USF Libraries
USF Digital Collections

Regulatory mechanism of myeloid derived suppressor cell activity

MISSING IMAGE

Material Information

Title:
Regulatory mechanism of myeloid derived suppressor cell activity
Physical Description:
Book
Language:
English
Creator:
Corzo, Cesar Alexander
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
T-cell suppression
NADPH Oxidase
Hypoxia
STAT3
HIF-1alpha
Dissertations, Academic -- Molecular Medicine -- Masters -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: Myeloid-derived suppressor cells (MDSC) are a major component of the immune suppressive network that develops during cancer. MDSC down-regulate immune surveillance and antitumor immunity and facilitate tumor growth. The ability of MDSC to suppress T cell responses has been documented; however the mechanisms regulating this suppression remain to be understood. This work proposes a biological dichotomy of MDSC regulated by the tumor microenvironment. In peripheral lymphoid organs MDSC cause T-cell non-responsiveness that is antigen-specific. These MDSC have increased expression of NOX2, enabling them to produce large amounts of reactive oxygen species. Since the transcription factor STAT3 is substantially activated in MDSC, its potential role in upregulation of NOX2 expression was investigated. Over-expression of a constitutively active form of STAT3 increases expression of NOX2 subunits, whereas attenuation of STAT3 activity leads to decreased expression of NOX2. The significance of NOX2 in ROS generation is demonstrated in mice devoid of NOX2 function; NOX2-deficient MDSC are unable to inhibit antigen-induced activation of T cells. In contrast, MDSC within the tumor microenvironment have a diminished potential to generate ROS but acquire expression of arginase and inducible nitric oxide synthase, enzymes implicated in T cell non-responsiveness. Upregulation of these enzymes results in MDSC ability to inhibit lymphocyte response in absence of antigen presentation. The tumor microenvironment also promotes the differentiation of MDSC to tumor associated macrophages. Hypoxia is an exclusive feature to the tumor microenvironment and we investigated its involvement in the properties of MDSC at the tumor site. Exposure of spleen MDSC to hypoxia converts MDSC to non-specific suppressors and induces a preferential differentiation to macrophages. Stabilization of HIF-1!, a transcription factor activated by hypoxia, induces similar changes in MDCS as hypoxic exposure. Finally, ablation of HIF-1prevents MDSC from acquiring factors that enable the suppression of T cells in absence of antigen. These findings help to expand our understanding of the biology of MDSC and suggest a regulatory pathway of myeloid cell function exclusive to the tumor microenvironment. They may also open new opportunities for therapeutic regulation as we now should take into consideration how systemic location affects the function of MDSC.
Thesis:
Dissertation (PHD)--University of South Florida, 2010.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Cesar Alexander Corzo.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains X pages.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
usfldc doi - E14-SFE0004663
usfldc handle - e14.4663
System ID:
SFS0027978:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam 22 Ka 4500
controlfield tag 007 cr-bnu---uuuuu
008 s2010 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0004663
035
(OCoLC)
040
FHM
c FHM
049
FHMM
090
XX9999 (Online)
1 100
Corzo, Cesar Alexander.
0 245
Regulatory mechanism of myeloid derived suppressor cell activity
h [electronic resource] /
by Cesar Alexander Corzo.
260
[Tampa, Fla] :
b University of South Florida,
2010.
500
Title from PDF of title page.
Document formatted into pages; contains X pages.
502
Dissertation (PHD)--University of South Florida, 2010.
504
Includes bibliographical references.
516
Text (Electronic thesis) in PDF format.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
3 520
ABSTRACT: Myeloid-derived suppressor cells (MDSC) are a major component of the immune suppressive network that develops during cancer. MDSC down-regulate immune surveillance and antitumor immunity and facilitate tumor growth. The ability of MDSC to suppress T cell responses has been documented; however the mechanisms regulating this suppression remain to be understood. This work proposes a biological dichotomy of MDSC regulated by the tumor microenvironment. In peripheral lymphoid organs MDSC cause T-cell non-responsiveness that is antigen-specific. These MDSC have increased expression of NOX2, enabling them to produce large amounts of reactive oxygen species. Since the transcription factor STAT3 is substantially activated in MDSC, its potential role in upregulation of NOX2 expression was investigated. Over-expression of a constitutively active form of STAT3 increases expression of NOX2 subunits, whereas attenuation of STAT3 activity leads to decreased expression of NOX2. The significance of NOX2 in ROS generation is demonstrated in mice devoid of NOX2 function; NOX2-deficient MDSC are unable to inhibit antigen-induced activation of T cells. In contrast, MDSC within the tumor microenvironment have a diminished potential to generate ROS but acquire expression of arginase and inducible nitric oxide synthase, enzymes implicated in T cell non-responsiveness. Upregulation of these enzymes results in MDSC ability to inhibit lymphocyte response in absence of antigen presentation. The tumor microenvironment also promotes the differentiation of MDSC to tumor associated macrophages. Hypoxia is an exclusive feature to the tumor microenvironment and we investigated its involvement in the properties of MDSC at the tumor site. Exposure of spleen MDSC to hypoxia converts MDSC to non-specific suppressors and induces a preferential differentiation to macrophages. Stabilization of HIF-1!, a transcription factor activated by hypoxia, induces similar changes in MDCS as hypoxic exposure. Finally, ablation of HIF-1prevents MDSC from acquiring factors that enable the suppression of T cells in absence of antigen. These findings help to expand our understanding of the biology of MDSC and suggest a regulatory pathway of myeloid cell function exclusive to the tumor microenvironment. They may also open new opportunities for therapeutic regulation as we now should take into consideration how systemic location affects the function of MDSC.
590
Advisor: Dmitry I. Gabrilovich, M.D., Ph.D.
653
T-cell suppression
NADPH Oxidase
Hypoxia
STAT3
HIF-1alpha
690
Dissertations, Academic
z USF
x Molecular Medicine
Masters.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.4663



PAGE 1

Regulatory Mechanism of Myeloid Derived Suppressor Cell Activity By Cesar Alexander Corzo A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Molecular Medicine College of M edicine University of South Florida Major Professor: Dmitry I. Gabrilovich, M.D., Ph.D. George Blanck, Ph.D. Julie Djeu, Ph.D Peter Medveczky, M.D Diana Lopez, Ph.D Date of Approval: June 17, 2010 Keywords: T cell suppression, NADPH Oxidase, Hypoxi a, STAT3, HIF 1 Copyright 2010, Cesar Alexander Corzo

PAGE 2

DEDICATION I want to dedicate this dissertation to my family for being an integral part of my life during my education. In particular to my moth er Carmen for her perpetual sacrifices for the benefit of her children; you are the greatest mother in the world. To my father Javier, for his support and advise. To my sister Linda for her unconditional love and for always being my best friend And l astly to little Alexander Nathaniel, you are the latest addition to our family and will be a blessing for us all.

PAGE 3

ACKNOWLEDGEMENTS I would like to thank my major professor Dmitry Gabrilovich for his guidance, patience and support throughout the past five years. I would like to offer special thanks to my coworkers Pin gyan Cheng, Srinivas Nagaraj and the numerous lab members through the years, for providing me with unequalled knowledge and assistance. I would like to mention the H. Lee Moffitt Cancer Research Center and for providing its core facilities and equipments that were used to complete th is dissertation. Lastly, I would like to acknowledge the National Institutes of Health for the financial assistance it provided to this project.

PAGE 4

i TABLE OF CONTENTS LIST OF FIGURES ................................ ................................ ................................ ........... iii ABSTRACT. ................................ ................................ ................................ ................ v INTRODUCTION ................................ ................................ ................................ .............. 1 Cancer and the Immune System ................................ ................................ ............. 1 Identification and Definition of MDSC. ................................ .............................. 3 MDSC Expansion in Cancer.. ................................ ................................ .................. 5 Suppressive Mechanisms of MDSC:. ................................ ................................ ...... 8 Origin and F unctional P olarization o f TAM ................................ ......................... .15 Role of Hypoxia in A ccumulation of TAMs ................................ ......................... 17 Statement of Purpose ................................ ................................ ............................. 19 MATERIALS AND METHODS ................................ ................................ ....................... 21 RESULTS ................................ ................................ ................................ .................. 30 I. Suppressive Mechanism of MDSC in Peripheral Lymphoid Organs: Role of NADPH Oxidase (NOX2) and Signal Transducer and Activator of Tran scription 3 (STAT3) ................................ ........................... ..30 Hyper production of ROS in splenic MDSC ................................ ............. 30 ROS generation by MDSC in peripheral blood samples of h ead and n eck cancer patients. ................................ ............................ 31 Increased Transcription of NAPDH Oxidase controls ROS upregulation and suppressive activit y of peripheral MDSC ........ 32 STAT3 recognizes promoter of NADPH Oxidase subunit ........................ 34 Stat3 a ctivity regulates e xpression of NADPH Oxidase s ubunits ............. 35 II. Suppressive Activity and Differentiation of MDSC in the Tumor Site: the Role of Tumor Hypoxia and HIF 1 ................................ ......................... 45 Phenotype of MDSC in the tumor site ................................ ....................... 46 Function of MDSC in the tumor microenvironment.. ................................ 47 Manipulation of L arginine metabolism is the main suppressive mechanism employed by Tumor MDSC. ................................ ........ 48 MDSC in Tumor Tissues of Cancer Patients.. ................................ ...... .49 Effect of Tumor microenvironment on MDSC function and differentiation. ................................ ................................ .................. 49 Effect of Hypoxia on MDSC function and differentiation.. .................. 51

PAGE 5

ii Effect of Hypoxia on MDSC function and differentiation.. .................. 51 Requirement of HIF 1 for tumor microenvironment and hypoxia induced changes in MDSC.. ................................ ..... 53 DISCUSSION ................................ ................................ ................................ ........ 73 RE FERENCES.. ................................ ................................ ................................ 85 ABOUT THE AUTHOR ................................ ................................ ................... END PAGE

PAGE 6

iii LIST OF FIGURES Figure 1: ROS level in MDSC from tumor bearing mice and cancer patients ................. 38 Figure 2: ROS production in MDSC from patients with head and neck cancer ................ 39 Figure 3: Up regulation of NADPH Oxidase in MDSC ................................ .................... 40 Figure 4: NADPH Oxidase is responsible for ROS production in splenic MDSC and the antigen specific suppression of T cells ................................ ............... 41 Figure 5: STAT3 recognition of NADPH oxidase subunit promoter ................................ 42 Figure 6: STAT3 regulates expression of NADPH oxidase ................................ .............. 43 Figure 7: Effect of STAT3 inhibitor JSI 124 on ROS level in MDSC .............................. 44 Figure 8: Phenotype of MDSC in tumor site ................................ ................................ ..... 57 Figure 9: Function of MDSC in tumor site ................................ ................................ ........ 58 Figure 10: Factors regulating MDSC suppressive activity ................................ .......... 59 60 Figure 11: MDSC i n peripheral blood and tumor tissues of cancer patients ..................... 61 Figure 12: Effect of the tumor microenvironment on MDSC function ....................... 62 63 Figure 13: Differentiation of MDSC in the tumor microenvironment .............................. 64 Figure 14: Regulation of MDSC function by hypoxia ................................ ....................... 65 Figur e 15: Regulation of MDSC differentiation by hypoxia ................................ ....... 66 67 Figure 16: Consequences of HIF 1 stabilization in MDSC properties .......................... 68 Figure 17: Evaluation of HIF 1 deficient chimeric mice before and after tumor

PAGE 7

iv establishment. ................................ ................................ ............................. 69 70 Figure 18: Changes in MDSC function and differentiation induced by the tumor microenvironment require HIF 1 ................................ ................................ ... 71 Figure 19: Schematic of MDSC function and differentiation in tumor bearing host ........ 72

PAGE 8

v Regulatory Mechan ism of Myeloid Derived Suppressor Cell Activity Cesar Alexander Corzo ABSTRACT Myeloid derived suppressor cells (MDSC) are a major component of the immune suppressive network that develops during cancer. MDSC down regulate immune surveillance and antitu mor immunity and facilitate tumor growth. The ability of MDSC to suppress T cell responses has been documented; however the mechanisms regulating this suppression remain to be understood. This work proposes a biological dichotomy of MDSC regulated by the t umor microenvironment. In peripheral lymphoid organs MDSC cause T cell non responsiveness that is antigen specific. These MDSC have increased expression of NOX2, enabling them to produce large amounts of reactive oxygen species. Since the transcription fac tor STAT3 is substantially activated in MDSC, its potential role in upregulation of NOX2 expression was investigated. Over expression of a constitutively active form of STAT3 increases expression of NOX2 subunits, whereas attenuation of STAT3 activity lead s to decreased expression of NOX2. The significance of NOX2 in ROS generation is demonstrated in mice devoid of NOX2 function; NOX2 deficient MDSC are unable to inhibit antigen induced activation of T cells. In contrast, MDSC within the tumor microenvironm ent have a diminished potential to generate ROS but acquire expression of arginase and inducible nitric oxide synthase, enzymes

PAGE 9

vi implicated in T cell non responsiveness. Upregulation of these enzymes results in MDSC ability to inhibit lymphocyte response in absence of antigen presentation. The tumor microenvironment also promotes the differentiation of MDSC to tumor associated macrophages. Hypoxia is an exclusive feature to the tumor microenvironment and we investigated its involvement in the properties of M DSC at the tumor site. Exposure of spleen MDSC to hypoxia converts MDSC to non specific suppressors and induces a preferential differentiation to macrophages. Stabilization of HIF 1 a transcription factor activated by hypoxia, induces similar changes in MDCS as hypoxic exposure. Finally, ablation of HIF 1 prevents MDSC from acquiring factors that enable the suppres sion of T cells in absence of antigen. These findings help to expand our understanding of the biology of MDSC and suggest a regulatory pathway of myeloid cell function exclusive to the tumor microenvironment. They may also open new opportunities for therap eutic regulation as we now should take into consideration how systemic location affects the function of MDSC.

PAGE 10

1 INTRODUCTION Cancer and the Immune System Cancer is among the most life threatening diseases and has risen to become the second leading cause of death in the developed world. Most cancer patients are treated by a combination of surgery, radiation, and/ or chemotherapy. While these standard therapies are efficient at treating the primary tumor, cancer still causes 25% of mortalities in the industrialized world. The primary reason for the failure in mortality prevention is the ineffectiveness of traditiona l treatments in controlling metastatic spread of the disease. Deficiencies in immune responses have been extensively described in cancer patients. The observation that tumor infiltrating lymphocytes (TILs) and antigen presenting cells (APCs) are non funct ional in tumor tissues exemplifies the defects in the immune system (1 5). Decreased numbers of mature dendritic cells (DCs) have been observed in the lymph nodes and spleen of tumor bearing mice (1,2,3), and in peripheral blood of cancer patients (4). In addition to the DC defects, T cells are rendered tolerant to tumor antigens early during tumor progression (5) demonstrating that the T lymphocyte compartment also becomes systemically impaired The failure of the immune system to eradicate tumor cells is arguably due to its inability to recognize cancer cells in an immunogenic context. However, it was shown over a century ago that activation of the immune system using the highly immunogenic

PAGE 11

2 Coley's toxin induced a potent systemic inflammatory response tha t helped to control tumor growth and in some cases to eradicate solid tumors (6), demonstrating that if properly activated the immune system is capable of controlling and eliminating the disease. This concept helped establish the immunotherapy approach for cancer treatment. The purpose of cancer immunotherapy is to activate the immune system and to restore its functionality, hoping that it will be able to eliminate the primary tumor and prevent its metastatic spread. Current therapies intended to boost the immune system involve administration of cytokines: interleukin 2 (IL 2) and interferon alpha (IFN ) are FDA approved for treatment of Kaposi's sarcoma and multiple types of leukemia (7, 8). A second approach of immunotherapy involves antibody based treat ment: Rituxan, Herceptin, Campath are example of commercially antibodies available for treatment of various leukemias, non Hodgkin's lymphoma, and colorectal cancer (9). Cancer vaccines are the latest strategy for prevention and treatment ofcancer. Cancer vaccines are intended to induce an endogenous, long lasting tumor antigen specific immune response. They involve the processing of tumor antigens by APCs and the accompanying presentation to T cells. Cancer vaccines include protein containing vaccines, in which tumor associated antigens (10) are usually combined with either adjuvants to induce a strong immune response, with irradiated autologous tumor cells, or with allogenic tumor cells lines transfected with cytokine genes (e.g. GM CSF, IL2). Additionally DC based vaccines are currently under evaluation. Autologous DCs are activated in vitro provided with the tumor antigen (either as peptide, or as mRNA or cDNA encoding the antigen), and re injected into the patient. DC based vaccines have shown promisin g results in animal models and in the

PAGE 12

3 clinical setting. The success of cancer vaccines is partly restrained by the accumulation of a group of myeloid cells with immune suppressive activity. These cells can take up antigen delivered by vaccination, present it to activated T cells and thereby inhibit the same antigen specific T cells that the vaccination strategy is aiming to activate (11). This makes even the most effective antigen delivery strategy ineffective because cancer patients or animals can have con siderable numbers of these myeloid derived suppressor cells. Reducing the numbers of these suppressive cells and/or inhibiting their suppressive factors have been demonstrated to improve the efficacy of immunotherapy in both animal models and cancer patien ts (12). This inhibitory population presents one of the many roadblocks to the success of cancer immunotherapy and their elimination is a priority for cancer patients who are candidates for active immunotherapy. Identification and Definition of MDSC A su ppressive myeloid cell population associated with tumor development and immunosuppression was described three decades ago (13). The first reports demonstrated that administration of a Gr 1 specific antibody slowed the growth of an experimental tumor. It wa s later found that the Gr 1 antibody eliminated both polymorphonuclear and mononuclear cells in the blood. The Gr 1 + cells were comprised of cells at different stages of maturation along the myeloid differentiation pathway (14). This suppressive population is referred to as myeloid derived suppressor cells (MDSC). MDSCs are characterized in mice by the co expression of the myeloid cell lineage differentiation antigen Gr1 and CD11b, also known as M integrin (14, 15). Gr 1 + CD11b + cells are

PAGE 13

4 normally present i n the bone marrow of healthy mice and accumulate in the spleen and blood of tumor bearing mice (16 19). MDSCs lack the expression of cell surface markers that are specifically expressed by monocytes, macrophages or DCs, and comprise a mixture of immature m yeloid cells (IMC) that have the morphology of granulocytes or monocytes and have been prevented from fully differentiating into mature cells (20). Gr 1 + CD11b + IMC present in steady state conditions are not able to induce suppression of stimulated T cells, and in healthy animals, they can quickly differentiate into mature granulocytes, macrophages or dendritic cells (DCs). Normal mouse bone marrow contains 20 30% of cells with this phenotype, but these cells make up only a small proportion (2 4%) of spleen cells and are absent from the lymph nodes. In tumor bearing animals, cells with this phenotype can make up 50 70% of all bone marrow cells and up to 40% of all splenocytes (these percentages fluctuate in tumor models). The human equivalents of mouse MDSC a re most commonly defined as CD14 CD11b + CD33 + cells or, more narrowly, as cells that express the common myeloid marker CD33 but lack the expression of markers of mature myeloid and lymphoid cells, and of the MHC class II molecule HLA DR (21,22). In healthy individuals, IMCs constitute ~0.5% of peripheral blood mononuclear cells (22); in the blood of patients with different types of cancer a tenfold increase in MDSC numbers has been detected (21 24). Although initial observations of MDSC expansion were made in the field of cancer, an expansion of immunosuppressive myeloid cell population has been documented in multiple pathological inflammatory conditions. The importance of MDSC has transcended into other scientific fields and MDSC related research has extend ed to areas involving bacterial infections (25 ,31 ), parasitic infections (26 30), traumatic stress,

PAGE 14

5 tran splantation and autoimmunity (32 33) MDSC Expansion in C ancer The past decade of research has failed to identify a single factor responsible for expa nsion of MDSC. The expansion of MDSC is predominantly viewed as the result of the combined effort of many different factors, including pro inflammatory mediators. The contribution of inflammation to tumor initiation and progression is an old concept. It wa s proposed by pathologist Rudolf Virchow over 140 years ago (34). Evidence linking inflammation and cancer comes from studies demonstrating that long term users of nonsteroidal anti inflammatory drugs, including aspirin, are at a significantly lower risk o f developing colorectal (35), lung, stomach, esophageal (36), and breast (37) cancers. In addition, the block of inflammatory mediators or signaling pathways regulating inflammation reduces tumor incidence and delays tumor growth, whereas heightened levels of proinflammatory mediators or adoptive transfer of inflammatory cells increases tumor development (38). These observations support the notion of a causative relationship between chronic inflammation and cancer onset and progression. The list of inflamma tory mediators implicated in MDSC expansion includes the complement protein C5a, prostaglandins PGE2, and the family of calcium binding proteins S100A8/A9. The anaphylatoxin C5a is a complement component and a potent chemoattractant and inflammatory media tor. Studies with C5aR deficient mice demonstrate the contribution of C5a to tumor progression, as after tumor challenge C5aR / had lower tumor volumes than littermate controls (38). C5a promotes the accumulation of MDSC not only in tumor tissues, but in peripheral lymphoid organs as well. The ability to

PAGE 15

6 suppress T cells of MDSC from tumor bearing C5aR deficient was impaired and consequently, tumor bearing C5aR / had higher numbers of infiltrating CTLs in the tumor tissue than wild type counterparts (38). A second set of potent inflammatory mediators produced by many tumors and implicated in MDSC expansion are the PGE2 molecules. PGE2 synthesis begins with the COX 2 catalyzation of arachidonic acid to prostaglandin G2 (PGG2), which is subsequently modified by PGE synthase to PGE2. Mouse MDSC were shown to express all four PGE receptors and coculture of bone marrow progenitors with receptor agonists induced the differentiation of precursors cells into suppressive MDSC. Blocking the PGE2 pathway with COX 2 in hibitors in tumor bearing mice decreases the numbers of MDSC and delays progression of spontaneous mammary carcinomas (39). Myeloid progenitors express receptors for the S100 family members and accumulating evidence confirms their role in MDSC expansion d uring infection and inflammation. The S100 calcium binding protein family comprises of 12 proteins that serve as inflammatory mediators released by cells of myeloid origin. S100A8 and S100A9 have been implicated in MDSC expansion. These proteins are releas ed in response to cell damage, infection, or inflammation, and function as pro inflammatory danger signals. When wild type mice were injected with complete Freud's adjuvant (CFA), a fivefold increase in the proportion of circulating MDCS was observed betwe en days 6 and 9 post injection. In contrast, in S100A9 deficient mice, the number of circulating MDSCs did not increase after the treatment and the proportion of MDSC in the spleens of S100A9 / mice after CFA challenge was threefold lower than challenged wild type animals (40).

PAGE 16

7 S100 proteins binding to their receptors activates nuclear factor kappa light chain enhancer of activated B cells (NF kB) in MDSC (41), and a potential function of NF KB in MDSC development has been proposed in microbial infections during which accumulation of MDSC appears to result from Toll like receptor (TLR) signaling. A recent study focused on polymicrobial sepsis in mice, induced by ligation of the cecum and a double enterotomy, found dramatic MDSC accumulating in spleens and peripheral lymph nodes after the procedure. MDSC accumulation did not occur in mice deficient for MyD88, an adapter protein operating downstream of TLRs (except TLR 3) that transmits signaling from the receptors. The ultimate target of MyD88 is the activa tion of NF kB, suggesting a possible involvement of NF kB in the accumulation of MDSC, at least during infection and tissue damage ( 31 ). In cancer, the expansion of MDSC has been primarily attributed to the numerous cytokines and growth factors produced by tumor cells. Primary evidence supporting this conclusion derives from studies revealing a decline of circulating MDSC after surgical resection of tumors, and by early experiments that showed that conditioned medium from tumor cells cultured in vitro pr evented the differentiation of hematopoietic progenitor cells (HPC) into mature APCs (42, 43) The cytokines and growth factors implicated to MDSC expansion include stem cell factor (SCF), IL 1 macrophage colony stimulating factor (M CSF), IL 6, granuloc yte macrophage colony stimulating factor (GM CSF), vascular endothelial growth factor (VEGF), transforming growth factor beta (TGF ), IL 10, IL 12, and IL 13 (44). Most of these cytokines trigger signaling cascades that converge in a common signaling path way, the Janus tyrosine kinase (JAK) protein family members and signal transducer and activator of transcription 3 (STAT3) which are

PAGE 17

8 signaling molecules that are involved in cell survival, proliferation, differentiation and apoptosis (45). STAT3 is a memb er of the STAT family of transcription factors which consists of seven members: STAT 1, 2, 3, 4, 6, and the closely related STAT5A and STAT5B (46 48). Engagement of cytokine receptors activates JAKs which subsequently recruit and phosphorylate STAT mem bers. STATs undergo homo or hetero dimerization with other STAT proteins followed by translocation to the nucleus. STATs modulate the expression of genes involved in cell growth, survival and differentiation. Abnormal activation of STAT3 during tumor pr ogression is well documented. STAT3 is constitutively activated in tumor cells (49) and in diverse tumor infiltrating immune cells (50), leading to inhibition of proinflammatory cytokine, reduced chemokine production, and to the release of factors that dow nregulate the immune response. Hyper activation of STAT3 is also observed in MDSCs from tumor bearing mice (51), and its persistent activation preventing myeloid progenitors from differentiating. An in vitro study showed that exposure of hematopoietic prog enitor cells (HPCs) to supernatants from tumor cell cultures results in the accumulation of Gr 1 + CD11b + MDSC and diminution of mature DCs. Blocking of STAT3 activity in the HPCs restored their ability to differentiate into mature DCs. These findings were f urther confirmed in vivo (40). Thus, hyper activation of STAT3 in MDSC promotes their expansion in tumor bearing animals; however other potential outcomes stemming from STAT3 signaling in MDSC remain to be elucidated. Suppressive M echanisms of MDSC MDSC mediated suppression of T cell activation has been extensively studied and

PAGE 18

9 proven by many research groups. These immunosuppressive activities appear to require direct contact with the target cell, suggesting that these suppressive activities function throu gh cell surface receptors and/or through the release of short lived soluble mediators. Factors implicated in suppression of T cell function include reactive oxygen species (ROS), regulation of L arginine metabolism, production of TGF depletion of cystei ne, induction of T regulatory cells (Treg), down regulation of L selectin surface proteins on T cells and others. (18,82 85,94 ) 1. ROS production Increased production of ROS is one of the main characteristics of MDSC (18,20,52 57). ROS are crucial immunos uppressive mediators; inhibition of ROS generation abrogates the suppressive function of MDSC in vitro (18,52,54). ROS are highly reactive molecules due to the presence of unpaired valence shell electrons. Generation of ROS occurs as the normal byproduct o f oxygen metabolism and include such species as super oxide (O 2 ), hydrogen peroxide (H2O2), hydroxyl radical (OH ), hypochlorous acid (HOCl ), and peroxynitrite (ONOO ). Traditionally ROS are known for their propensity to cause oxidative damage to nucleic acids, proteins and lipids; this property is exploited by phagocytes to destroy invading pathogens. ROS also play a regulatory role in signal transduction and gene expression. The primary stimuli promoting ROS production in MDSC may be contact with other cells. One study demonstrated that cell cell interactions mediated by the integrins CD11b, CD18 and CD29 significantly increased ROS production by MDSC (18). Thus, adhesion molecules may contribute to MDSC generation of ROS. Our lab has demonstrated the s ignificance of ROS generation by MDSC; the ROS molecule

PAGE 19

10 peroxynitrite produced during direct contact with T cells resulted in nitration of the T cell receptor and CD8 molecules, altering specific peptide binding and rendering T cells unresponsive to antige n specific stimulation (12). Peroxynitrite is produced by the chemical reaction between nitric oxide (NO) and O 2 ; it is one of the most powerful oxidants that are produced in the body capable of inducing the nitration and nitrosylation of the amino acids cysteine, methionine, tryptophan and tyrosine (63). Although studies have suggested that ROS molecules are important factors in tumor mediated immune suppression, the mechanism leading to generation of ROS by MDSC remains to be elucidated. The mitochondri a and various oxidative enzymes can generate ROS. The main source of ROS in leukocytes is a multi subunit enzyme called NADPH oxidase (NOX2), a complex that generates O 2 in the one electron reduction of O 2 using electrons supplied by NADPH after activatio n of its various components (58). The oxidase complex consists of two membrane bound proteins, gp91 phox and p22 phox cytosolic components p47 phox p67 phox p40 phox and a small GTPase protein Rac1 or Rac2 (58). The phagocyte NOX2 plays a key role in inna te immune responses against microbial pathogens by generating ROS that act as powerful microbicidal agents (59). Sustained NOX2 activity requires continuous renewal of the enzyme complex; without it rapid deactivation occurs (60). The activation of the com plex, which is essential for its full functionality, requires phosphorylation of the cytosolic components and their translocation to the plasma membrane where the generation of O 2 takes place (61). The assembly and activation of the NOX2 complex can be in duced by pro inflammatory cytokines, such as GM CSF and TNF alpha (62). Cell adhesion molecules and integrin engagement are also capable stimulants of NOX2 dependent ROS generation (160)

PAGE 20

11 2. Metabolism of amino acid L arginine Metabolism of the amino acid L arginine has been implicated in the suppressive activity of MDSC. Metabolic manipulation of L arginine is a survival strategy conserved in lower organisms (64). This strategy is exploited by MDSC to limit the expansion and function of T cells. L arginine serves as a substrate for two distinct but related enzymes arginase and inducible nitric oxide synthase. A) Arginase (ARG) : The importance of this enzyme in tumor progression is reflected by the observation that its inhibition slows the growth of a lung ca rcinoma in a dose dependent manner (65). Two distinct isoforms, Arg1 and Arg2, have been identified in mammals; they are encoded by different genes and are located in the cytoplasm and mitochondria, respectively. Arg1 is primarily located in the cytosol of hepatocytes and is an important component of the urea cycle. Arg1 expression is induced in myeloid cells by exposure to the Th2 cytokines IL 4 or IL 13 ( 66, 67 ) TGF (68), and GM CSF (69). Arg2, also known as kidney type arginase, is constitutively expr essed in the mitochondria of various cell types, including renal cells, neurons, macrophages and enterocytes Arginases hydrolyse the amino acid L arginine to L ornithine and urea. L Ornithine is a precursor for the synthesis of polyamines by the ornithine decarboxylase (ODC) pathway; polyamines have an anti inflammatory role and inhibit the release of pro inflammatory cytokines from monocytes (70). The primary consequence of arginase upregulation in MDSC is the depletion of L arginine from their surroundi ngs. In the absence of L arginine, T cells cultured in vitro fail to proliferate upon stimulation and fail to produce interferon gamma (IFN ) (71). L arginine deprivation triggers several negative effects on T cell activation. First, T cells

PAGE 21

12 deprived of L arginine are deficient for CD3 chain and become arrested in the Go G1 phase of the cell cycle (72) Second, the expression of cell cycle regulators cyclin D3 and cyclin dependent kinase 4 is also compromised (73). Finally, L arginine starvation can resul t in phosphorylation of eukaryotic translation initiation factor 2 (EIF2a), halting the initiation of translation and repressing protein synthesis (74). B) Nitric Oxide Synthase (NOS) L arginine is also the substrate for a family of enzymes known as NOS. These enzymes catalyse the reaction between oxygen and L arginine, generating L citrulline and NO. Three distinct isoforms of NOS are the products of different genes: NOS1 is primarily found in neuronal tissue; NOS2 is the inducible isoform (also known as iNOS) and is found in various cells of the immune system, including several types of myeloid cell. NOS3 is found in endothelial cells (75 77). NOS inhibitors reverse immune suppression demonstrating immunoregulatory properties of NO (78). NO operates thro ugh various mechanisms to suppress T cell function. It interferes with the IL 2R signalling pathway by blocking the phosphorylation of signal transducing pathways coupled to IL 2R and by altering the stability of IL 2 mRNA (79). Exposure to NO can also lea d to cellular apoptosis (80). NO also interferes with the cytotoxic effector phase (81). NO causes mRNA instability of Ras, a critical molecule in the signal transduction cascade from TCR activation to cytolytic granule release, resulting in inefficient ex ocytosis of the cytotoxic granules. Through this mechanism, NO prevents activated lymphocytes from killing target cells. 3. Production of TGF The immunosuppressive molecule TGF has also been implicated to MDSC function. TGF is a cytokine with multiple immunosuppressive properties ( 82 ).

PAGE 22

13 Inhibition of TGF by antibody or soluble receptor inhibits tumor growth in vivo ( 83 ) and T cells that d o not respond to TGF were resistant to implanted tumor cell lines B16 and EL4 (84). A separate study suggested that MDSC are the main source of TGF in tumor bearing animals. In this study, MDSC induced by a mouse fibrosarcoma or colon carcinoma when st imulated with IL 13 through the IL 13R are activated to produce TGF (85) In the presence of TGF 1, antigen stimulated T cells lose their cytolytic activity. This evidence suggests that direct action of TGF on T cells suppresses antitumor T cell activ ity and results in uncontrolled outgrowth of tumor cells. 4. Cysteine depletion. A new proposed mechanism of immune regulation employed by MDSC is deprivation of the amino acid cysteine. Cysteine is essential for T cell activation. T lymphocytes lack the enzyme to generate cysteine and must import it from APCs during antigen presentation. Macrophages and DCs import cystine, a cysteine precursor, from their environment and metabolize it into cysteine. MDSC import cystine at comparable rates as APCs but are unable to export cysteine into their surroundings. Thus, through the competition for cystine, MDSC make their immediate environment cysteine deficient and T cells are unable to synthesize the necessary proteins for activation (86) 5. Induction of regulator y T cells MDSC induction of forkhead box P3 (FOXP3) + T regs has been proposed to contribute to the persistent tolerance to tumor specific antigens in tumor bearing host. However, conflicting reports on this subject have been presented. In mice bearing 1D8 o varian tumours, the MDSC mediated induction of T regs required the expression of the co stimulatory B7 family member, B7H 1 (also known as CD80), by MDSCs (87). In a

PAGE 23

14 mouse model of lymphoma, MDSCs were shown to induce T regs expansion through a mechanism tha t involved arginase 1 and the capture, processing and presentation of tumor associated antigens by MDSCs, but was independent of TGF (88). By contrast, another group found that the percentage of T reg was invariably high throughout tumour growth and did not relate to the kinetics of expansion of the MDSC population, suggesting that MDSCs were not involved in T regs induction (89). Altho ugh it seems possible that MDSCs are involved in T regs differentiation through production of cytokines or through direct cell cell interactions, further work is required to resolve these conflicting reports and to determine the physiological relevance of t hese studies. 6. Downregulation of L selectin Antigen na•ve T cells typically encounter antigen in draining lymph nodes and inside tumor tissues (90,91). T cells are directed to these sites because they express high levels of L selectin (CD62L), a selectin family member that facilitates the extravasation of leukocytes from the blood and lymphatics to lymph nodes and inflammatory locales, such as tumor microenvironments (92,93). However, in cancer patients and animal models, circulating na•ve lymphocytes typ ically express low levels of L selectin. Evidence linking MDSC to the reduced levels of L selectin include the inverse correlation of L selectin expression in T cells with the number of MDSC in tumor bearing mice (94). Furthermore, CD4 + or CD8 + T cells co cultured with MDSC had an L selectin low phenotype, demonstrating that MDSC directly down regulate T cell expression of L selectin. Hence, this study proposed that MDSC block T cell activation by inhibiting T cell trafficking to antigen containing sites. Origin and F unctional P olarization of TAM

PAGE 24

15 In addition to MDSC, tumor associated macrophages (TAMs) are a population of myeloid cells that negatively regulate antitumor immune responses. The relationship between TAMs and MDSCs is not completely defined bu t, as discussed below, TAMs have been suggested to partly derive from or be related to MDSCs. Numerous studies have found a direct correlation between the presence of macrophages in tumor tissues and poor prognosis in multiple mouse and human malignancies (95 98) making the presence of TAMs a key prognosticator of cancer progression. Our current knowledge regarding the origin of macrophages at the tumor site remains incomplete. The recruitment of monocytes to neoplastic tissues is a contributing factor to t he accumulation of TAMs (98). Monocytes originate from the bone marrow and enter the circulation where they undergo maturation. Differentiation into macrophages happens once mature monocytes migrate into the tissues and involves a list of changes: the cell enlarges five to ten fold; phagocytic ability is enhanced; production of hydrolytic enzymes increases, and gains the potential to secrete large numbers of inflammatory factors (99). During the course of an immune response macrophages become activated an d, depending on the cytokine network they encounter, become either highly effective in destroying potential pathogens and activating the adaptive immune system, or become attenuators of the inflammatory response. These two opposing polarization states are classified as M1 or M2 polarization. M1 macrophages, also known as classically activated macrophages, are powerful effectors against invading pathogens and tumor cells, secrete inflammatory cytokines and efficiently activate the Th1 response. M1 macrophage s are induced in response to IFN alone or together with microbial agents (i.e. LPS) (100). In contrast to M1 macrophages, the alternatively activated M2

PAGE 25

16 macrophage is induced by anti inflammatory molecules, such as cytokines IL 4, IL 13, IL 10 and glucoc orticoids. M2 macrophages mediate wound repair, tissue remodeling, angiogenesis, and suppress Th1 immunity (101). While the M1 phenotype is characterized by production of cytokines IL 12, IL 6, TNF the M2 macrophage classically produces IL 10 and TGF In addition to their distinct patterns of cytokine expression, metabolism of L arginine is also a distinguishable characteristic of polarized macrophages: activation of NOS2 is a hallmark of M1 macrophages whereas ARG1 activation is one of the most specif ic markers of M2 polarization. It has been suggested that m acrophages differentiating within the immunosuppressive environment of a tumor display an M2 like phenotype, although it is not clear whether this suggestion can be generalized and applicable to T AMs in the different regions of a tumor. However, TAMs do appear to share a number of similar ities with M2 macrophages include expression of immunosuppressive factors (IL 10, TGF ARG1) while producing low levels of M1 macrophage mediated inflammation me diators i.e. IL 12, tumor necrosis factor alpha (TNF ), IL 6, iNOS (102, 103, 104). Angiogenesis is an M2 associated function, and TAMs are associated with angiogenesis through the production of angiogenic factors (VEGF, CCL2, FGF2, CXCL8, CXCL1, and CXCL 2) (102, 105, 106, 107). TAMs express high levels of the mannose receptor, a signature of M2 polarization. TAMs. T AMs are poor producers of both NO and ROS, hallmark characteristics of microbicidal M1 macrophages, and are poor antigen presenting cells In addition, TAMs display several pro tumoural functions and secrete factors that contribute to matrix remodeling ( TGF CCL2, matrix metalloproteinases such as MMP9) (102, 108), and have been observed to recruit T regs into tumor tissues

PAGE 26

17 (through secretion of CCL22) (109). Accumulation of TAMs in neoplastic tissues appears to be driven by the action of tumor derived cytokines. VEGF and M CSF promote monocytic migration and survival. IL 10 promotes monocyte differentiation into macrophages and blocks their differentiation to DCs. Additionally, chemokines produced by tumor cells (CCL2 being the most frequently found in tumors) appear to play a fundamental role in the recruitment of monocytes to the tumor site. Moreover, a relationship between MDSC and TAMs has also been suggested by recent studies; splenic Gr 1 + cells isolated from tumor bearing animals transferred into new tumor bearing hosts were shown to reach the tumor site and become TAMs characterized by high STAT1 phosphorylation and constitutive expression of ARG1 and NOS2 (78). This study indicates that, in addition to monocytes, circulating MDSC are plausible pr ecursors of TAMs. Role of Hypoxia in A ccumulation of TAMs Hypoxia is the state of oxygen deprivation and a characteristic feature of growing tumors. Hypoxic areas arise due to rapid oxygen consumption rate by cancer cells along with insufficient oxygen su pply. This disparity is caused partly when solid tumors rapidly outgrow their blood supply, leaving portions of the tumor with areas where the oxygen concentration is significantly lower than in healthy tissues. For instance, oxygen partial pressure (pO 2 ) measurements in squamous cell carcinomas from cervical cancer patients showed a four fold reduction compared to normal cervix tissue (8 mmHg in tumors, 42 mmHg in normal cervix) (117). The difference in oxygen tension between tumor tissues and the circulat ion is even greater, as pO 2 in alveoli reaches 100 mm Hg (118). The

PAGE 27

18 oxygenation status and extent of hypoxia were independent of clinical size, tumor stage and grade of malignancy (117). Cells have developed mechanisms to cope with hypoxic stress. The prin cipal element allowing cells to adapt to hypoxic stress is the hypoxia inducible factor (HIF) 1. HIF1 is a heterodimeric transcription factor consisting of a consti tutively expressed HIF 1 subunit and the oxygen tension regulated HIF 1 subunit. In the presence of oxygen, the HIF1 protein is quickly targeted for ubiquitination and degradation but accumulates in response to declining oxygen levels (119,120). Increas ed HIF1 protein stability and activity of the HIF1 complex, in turn, regulate the transcription of a vast array of genes involved in tumor cell survival: oxygen delivery, angiogenesis, and energy conservation (119,121). Macrophages are also affected by lo w oxygen tension. In mononuclear cells, hypoxia promotes production of growth factors and cytokines linked to tumor angiogenesis and progression. VEGF is one such example; interestingly, VEGF expression by TAMs is confined only to hypoxic areas in tumor se ctions and is not detected in well vascularized sections (122). In vitro studies with macrophages cultured under hypoxia have shown their increased production of key proangiogenic growth factors (123,124). Hypoxia is also capable of modifying immune respon ses from macrophages, as various inflammatory and anti inflammatory mediators are increased in macrophages after hypoxic exposure (125). Furthermore, the presence of TAMs in the tumor microenvironment may be controlled in part by tumor hypoxia. Corroborati ng this hypothesis is the observation that TAMs primarily accumulate at highest densities in hypoxic areas of solid tumors, a phenomenon reported in breast (110), prostate (111) and

PAGE 28

19 ovarian tumors (112). Chemoattractants released by tumor cells, such as en dothelin 2 and EMAPII, have been associated with TAM recruitment to hypoxic sites (113). In addition, hypoxia impedes the motility of macrophage once they reach hypoxic areas by inducing down regulation of chemokine receptors CCR2 and CCR5 (114,115) and up regulation of the enzyme mitogen activated protein kinase phosphatase (MKP 1) which inhibits chemotaxis signaling (116). Although there is plenty of information on the migration and activation of macrophages induced by hypoxia, the literature contains rat her little of the effect of hypoxia on the differentiation of myeloid cells. Recently, hypoxia was reported to inhibit the maturation of bone marrow progenitors into functional DCs (126). This observation prompts the speculation that macrophage differentia tion from progenitors could also be disturbed. Taking this idea further, it is quite plausible that tumor hypoxia may regulate the differentiation of MDSC into TAMs. Statement of Purpose The major goal of our laboratory is to understand the mechanisms of tumor associated immunosuppression and the development of new and effective cancer vaccines. MDSC is one of the major factors impeding host immune responses to tumor. These cells accumulate in peripheral lymphoid organs and in tumor tissues where they supp ress the activation of T cells helping tumors avoid the effector arm of the adaptive immune system. The mechanisms of suppression traditionally ascribed to MDSC are enhanced ROS productivity and regulation of the amino acid L arginine by its metabolizing e nzymes Arg and iNOS. Although each pathway exerts different

PAGE 29

20 consequences on T cell biology, both pathways converge on the same ultimate outcome: the inhibition of T cell function. The objective of this project was to determine the suppressive pathways by which MDSC render T cells ineffective in tumor bearing animals and cancer patients. The aspects investigated were the identification of suppressive nature of MDSC and its regulation, first in peripheral lymphoid organ and second in the tumor mocroenvironme nt. For MDSC mediated T cell suppression in lymphoid organs, we focused on investigating increased ROS productivity in splenic MDSC, and whether STAT3 protein played a role in this modulation. For T cell suppression in the tumor microenvironment we concent rated on the ability of MDSC to modulate L arginine metabolism and whether hypoxia, a prominent feature of tumor tissues, controlled the suppressive factors involved in MDSC mediated suppression. Investigating the role of hypoxia led us to further dissect the role of HIF 1 in differentiation and expansion of MDSC in tumor bearing hosts.

PAGE 30

21 MATERIALS AND METHODS Mice and tumor models. BALB/c and C57BL/6 mice (6 8 wk of age) were obtained from the National Cancer Institute. Mice were ke pt in pathogen free conditions. OT 1 TCR transgenic mice (C57Bl/6 Tg(TCRaTCRb)1100mjb), gp91 phox / (B6.129S6 Cybbtm1Din), CD45.1 + congeneic mice (B6.SJL PtrcaPep3b/BoyJ) HIF 1 flox/flox (B6.129 Hif1atm3Rsjo/JE), and Mx1 Cre +/ (C57BL/6J Tg(Mx1 cre)1Cgn/J) were purchased from Jackson Laboratories. 2C TCR transgenic mice have been described previously (10). STAT3 / mice (LysMcre/Stat3 flox/ ) were generated by Dr. S. Akira (Osaka University, Japan). LysMcre mice were crossed with Stat3 flox/+ mice to generate LysMcre/Stat3 flox/ mice (experimental group). LysMcre/Stat3 flox/+ mice from these crosses were used as littermate controls. The following subcutaneous tumor models were used in this study. In BALB/c mice: DA3 mammary carcinoma (provided by D. Lopez, Uni versity of Miami, FL), CT26 colon carcinoma (American Type Culture Collection (ATCC), Manassas, VA), and MethA sarcoma (provided by L. J. Old, Ludwig Institute for Cancer Research, New York, NY). In C57BL/6 mice: EL4 thymoma (ATCC), Lewis Lung Carcinoma (L LC), MC38 colon carcinoma (provided by I. Turkova, University of Pittsburgh, Pittsburgh, PA), and C3 sarcoma (provided by W. Kast, University of Southern California, Los Angeles, CA).

PAGE 31

22 The number of tumor cells injected s.c. was different for each model and was selected based on the ability to form a tumor with 1.5 cm diameter within 2 3 weeks of injection. EL 4 ascitic tumor was generated by injecting 3x10 5 tumor cells i.p. into C57BL/6 mice. mCC10TAg transgene model of lung cancer was described previously (Magdaleno et al., 1997). Reagents Arginase inhibitor NW hydroxyl nor L arginine (nor NOHA) and inducible NO synthase (iNOS) inhibitor NG monomethyl L arginine (L NMMA) were from Calbiochem. 2C specific (H 2Kb, SIYRYYGL) and control (H 2Kb RAHYNIVTF) pe ptides were obtained from QCB. Dichlorodihydrofluorescein diacetate (DCFDA) was purchased from Molecular Probes (Eugene, OR). Anti STAT3, phospho STAT3 antibodies were obtained from Cell Signaling Technology (Boston, MA); antibodies against gp91 phox and p4 7 phox were purchased from Santa Cruz Biotechnology (Santa Cruz, CA); anti HIF 1 antibody from R&D systems; biotinylated anti Gr 1 antibody from BD Pharmingen; biotinylated anti F4/80 antibody from Serotec (Raleigh, NC). MiniMACS magnetic beads conjugated with streptavidin (Miltenyi Biotec, Auburn, CA). All other antibodies used for flow cytometry were purchased from BD Biosciences (San Jose, CA). Patients. Six patients (47 78 years old) with resectable T3 or T4 and N2b stage of head and neck cancer (HNC) were enrolled in the study after signing IRB approved consent.

PAGE 32

23 Patients did no t receive radiation or chemotherapy for at least 3 months prior to sample collection. Peripheral blood and tumor tissues were collected at the time of surgery from all patients. In order to obtain single cell suspensions from tumors, solid tissue was subje cted to 1 hr enzymatic digestion using hyaluronidase (0.1 mg/ml; Sigma) collagenase (2 mg/ml; Sigma), DNase (600 U/ml; Sigma) and protease (0.2 mg/ml; Sigma) in RPMI 1640. The digested tissue was passed through a 70 m mesh, erythrocytes removed by hypoton ic lysis, and washed thoroughly to remove debris. Mononuclear cell suspensions were obtained from whole blood using a density gradient centrifugation. All cell samples were analyzed within 3 hr following collection. Cells were loaded with DCFDA and stimul ated with PMA where appropriate. To identify live MDSC, mononuclear cells were labeled with PerCP Cy5.5 conjugated anti CD14, APC conjugated anti CD11b and PE Cy 7 conjugated anti CD33. Antibody labeled cells were finally resuspended in DAPI buffer to iden tify viable cells before data collection. To detect iNOS in MDSC, cells after surface staining with antibodies described above were fixed, permeabilized using FixPerm buffer (BD Biosciences), and then stained with FITC conjugated anti iNOS antibody. Cells were evaluated by multi color flow cytometry using a LSRII flow cytometer (BD Biosciences, Mountain View, CA). At least 100,000 cells were collected from each parameter in order to obtain reliable data. Analysis of the samples was carried out essentially a s described elsewhere (12). Cell culture and hypoxic conditions. MDSC were cultured in complete RPMI media containing 10 ng/mL GMCSF. Hypoxic environment (1% O 2 with 5% CO 2 ) was created and maintained using C

PAGE 33

24 Chamber Hypoxic Incubator Chamber (BioSpherix NY). Isolation of mouse cells. To collect MDSC, single cell suspensions were prepared from spleens, and red cells were removed using ammonium chloride lysis buffer. MDSC were isolated by cell sorting on a FACSAria cell sorter using staining with APC conjugated anti Gr 1 and PE conjugated anti CD11b antibodies (BD Pharmingen). In some experiments splenic MDSC were isolated using magnetic beads conjugated with streptavidin (Miltenyi Biotec, Auburn, CA) and biotinylated anti Gr 1 antibody. MDSC isolation from lung tumors. Lungs were collected from CC10Tg mice with lung tumor and the blood in the lungs was cleared by perfusion through the pulmonary artery with saline containing 2mM EDTA. Lung tumor tissues were dissected and digested with collagenase XI ( 0.7 mg/ml; Sigma Aldrich) and type IV bovine pancreatic DNase (30 mg/ml; Sigma Aldrich) for 45 min at 37¡C water bath. Remaining red cells were lysed by ACK and dead cells were removed by Lympholyte M. Gr 1 + cells were isolated by using biotinylated anti Gr 1antibody and streptavidin microbeads on MiniMACS columns (MiltenyiBiotec, Auburn, CA). To collect peritoneal macrophages mice were injected intraperitoneally (i.p.) with 1 mL thiglycollate (DIFCO Laboratories, Detroit, MI). Three days later, peritone al cells were obtained by peritoneal lavage. Peritoneal macrophages were harvested using biotinylated anti F4/80 Ab (Serotec, Raleigh, NC) and magnetic isolation. To harvest cells from ascitic tumors mice were sacrificed and the peritoneum was washed wit h 10 ml of ice cold PBS; cells were then aspirated and placed on ice immediately.

PAGE 34

25 ROS detection, arginase activity, and NO production. Oxidation sensitive dye DCFDA was used to measure ROS production by MDSC. Cells were incubated at 37¡C in RPMI in the presence of 2.5 M DCFDA for 30 min. For PMA induced activation, cells were simultaneously cultured, along with DCFDA, with 30 ng/ml PMA (Sigma). Cells were then labeled with anti Gr 1 and anti CD11b Abs on ice and evaluated by flow cytometry. Production of H 2 O 2 was quan tified using Amplex¨ Red Hydrogen Peroxide/Peroxidase Assay Kit (Invitrogen) as recommended by manufacturer. Briefly, 25 x 10 3 cells were resuspended in Hanks Balanced Salt Solution (Sigma). After addition of PMA (30 ng/ml), the absorbance at 560 nm was me asured using a microplate plate reader (Bio Rad, Hercules, CA) at 37 ¡C. Absorbance results were normalized to a standard curve generated by serial dilutions of 20 mM H 2 O 2 Arginase activity was measured in cell lysates, as previously described (32). Brie fly, cells were lysed for 30 min with 0.1% Triton X 100. To 100 l of protein lysate (25 g/ml), 100 l of 25 mM Tris HCl and 10 l of 10 mM MnCl 2 were added, and the enzyme was activated by heating for 10 min at 56¡C. Arginine hydrolysis was conducted by incubating the lysate with 100 l of 0.5 M L arginine (pH 9.7) at 37¡C for 120 min. The reaction was stopped with 900 l of H 2 SO 4 (96%)/H 3 PO 4 (85%)/H 2 O (1/3/7, v/v/v). The urea concentration was measured at 540 nm after addition of 40 l of isonitrosopro piophenone (dissolved in 100% ethanol), followed by heating at 95¡C for 30 min. One unit of enzyme activity is defined as the amount of enzyme that catalyzes the formation of 1 mol urea per min. To detect nitrites equal volumes of culture supernatants (10 0 l) were mixed with Greiss

PAGE 35

26 reagent. After 10 min incubation at room temperature, the absorbance at 550 nm was measured using microplate plate reader (Bio Rad). Nitrite concentrations were determined by comparing the absorbance values for the test samples to a standard curve generated by serial dilution of 0.25 mM sodium nitrite. Quantative Real Time PCR (qRT PCR) RNA was extracted with Trizol (Invitrogen, Frederick, MD); cDNA was synthesized and used for the evaluation of gene expression as described pre viously (Nefedova et al., 2004). To detect Arg1, iNOS, and NOX2 subunits, PCR was performed with 2 l cDNA, TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA), and target gene assay mix containing sequence specific primers and 6 carboxyfluorescein (6 FAM) dye labeled TaqMan minor groove binder (MGB) probe (App lied Biosystems). Amplification with 18S endogenous control assay mix was used for controls. PCR was carried out in triplicate for each sample. Data quantitation was performed using the relative standard curve method. Expression levels of the genes were no rmalized by 18S mRNA. To detect expression of cytokines IL 6, TGF IL 12, IL 10, PCR was performed with 12.5 l SYBR Master Mixture (Applied Biosystems, Foster City, CA, USA), and the following primers: (sense + ): IL 6: 5' ATCCAGTTGCCTTCTTGGGACTGA 3'; IL 12: 5' ATGCAGCAAGTGGGCATGTGTT 3'; TGF : 5' TACGTCAGACATTCCGGGAAG CAGT 3'; IL 10: 5' TACCAAAGCCACAAAGCAGCCT 3'. The expression of IL 6, TGF IL 12, and IL 10 were normalized to actin. (5 ACCGCTCGTTGCCAATAGTGATGA 3')

PAGE 36

27 Western blotting. Cells were lysed in TNE buffer (20 mM Tris HCl pH 7.5, 150 mM NaCl, 1 mM EDTA) co ntaining 1% NP40 in the presence of protease and phosphatase inhibitors. Isolation of membrane and cytoplasmic compartments was achieved using Qproteome Cell Compartment Kit (Qiagen Inc., Valencia, CA) according to manufacturer's instructions. Protein lysa tes were subjected to 8% SDS PAGE and transferred to PVDF membranes. Membranes were probed with appropriate primary Abs overnight at 4¡C. Membranes were washed and incubated overnight at 4¡C with secondary Ab conjugated with peroxidase. Results were visual ized by chemiluminescence detection using a commercial kit (Amersham Biosciences). To confirm equal loading, membranes were stripped and reprobed with antibody against actin (Santa Cruz Biotechonology, Santa Cruz, CA) Evaluation of T cell function. Pro liferation. Splenocytes from either 2C transgenic mice or OT 1 mice, depleted of red cells, were placed in triplicates into U bottom 96 well plate (1 x 10 5 /well). For antigen specific responses, splenocytes were cultured in the presence of cognate antigen (2C specific peptide SIYRYYGL or OT 1 specific peptide SIINFEKL) and cultured for a total of 72 hr. For anti CD3/CD2 8 antibody induced T cell proliferation, splenocytes were cultured in the presence of 1 g/ml anti CD3 Ab and 5 g/ml anti CD28 Ab. Eighteen hours before harvesting, cells were pulsed with 3 H thymidine (1 Ci/well; Amersham Biosciences). 3 H Thymidine uptak e was counted using a liquid scintillation

PAGE 37

28 counter and expressed as counts per minute (CPM). IFN production The number of IFN producing cells in response to cognate antigens or CD3/CD28 antibodies was evaluated in ELISPOT assay as described (10). Each well contained 1 x 10 5 splenocytes. The number of spots was counted in triplicates and calculated by an automatic ELISPOT counter (Cellular Technology). EMSA. Nuclear extracts were prepared in hypertonic buffer containing 20 mM HEPES (pH 7.9), 420 mM N aCl, 1 mM EGTA, 1 mM EDTA, 20% glycerol, 1 mM DTT, and protease and phosphatase inhibitors cocktail. Extracts were normalized for total protein, and 5 g of protein was incubated with 32P labeled probes containing: STAT1 and STAT3 sequence, 5' AGCTTCAT TTCC CAGAA ATCCCTA 3'; p47 phox sequence, 5' AGCTTCAT TTCCCAGAT ATCCCTA 3'; or mutant sequence, 5' AGCTTCA TTGCACTCAT ATCCCTA 3'. Protein DNA complexes were resolved by nondenaturing PAGE and detected by autoradiography. Chromatin Immunoprecipitation (ChIP) assay. 32D cells were cultured in 10% FBS RPMI 1640, supplemented with IL 3. Preparation of chromatin DNA and ChIP assay were performed using a kit from Upstate Biotechnology (Lake Placid, NY), anti STAT3 antibody from Cell Signaling Technology, normal rabbit Ig G from Santa Cruz Biotechnology, protein A agarose/salmon sperm DNA from Upstate (Millipore, Billerica, MA). Sonication was performed using Branson Sonifier (model 450, VWR Scientific, West Chester, PA). After

PAGE 38

29 reversal of crosslinking, purified DNA was sub jected to PCR with the following primers spanning the potential STAT3 binding site in the p47 phox promoter: 5' AGTTAAAGGCATGTGCCACCACTG 3', and 5' TACACCTGCGTGCAGACATCATCT 3'. Primers for actin: 5' TAGGGTGTAGACTCTTTGCAGCCA 3', and 5' AGCGTCTGGTTCCCAATACTGTGT 3'. Experiments with embryonic stem (ES) cells. R1 ES cells were transfected with empty RcCMV Neo vector (R1 C) or STAT3c plasmid (R1 Stat3C)(18) using lipofectamin. ES transfectants were selected in DMEM containing G418 (0.2 mg/mL), 15% ES cell certified FBS (Gibco, Rockville, MD), eukocyte inhibitory factor (LIF; 1000 U, Chemocon, Temecula, CA), 0.1 mM nonessential amino acid, 100 M 2 mecaptoethenol, and 2 mM L glutam ine. Statistics. Statistical analysis was performed using non parametric Mann Whitney test and GraphPad Prism software (La Jolla, CA). In all cases p values were calculated using two sided t test.

PAGE 39

30 RESULTS I. Suppressive Mechanism of MDSC in Peripheral Lymphoid Organs: Role of NADPH Oxidase (NOX2) and Signal Transducer and Activator of Transcription 3 (STAT3) ROS molecules have been implicated in the attenuation of T cell immune responses by MD SC (52,54,56). Treatment of MDSCs with ROS inhibitors (catalase and uric acid) abrogated antigen specific inhibition of CD8 + T cells by splenic MDSC (18). Neutralization of ROS with the H 2 O 2 scavenger catalase improved the ability of MDSC to differentiate to mature myeloid cells in vitro (127). These studies established critical role of ROS in MDSC function. We thus intended to identify the source of ROS in MDSC and the mechanism leading to its production. To this end we analyzed the expression of the subun its of the NOX2 complex and its possible regulation by STAT3, whose enhanced activity had been previously demonstrated in MDSC (51). Hyper production of ROS in splenic MDSC from tumor bearing mice We first addressed the question whether up regulation of ROS in splenic MDSC was a wide spread phenomenon observed in several different tumor models, since prior studies demonstrating increased ROS generation by MDSC were carried using a select number of models. We tested seven mouse tumor models of sarcomas, t hymoma, colon, mammary, and lung carcinomas on BALB/c and C57BL/6 strains. A different number of tumor cells

PAGE 40

31 were injected s.c. in order to allow for the development of similar size tumors (1.5 cm in diameter) within 3 weeks after tumor inoculation. This t ime frame was selected as it is widely used in most studies of tumor associated immune suppression. Splenocytes were isolated, stimulated with PMA and labeled with anti Gr 1 and anti CD11b antibodies to identify MDSC in tumor bearing mice or immature myelo id cells (IMC) in na•ve tumor free mice. ROS levels were measured using the oxidation sensitive fluorescent dye DCFDA within the population of Gr 1 + CD11b + MDSC or IMC. MDSC from all tumor models without exception demonstrated a significantly higher level o f ROS than their control counterparts (Fig. 1A). To verify those observations using a different experimental system, we measured the level of hydrogen peroxide (H 2 O 2 ) in MDSC isolated from spleens of CT26 and EL4 tumor bearing mice. In both tumor models, M DSC produced substantially higher level of H 2 O 2 than IMC (Fig. 1B). Higher level ( p < 0.05) of ROS production by MDSC was also detected in response to other stimuli (ionomycin and LPS) indicating that this effect is not restricted to PMA (Fig. 1 C ). Furthe rmore, ROS levels were measured in MDSC during dynamic tumor growth. The significant increase of ROS levels in MDSC became most prominent 3 weeks after tumor inoculation (Fig. 1D) which coincides with substantial expansion of MDSC (unpublished observations ) in these models. ROS generation by MDSC in peripheral blood samples of h ead and n eck cancer patients To extend our studies to the clinic, we evaluated ROS levels in MDSC from patients with stage III head and neck cancer (HNC). In humans, MDSC are iden tifiable as

PAGE 41

32 CD11b + CD14 CD33 + cells and previous studies have shown that these cells have functional characteristics of MDSC (128,129). Peripheral blood mononuclear cells from healthy volunteers and patients were labeled with APC conjugated anti CD11b, Pe rCp Cy5.5 conjugated CD14 and PE Cy7 conjugated anti CD33 antibodies and loaded with DCFDA. ROS levels were evaluated within the population of CD11b + CD14 CD33 + cells. MDSC in peripheral blood from patients demonstrated an approximately five fold higher l evel of ROS upregulation following PMA stimulation compared to cells with the same phenotype from healthy volunteers (p=0.0165) (Fig. 2). Increased t ranscription of NAPDH Oxidase controls ROS upregulation and suppressive activity of peripheral MDSC Thou gh ROS can be produced in cells by several different mechanisms, the primary source of ROS in leukocytes is by NADPH oxidase (NOX2). The oxidase is a multicomponent enzyme consisting of two membrane proteins, gp91 phox and p22 phox and at least four cytosoli c components: p47 phox p67 phox p40 phox and a small G protein Rac (58). We measured expression of these subunits in MDSC isolated from na•ve tumor free and CT 26 tumor bearing BALB/c mice using qRT PCR. MDSC from tumor bearing mice had a substantially high er level of mRNA for several major NOX2 components. However, the most prominent increase was observed in the level of expression of gp91 phox and p47 phox (Fig. 3A). Increased expression of these genes was also observed in two other tested tumor models (EL 4 and MC38) (Fig. 3B). The most significant increase in gp91 phox and p47 phox expression was detected in mice 3 weeks after tumor inoculation, which coincided with the time when the most elevated level of ROS was observed in

PAGE 42

33 these cells (Fig. 1D). In accorda nce with our PCR results, MDSC from tumor bearing mice had substantially higher level of p47 phox and gp91 phox proteins in whole cell lysates than IMCs from na•ve mice (Fig. 3C). Up regulation of these proteins was also seen in the membrane fraction of MDS C from tumor bearing mice (Fig. 3D), which is possibly indicative of an elevated activation status when compared to naive counterparts. To investigate a direct contribution of NOX2 to the hyper production of ROS we used mice lacking gp91 phox These mice ar e used to study chronic granulomatous disease (CGD), a recessive disorder characterized by a defective phagocyte respiratory burst oxidase, life threatening pyogenic infections and inflammatory granulomas (130). Gene targeting was used to generate mice wit h a null allele of the 91 kD subunit of NADPH Oxidase. The affected mice lack phagocyte O 2 production, and manifest increased susceptibility to bacterial and fungal infections. EL 4 tumor was established in wild type and gp91 phox deficient mice and the le vel of ROS was measured in MDSC 3 weeks after tumor inoculation. In contrast to their wild type counterparts, gp91 phox deficient MDSC from tumor bearing mice showed no increase in the level of ROS when compared to MDSC from tumor free mice (Fig. 4A); it's also important to note that gp91 phox / mice smaller tumor growth compared to wild type mice, though the differences were not statistically significant (data not shown). We then asked whether lack of NOX2 activity affected suppressive activity of MDSC as w ell as their inability to differentiate. Gr 1 + CD11b + cells were isolated from spleens of na•ve tumor free mice, spleens of wild type EL 4 tumor bearing mice and gp91 phox / EL 4 tumor bearing mice and their ability to inhibit T cell responses was compared. MDSC from tumor bearing mice induced significant suppression of IFN production and proliferation of antigen specific CD8 + T

PAGE 43

34 cells in response to stimulation with a specific peptide (Fig. 4B,C). In striking contrast MDSC from NOX2 deficient mice failed to suppress T cell function (Fig. 4B,C). To evaluate the effect of NOX2 on MDSC differentiation, Gr 1 + CD11b + cells isolated from wild type and gp91 phox / tumor bearing mice were cultured in vitro for 5 days with GM CSF in the presence of tumor cell conditio ned medium (TCCM). Almost 40% of MDSC from wild type mice retained the immature phenotype (Gr 1 + CD11b + ), with a small proportion of cells differentiating to either DCs or macrophages. In contrast, the majority of MDSC from gp91 phox / tumor bearing mice di fferentiated to F4/80 + Gr 1 macrophages or CD11c + CD11b + DCs (Fig. 4D). S TAT3 recognizes promoter of NADPH Oxidase subunit. The STAT3 transcription factor plays a critical role in accumulation of MDSC in tumor bearing mice (51, 131); this led us to hypoth esize that STAT3 could be involved in the increased NOX2 levels in MDSC. To assess the role of STAT3 in regulation of NOX2 we concentrated on one subunit p47 phox To determine whether STAT3 could bind the p47 phox promoter, a chromatin immunoprecipitation (ChIP) assay was performed with the 32D myeloid cell line. 32D cells are murine myeloid cells that depend on IL 3 for growth and rapidly undergo apoptosis after IL 3 withdrawal (132). Due to the requirement for IL 3, these cells constantly have high level s of STAT3 phosphorylation (133), making them a perfect candidate for this experiment As shown in Fig. 5A, anti STAT3 antibody precipitated DNA that was amplified by primers specific for the p47 phox promoter region, indicating STAT3 binding to the p47 phox promoter. The promoter region of this gene contains the sequence TTCCCAGAG, which is almost identical to the

PAGE 44

35 STAT3 binding sequence TTCCCAGAA with the exception of one nucleotide. To verify that these two sequences had similar binding pattern, embryonic st em (ES) cells were transfected with a constitutively active STAT3 mutant (STAT3C) (131). Nuclear extract was prepared and binding of probes containing the consensus STAT3 binding sequence and p47 phox promoter derived sequence was assessed by EMSA. Both pro bes showed the same pattern of binding. Importantly, binding of the p47 phox derived probe was completely blocked by non labeled probe containing the STAT3 consensus sequence (Fig. 5B). Stat3 a ctivity r egulates e xpression of NADPH Oxidase To investigate the requirement of STAT3 for ROS production and p47 phox expression in MDSC, we used mice with a targeted disruption of STAT3 in myeloid cells STAT3 mutant mice (STAT3 MT ) were generated as described previously (134). Briefly, m ice in which the STAT3 gene i s f l a n ked by two loxP sites were crossed to a mouse in which the cre cDNA is inserted into the mouse lysozy me M gene by a knockin approach Lysozyme M is exclusively expressed in cells of the monocyte/macrophage and granulocyte lineages of hematopoietic di fferentiation; disruption of the STAT3 gene was therefore expected to take place only in these cell types. The ensuing STAT3 mutant protein lacks amino acids 701 732, including the tyrosine and serine residues critical for STAT activation. EL 4 tumors wer e established in STAT3 MT or their wild type littermates (WT). Since lack of STAT3 prevented the development of MDSC (51 and data not shown) we evaluated the effect of STAT3 disruption of NOX2 in CD11b + macrophages. Peritoneal

PAGE 45

36 macrophages were induced by in jection of thioglycollate and collected 3 days post treatment. Cells were labeled with anti CD11b antibody and their ability to generate ROS was analyzed. Both spontaneous and PMA i nducible levels of ROS in STAT3 MT CD11b + cells were substantially lower tha n that in their wild type counterparts (Fig. 6A). CD11b + macrophages were isolated from the peritoneum of tumor free and tumor bearing WT or STAT3 MT mice and the expression of gp91 phox and p47 phox evaluated by qRT PCR. Disruption of STAT3 resulted in signi ficant reduction in the expression of gp91 phox and p47 phox gene (Fig. 6B) and p47 phox protein (Fig. 6C). We then assessed the effect of over expression of STAT3 on NOX2 by analyzing NOX2 mRNA in STAT3C transfected ES cells (135). Normally, ES cells culture d in the presence of leukemia inhibitory factor (LIF) display functionally active phospho STAT3. LIF withdrawal leads to a substantial decrease in pY 705 STAT3 within 48 hr (40). Over expression of STAT3C in ES cells prevented downregulation of pY STAT3 and resulted in a substantial increase in the expression of gp91 phox and p47 phox (Fig. 6D). Taken together, these data indicate that STAT3 directly regulates NOX2 expression and ROS production in myeloid cells. Additionally, we used the STAT3 inhibitor JSI 12 4 (25) to block STAT3 activity in MDSC in vitro and compare its effects on ROS generation. JSI 124 is a plant natural product identified previously as cucurbitacin I, a member of the cucurbitacin family of compounds that are isolated from various plant fam ilies such as the Cucurbitaceae and Cruciferae and have been used as folk medicines for centuries in countries such as China and India. JSI 124 reduced the levels of phosphotyrosine STAT3 and tyrosine phosphorylation of its upstream activator JAK2 without affecting total protein levels in many human cancer cell lines including pancreatic, lung, and breast carcinomasand. The

PAGE 46

37 high selectivity of JSI 124 for disrupting STAT3 signaling is demonstrated by the fact that in human tumor cell lines, neither the PI3k /Akt, Ras/Raf/MEK/ERK, or the JNK signaling pathways are affected by JSI (Blaskovich 2003). Our lab independently showed that JSI 124 down regulates STAT3 phosphorylation in MDSC without affecting phosphorylation of other STAT family members. Treatment of tumor bearing mice with JSI 124 reduced the presence in of MDSC in spleens (137). MDSC were isolated from spleens of 3 week MC38 tumor bearing mice and treated with JSI 124 in the presence of TCCM. Twenty four hour treatment with the STAT3 inhibitor dramat ically reduced the level of ROS in these cells (Fig 7A). JSI 124 caused a decrease in the expression of p47 phox and gp91 phox as early as 6 hr after the start of treatment (Fig. 7B). JSI 124 treatment also resulted in a substantial decrease in the level of p47 phox protein in these cells (Fig. 7C).

PAGE 47

38 Figure 1. ROS level in MDSC from tumor bearing mice and cancer patients A. Spleens from na•ve tumor free and tumor bearing mice were collected 3 weeks after tumor injection. Spleno cytes were stimulated with PMA and labeled anti Gr 1 antibody and anti CD11b Abs. ROS were measured in Gr 1 + CD11b + cells by labeling cells with the oxidation sensitive dye DCFDA as described in Materials & Methods. Each group included 4 mice. Avg. and std. dev. of the mean fluorescence intensity (MFI) are shown. B. H 2 O 2 production by spleen MDSC from CT 26 or EL 4 tumor bearing mice. H 2 O 2 was measured as described in Materials & Methods. C Splenocytes from EL 4 tumor bearing and naive C57BL/6 mice were loa ded with 2 m M DCFDA and cultured at 37¡C for 30 min in RPMI 1640 in the presence of either ionomycin (2 M) or LPS (1 g/ml). ROS level was measured within the population of Gr 1 + CD11b + cells. D. ROS generation by MDSC from spleens of CT26, EL 4, and MC38 tumor bearing mice were evaluated at different time points after tumor injection. D. B. C A.

PAGE 48

39 Figure 2. ROS production in MDSC from patients with head and neck cancer. Peripheral blood MNC from healthy donors and patients with HNC were labeled with a cocktail of anti CD11b, anti CD14 and anti CD33 specific antibodies and stained with DCFDA to dete ct ROS level within the population of CD11b + CD14 CD33 + cells. A. The gating strategy to identify MDSC. CD14 CD11b + cells were gated first followed by gating of CD33 + cells. Histograms show representative fluorescence intensities of DCFDA in CD14 CD11b + CD33 + MDSC from patients and donors before and after PMA stimulation. B Summarized data obtained from 5 patients and 5 healthy donors. statistically significant difference (p<0.05) A B

PAGE 49

40 Figure 3. Up regulation of NADPH Oxidase in MDSC A Gr 1 + cells were isolated from spleens of na•ve or CT 26 tumor bearing mice. RNA was extracted and expression of NADPH oxidase subunits was measured in triplicates by qRT PCR. Three experiments with the same results were performed. statistically signif icant difference (p<0.05) between control and tumor bearing mice. B. MDSC from spleens of CT26, EL 4, and MC38 tumor bearing mice were evaluated at different time points after tumor injection. Gr 1 + CD11b + cells were isolated on weeks 2 and 3 after injectio n of tumor cells and the expression of gp91 phox and p47 phox was measured by qRT PCR. Each experiment was performed in triplicates and each group included 3 mice. C,D. Protein levels of gp91 phox and p47 phox were determined in total cell lysate ( C ) or membra ne fractions ( D ) of Gr 1 + CD11b + isolated cells indicative of an elevated activation status when compared to naive counterparts. A B C D

PAGE 50

41 Figure 4. NADPH Oxidase is responsible for ROS production in splenic MDSC and the antigen specific suppr ession of T cells. A. Production of ROS was evaluated in splenic Gr 1 + CD11b + MDSC from EL 4 tumor bearing and gp91 phox knockout mice. Each group included 5 mice. statistically significant difference (p<0.05) between wild type and gp91 phox / tumor beari ng mice. B, C. MDSC were isolated from na•ve, wild type, or gp91 KO mice and cultured with 1x10 5 splenocytes from OT 1 transgenic mice. IFN production was measured in triplicates in ELISPOT assay ( B ). ( C ) Proliferation after stimulation with OVA derived specific or control peptide (10 g/ml) was determined. CPM counts per minutes. Thymidine uptake in cells stimulated with control peptide was <1000 cpm. The values obtained from cells stimulated with control peptides were subtracted from values from cells stimulated with specific peptide. D. Splenic MDSC from wild type and gp91 KO tumor bearing mice and cultured with 20 ng/ml GM CSF and 25% v/v TCCM for 5 days. Cell phenotype was evaluated by flow cytometry. Cumulative results from three performed experime nts are shown. A B C D

PAGE 51

42 Fig ure 5. STAT3 recognition of NADPH Oxidase subunit promoter A, B. Nuclear extracts from STAT3C transfected ES cells were prepared and used in EMSA. SIE conventional STAT3 specific probe, p47 phox sequence derived from pr omoter region of p47 phox Mutant probe mutant p47 phox derived probe, SIE cold inhibition binding to p47 phox derived probe in the presence of 50 fold excess of unlabeled SIE probe. B. ChIP assay. DNA from 32D cells was precipitated with either anti STAT 3 antibody (STAT3) or control rabbit IgG (IgG). PCR was performed with primers specific for promoter regions of p47 phox or actin genes (C). Input PCR reaction performed with DNA isolated from nuclear extract without precipitation. A B

PAGE 52

43 Figure 6. STAT3 regulates expression of NADPH oxidase A, B, C. EL 4 tumor cells were injected into wild type (WT) or STAT3 mutant ( STAT3 MT ) mice. Cells from the peritoneum were flushed out and collected 21 days after injection of EL 4 cells. To recruit macrophages, thioglycollate was injected i.p. 3 days prior to sacrificing animals. Peritoneal cells were stained with a nti CD11b antibody and production of ROS was analyzed (A). CD11b + macrophages were isolated from peritoneum of WT or STAT3 MT mice. The expression of p47 phox was assessed by Real T ime PCR (B) and amount of p47 pho x protein was determined by Western blotting (C) D. R1 ES cells were transfected with either control plasmid (R1 C) or Stat3C plasmid (R1 Stat3C) (18). Expression of gp91 phox and p47 phox after transfection was determined. D Wild type STAT3 MT EL 4 Con EL 4 Con C B A MT = 159 WT = 527 MT=28 WT=156

PAGE 53

44 Figure 7. Effect of STAT3 inhibitor JSI 124 on ROS level in MDSC Gr 1 + cells were isolated from spleens of 3 week MC38 tumor bearing mice. Cells were cultured with tumor cell conditioned medium for 24 hours and treated with the STAT3 inhibitor, JSI 124 (1.5 M). A. ROS level measured in Gr 1 + CD11b + cells. B. Expression of gp91 phox and p47 phox at different time points after treatment with JSI 124. C. Levels of p47 phox protein in JSI 124 treated Gr 1 + CD11b + cells were analyzed by Western blotting. Hela cells wer e used as positive controls for phosphorylated STAT3 A B C

PAGE 54

45 II. Suppressive Activity and Differentiation of MDSC in the Tumor Site: the Role of Tumor Hypoxia and HIF 1a. MDSC have been reported to inhibit T cell activation by manipulating l arginine metabo lism. The action of the enzymes Arg1 and iNOS, independently or synergistically, has been reported to inhibit the response of T lymphocytes to antigen. Although simultaneous activation of both enzymes has been argued to be unfeasible because activation of one would limit the availability of l arginine as a substrate for the other, if we take kinetics into consideration we find that the enzymatic activity of either enzyme should be greatly affected (138). In fact, the combined activity of ARG and NOS is impo rtant for the suppressive activity of tumor infiltrating CD11b + myeloid cells (78) and of Gr 1 + CD11b + cells isolated from the spleen of mice that are chronically infected with helminthes (140). Interestingly, despite large number of MDSC in spleens and ly mph nodes of tumor bearing mice, and in the peripheral blood of cancer patients with advanced disease, T cells in these compartments seem to retain the ability to respond to different tumor non specific stimuli including viruses, lectins, IL 2, and stimula tion with CD3 and CD28 specific antibodies (140 143). In a sharp contrast, T cells directly isolated from tumors display profound defects in their ability to respond to those stimuli (144 146), suggesting that T cells in the lymphoid organs and in tumor t issues are inhibited by distinct mechanisms. Based on these observations, we hypothesized that MDSC inside tumor tissues exploited a suppressive mechanism different that MDSC in peripheral lymphoid organs. The roles of hypoxia, a prominent feature of tumor tissues, and the transcription

PAGE 55

46 factor HIF 1 were also evaluated in controlling MDSC activity We expanded our studies to the differentiation of MDSC inside the tumor microenvironment and the possible regulatory role of this phenomenon by hypoxia and HIF 1 Phenotype of MDSC in the tumor site In order to compare MDSC from the tumor site to MDSC from peripheral lymphoid organs (spleen), we developed a model where EL 4 tumor grows as an ascitis in C57BL/6 mice. The dose of EL 4 cells was selected to form an ascitis within 3 weeks after tumor injecti on. MDSC were sorted based on Gr 1 and CD11b co expression from the spleen and tumor of the same mouse (Fig. 8A). MDSC from both sites expressed the same level of Gr 1 and CD11b molecules and had similar mixed granulocytic and monocytic cell morphology (F ig. 8B). The number of total MDSC in the ascitis of our model was on average 3 4 fold lower than in spleen. Recent studies have determined that MDSC consists of two major subsets: cells with granulocytic phenotype (CD11b + Ly6G + Ly6Clow) and cells with monocy tic phenotype (CD11b + Ly6G Ly6Chigh) (20,147). We decided to analyze the morphology of MDSC from both sites to compare possible differences in MDSC composition. We found that granulocytic MDSC were the predominant type of MDSC in both sites. Moreover, the r atio of granulocytic and monocytic MDSC isolated from tumor or spleens was practically identical (Fig. 8C). The CD11c marker specific for DCs was not expressed on either spleen or tumor MDSC and almost all cells from both sites expressed the Neu marker (Fi g. 8C). A slightly higher proportion of Gr 1 + CD11b + MDSC from the tumor site did exhibit low expression of the macrophage marker F4/80 than did MDSC from

PAGE 56

47 spleens (p=0.06) (Fig. 8C). Thus, MDSC from the tumor and spleen of tumor bearing mice had similar mor phology and phenotype. Function of MDSC in the tumor microenvironment. We proceeded to compare the ability of tumor and spleen MDSC to suppress antigen specific T cell activation. Again, we evaluated two basic functions of T cells: IFN production and T cell proliferation. The antigen specific response to MHC class I restricted SIYRYYGL (SIY) peptide was measured in 2C transgenic CD8 + T cells. MDSC were isolated from the tumor site and spleens of the same mice and used under the same experimental conditi ons; Gr 1 + CD11b + immature myeloid cells (IMC) from spleens of na•ve tumor free mice were used as a control. As was demonstrated in previous studies, IMC lack immunosuppressive activity (53,78,148,149) In contrast, both spleen and tumor MDSC effectively sup pressed the antigen specific T cell response, though the level of suppression was significantly (p<0.05) higher in tumor MDSC (Fig. 9A). We also evaluated the T cell response after activation with anti CD3/CD28 antibodies. Under this scenario, spleen MDSC did not suppress the T cell response, whereas tumor MDSC exerted a profound suppressive effect (Fig. 9B). A similar effect was observed in a spontaneous lung cancer model. The mCC10TAg transgene was made by fusing the coding sequences of the SV40 TAg onco gene with the mCC10 promoter (150), a promoter that targets expression of the transgene only to proximal pulmonary lung epithelial cells. Under this model, mice develop multifocal pulmonary adenocarcinoma in the lung at three months of age. MDSC were isola ted from tumor or spleens of the three month old mice and then added to

PAGE 57

48 responder cells from na•ve mice stimulated with anti CD3/CD28 antibodies. Tumor MDSC showed a marked suppressive activity, whereas spleen MDSC failed to suppress non specific T cell pr oliferation (Fig. 9C). Thus, MDSC from the tumor site and spleen of the same mouse exhibit a marked difference in their ability to suppress T cell function. Manipulation of L arginine metabolism as the suppressive mechanism employed by Tumor MDSC Althoug h recently MDSC have been attributed with multiple novel suppressive methods, the traditional factors implicated in MDSC mediated immunosuppression consisted of ROS and manipulation of l arginine (151,152). We first evaluated ROS levels within the populati on of MDSC from spleen and tumors. IMC from spleen of na•ve mice served as controls. As shown in the previous section, MDSC from spleens of tumor bearing mice displayed a significantly higher level of ROS than the cells from tumor free mice. Surprisingly, ROS production in tumor MDSC was significantly lower than that of splenic MDSC (Fig. 10A). Expression of gp91 phox and p47 phox components of NOX2 were also significantly lower in MDSC isolated from the tumor site than that in MDSC from the spleen (Fig. 10B) In contrast, MDSC isolated from the tumor site displayed lofty arginase activity and high expression of arg 1 than spleen MDSC from the same mice (Fig. 10C). In addition, large amounts of NO were detected in cultures of MDSC and splenocytes. The expressi on of iNOS was >10 fold higher in MDSC from the tumor site after stimulation with IFN y (Fig. 10D). To determine if ROS played any role in the suppressive activity of tumor MDSC, we performed experiments with gp91 phox / tumor bearing mice. Lack of ROS el iminated

PAGE 58

49 inhibitory potential of spleen MDSC but the suppressive potential of tumor MDSC was not affected (Fig. 10E). In the other hand, inhibition of iNOS with LMMA and a rg1 with nor NOHA completely abrogated suppressive activity of tumor derived MDSC ( Fig. 10F). From these experiments we concluded that MDSC from the tumor use arginase and NO to suppress T cell function, whereas splenic MDSC primarily utilize the ROS mediated mechanism. MDSC in Tumor Tissues of Cancer Patients. Our data indicated that M DSC from the tumor site and peripheral lymphoid organs of tumor bearing mice differed in their ability to produce ROS and NO. To test whether a similar phenomenon is observed in cancer patients, we studied paired samples of peripheral blood and tumor tissu es obtained from patients with head and neck cancer. MDSC were defined as CD14 CD11b + CD33 + cells (Fig. 11A). ROS and inos were measured in MDSC using flow cytometry. MDSC in the tumor had significantly lower ROS production than MDSC in peripheral blood (Fi g. 11B). In contrast, i nos levels in tumor MDSC were substantially higher than in blood MDSC (Fig. 11C). Thus, these results, which are similar to those observed in tumor bearing mice, suggest that differences in MDSC may represent general phenomenon. Eff ect of tumor microenvironment on MDSC function and differentiation MDSC are a heterogeneous group of cells. Therefore, despite similarities in the morphology and phenotype of MDSC isolated from tumor sites and spleens, it was difficult for us to formally e xclude the possibility that MDSC in different sites may

PAGE 59

50 represent different populations of myeloid cells ( i.e. TAMs). To address this question as well as to identify the mechanisms of MDSC function in the tumor site, we performed a direct transfer of Gr 1 + CD11b + MDSC isolated from spleens of EL 4 tumor bearing congenic (CD45.1 + ) mice into the ascitis of EL 4 tumor bearing C57BL/6 (CD45.2 + ) recipients. EL 4 cells, a lymphoma cell lime, express CD45.2 but not the CD45.1 marker (data not shown). This system al lowed for discrimination between tumor cells and MDSC. In parallel, MDSC were injected i.v. into either EL 4 tumor bearing or tumor free recipients to evaluate donor cells in the spleen. Donor cells isolated from spleens 4 hr after the transfer retained th eir significant (p<0.01) ability to suppress antigen specific T cell responses (Fig. 12A). However, these cells failed to inhibit the T cell response t o a CD3/CD28 stimulation (Fig. 12 B). In contrast, donor cells isolated from tumor site 4 hr after the tra nsfer exhibited strong suppressive activity of both antigen specific and non antigenic T cell response (Fig. 12A,B). The expression of a rg1 and inos in donor cells isolated from tumors was significantly higher; simultaneously p47 phox mRNA was significantly lower than donor cells in spleens (Fig. 12C). At longer time points, 18 hr after post transfer to be specific, donor cells isolated from tumor sites gained dramatic suppressive activity (Fig. 12D) their expression levels of a rg1 and i nos elevated (Fig. 12E), and their ability to generate ROS was diminished (Fig. 12F). Thus, substantial changes in MDSC suppressive activity and up regulation of inos and a rg1 were observed as early as 4 hr after adoptive transfer of MDSC into the tumor site. It is known th at MDSC can differentiate into mature myeloid cells. We therefore investigated the fate of these cells after transfer into the tumor site and donor cells that reached the spleen. CD45.1+ MDSC isolated from spleens of tumor bearing mice were

PAGE 60

51 transferred i.v or injected directly into ascitis of CD45.2 + recipients. No differences were observed in the phenotype of cells isolated 4 hr after the transfer (data not shown). Eighteen hour post transfer most of the donor MDSC (>70%) in the spleen and tumor site stil l retained the MDSC phenotype (Gr 1 + CD11b + ) (Fig. 13A). Donor cells that lost Gr 1 expression were represented in the spleens primarily as CD11c + DCs, whereas in the tumor site as F4/80 + macrophages. After 48 hr, the proportion of Gr 1 + CD11b + MDSC among do nor cells in spleens remained about the same (> 60%). However, in the tumor site it was substantially decreased with less than 30% of donor cells retaining the phenotype of MDSC (Fig. 13B). Practically all Gr 1 negative donor cells in the tumor site, but o nly less than 30% of cells in the spleen, were F4/80 + CD11b + macrophages. In contrast, few Gr 1 cells in the tumor site express the CD11c marker of DCs, whereas in spleen more than 30% of these cells were CD11c + (Fig. 13B). Three days after the transfer, a ll Gr 1 negative donor cells in the tumor site remained F4/80 + CD11b + macrophages, whereas macrophages represented less than 20% of these cells in spleen (Fig. 13C). No CD11c + donor cells were detectable in spleens, which may reflect the possible migration of DCs out of the spleen. Thus, in the tumor microenvironment, MDSC rapidly differentiated into F4/80 + CD11b + TAM. In contrast, MDSC in spleens remained undifferentiated much longer and differentiated equally to macrophages and DCs. Effect of Hypoxia in MD SC function and differentiation. Our data demonstrates that the tumor microenvironment rapidly changes the function of MDSC and promotes their differentiation to TAM. We investigated the

PAGE 61

52 possible mechanism of this effect. Hypoxia is one of the major charac teristics of the tumor microenvironment and we decided to test the effect of hypoxia on MDSC. We incubated MDSC isolated from spleens of tumor bearing mice in complete culture medium and GM CSF at normoxic or hypoxic (1% O 2 ) conditions for 48 hr. Hypoxia s ignificantly (p<0.05) reduced the expression of gp91 phox and p47 phox components of NOX2 (Fig. 14A), which resulted in a substantial decrease in the level of ROS production in these cells (Fig. 14B). In contrast, MDSC subjugated to hypoxia had elevated expr ession of a rg1 and inos (Fig. 14C). MDSC cultured in hypoxia acquired the ability to suppress T cell activation in response to anti CD3/CD28 antibody (Fig. 14D). Thus, hypoxia recapitulated the effect of the tumor microenvironment on MDSC function. To asse ss the effect of hypoxia on MDSC differentiation, Gr 1 + CD11b + cells from spleens of tumor bearing mice were cultured for 5 days in normoxia or hypoxia in the presence of GMCSF. We observed accumulation of cells with macrophage morphology in the hypoxic gro up (Fig. 15A). In hypoxia, the proportion of Gr 1 + CD11b + MDSC was 4 fold lower compared with cells cultured at normoxia (p<0.01), whereas the proportion Gr 1 CD11b + F4/80 + M was significantly higher (p<0.05) (Fig. 15B). In contrast, the proportion of CD11c + cells was significantly (p<0.05) higher among the cells cultured at normoxia than those incubated at hypoxia (Fig. 15B). Thus, these data indicate that hypoxia can inde ed promote the differentiation of MDSC to macrophages, similar to the effect observed in the tumor microenvironment. We then asked whether hypoxia could cause functional polarization of macrophages during their differentiation from MDSC. MDSC isolated from spleens of tumor bearing mice were cultured at normoxia and hypoxia for 5 days, followed by

PAGE 62

53 isolation of F4/80 + cells and evaluation of their cytokine gene expression. As controls, we used F4/80 + macrophages obtained from peritoneal cavities of na•ve mice and F4/80 + cells collected from the ascitis of tumor bearing mice. As expected, TAM expressed substantially higher levels of M1 markers Arg1 and Il 10 than control peritoneal macrophages (Fig. 15C,E). Unexpectedly, in our experiment TAM also expressed hi gher levels of M2 markers iNOS and I l 12 than control peritoneal M (Fig 15D,F). The expression of TGF and I l 6 were very similar between the two groups (Fig 15G,H). Based on cytokine expression, macrophages generated from MDSC under hypoxic conditions very much resembled macrophages isolated directly from the tumor as they a lso expressed higher levels of Il 10 a rg1, i nos I l 12, and I l 6 than macrophages generated under normoxic conditions. TGF levels were very similar in M generated in vitro under either condition. These results suggest that hypoxia drives the dif ferentiation of MDSC to a similar phenotype expressed by macrophages inside tumor tissues. The fact that in our experimental model TAM expressed cytokines associated with both M1 and M2 polarization states may indicate the need for revision of the notion t hat TAM are strictly M2 polarized macrophages. Requirement of HIF 1 # for tumor microenvironment and hypoxia induced changes in MDSC Up regulation of HIF 1 is one of the major effects of hypoxia. We investigated the possible role of HIF 1 in the regulation of MDSC differentiation and function. Shortly after exposing sp lenic MDSC to hypoxia, we observed accumulation of HIF 1 (Fig. 16A). To test the possible role of this transcription factor on MDSC function in

PAGE 63

5 4 vitro we used deferoxamine (DFO), a compound that stabilizes HIF 1 Spleen MDSC from tumor bearing mice were t reated with DFO for 48 hr, washed and then added to splenocytes stimulated with anti CD3/CD28 antibodies. Untreated MDSC did not suppress proliferation (Fig. 16B) or IFN production (Fig. 16C) from activated T cells However, MDSC pre treated with DFO c aused profound suppression of T cell function (Fig. 16B,C). Similar to the effects observed after treatment with hypoxia, DFO caused significant up regulation of the expression of arg1, inos and a decrease in the expression of NOX components p47 phox and gp 91 phox (Fig. 16D,E). It also promoted macrophage differentiation from MDSC during a 5 day culture with GM CSF (Fig. 16F). Taken together, these results suggested that HIF 1 could be responsible for the observed effect of the tumor microenvironment on these cells To directly address this possibility, we used mice with conditional HIF 1 deletion. HIF 1 flox mice were crossed with Mx Cre mice and HIF 1 deletion was induced by repeated poly:IC administration (Fig. 17A). Poly:IC is a strong inducer of type I IFN and it could potentially affect MDSC function. Therefore, to exclude this possibility and to make sure that HIF 1 deletion is confined only to hematopoietic cells, we decided to reconstitute the bone marrow (BM) of wild type recipients with HIF 1a deficie nt progenitors. BM cells (2x10 6 ) from CD45.2 + HIF 1 deficient (HIF 1 floxCre +/ ) or control (HIF 1 floxCre / ) mice were used to reconstitute lethally irradiated CD45.1 + congeneic na•ve mice. The BM progenitors from HIF 1 deficient and wild type mice sho wed similar engraftment potential (Fig. 17B). We allowed two weeks for the myeloid compartment to repopulate in recipients. After two weeks we established s.c. tumors with EL 4 cells; no significant differences in tumor growth

PAGE 64

55 between the groups were seen (data not shown). At the time of submission of this manuscript, generation of HIF 1a / animals was still ongoing Due to the insufficient number of mice we cannot provide statistical significance in our results; c onsequently, it is important to disclose t hat the accompanying results should at this stage be regarded as prelimin ary rather than final We evaluated the populations of myeloid cells 3 weeks after tumor injection (1.5 cm in diameter). Large expansion of Gr 1 + CD11b + MDSC was observed in the spleen of tumor bearing mice that received HIF 1 +/+ BM. Surprisingly, only a modest increase of MDSC was observed in recipients of HIF 1 deficient BM (Fig. 17C). The proportion and absolute number of MDSC in the spleen of mice reconstituted with HIF 1 deficie nt BM was significantly (p<0.01) smaller than in mice reconstituted with HIF 1 +/+ BM (Fig. 17C). No significant differences were found in the proportion of macrophages and DCs between the tumor bearing recipients of HIF 1 deficient and wild type BM cell s (Fig. 17C ). The level of ROS was evaluated within the population of spleen MDSC. The HIF 1 deficient MDSC from tumor bearing mice generated larger amounts of ROS than wild type counterparts (Fig. 17D ). To assess the effect of the tumor microenvironment on HIF 1 deficient MDSC, Gr 1 + CD11b + cells were isolated from spleens of tumor bearing mice reconstituted with HIF 1 deficient or wild type BM and then injected directly into the ascitis of CD45.1 + congenic mice. Twelve hours later, Gr 1 + CD45.2 + donor MD SC were isolated and used in experiments. Similar to previous experiments, donor MDSC with wild type HIF 1 showed profound suppressive activity against T cells stimulated with anti CD3/CD28 antibodies (Fig. 18A). The expression of a rg1 and inos in donor H IF 1 positive MDSC

PAGE 65

56 was dramatically up regulated after transfer into the tumor site (Fig. 18B). The suppressive effect of HIF 1 deficient donor MDSC, as well as the expression of a rg1 and inos in these cells, was significantly (p<0.01) lower (Fig. 18A,B) The opposite effect was observed in the levels of ROS as HIF 1 deficient donor MDSC had substantially higher ROS production than their wild type counterparts (Fig. 18C). We then evaluated the differentiation of donor cells in the tumor microenvironment. We gated on CD45.2 + CD11b + cells; gating of CD11b + cells was necessary to exclude CD45.2 EL 4 tumor cells from the analysis. Within 12 hr after the transfer of either wild type or HIF 1 deficient MDSC, about 30% of donor (CD45.2 + CD11b + ) cells lost the ex pression of Gr 1 (data not shown). Most (>60%) of the HIF 1 deficient Gr 1 donor cells acquired the CD11c marker, suggesting that these cells differentiated towards DCs, whereas CD11c was practically not expressed on wild type donor cells. The opposite e ffect was observed in the expression of F4/80 (Fig. 18D). The proportion of F4/80 + TAM among HIF 1 deficient donor cells was two fold lower than that among wild type donor cells.

PAGE 66

57 Figure 8. Phenotype of MDSC in tumor site. A C. EL 4 tumor cells (3x10 5 ) were injected i.p. into C57BL/6 mice. After three weeks, spleens and cells from tumor ascitis were collected. Gr 1 + CD11b + MDSC were sorted (A) and their morphology was evaluated by staining with H&E (B) ( maginification x 200) C. Analysis of surface markers in gated Gr 1 + CD11b + MDSC isolated from splenic and tumors of the same mice. Three individual experiments were performed. C B A 94.8 97.1

PAGE 67

58 Figure 9. Function of MDSC in tumor site. A,B. Gr 1 + CD11b + cell s purified from spleens of tumor free mice (na•ve), or spleens (SPL) and ascitis (ASC) of EL 4 tumor bearing mice were cultured at indicated ratios with 10 5 splenocytes from transgenic 2C mice. A. Splenocytes were stimulated with control and specific pepti des and IFN production was measured in ELISPOT assay. Number of spots per 10 5 2C splenocytes is shown. Values in cells stimulated with control peptide were subtracted. statistically significant (p<0.05) difference from na•ve mice. B. Splenocytes were stimulated with anti CD3/CD28 antibodies and splenocyte proliferation was evaluated using 3H thymidine uptake. All experiments were performed in triplicates. A typical result of three performed experiments is shown. C Splenocytes were labeled with CFSE (1M) and cul tured with MDSC isolated from spleens and lungs of mCC10Tg tumor bearing mice. Splenocytes were stimulated with anti CD3/CD28 antibodies and proliferation was measured by CFSE dilution. Three experiments with similar results were performed. C A B

PAGE 68

59 A B C D E

PAGE 69

60 Figure 10. Factors regulating MDSC suppressive activity. A Cells collected from the tumor site or spleens of EL 4 tumor bearing mice were stimulated with PMA and labeled with 1 M DCFDA. DCFDA fluorescence was measured in Gr 1 + CD11b + population. Each group included 4 mice. statistically significant difference (p<0.05) from na•ve mice. B. Expression of gp91phox and p47phox was measured Gr 1 + CD11b + cells isolated from spleens o r tumor of the same mice. C. Arg 1 gene expression and enzymatic activity were evaluated in MDSC from tumor site and spleen. All experiments were performed in triplicates and repeated three times. statistically significant differences (p<0.05) from na• ve mice; # statistically significant differences between ascitis and spleen of the same mice. D. MDSC from spleen and tumor ascitis were stimulated with IFN (30 ng/mL) for 48 hr and expression of iNOS was measured. The same cells were mixed at the indicated ratio with 2x10 5 splenocytes stimulated with anti CD3/CD28 antibodies. After 48 hr incubation culture medium was collected and assayed for nitrites. Expe riments were performed in triplicates and repeated three times with similar results. E. Suppressive activity of MDSC from gp91 phox ko mice on IFN production by transgenic 2C T cells after stimulation with either specific peptide or with anti CD3/CD28 ant ibodies. statistically significant differences (p<0.05) from na•ve mice. F. MDSC isolated from spleens or tumor site were incubated at a 1:4 ratio with naive syngeneic splenocytes stimulated with anti CD3/CD28 antibodies in the presence of iNOS (0.5 mM L NNMA) and arginase (0.5 mM nor NOHA) inhibitors. IFN production and cell proliferation were measured. F

PAGE 70

61 Figure 11. MDSC in peripheral blood and tumor tissues of cancer patients. Peripheral blood and tumor tissues were collected from patients with HNC during surgical resection. A. A typical example of gating of CD11b + CD14 + CD33 + MDSC from the same patient in flow cytometry. B. Cells were stained with DCFDA to detect ROS level within the population of CD11b + CD14 + CD33 + cells from the same patient. Top panel ty pical example of DCFDA staining in these cells; bottom panel cumulative results from six patients. ** statistically significant difference between MDSC in the tumor site and peripheral blood. C. Cells were labeled with anti iNOS antibody and the protei n level was measured within the population of CD11b + CD14 + CD33 + cells. Top panel typical example of iNOS staining of one patient. Bottom panel cumulative results from six patients.* statistically significant difference between MDSC in the tumor site a nd peripheral blood.

PAGE 71

62 C B A D

PAGE 72

63 Figure 12. Effect of the tumor microenvironment on MDSC function. MDSC isolated from spleens of congenic CD45.1 + mice bearing 3 week s.c. EL 4 tum or were transferred into ascitis of CD45.2 + EL 4 tumor bearing recipients. CD45.1 + donor cells were recovered using magnetic beads 4 hr after cell transfer. For controls, CD45.1 + MDSC were transferred i.v. into EL 4 tumor bearing recipients or naive recipi ents and recovered from spleens 4 hrs after cell transfer. A. After adoptive transfer, CD45.1 + MDSC were cultured with 2C spleen responder cells (Resp.) (1:4 ratio) stimulated with control and specific peptides. IFN production was measured by ELISPOT assay. Each experiment was performed in triplicates and repeated twice B. Similar experiments performed using stimulation with anti CD3/CD28 antibodies. C. Evaluation of gene expression of argI, iNOS, and p47phox in MD SC post adoptive transfer. Each experiment was performed in triplicates and repeated twice with the same results. D F MDSC after 18h adoptive transfer. D Proliferation of 2C splenocytes in the presence of MDSC (MDSC:splenocyte ratio 1:4) in response to st imulation with specific peptide or with anti CD3/CD28 antibodies. Each experiment was performed in triplicates and repeated twice. Cell proliferation without peptide was below 1000 CPM. E. Expression of NOX subunits, argI and inos F. ROS assessment in Gr 1 + CD11b + cells before and after adoptive transfer. MFI for one typical experiment is shown. E F

PAGE 73

64 Figure 13. Differentiation of MDSC in the tumor microenvieonment Phenotype of donor CD45.1+ cells at different times after adoptive transfer. A. 18h post adoptive transfer. B. 48h post adoptive transfer. C .72h post adoptive transfer. Macrophages: F4/80 + CD11b + Gr 1 ; Dendritic cells CD11c + CD11b + Gr 1 C B A

PAGE 74

65 Figure 14. Regulation of MDSC function by hypoxia. MDSC were isolated from spleens of CT26 tumor bearing mice and cultured in medium containing 10 ng/ml GM CSF and 25% CT26 TCCM under normoxic and hypoxic (1% O2) conditions using a hypoxic chamber. A. Expression of NOX subunits was evaluated in triplicates after 2 days. B. Cells were collected after 3 days of culture and DCFDA intensity was measured within the Gr 1 + CD11b + population. Typical result of three performed experiments is shown. C. Expression of argI and inos was evalua ted in MDSC after 24 hr and 48 hr incubation. D. MDSC were cultured for 48 hr under normoxic or hypoxic conditions and their ability to suppress proliferation of anti CD3/CD28 stimulated splenocytes was evaluated A B C D

PAGE 75

66 A B C D

PAGE 76

67 FIGURE 15. Regulation of MDSC differentiation by hypoxia A. MDSC were cultured for 5 days with GM CSF (10 ng/ml) and 25% TCCM in normoxia or hypoxia, then fixed and stained with H&E. Magnification x 400. B. Phenotype of MDSC cultured for 5 days in hypoxia or normoxia. The proportion of cells with indicated phenotype were evaluated by flow cytometry. Cumulative results of 4 performed experiments are shown. statistical significant differences (p<0.0 5) between the groups. C H. MDSC F4/80 + cells were isolated from MDSC cultured for 5 days and the expression of cytokines associated with M1 and M2 M phenotypes ( C. arginase; D. iNOS; E. IL 10; F. IL 12; G. TGF b ; H. IL 6 ) were determined by real time PCR. Results were compared to TAM isolated from tumor bearing mice and peritoneal M from na•ve mice. E F G H

PAGE 77

68 l Figure 16. Consequences of HIF 1 stabilization in MDSC properties. A. MDSC isolated from spleens of EL 4 tumor bearing mice were cultured with GM CSF (10 ng/mL) in hypoxia for 4 hr or 16 hr. The level of HIF1 was measured by Western blot. B F. MDSC w ere treated with various concentrations of HIF 1 stabilizer DFO for 48 hr, then washed and used in the experiments. No effect of DFO on MDSC cell viability was observed at these concentrations (data not shown). B, C. Effect of DFO treated MDSC on prolifer ation ( B ) and IFN production ( C ) of splenocytes stimulated with anti CD3/CD28 antibodies. D, E. Expression of arg1, inos, gp91phox and p47phox in DFO treated MDSC for 48 hr treatment. Experiments were performed in triplicates and repeated two times with the same results. F. Percentage of F4/80 + CD11b + M # differentiated from MDSC treated with DFO for 5 days F A E D C B

PAGE 78

69 B C A HIF 1

PAGE 79

70 Figure 17. Evaluation of HIF 1 deficient chimeric mice before a nd after tumor establishment. A. Expression of HIF 1 in HIF 1 fl/flCre+/ and HIF 1 fl/flCre / mice after treatment with poly I:C using real time PCR. Experiments were performed in triplicates in three mice. B. Reconstitution of lethally irradiated CD45 .1+ congenic mice with CD45.2+ bone marrow from HIF 1 deficient (HIF 1 flox/flox ,Cre +/ ) or wild type (HIF 1 flox/flox Cre / ) mice. Blood of mice 2 weeks after bone marrow transfer was tested. C. CD45.1+ lethally irradiated recipients were reconstituted with CD45.2 + bone marrow cells from HIF 1 deficient ( / ) or wild type (+/+) mice. Two weeks later mice were inoculated s.c. with 5x10 5 EL 4 tumor cells. Three weeks after that, spleens were collected and cell phenotype was evaluated. For control, tumor free recipients were used. Each group included three mice. Proportion and absolute number of MDSC ( C ), statistically significant (p<0.05) differences between mice reconstituted with HIF 1 / and HIF 1 +/+ bone marrow. D. Splenocytes from tumor free or EL4 tumor bearing animals were labeled with DCFDA and fluorescence determined in the Gr 1 + CD11b + population. D

PAGE 80

71 Figure 18. Changes in MDSC function and differentiation induced by the tumor microenvironment requi re HIF 1 CD45.1 + lethally irradiated recipients were reconstituted with bone marrow cells from HIF 1 knockout (KO) or wild type (WT) CD45.2 + mice. Two weeks later mice were inoculated s.c. with 5x105 EL 4 tumor cells. Three weeks after that CD45.2 + HIF 1 WT or KO MDSC were isolated from spleens of tumor bearing mice and then transferred into ascitis of congenic CD45.1 + mice. Twelve hours later, CD45.2 + CD11b + donor cells were isolated and used in the following experiments. A. The MDSC were cultured with anti CD 3/CD28 antibody activated T cells (responder cells, Resp.) and their proliferation was measured. B. Expression of arg1 and inos was analyzed in the MDSC before and after adoptive transfer into the tumor milieu. Experiments were performed in triplicates. Ea ch group includes 3 mice. statistically significant (p<0.05) differences between the groups. C. ROS in MDSC after the adoptive transfer was determined with DCFDA. D. Percentage of macrophages and DCs in the population of CD11b + Gr 1 CD45.2 + donor cells 12 hr post adoptive transfer. D C A B

PAGE 81

72 Figure 19. Schematic of MDSC function and differentiation in tumor bearing host In lymphoid organs, MDSC retain a high level of NOX2 and increased ROS levels. This is associated with a little i ncrease in NO production and arginase I activity. As a result these MDSC produce peroxynitrite and exert their effect only via close cell cell contact with activated antigen specific T cells, which induce antigen specific T cell tolerance. At the same time these MDSC fail to suppress antigen non specific activation of T cells. In contrast, at the tumor site, MDSC due to the effect of hypoxia via HIF 1 dramatically up regulate expression of inos and argI, which is associated with down regulation of both NOX2 expression and ROS production. Because of these changes, MDSC acquire the ability to suppress antigen non specific T cell functions, which contri bute to the profound immune suppression observed within the tumor microenvironment. In addition, hypoxia via HIF 1 promotes differentiation of MDSC to immune suppressive TAM that further support the immune suppressive network.

PAGE 82

73 DISCUSSION Existing evidence indicates that T lymphocytes in tumor bearing hosts are exposed to multiple suppressive factors. T lymphocytes isolated from tumor tissues display a profound deficiency in their ability to respond to mitogenic stimulati on and their effector functions are severely compromised. As example, T lymphocytes infiltrating rat gliomas displayed reduced CD3e and TCR expression compared to spleen cells When TILs were purified and stimulated with polyclonal mitogens ConA or anti CD3 in vitro, their proliferate capacity was markedly diminished compared to spleen T cells [153]. In contrast, T cells isolated from peripheral lymphoid organs seem to experie nce antigen specific anergy to tumor associated antigens Circulating CD8+ T cells, specific for melanoma associated antigens, were unable to lyse melanoma target cells or produce cytokines while having capability to lyse Epstein Barr virus pulsed target cells or generate allogeneic responses [146]. Anti CD3 antibody or PHA induced T cel l responses were not affected in patients with metastatic kidney cancer (142). One possible explanation for these differences is that the tumor microenvironment contains a large number of different suppressive factors that are not present in the periphery (154). MDSC are a heterogeneous population of myeloid cells comprised of cells at various stages of differentiation. They prevent the activation and functionality of T lymphocytes, limiting the success of immunotherapy strategies aimed to eradicate

PAGE 83

74 develo ping cancer cells. The suppression of lymphocytes caused by MDSC has been demonstrated by numerous laboratories. Elimination of MDSC improves the function of T lymphocytes to immunotherapeutic treatments and promoting regression of developing tumors in ani mal models (139,141,155). This work demonstrates a dual role played by MDSC in immune suppression in cancer depending on their location. In lymphoid organs, MDSC retain a high level of NOX2 and increased ROS levels. This is associated with a little increa se in NO production and Arg I activity. The important role of ROS in spleen MDSC mediated suppression of T cells is supported by ample evidence provided during recent years. (10,19,156 159). ROS was specifically implicated in antigen specific T cell tolera nce mediated by MDSC (10,159). Due to high generation of ROS, MDSC produce peroxynitrite and exert their effect only via close cell cell contact with activated antigen specific T cells, which induce antigen specific T cell tolerance (10). At the same time, these MDSC fail to suppress antigen non specific activation of T cells. The up regulation of ROS in MDSC is a common phenomenon observed in a variety of different tumor models (Figure 1A). Importantly, this phenomenon was observed in human MDSC as well (F igure 2). We tried to clarify the reason for the increase in ROS levels in these cells. Although cells can employ multiple mechanisms for ROS generation, in leukocytes the primary producer of ROS is NADPH oxidase (NOX2). NOX2 catalyzes the one electron red uction of oxygen to superoxide anion using electrons supplied by NADPH. The importance of this enzyme can be observed in the severity of hereditary chronic granulomatous disease (CGD). CGD is caused by mutations in any of the genes that

PAGE 84

75 encode the subunits of the oxidase and patients with CGD experience frequent life threatening infections during their lifetime (130). In leukocytes, increased ROS production in response to different stimuli is regulated primarily by activation of NOX2 via assembly of the enz ymatic complex on the cellular membrane after translocation from the cytoplasm. The response usually does not involve transcriptional regulation of subunits of the NADPH complex. However, our data demonstrate that in MDSC from tumor bearing mice, the subst antial increase in the expression of several NOX2 subunits contributes to the up regulation of NOX2 activity and ROS production. Under the scenario of increased expression of NOX2 subunits, we believe that even slight stimulation of MDSC would result in a substantial production of ROS. An example of such stimuli could be an interaction of MDSC with activated T cells, endothelial cells, or fibroblasts in tissues. Under normal conditions, in the absence of injury, contact of myeloid cells with surrounding ce lls through adhesion molecules would result in a modest up regulation of ROS (160). However, in a situation when NOX2 expression is up regulated in MDSC, the same interaction results in dramatic increase in ROS production in these cells. This may explain a previous report that direct cell cell contact with antigen specific CD8 + T cells caused substantially higher level of ROS in MDSC than in IMC causing inhibition of T cell responses (52). This phenomenon was proposed to be mediated by integrins CD11b, CD18 and CD29 as pre treating MDSC with antibodies against these surface molecules abrogated the suppressive effect on the lymphocytes. In addition to contributing to their suppressive function, ROS have also been suggested to impede the differentiation of MD SC (127). MDSC with deleted gp91 phox gene, thus lacking NOX2 activity, did not demonstrate increased ROS level

PAGE 85

76 compared to IMC from na•ve mice. Notably, lack of NOX2 activity blocked the suppressive activity of MDSC on CD8+ T cells and allowed MDSC to diff erentiate into mature myeloid cells in vitro. This strongly suggest that up regulation of ROS in these cells in cancer is controlled by NOX2 activity. MDSC expansion in tumor bearing hosts is mediated by various tumor derived factors (44). STAT3 is arguab ly one of the main transcription factors responsible for MDSC accumulation in cancer. Signaling from many tumor derived factors implicated in MDSC expansion ultimately converge in the Jak/STAT3 pathway (162,163). Consequently, MDSCs from tumor bearing mice have dramatically increased levels of phosphorylated STAT3 compared to IMC from naive mice (50). Exposure of hematopoietic progenitor cells to tumor cell conditioned medium resulted in the activation of STAT3 and was associated with an expansion of MDSCs in vitro, whereas inhibition of STAT3 in these cells abrogated the effect of tumor derived factors on MDSC expansion (51). Ablation of STAT3 using conditional mutant mice or selective inhibitors dramatically reduced the expansion of MDSCs and improved T ce ll responses in tumor bearing mice (50, 161). Thus, it appears that abnormal persistent activation of STAT3 in myeloid progenitors prevents differentiation of myeloid cells and is associated with increased proliferation and survival of myeloid progenitors, possibly through up regulation of STAT3 targeted genes like Bcl xL, cyclin D1, c myc, survivin (162) or S100A8 and S100A9 proteins (39). Due to such a prominent role of STAT3 in MDSC biology, it was tempting to speculate that STAT3 could be responsible fo r enhanced expression of NOX2. Our data suggests that STAT3 regulates expression of p47 phox arguably one of the main components of the NOX2 complex, by directly binding to the

PAGE 86

77 p47 phox gene promoter region. Th e experiments involving STAT3 MT mice as well as over expression of STAT3 in ES cells further corroborates to the role of STAT3 in transcriptional regulation of p47 phox and in addition suggest that gp91 phox the catalytic subunit of NOX2, is controlled by STAT3 through a similar process. Regulation of R OS in MDSC by STAT3 was further confirmed in experiments with JSI 124 (Fig. 7), a selective STAT3 inhibitor (135). Overall, this provides a direct link between the various tumor derived factors affecting MDSC and the level of ROS in these cells. Inside tu mor tissues, the tumor microenvironment convert MDSC into potent suppressor cells by up regulating proteins involved in the metabolism of L arginine. These enzymes ( iNOS and Arg I ) are known to be actively involved in T cell suppression (164,165). Importan tly, they do not require antigen specific contact between MDSC and T cells to inhibit their function. This last observation makes biological sense, as tumor infiltrating lymphocytes are effector cells that have been activated in peripheral lymphoid organs and thus have already produced cytotoxic granules. Recognition of antigen by effector cells would lead to exocytosis of cytolytic enzymes (perforin and granzymes) resulting in the destruction of the target cell, or in this particular case the elimination o f the MDSC. By circumventing the necessity of cell to cell interaction to activate their suppressive function, MDSC can inhibit T cell activity through down regulation of CD3 re expression, blocking CTL degranulation, and inducing T cell apoptosis, all of which are potential outcomes of iNOS and Arg 1 activity. In order to make a fair comparison of the function of MDSC from spleen and tumor sites, it was essential to ensure that we are indeed comparing cells with the same phenotype. We sorted MDSC based on the expression of Gr 1 and CD11b, two markers

PAGE 87

78 that are considered hallmarks of MDSC. The expression of the macrophage cell marker F4/80 was slightly higher on tumor MDSC th an on spleen cells; however, this F4/80 expression was nowhere near the level expressed by TAMs. In addition, the MDSC we isolated from the tumor site and spleen had similar morphology and expression of other macrophage markers. The difference in suppress ive activity between MDSC from tumor and spleen was quite substantial. While spleen MDSC contain a high level of ROS, and a relatively modest level of NO and Arg I activity (although it was still elevated by comparison with Gr 1 + CD11b + cells from na•ve mic e), MDSC isolated from the tumor showed no increase in ROS over na•ve Gr 1 + CD11b + IMC but a very high level of NO and arginase I. These biochemical disparities translated into fundamental differences in their ability to suppress T cells. Tumor MDSC were n ot only more potent inhibitors of antigen specific T cell functions than spleen MDSC but also, in contrast to spleen MDSC, suppressed non specific T cells. A recent study found that in spleens, granulocytic CD11b + Ly6G + Ly6C low MDSC produce substantially hig her level of ROS and a lower level of NO than monocytic CD11b + Ly6G Ly6C high cells (19). It was possible that the composition of these MDSC subsets could be different in spleens and tumors which would explain the differences in functional activity of MDSC. However, the populations of MDSC in the spleen and tumor site contained similar ratios of granulocytic and monocytic sub populations. Furthermore, experiments involving the direct transfer of spleen MDSC to the tumor microenvironment demonstrated that 4 hr was sufficient to cause dramatic changes in MDSC activity. These experiments also indicate that the observed differences were indeed specific for the relative MDSC population and not

PAGE 88

79 caused by possible contamination of macrophages since the phenotype of M DSC was not changed within 4 hr after transfer (data not shown). The upregulation of Arg1 and iNOS by MDSC in the tumor site is a very rapid process and takes only hours to occur. One of the major factors that distinguish the tumor microenvironment from ly mphoid organs is hypoxia. Tumor hypoxia is of great clinical concern as it can reduce the effectiveness of radiation therapy and lessen the efficacy of cytotoxic drugs (166 168). It appears that hypoxia also plays a critical role in the regulation of MDSC function by the tumor microenvironment. Our experiments have demonstrated that exposure of spleen MDSC to hypoxia could reproduce the effect of the tumor microenvironment on these cells by inducing a dramatic up regulation of iNOS and A rg 1 decreasing the expression of NOX2 and ROS, and shifting MDSC suppression from antigen mediated to no requirement for antigen presentation. The major molecular mechanism of the hypoxia effect is mediated by the HIF 1 transcription factor. In hematopoietic cells, HIF 1 is the predominant oxygen sensitive subunit (169). Regulation of HIF 1 activity is mediated by posttranslational modification of the oxygen dependent degradation domain (ODD) of HIF 1 At oxygen levels above 5%, hydroxylation of the proline residue s 402 and 564 in the ODD of HIF 1 enables binding of the ubiquitination ligase von Hippel Lindau tumor suppressor protein, which leads to degradation of HIF 1 by the proteosome. In contrast, at oxygen levels below 5%, hydroxylation is inhibited leading t o stabilization of HIF 1 HIF 1 has been directly implicated in the up regulation of iNOS (170) and arginase (171,172) in macrophages. HIF 1 has been shown to suppress oxidative phosphorylation and ROS production in mitochondria (173,174).

PAGE 89

80 HIF 1 stabi lization is not the only consequence of hypoxia exposure. One of the outcomes resulting from the metabolic changes induced by hypoxia is the accumulation of extracellular adenosine. Leukocytes express surface receptors capable of detecting adenosine, a cla ss of these adenosine receptors, A2aR and A2bR, has been associated with immunosuppressive functions (175,176). The signaling cascade initiated through these receptors results in increased concentrations of cAMP, leading to attenuation of TCR triggered T c ell activation, TLR triggered myeloid cell activation, and inhibition of T cell proliferatio n and cytokine production (IFN TNF). Another outcome originating due to tumor hypoxia is increased acidity in the tumor microenvironment. Under aerobic condition s, the catabolism of glucose concludes in the oxidation of pyruvate to CO 2 and H 2 O in the mitochondria. However, in the situation when O 2 is in short supply, glucose is reduced to lactate, resulting in the production and accumulation of lactic acid in the microenvironment of many cancer cell types (177). We investigated a potential role of both of these factors, adenosine and acidity, in regulation of MDSC function. However, neither treating MDSC with high adenosine concentrations nor lowering the pH in med ium of cell cultures, altered the suppressive activity of MDSC (data not shown). These results, together with our data using mice reconstituted with a HIF 1 deficient leukocyte compartment, strongly argue that HIF 1 directly mediates the shift in suppres sive mechanisms employed by MDSC that was caused by the tumor microenvironment. MDSC have the potential to differentiate into macrophages and DCs (77,126), and hypoxia, acting via HIF 1 appears to have a direct effect on MDSC differentiation.

PAGE 90

81 Two days af ter our adoptive transfer experiment, more than 60% of MDSC that reached the spleen retained an immature phenotype while the rest of the cells differentiated evenly to macrop[hages and DCs. In contrast, MDSC transferred into tumor site differentiated much more rapidly, with most of the cells acquiring the phenotype of macrophages. In vitro culture of MDSC under hypoxic conditions recapitulated these findings. Stabilization of HIF 1 with DFO reproduced this effect, suggesting that HIF 1 could be an important factor regulating the differentiation of MDSC to TAM. MDSC lacking HIF 1 did not differentiate into TAM within the tumor micoenvironemnt or under in vitro hypoxia, but interestingly acquired markers of DCs instead. It has been shown that in patients with cancer, tumors do contain small numbers of D C s. However, the DCs present do not ex press co stimulatory molecules or adequate levels of MHC class II molecules and consequently are poor immune stimulators. For instance, it was shown that renal cell carcinomas or tumors of the prostate contain DCs that express minimal levels of the costimu latory molecules CD80 and CD86 (178,179). Less than 1% of DCs isolated from basal cell carcinomas expressed either CD80 or CD86 (180), while less than 10% of DCs isolated from colon carcinomas express CD80 or CD86. In the absence of an appropriate co stimu latory signal for T cells, together with the lack of production of cytokines that are required for T cell stimulation, any antigen presentation by tumor infiltrating DCs might result in the induction of tolerance. In support of this argument, DCs derived f rom colon cancer tissue have been shown to be inducers of T cell anergy (181). Thus, it will be interesting to further explore in detail the phenotype of the DCs that differentiated from HIF 1 deficient MDSC inside the tumor; expression of co stimulatory molecules, of MHC proteins, and of cytokines must be evaluated, as well

PAGE 91

82 as their potential to induce an anti tumor immune response. Although we did not explore this thoroughly, our data with HIF 1 deficient mice indicate that this transcription factor may play an important role in MDSC expansion. Expansion of MDSC from HIF 1 deficient progenitors in tumor bearing mice was substantially lower than that from their HIF 1 wild type counterparts. HIF 1 is critically important during embryonic hematopoiesis. HIF 1 knockout mice develop extensive hematopoietic pathologies and are embryonic lethal at day E10.5 due to neural tube defects, dilated vasculature, and hyperplastic myocardium; absence of VEGF is considered to be responsible for the defect. Involvement of HIF 1 in adult hematopoiesis within the bone marrow has not yet been fully proven, but some reports have pointed out the possible role of HIF 1 in myeloid cell differentiation. Differentiation of the macrophage THP 1 cell line or monocytes from perip heral blood caused up regulation of HIF 1 and HIF 1 increasing HIF 1 transcriptional activity and expression of HIF 1 target genes (182). Another study has shown that CD34 + and CD133 + hematopoietic progenitor and stem cells express a stabilized cytoplas mic form of HIF 1 even under normoxic conditions. HIF 1 stabilization is also positively con trolled by NADPH O xidase dependent production of ROS (183). In A549 cells, hypoxic upregulation of NOX1 and the subsequently augmented ROS generation activated HI F 1 dependent pathways (184). Furthermore, the upregulation of expression of mRNA encoding HIF1 is induced by other stimuli, such as signaling mediated by pro inflammatory cytokines (185,186) insulin (187), thrombin, angiotensin II and platelet derived gr owth factor (188). Therefore, the possibility exists that up regulation of HIF 1 target genes in myeloid progenitors may be mediated by ROS, tumor secreted

PAGE 92

83 cytokines, or by other inflammatory mediators, partially contributing to the systemic expansion of MDSC. Activation of HIF 1 by the aforementioned mechanisms in the periphery may not be sufficient to drive the differentiation of MDSC into mature cells; however, in the tumor, hypoxia likely induces multiple changes in MDSC, such as possible regulation o f transcription factors (unpublished observations), which in combination with HIF 1 stabilization may promote differentiation to macrophages. It is also possible that hypoxia potently activates HIF 1 to a much greater extent than cytokines or inflammator y molecules can achieve, thus resulting in the activation of different sets of genes in the two compartments. Overall, this study may suggest a model of MDSC function and differentiation in cancer. Tumor derived factors, via constitutive up regulation of S TAT3 transcription factors, induce an expansion of MDSC in BM of tumor bearing hosts (39,50,130,189), results in an accumulation of MDSC in peripheral lymphoid organs and in the tumor site. In peripheral lymphoid organs, the accumulated MDS C contain high l evels of NADPH O xidase components and any stimuli, including contact with surrounding cells, makes the cells react with increased ROS productivity which contributes to the immunosuppressive activity of these cells. Thus, NOX2 could be an attractive target in therapeutic regulation of function of circulatory MDSC. In the tumor tissues, due to the effect of hypoxia via HIF 1 MDSC dramatically up regulate expression of iNOS and A rgI, which is associated with down regulation of both NOX2 expression and ROS pr oduction. Because of these changes, MDSC acquire the ability to suppress antigen non specific T cell functions, which contribute to the profound immune suppression observed within the tumor microenvironment. In addition, hypoxia via HIF 1 promotes differe ntiation of

PAGE 93

84 MDSC to immune suppressive TAM that further support the immune suppressive network (Fig.18). Elucidation of this dual role of MDSC may not only help to understand the biology of tumor associated immune suppression, but also suggest that any the rapeutic interventions should take into account the effect of spatial location on the function of these cells.

PAGE 94

85 REFERENCES CITED 1. Gabrilovich, D., Ciernik, F. & Carbone, D. P. Dendritic cells in anti tu mor immune responses. I. Defective antigen presentation in tumor bearing hosts. Cell. Immunol. 170 101 110 (1996). 2. Gabrilovich, D. I., Ishida, T., Nadaf, S., Ohm, J. & Carbone, D. P. Antibodies to vascular endothelial growth factor enhance the efficacy of cancer immunotherapy by improving endogenous dendritic cell function. Clin. Cancer Res. 5 2963 2970 (1999). 3. Ishida, T., Oyama, T., Carbone, D. & Gabrilovich, D. I. Defective function of Langerhans cells in tumor bearing animals is the result of defective maturation from hematopoietic progenitors. J. Immunol. 161 4842 4851 (1998). 4. Almand, B.Resser JR, Lindman B, Nadaf S, Clark JI, Kwon ED, Carbone DP, Gabrilovich DI. Clinical significance of defective dendritic cell differentiation in cancer. Clin. Cancer Res. 6 1755 1766 (2000). 5. Cuenca A, Cheng F, Wang H, Brayer J, Horna P, Gu L, Bien H, Borrello IM, Levitsky HI, Sotomayor EM. Extra lymphatic solid tumor growth is not immunologically ignored and results in early induction of antigen specific T cell anerg y: dominant role of cross tolerance to tumor antigens. Cancer Res 63 9007 9015 (2003) 6. Coley WB. The treatment of malignant tumors by repeated inoculations of erysipelas. With a report of ten original cases. 1893. Clin Orthop Relat Res. 262:3 11 (1991) 7. H urley, K.E., Chapman, P.B., Helping melanoma patients decide whether to choose adjuvant high dose interferon alpha2b. Oncologist 2005, 10 739 742. 8. Yang, J.C., Sherry, R.M., Steinberg, S.M., Topalian, S.L., Schwartzentruber, D.J. et al ., Randomized study o f high dose and low dose interleukin 2 in patients with metastatic renal cancer. J. Clin. Oncol. 2003, 21 3127 3132.

PAGE 95

86 9. Schuster M, Nechansky A, Loibner H, Kircheis R Cancer immunotherapy. Biotechnol. J. 2006, 1, 138 147 10. Baxevanis CN, Perez SA, Papamichai l M. Combinatorial treatments including vaccines, chemotherapy and monoclonal antibodies for cancer therapy. Cancer Immunol Immunother. 2009 Mar;58(3):317 24 11. Nagaraj S, Gupta K, Pisarev V, Kinarsky L, Sherman S, Kang L, Herber DL, Schneck J, Gabrilovich DI Altered recognition of antigen is a mechanism of CD8+ T cell tolerance in cancer. Nature Med 13 828 835 (2007) 12. Mirza N, Fishman M, Fricke I, Dunn M, Neuger AM, Frost TJ, Lush RM, Antonia S, Gabrilovich DI. All trans retinoic acid improves differentiatio n of myeloid cells and immune response in cancer patients. Cancer Res 66 9299 307 (2006) 13. Maier, T., Holda, J.H., and Claman, H.N. 1989. Natural suppressor cells. Prog. Clin. Biol. Res. 288 :235 244. 14. Seung, L.P., Rowley, D.A., Dubey, P., and Schreiber, H. 1 995. Synergy between T cell immunity and inhibition of paracrine stimulation causes tumor rejection. Proc. Natl. Acad. Sci. U. S. A. 92 :6254 6258. 15. Kusmartsev, S. & Gabrilovich, D. I. Immature myeloid cells and cancer associated immune suppression. Cancer I mmunol. Immunother. 51 293 298 (2002). 16. Bronte, V., et al. 1999. Unopposed production of granulocyte macrophage colony stimulating factor factorby tumors inhibits CD8+ T cell responses by dysregulating antigen presenting cell maturation. J. Immunol. 162 :5 728 5737. 17. Melani, C., Chiodoni, C., Forni, G., and Colombo, M.P. 2003. Myeloid cell expansion elicited by the progression of spontaneous mammary carcinomas in c erbB 2 transgenic BALB/c mice suppresses immune reactivity. Blood. 102 :2138 2145. 18. Kusmartsev, S., Nefedova, Y., Yoder, D., and Gabrilovich, D.I. 2004. Antigen specific inhibition of CD8+ T cell response by immature myeloid cells in cancer is mediated by reactive oxygen species. J. Immunol. 172 :989 999. 19. Sinha, P., Clements, V.K., and Ostrand Rosenbe rg, S. 2005. Reduction of myeloid derived suppressor cells and induction of M1 macrophages facilitate the rejection of established metastatic disease. J. Immunol. 174 :636 645 20. Youn, J. I., Nagaraj, S., Collazo, M. & Gabrilovich, D. I. Subsets of myeloid

PAGE 96

87 der ived suppressor cells in tumor bearing mice. J. Immunol. 181 5791 5802 (2008). 21. Ochoa, A. C., Zea, A. H., Hernandez, C. & Rodriguez, P. C. Arginase, prostaglandins, and myeloid derived suppressor cells in renal cell carcinoma. Clin. Cancer Res. 13 721s 72 6s (2007). 22. Almand, B. et al. Increased production of immature myeloid cells in cancer patients. A mechanism of immunosuppression in cancer. J. Immunol. 166 678 689 (2001) 23. Mirza, N. et al. All trans retinoic acid improves differentiation of myeloid cells a nd immune response in cancer patients. Cancer Res. 66 9299 9307 (2006). 24. Diaz Montero, C. M. et al. Increased circulating myeloid derived suppressor cells correlate with clinical cancer stage, metastatic tumor burden, and doxorubicin cyclophosphamide chemo therapy. Cancer Immunol. Immunother. 58 49 59 (2009). 25. Sunderkotter, C. et al. Subpopulations of mouse bloodvmonocytes differ in maturation stage and inflammatory response. J. Immunol. 172 4410 4417 (2004). 26. Terrazas, L. I., Walsh, K. L., Piskorska, D., M cGuire, E. & Harn, D. A. Jr. The schistosome oligosaccharide lacto N neotetraose expands Gr1+ cells that secrete anti inflammatory cytokines and inhibit proliferation of naive CD4+ cells: a potential mechanism for immune polarization in helminth infections J. Immunol. 167 5294 5303 (2001). 27. Gomez Garcia, L. et al. Intact glycans from cestode antigens are involved in innate activation of myeloid suppressor cells. Parasite Immunol. 27 395 405 (2005). 28. Brys, L. et al. Reactive oxygen species and 12/15 lipoxyg enase contribute to the antiproliferative capacity of alternatively activated myeloid cells elicited during helminth infection. J. Immunol. 174 6095 6104 (2005). 29. Mencacci, A. et al. CD80+Gr 1+ myeloid cells inhibit development of antifungal Th1 immunity i n mice with candidiasis. J. Immunol. 169 3180 3190 (2002). 30. Ezernitchi, A. V. et al. TCR down regulation under chronic inflammation is mediated by myeloid suppressor cells differentially distributed between various lymphatic organs. J. Immunol. 177 4763 4772 (2006).

PAGE 97

88 31. Delano, M. J. et al. MyD88 dependent expansion of an immature GR 1+CD11b+ population induces T cell suppression and Th2 polarization in sepsis. J. Exp. Med. 204 1463 1474 (2007). 32. Kerr, E. C., Raveney, B. J., Copland, D. A., Dick, A. D. & Nic holson, L. B. Analysis of retinal cellular infiltrate in experimental autoimmune uveoretinitis reveals multiple regulatory cell populations. J. Autoimmun. 31 354 361 (2008). 33. Haile, L. A. et al. Myeloid derived suppressor cells in inflammatory bowel diseas e: a new immunoregulatory pathway. Gastroenterology 135 871 881 (2008) 34. Balkwill, F., and A. Mantovani. 2001. Inflammation and cancer: back to Virchow? Lancet 357: 539 545. 35. Garcia Rodriguez, L. A., and C. Huerta Alvarez. 2001. Reduced risk of colorectal c ancer among long term users of aspirin and nonaspirin nonsteroidal anti inflammatory drugs. Epidemiology 12: 88 93. 36. Baron, J. A., and R. S. Sandler. 2000. Nonsteroidal anti inflammatory drugs and cancer prevention. Annu Rev Med. 51: 511 523. 37. Mantovani, A., P. Allavena, A. Sica, and F. Balkwill. 2008. Cancer related inflammation. Nature 454: 436 444. 38. Markiewski, M. M., R. A. DeAngelis, F. Benencia, S. K. Ricklin Lichtsteiner, A. Koutoulaki, C. Gerard, G. Coukos, and J. D. Lambris. 2008. Modulation of the ant itumor immune response by complement. Nat. Immunol. 9: 1225 1235. 39. Sinha, P., V. K. Clements, A. M. Fulton, and S. Ostrand Rosenberg. Prostaglandin E2 promotes tumor progression by inducing myeloid derived suppressor cells. Cancer Res. 67: 4507 4513. (2007) 40. Cheng, P. et al. Inhibition of dendritic cell differentiation and accumulation of myeloid derived suppressor cells in cancer is regulated by S100A9 protein. J. Exp. Med. 205 2235 2249 (2008) 41. Sinha, P. et al. Proinflammatory s100 proteins regulate the acc umulation of myeloid derived suppressor cells. J. Immunol. 181 4666 4675 (2008). 42. Gabrilovich, D. I., Nadaf, S., Corak, J., Berzofsky, J. A. & Carbone, D. P. Dendritic cells in anti tumor immune responses. II. Dendritic cells grown from bone marrow precurs ors, but not mature DC from tumor bearing mice, are effective antigen carriers in the therapy of established tumors. Cell. Immunol. 170 111 120 (1996).

PAGE 98

89 43. Gabrilovich DI, Chen HL, Girgis KR, Cunningham HT, Meny GM, Nadaf S, Kavanaugh D, Carbone DP Production of vascular endothelial growth factor by human tumors inhibits the functional maturation of dendritic cells. Nature Med. 2 1096 1103 (1996). 44. Gabrilovich, D.I. and Nagaraj S. Myeloid derived suppressor cells as regulators of the immune system. Nat Rev Im munol 9, 162 74 (2009). 45. Bromberg, J. Stat proteins and oncogenesis. J. Clin. Invest. 109 1139 1142 (2002). 46. Yu, H. & Jove, R. The STATs of cancer new molecular targets come of age. Nature Rev. Cancer 4 97 105 (2004) 47. Schindler, C., Levy, D. E. & Decker, T. JAK STAT signaling: from interferons to cytokines. J. Biol. Chem. 282 20059 20063 (2007). 48. Takeda, K. & Akira, S. STAT family of transcription factors in cytokine mediated biological responses. Cytokine Growth Factor Rev. 11 199 207 (2000). 49. Buettner R, Mora LB, Jove R. Activated STAT signaling in human tumors provides novel molecular targets for therapeutic intervention. Clin Cancer Res 2002;8:945 954. 50. Yu H, Kortylewski M, Pardoll D. Crosstalk between cancer and immune cells: role of STAT3 in the tu mour microenvironment. Nat Rev Immunol. 2007 Jan;7(1):41 51 51. Nefedova Y, Nagaraj S, Rosenbauer A, Muro Cacho C, Sebti SM, Gabrilovich DI Regulation of dendritic cell differentiation and antitumor immune response in cancer by pharmacologic selective inhibi tion of the janus activated kinase 2/signal transducers and activators of transcription 3 pathway. Cancer Res. 65 9525 9535 (2005) 52. Schmielau, J. & Finn, O. J. Activated granulocytes and granulocyte derived hydrogen peroxide are the underlying mechanism of suppression of T cell function in advanced cancer patients. Cancer Res. 61 4756 4760 (2001). 53. Kusmartsev, S., Y. Nefedova, D. Yoder, and D.I. Gabrilovich. 2004. Antigen specific inhibition of CD8+ T cell response by immature myeloid cells in cancer is me diated by reactive oxygen species. J Immunol 172:989 999. 54. Szuster Ciesielska, A., Hryciuk Umer, E., Stepulak, A., Kupisz, K. & Kandefer Szerszen, M. Reactive oxygen species production by blood neutrophils of patients with laryngeal carcinoma and antioxidat ive enzyme

PAGE 99

90 activity in their blood. Acta Oncol. 43 252 258 (2004). 55. Waris, G. & Ahsan, H. Reactive oxygen species: role in the development of cancer and various chronic conditions. J. Carcinog. 5 14 (2006). 56. Mantovani, G. et al. Antioxidant agents are ef fective in inducing lymphocyte progression through cell cycle in advanced cancer patients: assessment of the most important laboratory indexes of cachexia and oxidative stress. J. Mol. Med. 81 664 673 (2003). 57. Agostinelli, E. & Seiler, N. Non irradiation derived reactive oxygen species (ROS) and cancer: therapeutic implications. Amino Acids 31 341 355 (2006). 58. Zhan, S, Vazquez, N, Wientjes, FB, et al. Genomic structure, chromosomal localization, start of transcription, and tissue expression of the human p4 0 phox, a new component of the nicotinamide adenine dinucleotide phosphate oxidase complex. Blood 1996 59. Babior B. M.: Oxidants from phagocytes: agents of defense and destruction. Blood 1984 60. Decoursey TE, Ligeti E. Regulation and termination of NADPH oxidase activity. Cell Mol Life Sc 61. Dinauer, MC. The respiratory burst oxidase and the molecular genetics of chronic granulomatous disease. Crit Rev Clin Lab Sci (1993) 62. Pham My Chan Dang, Allan Stensballe, Tarek Boussetta, Houssam Raad, Cedric Dewas, Yolande Kro viarski, Gilles Hayem, Ole N. Jensen, Marie Anne Gougerot Pocidalo, and Jamel El Benna. A specific p47 phox serine phosphorylated by convergent MAPKs mediates neutrophil NADPH oxidase priming at inflammatory sites. J. Clin. Invest., Jul (2006) 63. Vickers, S. M., MacMillan Crow, L. A., Green, M., Ellis, C. & Thompson, J. A. Association of increased immunostaining for inducible nitric oxide synthase and nitrotyrosine with fibroblast growth factor transformation in pancreatic cancer. Arch. Surg. 134 245 251 (199 9). 64. Gobert, A. P. et al Helicobacter pylori arginase inhibits nitric oxide production by eukaryotic cells: a strategy for bacterial survival. Proc. Natl Acad. Sci. USA 98 13844 13849 (2001). 65. Rodriguez, P. C. et al Arginase I production in the tumor mic roenvironment by mature myeloid cells inhibits T cell receptor expression and antigen specific T cell responses. Cancer Res. 64 5839 5849 (2004).

PAGE 100

91 66. Munder, M. et al TH1/TH2 regulated expression of arginase isoforms in murine macrophages and dendritic cell s. J. Immunol. 163 3771 3777 (1999). 67. Boutard, V. et al Transforming growth factor stimulates arginase activity in macrophages. Implications for the regulation of macrophage cytotoxicity. J. Immunol. 155 2077 2084 (1995) 68. Boutard, V. et al Transforming growth factor stimulates arginase activity in macrophages. Implications for the regulation of macrophage cytotoxicity. J. Immunol. 155 2077 2084 (1995). 69. Jost, M. M. et al Divergent effects of GM CSF and TGF 1 on bone marrow derived macrophage arginase 1 activity, MCP 1 expression, and matrix metalloproteinase 12: a potential role during arteriogenesis. FASEB J. 17 2281 2283 (2003). 70. Zhang, M. et al Spermine inhibits proinflammatory`cytokine synthesis in human mononuclear cells: a` \ counterregulatory me chanism that restrains the immune`response. J. Exp. Med. 185 1759 1768 (1997). 71. Taheri F, et al. L Arginine regulates the expression of the T cell receptor zeta chain (CD3zeta) in Jurkat cells. Clin Cancer Res 2001; 7 :958s 965s. 72. Baniyash, M. TCR chain dow nregulation: curtailing an excessive inflammatory immune response. Nature Rev. Immunol. 4 675 687 (2004). 73. Rodriguez, P. C., Quiceno, D. G. & Ochoa, A. C. l arginine availability regulates T lymphocyte cell cycle progression. Blood 109 1568 1573 (2007). 74. Z hang, P. et al The GCN2 eIF2 # kinase is required for adaptation to amino acid deprivation in mice. Mol. Cell. Biol. 22 6681 6688 (2002). 75. Wu, G. & Morris, S. M. Jr. Arginine metabolism: nitric oxide and beyond. Biochem. J. 336 1 17 (1998). 76. Bogdan, C. Ni tric oxide and the immune response. Nature Immunol. 2 907 916 (2001). 77. Alderton, W. K., Cooper, C. E. & Knowles, R. G. Nitric oxide synthases: structure, function and inhibition. Biochem. J. 357 593 615 (2001). 78. Kusmartsev, S. & Gabrilovich, D.I. STAT1 sig naling regulates tumor associated macrophage mediated T cell deletion. J. Immunol. 174 4880 4891 (2005) 79. Fischer, T. A. et al Activation of cGMP dependent protein kinase I inhibits

PAGE 101

92 interleukin 2 release and proliferation of T cell receptor stimulated human peripheral T cells. J. Biol. Chem. 276 5967 5974 (2001). 80. Rivoltini, L. et al. Immunity to cancer: attack and escape in T lymphocyte tumor cell interaction. Immunol. Rev 188 97 113 (2002) 81. Ferlito M, Irani K, Faraday N, Lowenstein CJ. Nitric oxide inhibits exocytosis of cytolytic granules from lymphokine activated killer cells. PNAS 103(31):11689 94 (2006) 82. Letterio, J.J. & Roberts, A.B. Regulation of immune responses by TGF Annu. Rev. Immunol. 16 137 161 (1998). 83. Maeda, H. & Shiraishi, A. TGF contributes to the shift toward Th2 type responses through direct and IL 10 mediated pathways in tumor bearing mice. J. Immunol. 156 73 78 (1996). 84. Leonid Gorelik & Richard A. F lavell. Immune mediated eradication of tumors through the blockade of transforming growth factor signaling in T cells. Nature Medicine 7 1118 1122 (2001) 85. Terabe, M., S. Matsui, J. M. Park, M. Mamura, N. Noben Trauth, D. D. Donaldson, W. Chen, S. M. W ahl, S. Ledbetter, B. Pratt, et al. 2003. Transforming growth factor b production and myeloid cells are an effector mechanism through which CD1drestricted T cells block cytotoxic T lymphocyte mediated tumor immunosurveillance: abrogation prevents tumor re currence. J. Exp. Med. 198 : 1741 1752. 86. Srivastava MK, Sinha P, Clements VK, Rodriguez P, Ostrand Rosenberg S Myeloid derived suppressor cells inhibit T cell activation by depleting cystine and cysteine. Cancer Res. 1 : 68 77 (2010) 87. Yang, R. et al. CD80 in immune suppression by mouse ovarian carcinoma associated Gr 1+CD11b+ myeloid cells. Cancer Res. 66 6807 6815 (2006). 88. Serafini, P., Mgebroff, S., Noonan, K. & Borrello, I. Myeloid derived suppressor cells promote crosstolerance in B cell lymphoma by expan ding regulatory T cells. Cancer Res. 68 5439 5449 (2008). 89. Movahedi, K. et al. Identification of discrete tumor induced myeloid derived suppressor cell subpopulations with distinct T cell suppressive activity. Blood 111 4233 4244 (2008). 90. Khan AI, Landis RC, Malhotra R (2003) L Selectin ligands in lymphoid tissues and models of inflammation. Inflammation 27:265 280

PAGE 102

93 91. Rosen SD. Ligands for L selectin: homing, inflammation, and beyond. Annu Rev Immunol 22:129 156 (2004) 92. Bradley LM, Watson SR, Swain SL Entry of naive CD4 T cells into peripheral lymph nodes requires L selectin. J Exp Med 180:2401 2406 (1994) 93. Tedder TF, Steeber DA, Pizcueta P. L Selectin deficient mice have impaired leukocyte recruitment into inflammatory sites. J Exp Med 181:2259 2264 (1995) 94. Hanson EM, Clements VK, Sinha P, Ilkovitch D, Ostrand Rosenberg S Myeloid derived suppressor cells down regulate L selectin expression on CD4 + and CD8 + T cells. J Immunol 183:937 944(2009) 95. Mantovani, A., et al. Macrophage polarization: tumor associated m acrophages as a paradigm for polarized M2 mononuclear phagocytes. Trends Immunol. 23 :549 555 (2002) 96. Sica, A., Schioppa, T., Mantovani, A., and Allavena, P. Tumour associated macrophages are a distinct M2 polarised population promoting tumour progression: p otential targets of anti cancer therapy. Eur. J. Cancer. 42 :717 727 (2006). 97. Bingle, L., Brown, N.J., and Lewis, C.E. The role of tumour associated macrophages in tumour progression: implications for new anticancer therapies. J. Pathol. 196 :254 265 (2002). 98. Mantovani, A., et al. The origin and function of tumor associated macrophages. Immunol. Today. 13 :265 270 (1992). 99. Valledor AF, Borrˆs FE, Cullell Young M, Celada A. Transcription factors that regulate monocyte/macrophage differentiation. J Leukoc Biol. 1998 Apr;63(4):405 17 100. Benoit M, Desnues B, Mege JL.Macrophage Polarization in bacterial Infections. J Immunol. 181; 3733 9 (2008) 101. Gordon, S. 2003. Alternative activation of macrophages. Nat. Rev. Immunol. 3 :23 35. 102. Mantovani, A., et al. 2002. Macrophage polarization: tumor associated macrophages as a paradigm for polarized M2 mononuclear phagocytes. Trends Immunol. 23 :549 555. 103. Saccani, A., et al. 2006. p50 nuclear factor {kappa}B overexpression in tumor associated macrophages inhibits M1 inflammatory re sponses and ant

PAGE 103

94 tumor resistance. Cancer Res. 66 :11432 11440. 104. Biswas, S.K., et al. 2006. A distinct and unique transcriptional program expressed by tumor associated macrophages (defective NF kappaB and enhanced IRF 3/STAT1 activation). Blood. 107 :2112 2122 105. Luo, Y., et al. 2006. Targeting tumor associated macrophages as a novel strategy against breast cancer. J. Clin. Invest. 116 :2132 2141. 106. Bolat, F., et al. 2006. Microvessel density, VEGF expression, and tumor associated macrophages in breast tumors: corre lations with prognostic parameters. J. Exp. Clin. Cancer Res. 25 :365 372. 107. Ueno, T., et al. 2000. Significance of macrophage chemoattractant protein 1 in macrophage recruitment, angiogenesis, and survival in human breast cancer. Clin. Cancer Res. 6 :3282 328 9. 108. van Kempen, L.C., and Coussens, L.M. 2002. MMP9 potentiates pulmonary metastasis formation. Cancer Cell. 2 :251 252 109. Curiel, T.J., et al. 2004. Specific recruitment of regulatory T cells in ovarian carcinoma fosters immune privilege and predicts reduced s urvival. Nat. Med 110. Leek RD, Lewis CE, Whitehouse R, Greenall M, Clarke J, Harris AL: Association of macrophage infiltration with angiogenesis and prognosis in invasive breast carcinoma. Cancer Res 1996, 56:4625 4629 111. Burton JL, Wells JM, Corke KP, Maitland N, Hamdy FC, Lewis CE: Macrophages accumulate in avascular, hypoxic areas of prostate tumors: implications for the targeted therapeutic gene delivery to such sites. J Pathol 2000, 192:8A 112. Negus RP, Stamp GW, Hadley J, Balkwill FR: Quantitative assessment o f the leukocyte infiltrate in ovarian cancer and its relationship to the expression of C C chemokines. Am J Pathol 1997, 150:1723 1734 113. Murdoch C, Giannoudis A, Lewis CE: Mechanisms regulating the recruitment of macrophages into hypoxic areas of tumors and other ischemic tissues. Blood 2004, 104:2224 2234 114. Sica A, Saccani A, Bottazzi B, Bernasconi S, Allavena P, Gaetano B, Fei F, LaRosa G, Scotton C, Balkwill F, Mantovani A: Defective expression of the monocyte chemotactic protein 1 receptor CCR2 in macropha ges associated with human ovarian carcinoma. J Immunol 2000, 164:733 738 115. Bosco MC, Reffo G, Puppo M, Varesio L: Hypoxia inhibits the expression of

PAGE 104

95 the CCR5 chemokine receptor in macrophages. Cell Immunol 2004, 228:1 7 116. Grimshaw MJ, Balkwill FR: Inhibition o f monocyte and macrophage chemotaxis by hypoxia and inflammation a potential mechanism. Eur J Immunol 2001, 31:480 489 117. Vaupel P, Thews O, Hoeckel M. Treatment resistance of solid tumors: role of hypoxia and anemia. Med Oncol 2001;18:243 259 118. Sitkovsky M, L ukashev D. Regulation of immune cells by local tissue oxygen tension: HIF1 alpha and adenosine receptors. Nat Rev Immunol. 2005 Sep;5(9):712 21 119. Vaupel P, Briest S, Hšckel M. Hypoxia in breast cancer: pathogenesis, characterization and biological/therapeu tic implications. Wien Med Wochenschr 152:334 342 (2002) 120. Hšckel M, Vaupel P. Tumor hypoxia: definitions and current clinical, biologic, and molecular aspects. J Natl Cancer Inst 93:266 276 (2001) 121. Hšckel M, Vaupel P. Biological consequences of tumor hypoxi a. Semin Oncol 28; 36 41 (2001) 122. Lewis JS, Landers RJ, Underwood JC, Harris AL, Lewis CE. Expression of vascular endothelial growth factor by macrophages is up regulated in poorly vascularized areas of breast carcinomas. J Pathol. 2000 Oct;192(2):150 8 123. Whi te JR, Harris RA, Lee SR, Craigon MH, Binley K, Price T, Beard GL, Mundy CR, Naylor S. Genetic amplification of the transcriptional response to hypoxia as a novel means of identifying regulators of angiogenesis. Genomics. 2004 Jan;83(1):1 8. 124. Kuwabara K, Og awa S, Matsumoto M, Koga S, Clauss M, Pinsky DJ, Lyn P, Leavy J, Witte L, Joseph Silverstein J, et al. Hypoxia mediated induction of acidic/basic fibroblast growth factor and platelet derived growth factor in mononuclear phagocytes stimulates growth of hyp oxic endothelial cells. PNAS. 9;92(10):4606 10.1995 125. Murdoch C, Muthana M, Lewis CE. Hypoxia regulates macrophage functions in inflammation. J Immunol. 2005 Nov 15;175(10):6257 63. 126. Lining Zhang, Qun Wang, Chunmei Liu, Xiaoyan Wang, Faliang Zhu and Wenshen g Sun Hypoxia inhibits the maturation and function of murine bone marrow derived dendritic cells The FASEB Journal ; 22 :846.27 (2008) 127. Kusmartsev, S., and D. I. Gabrilovich. Inhibition of myeloid cell

PAGE 105

96 differentiation in cancer: the role of reactive oxygen sp ecies. J. Leukocyte Biol. 74: 186 196 (2003). 128. Nagaraj S, Schrum AG, Cho HI, Celis E, Gabrilovich DI. Mechanism of T cell tolerance induced by myeloid derived suppressor cells. J Immunol. 184(6):3106 16 (2010) 129. Zea, A. H. et al. Arginase producing myeloid su ppressor cells in renal cell carcinoma patients: a mechanism of tumor evasion. Cancer Res. 65 3044 3048 (2005). 130. Assari, T. 2006. Chronic granulomatous disease; fundamental stages in our understanding of CGD. Med Immunol. 5: 4. 131. Nefedova, Y., M. Huang, S. Kusmartsev, R. Bhattacharya, P. Cheng, R. Salup, R. Jove, and D. Gabrilovich. 2004. Hyperactivation of STAT3 is involved in abnormal differentiation of dendritic cells in cancer. J. Immunol. 172: 464 474. 132. Pierce JH, Ruggiero M, Fleming TP, Di Fiore PP, G reenberger JS, Varticovski L, Schlessinger J, Rovera G, Aaronson SA. Signal transduction through the EGF receptor transfected in IL 3 dependent hematopoietic cells. Science. 239:628 31 1988 133. Chaturvedi P, Reddy MV, Reddy EP. Src kinases and not JAKs activate STATs during IL 3 induced myeloid cell proliferation. Oncogene. 1998 Apr 2;16(13):1749 58. 134. Takeda, K., B. E. Clausen, T. Kaisho, T. Tsujimura, N. Terada, I. Forster, and S. Akira. Enhanced Th1 activity and development of chronic enter colitis in mice d evoid of Stat3 in macrophages and neutrophils. Immunity 10: 39 49 (1999) 135. Bromberg, J. F., M. H. Wrzeszczynska, G. Devgan, Y. Zhao, R. G. Pestell, C. Albanese, and J. E. Darnell. 1999. Stat3 as an oncogene. Cell 98: 295 303. 136. Blaskovich MA, Sun J, Cantor A, Turkson J, Jove R, Sebti SM. Discovery of JSI 124 (cucurbitacin I), a selective Janus kinase/signal transducer and activator of transcription 3 signaling pathway inhibitor with potent antitumor activity against human and murine cancer cells in mice. Can cer Res. 2003 Mar 15;63(6):1270 9 137. Nefedova Y, Cheng P, Gilkes D, Blaskovich M, Beg AA, Sebti SM, Gabrilovich DI. Activation of dendritic cells via inhibition of Jak2/STAT3 signaling. J Immunol. 2005 Oct 1;175(7):4338 46

PAGE 106

97 138. Fligger, J., Blum, J. & Jungi, T. W Induction of intracellular arginase activity does not diminish the capacity of macrophages to produce nitric oxide in vitro Immunobiology 200 169 186 (1999). 139. Brys, L. et al. Reactive oxygen species and 12/15 lipoxygenase contribute to the antiprolifer ative capacity of alternatively activated myeloid cells elicited during helminth infection. J. Immunol. 174 6095 6104 (2005). 140. Antonia, S.J., N. Mirza, I. Fricke, A. Chiappori, P. Thompson, N. Williams, G. Bepler, G Simon, W. Janssen, J.H. Lee, K. Menande r, S. Chada, and D.I. Gabrilovich. Combination of p53 cancer vaccine with chemotherapy in patients with extensive stage small cell lung cancer. Clin Cancer Res 12:878 887. 2006 141. Fricke, I., N. Mirza, J. Dupont, G. Lockhart, A. Jackson, J. H. Lee, J.A. Sosma n, and D.I. Gabrilovich. 2007. Treatment of cancer patients with VEGF Trap overcomes defects in DC differentiation but is insufficient to improve antigen specific immune responses. Clin Cancer Res 13:4840 4848. 142. Mirza, N., M. Fishman, I. Fricke, M. Dunn, A. Neuger, T. Frost, R. Lush, S. Antonia, and D. Gabrilovich. 2006. All trans retinoic acid improves differentiation of myeloid cells and immune response in cancer patients. Cancer Res 66:9299 9307. 143. Monu, N., and A.B. Frey. 2007. Suppression of proximal T cell receptor signaling and lytic function in CD8+ tumor infiltrating T cells. Cancer Res 67:11447 11454 144. Lopez, C.B., T.D. Rao, H. Feiner, R. Shapiro, J.R. Marks, and A.B. Frey. Repression of interleukin 2 mRNA translation in primary human breast carcino ma tumor infiltrating lymphocytes. Cell Immunol 190:141 155 (1998) 145. Rabinowich, H., M. Banks, T.E. Reichert, T.F. Logan, J.M. Kirkwood, and T.L. Whiteside. Expression and activity of signaling molecules in T lymphocytes obtained from patients with metastati c melanoma before and after interleukin 2 therapy. Clin Cancer Res 2:1263 1274 (1996) 146. Reichert T.E., L. Strauss, E.M. Wagner, W. Gooding, and T.L. Whiteside. Signaling abnormalities, apoptosis, and reduced proliferation of circulating and tumor infiltrati ng lymphocytes in patients with oral carcinoma. Clin Cancer Res 8:3137 3145 (2002) 147. Movahedi K, Guilliams M, Van den Bossche J, Van den Bergh R, Gysemans C, Beschin A, De Baetselier P, Van Ginderachter JA. Identification of discrete tumor induced myeloid d erived suppressor cell subpopulations with distinct T cell suppressive activity. Blood. 111:4233 44 (2008).

PAGE 107

98 148. Yamamoto, Y., H. Ishigaki, H. Ishida, Y. Itoh, Y. Noda, and K. Ogasawara. Analysis of splenic Gr 1(int) immature myeloid cells in tumor bearing m ice. Microbiology and immunology 52:47 53 (2008) 149. Zhou, R., P.L. He, Y.X. Ren, W.H. Wang, R.Y. Zhou, H. Wan, S. Ono, H. Fujiwara, and J.P. Zuo. Myeloid suppressor cell associated immune dysfunction in CSA1M fibrosarcoma tumor bearing mice. Cancer science 98:882 889 (2007) 150. Magdaleno, S.M., G. Wang, V.L. Mireles, M.K. Ray, M.J. Finegold, and F.J. DeMayo. Cyclin dependent kinase inhibitor expression in pulmonary Clara cells transformed with SV40 large T antigen in transgenic mice. Cell Growth Differ 8:145 15 5 (1997). 151. Gabrilovich, D.I., and S. Nagaraj. 2009. Myeloid derived suppressor cells as regulators of the immune system. Nat Rev Immunol 9:162 174. 152. Ostrand Rosenberg, S., and P. Sinha. 2009. Myeloid derived suppressor cells: linking inflammation and cancer. J Immunol 182:4499 4506. 153. Prins, R. M.; Graf, M. R.; Merchant, R. E. (2001) Cancer Immunol. Cytotoxic T cells infiltrating a glioma express an aberrant phenotype that is associated with decreased function and apoptosis Immunother., 50, 285 292. 154. Rabinovi ch, G.A., D. Gabrilovich, and E.M. Sotomayor. Immunosuppressive strategies that are mediated by tumor cells. Annu Rev Immunol 25:267 296.2007 155. Nagaraj S, Youn JI, Weber H, Iclozan C, Lu L, Cotter MJ, Meyer C, Becerra CR, Fishman M, Antonia S, Sporn MB, Li by KT, Rawal B, Lee JH, Gabrilovich DI. Anti inflammatory triterpenoid blocks immune suppressive function of MDSCs and improves immune response in cancer. Clin Cancer Res. 16:1812 23 (2010 ) 156. Kusmartsev, S., Z. Su, A. Heiser, J. Dannull, E. Eruslanov, H. Ku bler, D. Yancey, P. Dahm, and J. Vieweg. Reversal of myeloid cell mediated immunosuppression in patients with metastatic renal cell carcinoma. Clin Cancer Res 14:8270 8278.2008 157. Markiewski, M.M., R.A. DeAngelis, F. Benencia, S.K. Ricklin Lichtsteiner, A. Koutoulaki, C. Gerard, G. Coukos, and J.D. Lambris. 2008. Modulation of the ant tumor immune response by complement. Nat Immunol 9:1225 1235 158. Mougiakakos, D., C.C. Johansson, and R. Kiessling. 2008. Naturally occurring regulatory T cells show reduced sens itivity towards oxidative stress induced cell death. Blood

PAGE 108

99 159. Kusmartsev, S., S. Nagaraj, and D.I. Gabrilovich. 2005. Tumor associated CD8+ T cell tolerance induced by bone marrow derived immature myeloid cells. J Immunol 175:4583 4592. 160. Forman, H. J., and M. Torres. 2001. Redox signaling in macrophages. Mol. Aspects Med. 22: 189 216. 161. Kortylewski, M., M. Kujawski, T. Wang, S. Wei, S. Zhang, S. Pilon Thomas, G. Niu, H. Kay, J. Mule, W. G. Kerr, et al. 2005. Inhibiting Stat3 signaling in the hematopoietic system elicits multicomponent antitumor immunity. Nat. Med. 11:1314 1321. 162. Nefedova, Y., and D. I. Gabrilovich. 2007. Targeting of Jak/STAT pathway in antigen presenting cells in cancer. Curr. Cancer Drug Targets 7: 71 77. 163. Gabrilovich, D. I. 2004. The mechanisms and functional significance of umourinduced dendritic cell defects. Nat. Rev. Immunol. 4: 941 952 164. Bronte, V., and P. Zanovello. 2005. Regulation of immune responses by L arginine metabolism. Nat Rev Immunol 5:641 654. 165. Rodriguez, P.C., and A.C. Ochoa. 20 08. Arginine regulation by myeloid derived suppressor cells and tolerance in cancer: mechanisms and therapeutic perspectives. Immunol Rev 222:180 191. 166. Gray LH, Conger AD, Ebert M et al. The concentration of oxygen dissolved in tissues at the time of irrad iation as a factor in radiotherapy. Br J Radiol 1953;26:638 648. 167. Teicher BA, Holden SA, al Achi A et al. Classification of antineoplastic treatments by their differential toxicity toward putative oxygenated and hypoxic tumor subpopulations in vivo in the FSaIIC murine fibrosarcoma. Cancer Res 1990;50:3339 3344. 168. Littlewood TJ. The impact of hemoglobin levels on treatment outcomes in patients with cancer. Semin Oncol 2001;28(suppl 8):49 53 169. Simon MC, Ramirez Bergeron D, Mack F, Hu CJ, Pan Y, Mansfield K. Hypox ia, HIFs, and cardiovascular development. Cold Spring Harb Symp Quant Biol. 2002;67:127 32 170. Yang, D.I., J.H. Yin, S. Mishra, R. Mishra, and C.Y. Hsu. 2002. NO mediated chemoresistance in C6 glioma cells. Ann N Y Acad Sci 962:8 17. 171. Albina, J.E., and J.S. Rei chner. 2003. Oxygen and the regulation of gene expression in wounds. Wound Repair Regen 11:445 451.

PAGE 109

100 172. Sica, A., and V. Bronte. 2007. Altered macrophage differentiation and immune dysfunction in tumor development. J Clin Invest 117:1155 1166. 173. Kim, J.W., I. Tchernyshyov, G.L. Semenza, and C.V. Dang. 2006. HIF 1 mediated expression of pyruvate dehydrogenase kinase: a metabolic switch required for cellular adaptation to hypoxia. Cell metabolism 3:177 185. 174. Papandreou, I., R.A. Cairns, L. Fontana, A.L. Lim, and N.C. Denko. 2006. HIF 1 mediates adaptation to hypoxia by actively downregulating mitochondrial oxygen consumption. Cell metabolism 3:187 197. 175. Lukashev, D., Ohta, A., Apasov, S. & Sitkovsky, M. Physiologic attenuation of proinflammatory transcription by t he Gs protein coupled A2A adenosine receptor in vivo J. Immunol. 173 21 24 (2004). 176. Huang, S., Koshiba, M., Apasov, S. & Sitkovsky, M. Role of A2A adenosine receptor mediated signaling in inhibition of T cell activation and expansion. Blood 90 1600 1610 (1997). 177. Walenta, S., W. F. Mueller Klieser. 2004. Lactate: mirror and motor of tumor malignancy. Semin. Radiat. Oncol. 14: 267 274 178. Troy, A., Davidson, P., Atkinson, C. & Hart, D. Phenotypic characterisation of the dendritic cell infiltrate in prostate c ancer. J. Urol. 160 214 219 (1998). 179. Troy, A. J., Summers, K. L., Davidson, P. J., Atkinson, C. H. & Hart, D. N. Minimal recruitment and activation of dendritic cells within renal cell carcinoma. Clin. Cancer Res. 4 585 593 (1998). 180. Nestle, F. O., Burg, G., Fah, J., Wrone Smith, T. &Nickoloff, B. J. Human sunlight induced basal cellcarcinoma associated dendritic cells are deficient in T cell co stimulatory molecules and are impaired as antigen presenting cells. Am. J. Pathol. 150 641 651 (1997). 181. Chaux, P., Favre, N., Martin, M. & Martin, F. Tumor infiltrating dendritic cells are defective in their antigen presenting function and inducible B7 expression in rats. Int. J. Cancer 72 619 624 (1997). 182. Oda, T., K. Hirota, K. Nishi, S. Takabuchi, S. Oda, H. Yam ada, T. Arai, K. Fukuda, T. Kita, T. Adachi, G.L. Semenza, and R. Nohara. 2006. Activation of hypoxia inducible factor 1 during macrophage differentiation. Am J Physiol Cell Physiol 291:C104 113. 183. Piccoli, C., A. D'Aprile, M. Ripoli, R. Scrima, D. Boffoli, A. Tabilio, and N. Capitanio. 2007. The hypoxia inducible factor is stabilized in circulating hematopoietic stem cells under normoxic conditions. FEBS Lett 581:3111

PAGE 110

101 3119. 184. Goyal, P., N. Weissmann, F. Grimminger, C. Hegel, L. Bader, F. Rose, L. Fink, H.A. Ghofrani, R.T. Schermuly, H.H. Schmidt, W. Seeger, and J. Hanze. 2004. Upregulation of NAD(P)H oxidase 1 in hypoxia activates hypoxia inducible factor 1 via increase in reactive oxygen species. Free Radic Biol Med 36:1279 1288. 185. Thornton, R. D. et al Inte rleukin 1 induces hypoxia inducible factor 1 in human gingival and synovial fibroblasts. Biochem. J. 350 307 312 (2000). 186. Stiehl, D. P., Jelkmann, W., Wenger, R. H. & Hellwig Burgel, T. Normoxic induction of the hypoxia inducible factor 1 by insulin and interleukin 1 involves the phosphatidylinositol 3 kinase pathway. FEBS Lett. 512 157 162 (2002). 187. Zelzer, E. et al Insulin induces transcription of target genes through the hypoxia inducible factor HIF 1 /ARNT. EMBO J. 17 5085 5094 (1998 ). 188. Richard, D. E., Berra, E. & Pouyssegur, J. Nonhypoxic pathway mediates the induction of hypoxia inducible factor 1 in vascular smooth muscle cells. J. Biol. Chem. 275 26765 26771 (2000) 189. Kujawski, M., M. Kortylewski, H. Lee, A. Herrmann, H. Kay, and H. Yu. Stat3 mediates myeloid cell dependent tumor angiogenesis in mice. J Clin Invest 118 :3367 3377 (2008).

PAGE 111

ABOUT THE AUTHOR Cesar A. Corzo was born in Lima, Peru and earned a B.S. degree in Microbiology fro m the University of Florida. He was awarded a pre doctoral fellowship from the National Institutes of Health in 2007 and is the author of 5 peer reviewed publications in tumor immunology