 1018 NCS (inactivated) 2 HyClone SH30118.03 Penicillin (200,000 U/ml) 0.1 HyClone P 7794 Streptomycin (200 mg/ml) 0.1 Sigma S 9137 Amphotericin B (2.5 mg/ml) 0.1 Sigma A 9258 Kanamycin (50 mg/ml) 0.1 Sigma K 1377 HEPES (1 M) 1 Sigma H 4034 Biology Field Diluent (BFD) Reagent ml Vendor Catalog Number 1X HMEM 90 Sigma M 10 18 FCS (inactivated) 10 HyClone SH30070.03 Penicillin (200,000 U/ml) 0.1 HyClone P7794 Streptomycin (200 mg/ml) 0.1 Sigma S9137 Amphotericin B (2.5 mg/ml) 0.1 Sigma A9258 Kanamycin (50 mg/ml) 0.1 Sigma K1377

PAGE 78

69 Appendix B BOL Tampa environmental isolat e RT PCR screening panel for endemic Arboviruses Target genus/ genomic target Forward Primer Reverse Primer App ox. amplicon size (bp) Source Name Name California serogroup CAL A1 ATGACTGAGTTGGAGTTT CATGATGTCGC CAL A2 TGTTCCTGTTGCCAGGAA AAT 250 CDC Alphavirus A TACCCNTTYATGTGGG T 25 V Mlu TTACG AATTCACGCG T 25 1.0 1.5 kb (Powers et al., 2001) SLEV SLE C1 GTAGCCGACGGTCAATCT CTGTGC SLE C2 ACTCGGTAGCCTCCATCT TCATCA 392 CDC Dengue group D1 TCAATATGCTGAAACGCG CGAGAAACCG D2 TCAATATGCTGAAACGCG CGAGAAACCG 511 CDC

PAGE 79

70 Appendix B (Continued) BOL Tampa environmental isolate Real Time RT PCR screening panel for endemic Arboviruses Target genus/ Forward Primer Reverse Primer Probe Source genomic target Name Name Name WNV WN A1 CAGACCACGCTACG GCG WN A2 CTAGGGCCGCGT GGG WN A BHQ CTGCGGAGAGTGC AGTCTGCGAT CDC SLEV SLEA P2 GAAAACTGGGTTCT GCGCA SLE A P1 GGTGCTGCCTAG CATCCATCC SLE A BHQ TGGATATGCCCTAG TTGCGCTGGC CDC EEEV EE9391 ACACCGCACCCTGA TTTTACA EE94 59c CTTCCAAGTGAC CTGGTCGTC EEE 9414 TGCACCCGGACCAT CCGACCT CDC

PAGE 80

71 Appendix C RT PCR Assays used for identity confirmation Forward Primer Reverse Primer Genomic Target Name Name Fla nders virus Medium gene Flanders FWD CTTTGAATCCTGGTCGTGGT Flanders REV TTACGCTCGACACACCATGT Orthobunyavirus N ORF Cal/BWA FWD GCAAATGGATTTGATCCTGATG CAG Cal/BWA REV TTGTTCCTGTTTGCTGGAAAATG AT Orthobunyavirus G C glycoprotein M3 FWD GTGGTTGCATACATAAAATCT M3 REV TAGGCAGGCTGTAACTCTCA

PAGE 81

72 Appendix C (Continued) M aster Mix Components for RT PCR SuperScript III One Step RT PCR System with Platinum Taq DNA polymerase Master Mix components for use with amplification of the S segment of members of the family Bunya viridae primer set (Lambert and Lanciotti 2009) and amplification of the GC glycoproten of Infirmatus virus. Component [Final Concentration] Volume Stock Concentration RNase/DN ase free water 5.5 l N/A 2X Reaction Mix 12.5 l Proprietary 20 um Forward primer 0.5 l 20 um Reverse primer 0.5 l SuperScript III Platinum Taq 1 .0 l Proprietary Template 5 .0 l N/A Total 25 l SuperScript III One Step RT PCR System with Platinum Taq DNA polymerase Master Mix components for use with Flanders M gene spe cific primers Component [Final Concentration] Volume Stock Concentration RNase/DNase free water 4.5 l N/A 2X Reaction Mix 12.5 l Proprietary 20 um Forward primer 1.0 l 20 um Reverse primer 1.0 l SuperScript III Platinum Taq 1.0 l Pr oprietary Template 5.0 l N/A Total 25 l

PAGE 82

73 Appendix C (Continued) Thermal Cycler Parameters Thermacycling parameters for amplification of the S segment of members of the family Bunyaviridae primer set (Lamber t and Lanciotti 2009) and amplification of the GC glycoproten of Infirmatus virus. Reverse Transcription (1 cycle) 50 30 min 95 5 min PCR (45 cycles) 94 20 sec 55 30 sec 68 2 min Final Extension (1 cycle) 72 20 min Thermacycling parameters for amplification using Flanders M gene specific p r imers Reverse Transcription (1 cycle) 50 30 min 95 5 min PCR (35 cycles) 95 5 min 55 30 sec 72 30 sec Final Extension (1 cycle) 72 7 min

PAGE 83

About the Author Jessie L. Dyer received a Bachelor of Science degree in Molecular Biology from the Florida Institute of Technology in 2007. She has co authored several peer reviewed journal articles on arboviruses. During her time as th e University of South Florida, she received the University of South Florida Student Research Award 2008 to support her graduate research project, served as the President of the Infectious Disease Association and was actively involved in several student org anizations.