USF Libraries
USF Digital Collections

Angiostatic regulators in ovarian cancer

MISSING IMAGE

Material Information

Title:
Angiostatic regulators in ovarian cancer
Physical Description:
Book
Language:
English
Creator:
Drenberg, Christina
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Angiogenesis
Angiostatin
Biomarker
Semaphorin 3F
Telomerase
Dissertations, Academic -- Medical Sciences -- Masters -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: Angiogenesis by either normal or neoplastic cells involves a delicate balance of both angiogenic and angiostatic regulators. In the ovary, normal physiological angiogenesis occurs around the developing follicle and corpus luteum in response to hormonal shifts. Interestingly, carcinomas arising from the ovary are usually highly vascularized and are commonly clinically observed to produce cyst fluids or ascites which contain both angiostatic and/or angiogenic regulators. However, in contrast to normal angiogenesis, angiogenesis associated with epithelial ovarian cancer usually produces aberrant vasculature that may promote neoplastic progression. Therefore, the ovary and ovarian cancers provide models to study the mechanisms governing the strict balance of angioregulators in both normal and tumor angiogenesis. While most studies to date have focused on angiogenic regulators for normal and aberrant angiogenesis, we investigated the potential for dysregulation of angiostatic regulators to contribute to the etiology of epithelial ovarian cancer. Therefore, in this study, we examined two angiostatic regulators, angiostatin and semaphorin 3F, in epithelial ovarian cancer. Angiostatin, a cleavage product of the circulating zymogen plasminogen, was isolated from serum and urine of mice bearing a Lewis lung carcinoma and in vivo studies have demonstrated its potent angiostatic properties. Thus, we investigated the potential prognostic/diagnostic advantage of aberrant angiostatin expression with epithelial ovarian cancer. We found that urinary angiostatin, compared to other angioregulators in plasma or urine, could serve as an effective biomarker for early detection of epithelial ovarian cancer, especially when used in combination with cancer antigen 125. Additionally, urinary angiostatin correlated with both recurrent disease as well as successful tumor ablation further supporting its potential as a disease biomarker. Alternative biological functions for the axon guidance molecule, semaphorin 3F, have been reported particularly in regard to angiogenesis, tumor progression and metastasis. However, the underlying mechanisms governing semaphorin 3F regulation and dysregulation remain unclear. Therefore, we first investigated the clinical relationship between semaphorin 3F expression and epithelial ovarian cancer progression. These immunohistological studies revealed that, similar to lung cancer, semaphorin 3F expression decreased with progression supporting a tumor suppressor-like role for semaphorin 3F. Additionally, we found that calcium, an essential cellular signaling molecule, could mediate transcriptional suppression of semaphorin 3F expression in a CREB-dependent manner. Lastly, given the antagonistic relationship between semaphorin 3F and vascular endothelial growth factor, we sought to determine whether semaphorin 3F and vascular endothelial growth factor promoted opposing effects on a common downstream target. In the course of these studies we determined that telomerase is a novel molecular target of semaphorin 3F in ovarian cancer cells such that semaphorin 3F suppresses telomerase activity while vascular endothelial growth factor promotes telomerase activity. In addition, we found that the inverse relationship between semaphorin 3F and telomerase was mediated through transcriptional inhibition of the hTERT promoter by semaphorin 3F. In conclusion, this research shows that dysregulation of the angiostatic regulators, angiostatin and semaphorin 3F, may contribute to the etiology of epithelial ovarian cancer. In the future, dysregulation of these and other angiostatic regulators may be exploited for therapeutic intervention or as biomarkers for early detection which would allow women more treatment choices and hopefully, reduce the mortality associated with this insidious disease.
Thesis:
Dissertation (PHD)--University of South Florida, 2010.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Christina Drenberg.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains X pages.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
usfldc doi - E14-SFE0004698
usfldc handle - e14.4698
System ID:
SFS0028006:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim
leader nam 22 Ka 4500
controlfield tag 007 cr-bnu---uuuuu
008 s2010 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0004698
035
(OCoLC)
040
FHM
c FHM
049
FHMM
090
XX9999 (Online)
1 100
Drenberg, Christina.
0 245
Angiostatic regulators in ovarian cancer
h [electronic resource] /
by Christina Drenberg.
260
[Tampa, Fla] :
b University of South Florida,
2010.
500
Title from PDF of title page.
Document formatted into pages; contains X pages.
502
Dissertation (PHD)--University of South Florida, 2010.
504
Includes bibliographical references.
516
Text (Electronic thesis) in PDF format.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
3 520
ABSTRACT: Angiogenesis by either normal or neoplastic cells involves a delicate balance of both angiogenic and angiostatic regulators. In the ovary, normal physiological angiogenesis occurs around the developing follicle and corpus luteum in response to hormonal shifts. Interestingly, carcinomas arising from the ovary are usually highly vascularized and are commonly clinically observed to produce cyst fluids or ascites which contain both angiostatic and/or angiogenic regulators. However, in contrast to normal angiogenesis, angiogenesis associated with epithelial ovarian cancer usually produces aberrant vasculature that may promote neoplastic progression. Therefore, the ovary and ovarian cancers provide models to study the mechanisms governing the strict balance of angioregulators in both normal and tumor angiogenesis. While most studies to date have focused on angiogenic regulators for normal and aberrant angiogenesis, we investigated the potential for dysregulation of angiostatic regulators to contribute to the etiology of epithelial ovarian cancer. Therefore, in this study, we examined two angiostatic regulators, angiostatin and semaphorin 3F, in epithelial ovarian cancer. Angiostatin, a cleavage product of the circulating zymogen plasminogen, was isolated from serum and urine of mice bearing a Lewis lung carcinoma and in vivo studies have demonstrated its potent angiostatic properties. Thus, we investigated the potential prognostic/diagnostic advantage of aberrant angiostatin expression with epithelial ovarian cancer. We found that urinary angiostatin, compared to other angioregulators in plasma or urine, could serve as an effective biomarker for early detection of epithelial ovarian cancer, especially when used in combination with cancer antigen 125. Additionally, urinary angiostatin correlated with both recurrent disease as well as successful tumor ablation further supporting its potential as a disease biomarker. Alternative biological functions for the axon guidance molecule, semaphorin 3F, have been reported particularly in regard to angiogenesis, tumor progression and metastasis. However, the underlying mechanisms governing semaphorin 3F regulation and dysregulation remain unclear. Therefore, we first investigated the clinical relationship between semaphorin 3F expression and epithelial ovarian cancer progression. These immunohistological studies revealed that, similar to lung cancer, semaphorin 3F expression decreased with progression supporting a tumor suppressor-like role for semaphorin 3F. Additionally, we found that calcium, an essential cellular signaling molecule, could mediate transcriptional suppression of semaphorin 3F expression in a CREB-dependent manner. Lastly, given the antagonistic relationship between semaphorin 3F and vascular endothelial growth factor, we sought to determine whether semaphorin 3F and vascular endothelial growth factor promoted opposing effects on a common downstream target. In the course of these studies we determined that telomerase is a novel molecular target of semaphorin 3F in ovarian cancer cells such that semaphorin 3F suppresses telomerase activity while vascular endothelial growth factor promotes telomerase activity. In addition, we found that the inverse relationship between semaphorin 3F and telomerase was mediated through transcriptional inhibition of the hTERT promoter by semaphorin 3F. In conclusion, this research shows that dysregulation of the angiostatic regulators, angiostatin and semaphorin 3F, may contribute to the etiology of epithelial ovarian cancer. In the future, dysregulation of these and other angiostatic regulators may be exploited for therapeutic intervention or as biomarkers for early detection which would allow women more treatment choices and hopefully, reduce the mortality associated with this insidious disease.
590
Advisor: Santo Nicosia, M.D.
653
Angiogenesis
Angiostatin
Biomarker
Semaphorin 3F
Telomerase
690
Dissertations, Academic
z USF
x Medical Sciences
Masters.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.4698



PAGE 1

Angiostatic Regulators in Ovarian Cancer b y Christina Diane Drenberg A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Pathology and Cell Biology College of Medicine University of South Florida Co Major Professor: Santo V. Nicosia, M.D. Co Major Professor: Patricia A. Kruk, Ph.D. Jin Q. Cheng, M.D., Ph.D. Xiaohong Zhang, Ph.D. Steven S. Brem, M.D. Amyn Rojiani, M.D., Ph.D. Date of Approval: November 4, 2010 Keyw ords: angiogenesis, angiostatin, biomarker, semaphorin 3F telomerase Copyright 2010, Christina Diane Drenberg

PAGE 2

DEDICATION This work is dedicated to the people in my life that have been diagnosed with cancer. Those that I have lost have given m e the courage to live and those that have survived have given me the determination to fight.

PAGE 3

ACKNOWLEDG E MENTS My gratitude goes to Dr. Santo V. Nicosia for the opportunity to join his ovarian cancer research team and to work in his labor atory as a graduate student. He is a truly outstanding physician scientist and I am confident that I will achieve my long term career goals due to his ceaseless role as a mentor and role model. My appreciation also goes to Dr. Patricia A. Kruk for allowi ng me to work in her laboratory, for supporting my development into an independent researcher, and for always having an open door. I would like to sincerely thank my committee members for their expertise and advice during the development of my project: Dr. Cheng, Xiaohong Zhang, Amyn Rojiani and Steven Brem. Additionally, I thank Dr. Jo lle Roche for serving as my external chair and providing reagents which advanced my research. I thank June Paciga who always p lacidly amid the noise and haste. My thanks also go to Mackenzie Ott, a best friend and fellow graduate student that helped me survive my days at the COM Finally, I would like to tha nk my mother, father, and Matt for their unconditional love and suppor t Their encouragement and confidence in me gave me strength to keep reaching for the stars

PAGE 4

i TABLE OF CONTENTS LIST OF TABLES ................................ ................................ ................................ iv LIST OF FIGURES ................................ ................................ ............................... v LIST OF ABBREVIATIONS ................................ ................................ ................. vii ABSTRACT ................................ ................................ ................................ .......... xi CHAPTER I INTRODUCTION ................................ ................................ .............. 1 Ovarian Cancer ................................ ................................ .......................... 1 Epidemiology ................................ ................................ ................... 2 Histopathology ................................ ................................ ................ 2 Pathogenesis ................................ ................................ .................. 5 Molecular Alterations ................................ ................................ ....... 6 Detection ................................ ................................ ......................... 8 Angiogenesis ................................ ................................ ........................... 10 Ovarian Angiogenesis ................................ ................................ ... 12 Tumor Angiogenesis ................................ ................................ ..... 13 Angiostatin ................................ ................................ .................... 15 Axon Guidance and Angiogenesis ................................ ................ 18 Semaphorins ................................ ................................ ............................ 18 Receptors ................................ ................................ ...................... 19 Class 3 Semaphorins ................................ ................................ .... 21 Semaphorin 3F ................................ ................................ .............. 24 Central Hypothesis ................................ ................................ .................. 25 Specific Aims ................................ ................................ ........................... 25 CHAPTER II URINARY ANGIOSTATIN LEVELS ARE ELEVATED IN PATIENTS WITH EPITHELIAL OVAR IAN CANCER ................................ ....................... 27 Abstract ................................ ................................ ................................ .... 27 Introduction ................................ ................................ .............................. 28 Methods and Materials ................................ ................................ ............. 31 Patient Cohort ................................ ................................ ............... 31 Sample Preparation ................................ ................................ ...... 32 Enzyme Linked Immun o sorbant Assay ................................ ......... 32 Western Blot Analysis ................................ ................................ ... 35

PAGE 5

i i Statistical Analysis ................................ ................................ ........ 35 Results ................................ ................................ ................................ ..... 36 uAS Levels are Elevated in EOC Patients ................................ .... 36 Clinical Status ................................ ................................ ............... 40 Elevated uAS Levels Complement CA125 Values ........................ 45 Discussion ................................ ................................ ............................... 46 C HAPTER III EXPRESSION OF SEMAPH ORIN 3F AND ITS RECE PTORS IN EPITHELIAL OVARIAN C ANCER, FALLOPIAN TUB ES, AND SECONDARY M LLERIAN TISSUES ................................ ................................ ................. 49 Abstract ................................ ................................ ................................ .... 49 Introduction ................................ ................................ .............................. 50 Methods and Materials ................................ ................................ ............. 52 Tissue Specimens ................................ ................................ ......... 52 Immunohistochemistry ................................ ................................ .. 53 Statistical Analysis ................................ ................................ ........ 54 Results ................................ ................................ ................................ ..... 55 S3F Expression Decreases with Epithelial Ovarian Cancer Progression ................................ ................................ .............. 55 NP 2 Expression Decreases with Epithelial Ovarian Cancer Progression ................................ ................................ .............. 59 NP 1 Expression Increases with Epith elial Ovarian Cancer Progression ................................ ................................ .............. 60 S3F, NP 2, and NP 1 Expression is Elevated in Inclusion Cysts, Paraovarian Cysts, and Fallopian Tube Epithelium ...... 61 Discussion ................................ ................................ ............................... 64 CHAPTER IV SEMAPHORIN 3F DYSREG ULATION INDUCES TELO MERASE ACTIVITY IN OVARIAN CANCER CELLS ................................ .................... 67 Abstract ................................ ................................ ................................ .... 67 Introduction ................................ ................................ .............................. 68 Methods and Materials ................................ ................................ ............. 71 Cell lines and C ulture ................................ ................................ .... 71 Treatment with SEMA3F, VEGF, CBO P11, Calcium and other Divalent Ions ................................ ................................ ... 71 Transient Transfection and Small Interfering RNA Transfection ................................ ................................ ............. 72 RT PCR ................................ ................................ ........................ 73 Telomer ase Assay ................................ ................................ ........ 74 Western Blot Analysis ................................ ................................ ... 74 Luciferase Reporter Assay ................................ ............................ 75 Statistical Analysis ................................ ................................ ........ 76 Results ................................ ................................ ................................ ..... 76 Calcium Suppresses SEMA3F Expression in I OSE and Ovarian Cancer Cells ................................ ............................... 76

PAGE 6

iii Calcium mediated Suppression of SEMA3F is CREB dependent ................................ ................................ ................ 79 SEMA3F Promoter Region 4810 to 4418 is Required for Expression in IOSE ................................ ................................ .. 82 SEMA3F Expression is Inversely Correlated with Telomerase in I OSE and Ovarian Cancer Cell Lines ............... 83 SEMA3F Mediates Suppression of Telomerase Activity in Ovarian Cancer Cells ................................ ............................... 85 SEMA3F Tar gets the 378 and 181 regions of the hTERT Promoter ................................ ................................ .................. 85 SEMA3F and VEGF have Opposing Effects on Telomerase Activity ................................ ................................ ..................... 88 Discussion ................................ ................................ ............................... 89 C HAPTER V CONCLUDING REMARKS ................................ .......................... 95 LIST OF REFERENCES ................................ ................................ .................. 101 APPENDICES ................................ ................................ ................................ .. 120 Appendix I. List of Publications ................................ ............................. 121 ABOUT THE AUTHOR ................................ ................................ ............ End page

PAGE 7

iv LIST OF TABLES Table 1: Histological Diagnosis and Clinical Char acteristics of the Study Cohort ................................ ................................ ............ 34 Table 2: VEGF, HGF, ES, and AS in the Study Cohort as Descriptive Statistical Information ................................ .............................. 37 Table 3: E pithelial Expression of S3F and NP 2 Decreases While NP 1 Increases with Ovarian Epithelial Tumor Progression .......... 56

PAGE 8

v LIST OF FIGURES Figure 1: Ovarian Surface Epithelium ................................ .............................. 4 Figure 2: Schematic of Angiostatin Structure and Generation by Proteolytic Cleavage of Plasmin and Plasminogen ................................ ....... 17 Figure 3: Schematic Representation of Class 3 Semaphorins and Receptors, Neuropilins and Plexins Structure .............................. 23 Figure 4: Plasma and Urinary Levels of Angiogenic Regulators are Elevated with EOC Progression ................................ ................... 38 Figure 5: AS Levels are El evated in EOC Patients ................................ .......... 39 Figure 6: uAS Levels are Elevated in EOC Patients ................................ ........ 41 Figure 7: Elevated uAS Correlates with Recurrent EOC and Complements CA125 Measurements ................................ .......... 44 Figure 8: S3F Expression Decreases while NP 1 Increases with Epithelial Ovarian Cancer Progression ................................ ........ 57 Figure 9: Graphical Depiction of S3F, NP 2, and NP 1 Expression in Epithelial Ovarian Cancer Progression ................................ ........ 58 Figure 10: NP 2 Expression Occurs in Distinct Clusters o f Tumor Cells ............ 60 Figure 11: S3F Expression is Elevated in Inclusion Cysts, Paraovarian Cysts, and Fallopian Tubes ................................ ......................... 62 Figure 12: Graphical Depiction S3F, NP 2, and NP 1 Expression in Inclusion Cysts, Paraovarian Cysts, and Fallopian Tubes Compared to Normal Ovaries ................................ ...................... 63 Figure 13: Calcium mediates SEMA3F Suppres sion in I OSE and Ovarian Cancer Cells ................................ ................................ ................ 78

PAGE 9

vi Figure 14: CREB down regulates SEMA3F transcription in I OSE and ovarian cancer cells ................................ ................................ ..... 80 Figure 15: SEMA3F expression is inversely correlated with telomerase in I OSE and ovarian cancer cells ................................ ..................... 84 Figure 16: SEMA3F suppresses telomerase activity in ovarian cancer cells ................................ ................................ ............................. 86 Figure 17: SEMA3F and VEGF have opposing effects on telomerase activity ................................ ................................ .......................... 89 Figure 18: Schematic of the proposed SEMA3F signaling pathway ................... 98

PAGE 10

vii LIST OF ABBREVIATION S AS Angiostatin Bcl 2 B cell lymphoma 2 bFGF Basic Fibroblast Growth Factor BRCA1 Breast Cancer Gene 1 BRCA2 Breast Cancer Gene 2 BSA Bovine Serum Albumin CA125 Cancer Antigen 125 CaCl 2 Calcium Chloride cAMP cyclic Adenosine Monophosphate cDNA complementary Deoxyribonuclei c Acid CpG Cytosine phosphate Guanine CREB cAMP Response Element Binding Protein CsCl 2 Cesium Chloride CUB Complement like CuCl 2 Copper Chloride Cy Cystadenoma DNA Deoxyribonucleic Acid EC Endothelial Cell

PAGE 11

viii ECL Enhanced Chemiluminescence EGF Epidermal Growth Factor ELISA Enzyme Linked Immunosorbent Assay EOC Epithelial Ovarian Cancer ES Endostatin FBS Fetal Bovine Serum FHIOSE Familial History Immortalized Ovarian Surface Epithelium FIGO International Federation of Gynecology and Obstetri cs FSH Follicle Stimulating Hormone FT Fallopian Tube GAP GTPase Activating Protein GPI Glycophosphatidylinositol HCl Hydrochloric Acid Her2/neu Human Epidermal Growth Factor 2/derived from Neuroblastoma HGF Hepatocyte Growth Factor HIF 1 Hypoxia In ducible Factor 1 HOX Homeobox HRP Horseradish Peroxidase hTERT Human Telomerase Reverse Transcriptase hTR Human Telomerase RNA IC Inclusion Cyst Ig Immunoglobulin IOSE Immortalized Ovarian Surface Epithelium

PAGE 12

ix LH Luteinizing Hormone LOH Loss of Heterozygosity LPA Lysophosphatidic Acid MAPK Mitogen Activated Protein Kinase MgCl 2 M agnesium Chloride mRNA messenger Ribonucleic Acid N Normal NP Neuropilin NP 1 Neuropilin 1 NP 2 Neuroplini 2 OSE Ovarian Surface Epithelium PBS Phosphate Buffer ed Saline PC Paraovarian Cyst PCR Polymerase Chain Reaction PD Poorly Differentiated PDGF Platelet Derived Growth Factor PI3K Phosphatidyl Inositol 3 Kinase PlGF 2 Placenta Growth Factor 2 PP Primary Peritoneal PSI Plexin Semaphorin Integrin PVDF Polyvinylidene Fluoride RNA Ribonucleic Acid RT PCR Reverse Transcriptase Polymerase Chain Reaction

PAGE 13

x SDS PAGE Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis SE Standard Error SEMA3 Class 3 Semaphorin SEMA3F Semaphorin 3F Sp1 Specific Protein 1 SV 40 Simian Virus 40 TBS Tris Buffered Saline TBS T Tris Buffered Saline with Tween TVS Transvaginal Ultrasonography VEGF Vascular Endothelial Growth Factor VEGFR Vascular Endothelial Growth Factor Receptor WD Well Differentiated ZEB 1 Zinc Finge r E box Binding Homeobox 1 ZnCl 2 Zinc Chloride

PAGE 14

xi ABSTRACT Angiogenesis by either normal or neoplastic cells involves a delicate balance of both angiogenic and angiostatic regulators. In the ovary, normal physiological angiogenesis occurs around the de veloping follicle and corpus luteum in response to hormonal shifts. Interestingly, carcinomas arising from the ovary are usually highly vascularized and are commonly clinically observed to produ ce cyst fluid s or ascites which contain both angiostat ic and/or angiogenic regulators. However, in contrast to normal angiogenesis, angiogenesis associated with epithelial ovarian cancer usually produces aberrant vasculature that may promote neoplastic progression. Therefore, the ovary and ovarian cancers provide models to study the mechanisms governing the strict balance of angioregulators in both normal and tumor angiogenesis. While most studies to date have focused on angiogenic regulators for normal and aberrant angiogenesis, we investigate d the potential for dysregulation of angiostatic regulators to contribute to the etiology of epithelial ovarian cancer. Therefore, in this study we examined two angiostatic regulators angiostatin and semaphorin 3F, in epithelial ovarian cancer Angiostatin, a cleavage product of the circulating zymogen plasminogen, was isolated from serum and urine of mice bearing a Lewis lung carcinoma and

PAGE 15

xii in vivo studies have demonstrated its potent angiostatic properties. Thus, we investigated the potential prognostic/dia gnostic advantage of aberrant angiostatin expression with epithelial ovarian cancer. We found that urinary angiostatin, compared to other angioregulators in plasma or urine, could serve as an effective biomarker for early detection of epithelial ovarian c ancer, especially when used in combination with cancer antigen 125. Additionally, urinary angiostatin correlated with both recurrent disease as well as successful tumor ablation further supporting its potential as a disease biomarker. Alternative biologic al functions for the axon guidance molecule, semaphorin 3F, have been reported particularly in regard to angiogenesis, tumor progression and metastasis. However, the underlying mechanisms governing semaphorin 3F regulation and dysregulation remain unclear Therefore, we first investigated the clinical relationship between semaphorin 3F expression and epithelial ovarian cancer progression. These immunohistological studies revealed that, similar to lung cancer, semaphorin 3F expression decreased with progr ession supporting a tumor suppressor like role for semaphorin 3F. Additionally, we found that calcium, an essential cellular signaling molecule, could mediate transcriptional suppression of semaphorin 3F expression in a CREB dependent manner. Lastly, give n the antagonistic relationship between semaphorin 3F and vascular endothelial growth factor, we sought to determine whether semaphorin 3F and vascular endothelial growth factor promoted opposing effects on a common downstream target. In the course of the se studies we determined that

PAGE 16

xiii telomerase is a novel molecular target of semaphorin 3F in ovarian cancer cells such that semaphorin 3F suppresses telomerase activity while vascular endothelial growth factor promotes telomerase activity. In addition, we fou nd that the inverse relationship between semaphorin 3F and telomerase was mediated through transcriptional inhibition of the hTERT promoter by semaphorin 3F. In conclusion, this research shows that dysregulation of the angiostatic regulators, angiostatin a nd semaphorin 3F, may contribute to the etiology of epithelial ovarian cancer. In the future, dysregulation of these and other angiostatic regulators may be exploited for therapeutic intervention or as biomarkers for early detection which would allow wome n more treatment choices and hopefully, reduce the mortality associated with this insidious disease.

PAGE 17

1 CHAPTER I INTRODUCTION Ovarian Cancer Ovarian cancer is the mo st lethal gynecologic malignancy and is neither a common nor rare disease. The American Cancer Society estimates approximately 22,000 new cases of ovarian cancer in the United States in 2010 and over half, approximately 14,000, of these women will succumb to the disease ( 1 ) Over the past two dec ades advances in both cytoreductive surgery and combination chemotherapy have contributed to a modest increased overall 5 year survival. Furthermore, when cancer is confined to the ovaries, stage I up to 90% of patients can be cured with currently availa ble therapy. Unfortunately due to a lack of early symptoms and no reliable screening method, ovarian cancer Therefore, ovarian cancer represents a great clinical challenge in g ynecologic oncology.

PAGE 18

2 Epidemiology The incidence of ovarian cancer is highest in the U.S. and Europe and lowest in developing countries ( 2 ) Although the gap is narrowing, in the U.S., there is a higher frequency of ovarian cancer among Caucasian women rather than African American or Asian American women ( 2 ) Ovarian cancer is more prevalent among perime nopausal and postmenopausal women, generally occurring after the age of 40 ( 3 ) The majority of ovarian cancers are sporadic, whereas the occurrence of hereditary ovarian cancer accounts for only a small proportion (5 10%) of total cases; however, family history of disease is the most significant risk factor for ovarian cancer. Advances in molecular genetics have identified specific germline mutations in the breast cancer 1 and 2 genes (BRCA1, BRCA2) and women who harbor these alterations carry an increased susceptibility to both ovarian and breast cancer ( 4 ) Additional risk factors include early menarche, late menopause, nulliparity, estrogen, infertility, fertility drugs, obesity, and use of talc as well as other environmental factors ( 3 ) Conversely, numerous studies have identified protective factors for risk of ovarian cancer. These include use of oral contraceptives, multi parity, tubal ligation, and history of breastfeeding ( 5 7 ) Histopathology More than 90 % of ovarian cancers have been traditionally thought to arise from the simple ovarian surface epithelium (OSE) which covers the ovary ( Figure 1 ). This dynamic epithelium remains in a relatively uncommitted state with

PAGE 19

3 mesenchymal features and a propensity to undergo epithelial mesenchymal transition ( 3 8 ) As a result, in contrast to other epithelial malignancies, ovarian cancers tend to be more differentiated than the ir tissue of origin and present as morphological derivatives of coelomic epithelium of the fallopian tube, endocervix and endometrium ( 8 ) The predominant form of epithelial ovarian cancer (EOC) is denoted as serous which resembles tubal epithelium, followed by mucinous and endometriod which resemble endocervical and endometrial epithelium, respectively ( 7 ) Less common epithelial histologic subtypes of ovarian cancer include clear cell, Brenner, small cell, and undifferentiated carcinoma. Additional non epithelial types of ovarian tumors can develop from germ cells, responsible for producing ova, an d sex cord stromal cells, which generate reproductive hormones. Consequently, the variety of histological subtypes of ovarian cancer contributes to the heterogeneity of this disease ( 9 ) Furthermore, specific subtypes are associated with different degrees of aggressiveness, especially with regards to clinical characteristics, surviv al, and genetic alterations. Interestingly, a retrospective study by Hollingsworth et al. provided strong evidence of an association between the degree of tumor vascularization and overall survival ( 10 )

PAGE 20

4 Figure 1. Ovarian surface epithelium The origin of ovarian cancer has been traditionally attributed to the OSE (arrow) OSE tends to have a simple cuboidal or low columnar morphology and is separated from the ovarian cortex by a distinct basement membrane Hematoxylin and Eosin stain, Original Magnification 166x with correction factor.

PAGE 21

5 Pathogenesis The etiology of ovarian cancer remains unclear, nevertheless, several hypotheses have been proposed for the pathogenesis of ovarian cancer. First, trauma and repair, in addi tion to exposure to an estrogen rich follicular fluid, promotes the mitotic activity of OSE which increases the likelihood of genetic alterations that eventually lead to malignant transformation ( 11 ) Moreover, in vitro experiments by Nicosia et al. and Godwin et al. con firmed increased mitotic activity of rabbit OSE with chromosomal aberrations, proliferation or formation of preneoplastic lesions as a consequence of repetitive ovulation ( 12 13 ) This hypothesis is further supported by the decr eased risk for disease associated with multi parity and use of oral contraceptives, emphasizing a correlation between the number of ovulatory cycles with ovarian cancer risk ( 14 ) Second, the gonadotropin stimulation hypothesis, proposed by Stadel in 1975 and expanded by Cramer and Welch suggests that excessive exposure to the gonadotropins, pa rticularly follicle stimulating hormone (FSH) and luteinizing hormone (LH), can directly and indirectly stimulate OSE to form inclusion cysts derived from crypts or invaginations in the epithelium ( 15 16 ) FSH targets granulosa cells of the ovarian follicle, wher eas LH targets theca, granulosa, and luteal cells ( 17 ) These hormones bind specific receptors on the surface of target cells and activate intracellular second messenger signaling ( 17 ) Li kewise, in vitro studies demonstrate increased proliferation of OSE in response to both FSH and LH ( 18 ) Similar to the incessant ovulation hypothesis, this theory is further supported by the decreased ri sk for ovarian cancer associated with multi parity

PAGE 22

6 and use of oral contraceptives. In addition, this model also predicts increased risk associated with age, since levels of both gonadotropins, FSH and LH, are elevated in postmenopausal women ( 18 ) Last the M llerian system hypothesis, which as an alternative to a coelomic cell of origin, attributes the source of ovarian cancers to tissues that are primary or secondary derivatives of the Mllerian system, such as the fimb riated end of the fallopian tube ( 7 19 20 ) Histologica l similarities among epithelia lining inclusion cysts, paraovarian cysts, and fallopian tube have been well documented, as have similarities among carcinomas arising from the ovary, fallopian tube, and peritoneum ( 19 20 ) This hypothesis, then, would explain why epithelial ovarian neoplasms present as morphological derivatives of epithelia of the fallopian tube (serous adenocarcinoma), uterus (endometriod), and endocervix (mucinous adenocarcinoma) without requiring an intermediate metaplastic step ( 19 ) Molecular Alterations In general, different cell types are regulated by specific genes. Therefore, determining the impact of specific inherited or acquired genetic alterations may aid in the characterization of tumors and, thus, identification of their cell of origin. There are two classes of genes, oncogenes and tumor suppressor genes, which have been implicated in tumor pathogenesis. Oncogenes en code proteins that stimulate growth, whereas tumor suppressor genes encode proteins that inhibit proliferation of normal cells ( 21 ) In cancer, activation of proto oncogenes occurs

PAGE 23

7 in a single allele by mutation, over expression, or translocation, so that oncogenes are referred to as dominant transforming genes. Conversely, tumor suppressor genes are inactivated in cancer and are co nsidered recessive transforming genes because loss of both alleles or loss of heterozygosity (LOH) is required for neoplastic transformation ( 21 ) Several tyrosine kinases have been identified as oncogenes, h owever overexpression and/or amplification of the epidermal growth factor (EGF) and human epidermal growth factor 2 derived from neuroblastoma (Her2/ neu ) receptors are most frequently observed in ovarian tumors and are associated with a very poor prognosis ( 22 ) These receptors target phosphatidylinositol 3 kinase (PI3K), an intracellular kinase, and result in aberrant autocrine/paracrine signaling ( 23 ) Several lines of evidenc e suggest that, re expression of homeobox (HOX) genes, which regulate differentiation of Mllerian derived cells during development, may also contribute to the differentiation of ovarian carcinomas ( 23 ) Furthermore, in vitro studies indicate dif ferential expression of HOX 9, 10, and 11 in transformed mouse OSE results in serous, endometrioid and mucinous tumors, respectively ( 24 ) The most frequent genetic aberration of a tumor suppressor gene occurs in the p53 gene. Normally, p53 acts as a transcriptional regulator and is often referred to as the guardian of the genome. Investigators have identified several p53 mutations, most of which occur in highly conserved regions of the gene and are of functional importance ( 25 ) Specifically in ovarian cancer, the presence of

PAGE 24

8 tubal epithelium of women at risk of developing ovaria n carcinomas (women with BRCA mutations) and pre invasive lesions ( 26 ) Moreover, the p53 sig nature characterizes high grade serous histological subtypes ( 26 ) Although a preclinical stage has not been observed, identifying recurrent genetic mutations pendent of its cell of origin the pathogenesis of EOC remains complicated and not well understood. Detection detection method. A major prognostic factor is tumor stage at diagno sis and since most stage I ovarian cancers can be cured with conventional treatment, detection at a preclinical or early stage would have an impact on overall survival. An effective screening strategy requires a high sensitivity (true positive rate or prob ability that a subject with cancer will have a positive result), >75%, but even higher specificity (1 false positive rate or probability that a subject without cancer will show a negative result), >99.6%, in order to achieve a positive predictive value of 10% and avoid unnecessary surgery ( 27 ) Current screening strategies have centered on transvaginal ultrasonography (TVS) and tumor markers or a combination of these tw o approaches. Unfortunately, these methods alone or in combination do not satisfy the aforementioned criteria. Although, TVS can provide precise imaging of the ovaries, in practice it is incapable of distinguishing small cancerous lesions from benign ma sses ( 28 ) In

PAGE 25

9 addition, three major trials conducted in the US, UK, and Japan revealed limitations in both sensitivity and specificity ( 29 31 ) and have raised concerns about cost effectiveness. Research of potential biomarkers has largely focused on the serum tumor marker cancer antigen 125 (CA125), a large surface glycoprotein thought to play a role in epithelial cell attachment. At present, CA125 is the gold standard for ovarian cancer detection; however, it has limitations in sensitivity because only about 50% of women with stage I have an elevated CA125 level. Furthermore, CA125 lacks specificity, especially in premenopausal women, where many other conditions of the gen ital tract can produce an elevated CA125 level, for instance endometriosis. Specificity has been improved when CA125 is monitored over time or paired with TVS ( 27 32 ) but still does meet the stringent criteria for an effecti ve screening strategy. Several emerging biomarkers currently under investigation for early detection of ovarian cancer appear promising. Of particular interest due to its role in regulation of the proangiogenic cytokine, vascular endothelial growth facto r (VEGF), is the naturally occurring phospholipid, lysophosphatidic acid (LPA). Independent reports by Xu et al. and Sutphen et al. have found elevated LPA serum levels in 90% of stage I patients and elevated LPA levels in preoperative samples compared to healthy controls, respectively ( 33 34 ) Furthermore, recent reports from Anderson et al. and Badgwell et al. demonstrate significantly elevated urinary levels of B cell lymphoma 2 (Bcl 2) and mesothelin, respectively, in addition to complementarity with CA125 ( 35 36 )

PAGE 26

10 Further validation of these emerging biomarkers in combination with other markers is required and could provide a convenient, non invasive and cost effective strategy for early detection of ovarian canc er. Angiogenesis Angiogenesis is the formation of new blood vessels from pre existing vasculature ( 37 ) This process is strictly regulated by angioregulators, which are defined as endogenous factors that are angiogenic and promote angiogenesis, or angiostatic and inhibit angiogenesis. Embryonic development growth and maintenance of cells and tissues are dependent on a vascular supply ( 38 ) Although most vasculature in the ad ult is quiescent, physiological angiogenesis occurs during wound healing and prominently in the female reproductive system, pertinent to this work most notably taking place in the ovary ( 39 ) Dysfunctional or uncontrolled angiogenesis leads to several pathological conditions such as chronic inflammation ( 40 ) immunological diseases ( 41 ) and cancer ( 42 ) Elucidating which factors positively or negatively regulate this process has been a great challenge. However, ongoing research continues to unravel the intricate mechanisms involved in the tight regulation of pro and anti angiogenic signals. Angiogenesi s can be triggered by several factors including metabolic stress, especially under hypoxic conditions, as well as, mechanical forces like shear stress induced by blood flow, and genetic mutations such as, activation of

PAGE 27

11 oncogenes, like K ras. Regardless of the cause, angiogenesis involves a multi step and orderly process and initiated by the expression of angiogenic growth factors by tissues ( 37 43 ) The release of pro angiogenic factors activates receptors of the endothelium so that and endothelial cells (ECs) begin to degrade their basement membrane ( 44 45 ) Once the ECs penetrate the basement membrane they migrate towards the angiogenic stimulus ( 46 ) and endothelial sprouting is initiated. Sprout extension continues until individual sprouts join or anastomose and align with other sprouts or capillaries which results in tube formation ( 47 ) This process continues until the angiogenic factors are down regulated or are counterbalanced by angiostatic factors. Although, regulation of angiogenesis is reliant on a delicate balance of angioregulators, most research, to date, has focused on positive regulators. VEGF has emerged as the most prominent angiogenic regulator and the VEGF pathway appears highly conserved among different species ( 48 49 ) Other pro angiogenic factors include basic fibroblast growth factor (bFGF), platelet derived growth f actor (PDGF), angiopoietins, and the transcription factor hypoxia inducible factor 1 (HIF 1). Conversely, studies aimed at identifying novel angiostatic molecules and elucidating the role of these endogenous inhibitors of angiogenesis are ongoing. Howeve r, in general angiostatic regulators associate with the extracellular matrix and suppress angiogenesis by exerting inhibitory effects on EC migration or by stimulating apoptosis ( 50 )

PAGE 28

12 Ovarian Angiogenesis During the ovarian cycle angiogenesis occurs around the growing follicle and developing corpus luteum which is self limited or transient, and ceases once the cycle is complete ( 37 ) In addition, studies have demonstrated hormonal shifts contribute to alterations of the ovarian vasculature ( 51 ) Consequently, several reproductive disorders are associated with dysregulated angiogenesis and vascular regression, for example, endometriosis, polycystic ovary syndrome, and cancer. Similar to embryonic angiogenesis in the ovary angiogenesis is driven by growth factors and cytokines and mitigated by inhibitors of angiogenesis ( 52 ) Therefore, the ovary provides a physiological model to study both pro and anti angiogenic mechanisms. During follicular maturation, primary and early secondary follicles are surrounded by a single layer of capillaries. Once changes in the oocyte occur and follicular cells proliferate and become more cuboidal, blood vessels begin to appear in late secondary follicles. Ferrara et al. h ave established a critical role for the pro angiogenic factor, VEGF, and in situ hybridization reveals high levels of VEGF expression are maintained as follicles develop ( 53 54 ) As a consequence, human follicular fluid is angiogenic ( 55 ) Furthermore, in vivo studies neutralizing VEGF directly or via receptor inhibition showed marked inhibition of follicular development and a decrease in both endothelial cell proliferation and vascular area ( 55 57 ) The basement membrane keeps the blood vessels restricted to the theca layer and prevents invasion of the avascular granulose layer ( 58 ) Just prior to

PAGE 29

13 ovulation there is a surge in LH which results in vasodilation of capillaries in addition to an increase in vascular permeability, tissue edema, and ischemia ( 59 ) At ovulation, the breakdown of the basement membrane occurs in association with intense angiogenesis, concurrently the blood vessels invade the resulting corpus luteum. More than 75% of cells are of vascular origin in the matu re corpus luteum ( 60 ) and it receives one of the highes t blood supplies per gram of tissue than any other organ ( 61 ) Interestingly, the corpus luteum demonstrates angiogenic activity when transplanted into the hamster cheek pouch and rabbit cornea ( 39 62 63 ) Tumor Angiogenesis Folkman first hypothesized that tumor grow th is dependent on angiogenesis ( 64 ) Indeed, tumors cannot grow more than 1 2 mm in size unless they recruit their own blood supply. Like normal physiological angiogenesis, t o satisfy this requirement, neoplastic cells produce angiogenic factors namely VEGF, which stimulate formation of new blood vessels from the endothelium of the pre existing vasculature. However, in contrast to the angiogenesis that takes p lace in the ovary, once tumor angiogenesis is initiated it continues indefinitely and only ceases when the tumor is completely ablated or the host dies ( 37 ) which indicates an imbalance of angioregulators in favor of angiogenic factors and, thus, initiation of tumor angiogenesis Using in vivo model system Gullino et al. have demonstrated that angiogenic activity occurs prior to neoplastic

PAGE 30

14 transformation ( 65 ) even in the absence of morphological changes ( 66 67 ) Therefore, the angiogenic switch, serves as a control point for most solid tumors, includin g highly vascularized ovarian neoplasms Although, tumor angiogenesis parallels normal physiological angiogenesis, distinct differences in the intrinsic vasculature morphology and functionality are evident. For instance, certain tumors demonstrate structural alterations in their capillary networ ks such as fenestrations in ECs and blind ends, in addition to occasional interruptions in the basement membrane ( 68 69 ) and extensive tortuosity reflective of vascular compression. Furthermore, the so called leaky vessels of tumor vasculature appear due to constant exposure to VEGF which incr eases in vascular permeability. Distorted tumor vasculature is a direct result of dysregulated angiogenesis and is compounded by a continual outgrowth of the blood supply. Alternative to traditional angiogenesis, vasculogenic mimicry suggests that in add ition to ECs, pluripotent embryonic like and highly aggressive tumor cells contribute to neovascularization in tumors ( 70 ) Ovarian cancers have a propensity to be highly vascularized and often metastasize to the peritoneal lining. Additionally once these tiny implants be come vascularized, ascit es accumulates in the abdomen, a clinical obs ervation of progression ( 71 ) Nicosia and colleagues have reported elevated levels of the angiogenic regulators, VEGF and HGF, in patients with benign ovarian cysts or functional cysts and patients with malignant tumors ( 72 ) Moreov er, in contrast to ascites ovarian cyst fluid contains VEGF and demonstrates angiogenic pro perties ( 72 ) Counter intuitively, angiostatin (AS) (see below) and other anti

PAGE 31

15 ang iogenic plasminogen cleavage products are also present in malignant ascites fluid and contribute to its net angiostatic properties ( 73 ) Therefore, since ovarian cancers are associated with the production of ascites and cyst fluids which contain positive and/or negative angioregulators, evaluation o f angioregulators in bodily fluids may be clinically relevant for ovarian cancer. Angiostatin et growth of residual tumors following surgical removal of primary tumors. Therefore, they postulated that although a primary tumor can stimulate angiogenesis locally, it is capable of inhibiting a secondary tumor at a distant site ( 74 ) Inhibition of the distant metastasis was hypothesized to be a consequence of an unbalanced production of both positive and negative angioregulators by the primary tumor, where angiogenic regu lators could promote angiogenesis of the primary tumor and angiostatic regulators could suppress metastatic growth. In an effort to elucidate the phenomenon of inhibition of tumor growth by tumor iostatic regulator, AS. Interestingly, AS was purified from the serum and urine of mice bearing a Lewis lung carcinoma and supports the concept of tumor dormancy whereby, AS generated by the primary lung tumor diffused into circulation and inhibited a di stant metastatic growth ( 74 ) AS, is a 38 kDa internal cleavage product of the circulating zymogen, plasminogen (Figure 2) ( 74 ) Paradoxically, AS is generated via proteolytic

PAGE 32

16 cleavage by proteinases which a re activated in response to an angiogenic signaling cascade. Production of AS, then, illustrates the obligatory coupling of angiogenic and angiostatic regulators as a consequence of normal physiological angiogenesis. AS was originally described to contai n the first four kringle domains of plasminogen. However, several studies have confirmed that a variety of proteases are able to cleave plasminogen creating different isoforms of AS with markedly different anti angiogenic activity based on the presence of specific kringle domains ( 75 ) For instance, kringle 5 appears to possess more potent angiostatic activity than other kringle domains, so that AS isoforms containing kringle 5 are more effective inhibitors ( 76 77 ) Functionally, AS inhibits migration and proliferation of ECs, most likely through its cell surface receptor ATP synthase ( 78 ) Consequently, delineatin g the molecular mechan isms involved in production, regulation and dysregulation of AS may be clinical ly useful for therapeutic intervention.

PAGE 33

17 Figure 2 Schematic of angiostatin structure and generation by proteolytic cleavage of plasmin and plasminogen. The asterisks indicate where plasminogen activators (urokinase and tissue plasminogen activator) cleave the zymogen to yield plasmin, an active fibrinolytic serine proteinase. Plasmin undergoes autoproteolysis in the presence of a free sulfh ydryl donor to yield ( 74 )

PAGE 34

18 Axon Guidance and Angiogenesis The fundamental principles of blood vessel and nerve fiber growth involve sprouting, migration, and proliferation of ECs and axons, respectively in response to concentration gradients. These networks develop in response to common attractive and repulsive guidance cues, such as semaphorins which bind to cellular receptors to facilitate regulation. Consequently, specialized ECs and axons, identified as tip cells and growth cones, respectively, undergo cytoskeletal rearrangement and extend filopodia to become motile and invasive ( 79 80 ) Intriguingly, many genes thought to be specific to neurons also play a role in angiogenesis, suggesting a developmental similarity between nervous tissue and vasculature. This is further supported by the observation that blood vessels and nerve fibers often align in parallel in order to provide oxygen and nutrients to the periphera l nervous system and arterial innervation ( 79 81 ) Therefore, further investigation of these multifaceted cues may identify a novel angiostatic regulatory mechanism. Semaphorins Semaphorins are a large family of cell associated proteins. Although, initially identified to be involved in axon guidance and growth cone collapse, semaphorins have been found to be widely expressed outside the nervous system. There are eight classes of semaphorin genes and more than 30

PAGE 35

19 members, which are implicated in several biological functions including cell adhesion, migration, and angiogenesis ( 82 ) Semaphorins are divided based on structure: classes 1 and 2 consist of invertebrate semaphorins, whereas classes 3 to 7 comprise vertebrate semaphorins and class V consists of semaphorins encoded by viral genomes. All semaphorins are characterized by a c onserved 500 amino acid, cysteine rich, for signaling ( 82 ) The sema domain has a seven propeller motif and integrins ( 83 ) Additionally, semaphorins contain a putative cysteine rich protein binding domain known as a plexin semaphorin integrin (PSI) domain located adjacent to the sema domain ( 84 ) Class 3 semaphorins are unique in that they are the only secreted family members and are further distinguished by the presence of a basic C terminal domain which is required for receptor binding (Figure 3). Class 4 7 semaphorins are anchored to the membrane and distinguished by structural features that in clude immunoglobulin like domains, thrombospondin repeats (class 5), or a glycophosphatidylinositol (GPI) anchor (class 7). Receptors There are two classes of high affinity receptors for semaphorins, plexins and neuropilins (NPs) ( 85 87 ) In humans, plexins are divided into four subfamilies (A,B, C, D) and expression is ubiquitous, whereas invertebrates only have two plexin genes which are more exclusively expressed in the nervous

PAGE 36

20 tissue ( 86 ) extracellular moiety in addition to 3 4 PSI domains ( Figure 3). Although, the putative cytoplasmic domain of plexins lacks endo genous tyrosine kinase activity, this segment has demonstrated a weak intrinsic GTPase activating protein (GAP) which facilitates R ras inactivation ( 88 ) Most class 4 7 semaphorins directly bind to plexins and acti vate plexin mediated signal transduction. In contrast to other types of semaphorins, class 3 semaphorins (SEMA3s) are unable to directly bind plexins and, therefore, utilize the NPs, NP 1 and NP 2, as co receptors, with the exception of SEMA3E. NPs are only expressed in vertebrates and are single span transmembrane glycoproteins characterized by two extracellular complement like (CUB) domains (designated a1/a2 domains) as well as, two FV/FVIII coagulation factor like domain (designated b1/b2 domains) and a meprin like MAM domain (designated as c domain) ( Figure 3) ( 85 86 89 ) NPs have a relatively short cytoplasmic domain and no signaling consensus sequence has been identified. Interestingly, although the NPs do not interact w ith membrane bound semaphorins, they serve as co receptors for VEGF family members where signal transduction is facilitated via activation of tyrosine kinase receptors, vascular endothelial growth factor receptor 2 (VEGFR2) and vascular endothelial growth factor receptor 3 (VEGFR3) ( 89 92 ) Additionally, NPs also interact with other heparin dependent ligands such as, bFGF, placenta growth factor 2 (PlGF 2) and hepatocyte growth factor (HGF) ( 93 ) However, the interaction between

PAGE 37

21 VEGF family members and NPs suggests a potential role in vascular and tumor biology for NPs in addition to their SEMA3 ligands. In contrast to most biological signaling pathways which are unidirectional, semaphorin signaling is bidirectional, occurring in an autocrine or paracrine manner. These guidance cues operate in a mode similar to that of a traffic sign, harboring the ability to provide two alternative signals, specifically inhibition or induction of cell motility. The underlying mechanisms driving semaphorin signaling are unclear, studies suggest that this dyn amic signaling is dependent upon the oligomerization of specific receptors and distinct downstream molecular pathways ( 94 ) Although counter intuitive, this bi directional semaphorin signaling is similar to the action of angiogenic and angiostatic regulators governing angiogenesis. Consequently, bidirectional semaphorin signaling and/or its dysregulation have implications for cell motility and invasion, and especially as that pertain to tumor angiogenesis and may promote tumor progression. Class 3 semaphorins In recent years, the putative role of SEMA3 signaling has expanded beyond the nervous system. SEMA3s are approximately 100 kDa and consist of seven soluble proteins designated SEMA3A G ( 95 ) As secreted proteins, SEMA3s specifically target cells expressing NPs, most notably neurons, ECs, epithelial cells (like OSE) and tumor cells. As a result, SEMA3s involved in axon guidance and angiogenic VEGF family members share NP receptors. There is a

PAGE 38

22 high degree of specificity in binding between the NPs and their ligands. NP 1 has a higher affinity for SEMA3A, in addition to VEGF 165 PlGF 2, HGF whereas NP 2 has a higher affinity for SEMA3F, SEMA3G and VEGF 145 However, SEMA3B, SEMA3C, VEGF 165 and VEGF 121 can bind either NP receptor ( 85 86 89 91 93 96 101 ) SEMA3E is the only SEMA3 that does not bind NP receptors, however, it does directly bind to Plexin D1 ( 102 ) C onsequently, inter relationships between axon guidance SEMA3s and angiogenic VEGF with NP, VEGFR, and plexin receptors potentially regulate a wide range of signaling pathways involved in cell adhesion, migration, tube formation, sprouting, permeability, an giogenesis, and metastasis. For instance, SEMA3A initially identified to repel axon movement also inhibits EC and tumor cell motility ( 103 104 ) Clearly, investigating the mechanisms governing the molecular cross talk between the variety of cellular mechanisms influenced by SEMA3 signaling has potential prognostic and therapeutic impli cations.

PAGE 39

23 Figure 3. Schematic representation of class 3 semaphorins and receptors, neuropilins and plexins, structure. SEMA3s function in a paracrine manner which is mediated through specific binding of SEMA3s to NP receptors on the surface of target cells followed by complexing with another transmembrane receptor family, known as Plexins, and subsequent activation of intr acellular signaling pathways.

PAGE 40

24 Semaphorin 3F Semaphorins have been studied extensively in vertebrates, and was initially identified to play an important role in brain development as a potent chemo repellant to axonal extensions and neuronal migration ( 105 ) Current research has established additional biological functions for SEMA3F outside the nervous system, most notably in regard to angiogenesis, as well as tumor progression and metastasis. In fact, the SEMA3F gene was originally isolated from 3p21.3, a region known to be deleted in lung, breast, and ovarian cancers ( 106 107 ) (remove 106 and replace with 1996 Roche Oncogene #158) Exogenous SEMA3F expression in tumor cells resulted in reduced tumor formation in nude mice thereby implicating SEMA3F as a tumor suppressor ( 108 ) Since SEMA3F and VEGF share a common receptor, several studies have investigated the antagonistic relationship between SEMA3F and VEGF which is attributed, in part, to ov erlapping ligand binding regions in the b1/b2 extracellular domains of both NPs (Figure 3). In a lung cancer cell line, Roche et al. have suggested, in addition to competition for binding, that an alternative mechanism driving the angiostatic activity of SEMA3F is down regulation of VEGF mRNA via inhibition of HIF ( 109 ) Likewise, immunohistological studies indicate a loss of SEMA3F expression with advanced stage of disease and while VEGF expression is increased ( 110 ) Furthermore, in ovarian cancer the ratio of VEGF to SEMA3 may have potential prognostic implications, such that patients with a higher VEGF/SEMA3 ratio are associated with poorer survival compared to patients with a lower VEGF/SEMA3 ratio ( 111 )

PAGE 41

25 Although several signaling pathways are affected by SEMA3F, including inactivation of the mitogen activated protein kinase (MAPK) and Akt pathways, regulation of SEMA3F remains unclear ( 109 ) Interestingly, there is some evidence suggesting that p53 and/or the transcription factor zinc finger E box binding homeobox 1 (ZEB 1) may be involved ( 112 113 ) In summary, considering the inter relationships and parallels during axon guidance and angiogenesis, further studies are warranted to elucidate the molecular mechanisms regulating SEMA3F function and dysregulation, especially as they impact ovarian tumo r formation and progression. Central Hypothesis Dysregulation of angiostatic regulators plays a role in ovarian cancer. Specific Aims Ovarian cancers develop into morphologically complex, highly vascularized structures. Although, the role of an g io genic regulators has been well documented the role of angiostatic regulators has been understudied. Therefore, this study examined two angiostatic regulators, angiostatin and semaphorin3F, in ovarian cancer. Three specific aims were proposed to address t his hypothesis:

PAGE 42

26 1) Evaluate the sensitivity and specificity of urinary angiostatin as a potential biomarker for ovarian cancer. 2) Establish the clinical relationship between semaphorin3F expression and ovarian cancer progression. 3) Expand upon the antagonisti c relationship between VEGF and semaphorin3F, by examining semaphorin3F regulation and semaphorin3F mediated telomerase activity in ovarian cancer cells.

PAGE 43

27 CHAPTER II URINARY ANGIOSTATIN LEVELS ARE ELEVATED IN PATIENTS WITH EPITHELIAL OVARIAN C ANCER Abstract The poor prognosis associated with EOC is due to the lack of overt early symptoms and the absence of reliable diagnostic screening methods. Since many tumors over express angiogenic regulators, the purpose of this study was to determine whether elevated levels of the angiogenic or angiostatic molecules VEGF HGF endostatin (ES), and AS were elevated in plasma and urine from patients with EOC. VEGF, HGF, ES and AS were assayed by ELISA in samples from pilot cohort consisting of healthy women (N=4 8; pre menopausal N=23, post menopausal N=25), women with benign gynecological disease (N=54), patients with primary peritoneal cancer (PP) (N=2) and EOC (N=35). Wherever possible, parallel serum samples were measured for CA125 levels by ELISA. AS was the angioregulator that independently discriminated EOC patients from healthy individuals. Levels of urinary AS (uAS) from healthy individuals or

PAGE 44

28 women with benign gynecological disease averaged 21.4 ng/mL3.7 and 41.5 ng/mL8.8, respectively. In contrast, uAS averaged 115 ng/mL39.2 and 276 ng/mL45.8 from women with Stage I (N=6) and late stage (N=31) EOC, respectively. Further, uAS was elevated in EOC patients regardless of tumor grade, stage, size, histological subtype, creatinine levels, menopausal sta tus, or patient age, but appeared to complement CA125 measurements. Levels of AS are elevated in the urine of patients with EOC and may be of diagnostic and/or prognostic clinical importance. Further studies of uAS as a biomarker for EOC alone or in combi nation with other markers are warranted. Introduction EOC is the most lethal gynecologic neoplasm. In 2009, it will strike over 21,000 women, seventy percent of whom will be first diagnosed at advanced stage ( 114 ) As a result, less than 50 percent of patients are alive five years after initial diagnosis. In order to detect early stages of EOC and avoid unnecessary surgery screening strategies requ ire a sensitivity >75% and a specificity of 99.6% ( 27 115 ) Currently, three screening procedures are in use fo r EOC detection: bimanual pelvic examination, serum CA125 and transvaginal ultrasonography (TVS) ( 27 115 ) Pelvic examination is an important part of routine gynecologic examination but lacks sensitivity and specificity. Although CA125 is elevated in 80 percent of patients with EOC, its use as an early predictor of malignancy is

PAGE 45

29 limited because only half t he patients with stage I disease have elevated CA125 levels. In addition, CA125 lacks specificity as a screening procedure being elevated in a significant number of healthy women or in patients with benign ovarian lesions. The pairing of TVS with CA125 i mproves specificity, although the former procedure is not practical for cancer screening because of its potential for false positive results and unnecessary surgery. Unfortunately, these strategies alone or in combination do not satisfy the aforementioned criteria. Pairing of multiple markers and clinical symptoms is also being explored with promising, but yet unresolved clear advantages over CA125 toward early diagnosis ( 61 116 117 ) Molecular alterations that occur in the early or recurrent cancer may serve as biomarkers of tumor growth and progression and may provide new approaches to detect EOC. During the early tumor development, cells acquire the capacity to stimulate angiogenesis ( 53 ) For instance, a primitive blood capillary with its surrounding fibrocollagenous stroma is found at the bas e of incipient papillae of ovarian serous neoplasms ( 118 ) Experimental tumors cannot grow more than 2 to 3 mm in size unless they are vascularized. To satisfy this requirement, neoplastic cells produce angiogenic factors which stimulate formation of new vessels from the endoth elium of the preexisting host vasculature ( 119 ) The switch to an angiogenic phenotype during the early stages of tumor progression is fashion ( 119 ) may contribute to the early detection of EOC The angiogenesis de pendent nature of

PAGE 46

30 tumor growth is particularly relevant for this cancer which can reach large proportions and correlations between microvascular density and tumor aggressiveness have been established ( 120 ) Thus, analysis of angiogenic factors that regulate EOC growth and progression may have important implications for the diagnostic and prognostic evaluation of this disease. Our lab previously reported that the cyst fluid of EOC con tains large amounts of VEGF ( 72 ) VEGF and basic fibroblast growth factor (bFGF) levels were evaluated in patients with benign ovarian cysts, functional cysts, borderline tumors, and patients with malignant tumors. There was a marked difference in VEGF levels between malignant cysts and benign, borderline or functional cysts. Malignant neoplasms had an a verage 26 fold increase in VEGF over benign lesions and a 6 fold increase over borderline tumors. Unlike VEGF, bFGF was generally very low or undetectable in malignant cysts and did not correlate with malignancy. We also found that VEGF levels in ovarian cyst fluid were 3 fold higher in 6 patients with evidence of disease 1 2 years after surgery (~50 ng/mL) as compared to 7 patients with no evid ence of disease (~18 ng/mL) ( 72 ) Consequently, evaluation of circulating or excreted angiogenic and/or angiostatic markers may be clinically relevant for EOC. Other studies have also shown that high intratumoral concentrations of VEGF and other ang iogenic cytokines, such as HGF may be reflected by elevated levels in peripheral blood, in urine and in effusions of patients with a wide spectrum of cancers, including EOC ( 121 124 ) Malignant tumors also generate small inhibitors of a ngiogenesis such as ES AS and thrombospondin ( 73 125 128 )

PAGE 47

31 Additionally, ES and AS have been reported at detectable levels in urine of patients with malignant disease and could, therefore, provide biomarkers for cancer ( 129 131 ) Given these reports along with our earlier finding of elevated VEGF in th e cyst fluid of EOC ( 72 ) we sought to determine if plasma and urinary levels of the angioregulators VEGF, HGF, ES, and AS correlate with EOC disease status. Methods and Materials Patient cohort With prior institutional approval, urine and blood samples were collected from a cohort of healthy pre menopausal (N=23) and post menopausal (N=25) individuals, women with benign gynecologic disorders (N=54) and patients with EOC (N=35) or primary peritoneal (PP) cancer (N=2) at the H. Lee Moffitt Cancer Center and Tampa General Hospital in collaboration with the University of South Florida. Two cases designated as low malignancy potential (LMP) tumors were also evaluated. All except 8 specimens were collected prior to initial surgical cytoreduction while the latter 8 specimens presented with recurrent disease at the time of enrollment in thi s study. In addition to EOC, the cancer category consisted of women diagnosed PP cancer, which is often related to EOC. The samples collected from women with benign disease consisted of a broad range of ovarian and non ovarian genital tract (GT) lesions (Table 1). Tissue blocks were identified and reviewed by SVN to confirm the histopathology of benign and malignant lesions, the latter according to FIGO

PAGE 48

32 criteria. The clinical databases of these women were also reviewed and information regarding patient a ge, tumor type, stage, grade, size, CA125 values and surgical and adjuvant treatment abstracted whenever available. This information and tumor pathology were correlated with plasma and urinary levels of angioregulators, which are summarized in Tables 1 an d 2, in a total of 141 women. Sample preparation Urine and blood samples were collected from patients, anonymized and decoded to protect patient identity, and released from the tissue banks for this research project. All samples were kept on ice followin g collection. Urine (2 aminoethyl) ours of collection and centrifuged at 3000g. Urinary supernates and plasma samples were then aliquoted and ears without change in activity. Enzyme linked immunosorbant assay Angiogenic molecules were assayed using quantitat ive sandwich enzyme linked immunosorbant assay (ELISA) kits for VEGF, HGF, and ES (all kits from R uAS was assayed using lysine ELISA as described previously by Cao et al ( 129 )

PAGE 49

33 In accordance with previous studies ( 129 ) uAS threshold levels were set to include 95% of AS values of urine samples from healthy women. were assayed by individual ELISA tests (Bio Quant, San Diego, CA) according t o nm or 492 nm using a Dynex MRX plate reader (Dynex Technologies, Chantilly, VA) and results were expressed as the mean absorbance of triplicate samples S.E. for VEGF, HGF, E S, while CA125 and AS results were expressed as the mean of duplicate samples.

PAGE 50

34 Table 1. Histological diagnoses and clinical characteristics of the study cohort. Sample Cancer Pathological Parameters Age mean SE AS mean ng/ml SE Healthy (48) 53.5 1.7 21.4 3.7 Pre Menopausal (23) 44 1.6 21.4 5.8 Post Menopausal (25) 62 1.2 21.4 4.9 Benign (54) 54.9 2.0 41.5 8.8 Cysts (12) 43.7 18.9 Papillomatosis (1) 180 Fibroma/Adenofibroma (8) 25.2 9.6 Teratoma (3) 15.6 0 Serous Cystadenoma (12) 74.4 29.8 Muscinous Cystadenoma (2) 15.62 Genital Tract Lesions (16) 22.9 5.1 Cancer (37) 63.1 2.2 247 37.6 Mucinous (7) 274 129.3 Endometriod (1) 15.62 Serous (27) 251 39.9 LMP (2) 126 Grade 1 (9) 272 105 Grade 2 (10) 189 42.3 Grade 3 (18) 269 53.2 Stage I (6) 115 39.2 Stage II (1) 208 Stage III (20) 246 49.2 Primary Peritoneal (2) 59 216

PAGE 51

35 Western blot analysis For Western blot analysis, plasma samples were solubilized in SDS gel mercaptoethanol), separated via 10% SDS PAGE and electroblotted onto PVDF membranes by wet transfer. Immunoblotting was performed using antibodies d irected against the kringle 1 3 regions of human plasminogen ( 1:1000, R & D actin ( 1:10,000, Sigma Aldrich, St. Louis, MO) was used as a loading control. Blots were visualized using the ECL Western Blotting Analysis System (A mersham Pharmacia Biotech, Piscataway, NJ) with ImageQuant image analysis software (GE Healthcare Bio Sciences Corp., Piscataway, NJ). Values reported for AS were normalized to actin levels. Statistical analysis Samples for VEGF, HGF, and ES were run in triplicate, whereas samples for CA125 and AS were run in duplicate and the data subject to descriptive, one way Kruskal Wallis, Spearman correlati on, and/or receiver operator curve and area under the curve (ROC AUC) analyses. P values <0.05 were consi dered statistically significant.

PAGE 52

36 Results uAS levels are elevated in EOC patients We evaluated the levels of VEGF, HGF, and ES in the plasma and ur ine of healthy controls and of patients with benign gynecologic disorders or EOC; uAS was also evaluated. Kruskal Wallis global test indicated seriousness of clinical status (EOC > benign lesions > healthy status) correlated with plasmatic and uAS (p < 0.0001) (Figures 4, 5 A, Table 2). uAS was the variable that independently discriminated EOC patients from healthy controls. Although there have been some studies reporting the detection of non ovarian cancers by measuring various proteins in urine, only few reports have been recently published relative to EOC detection in this biological fluid ( 35 123 129 ) and to our knowledge this is the first report of AS as a biomarker of EOC. Since plasminogen interfered with the measurement of plasmatic AS by ELISA, plasmatic AS was detected in representative sam ples (6/group) by Western immunoblotting and did also appear to correla te with disease status (Figure 5 B). We believe uAS is better because renal filtration allows smaller, positively charged fragments of plasminogen, like AS, but not its higher molecular weight precursor, to be excreted in urine. In addition, creatinine levels measured at the time of urine collection indicated that elevated uAS in cancer patients was not related to renal dysfunction (data not shown).

PAGE 53

37 Table 2. VEGF, HGF, ES, and AS in the Study Cohort as Descriptive Statistical Information Angiogenic Factor # Mean SE Median M in, Max Chi Square p value P U P U P U P U P U P U VEGF (pg/mL) Normal Benign Cancer Global Test Normal v Benign Normal v Cancer Benign v Cancer 24 54 39 117 78 61 91 33.65 52.72 89.28 47.5 57 86.52 1.92 5.37 17.97 4.51 4.49 12.3 31.2 31.2 44 42.5 39.5 60 31.2, 77 31.2, 225 31.2, 550 24, 112 31.2, 152.73 31.2, 395 12.81 6.31 11.93 3.12 10.2 0.43 6.12 4.35 0.0016 0.012 0.0006 0.0773 0.01 0.51 0.01 0.04 HGF (pg/mL) Normal Benign Cancer Global Test Normal v Benign Normal v Cancer Benign v Cancer 24 54 39 117 78 61 91 591.44 650.39 1566.3 565 496 994 42.29 41.68 528.7 89.2 38.8 136.4 565 598.8 900 375 385 760 220, 1177 119.2, 1450 260, 16000 250, 1664.3 25, 1160 250, 4026.3 12.37 0.13 12.51 5.86 12.9 0.11 6.76 10.7 0.0021 0.7168 0.0004 0.0155 0.0016 0.7409 0.0093 0.0011 ES (ng/mL) Normal Benign Cancer Global Test Normal v Benign Normal v Cancer Benign v Cancer 24 54 3 117 78 61 91 19.99 16.46 25.51 8.49 8.44 11.38 0.51 0.92 2.81 1 0.67 1.58 19.87 16.4 22 7.5 7.4 10 15.01, 24.57 7.03, 36.8 7.8, 109 3.9, 19 3.6, 19 3.9, 62.5 12.81 6.31 11.93 3.12 10.2 0.43 6.12 4.35 0.0016 0.012 0.0006 0.0773 0.01 0.51 0.01 0.04 AS (ng/mL) Normal Benign Cancer Global Test Normal v Benign Normal v Cancer Benign v Cancer 24 54 39 117 78 61 91 ND ND ND 21.1 41.5 241 ND ND ND 5.5 8.8 36 ND ND ND 15.62 15.62 192 ND ND ND 15.62, 148 15.62, 336 15.62, 1000 ND ND ND ND 59.64 2.83 33..39 42.14 ND ND ND ND <0.0001 0.0926 <0.0001 <0.0001 P, plasma; U, urine; ND, not determined

PAGE 54

38 Figure 4 Plasma and urinary levels of angiogenic regulators are elevated with EOC progression. ELISA was utilized to measure (A.) VEGF (mean pg/ml S.E.), (B.) HGF (m ean pg/ml S.E.) and (C.) ES (mean ng/mL S.E.) in the plasma and urine of healthy volunteers (N=24) and of patients with benign gynecologic disorders (N= 54) or EOC (N= 39). Samples were examined in triplicate and the data expressed as mean S.E/categ ory (normal purple benign pink cancer green ). Lined bars plasma; Solid bars

PAGE 55

39 Figure 5 AS levels are elevated in EOC patients. (A.) uAS was evaluated using lysine ELISA. Samples were examined in duplicate and the data expressed as mean ng/mL S.E. per category. Healthy individuals were further divided based on menopausal status (inset). (B.) Plasmatic AS was detected in representative samples (6/category) by Western immunoblotting using a monoclonal antibody against the kringl e 1 3 regions of human plasminogen. Densitometric analyses are expressed as relative intensity of plasmatic AS levels normalized to actin protein levels. N ormal purple; B enign pink; C ancer green; Lined bars plasma; Solid bars

PAGE 56

40 Clinical status Based on the initial findings of a better discriminating effectiveness of AS, we expanded our analysis with regards to clinical parameters in this cohort of healthy controls, women with benign gynecologic disorders and patients with EOC. Though this cohor t comprises a small pilot study, it is representative of our institutional clinical practice in regard to EOC histology, grade and stage distribution. The amount of uAS was generally negligible (average of 21.4 ng/mL3.7; 95% confidence interval = 13.9 2 8.9) in healthy controls regardles s of menopausal status (Figure 5 A inset) with only 8% of samples above a previously established cutoff threshold of 16 ng/mL for uAS in normal individuals ( 129 131 ) (Figure 5A Table 1). In contrast, uAS associated with EOC and PP cancer was generally >10x than found in healthy controls with an overall mean value of 249 ng/mL39.7 and 216 ng/mL, respectively (95% confidence interval of al l cancers = 171 323.5) (Figure 6 A, Table 1). Interestingly, 5/37 and 3/37 of EOC patients were derived from patients with mucinous ovarian cancer and one was derived from endometrio id ovarian cancer (Figure 6A).

PAGE 57

41 Figure 6 uAS levels are elevated in EOC patients. Urinary samples were analyzed in duplicate by lysine ELISA and data expressed as mean ng/mL per patient in (A.) healthy controls and cancer histological types (muc, mucinous; serous, serous adenocarcinoma; PP, primary peritoneal) as well as serous tumor grade; (B.) according to tumor stage including recurrent EOC, grade and size and (C.) among women with benign ovarian and non ovarian genital tract (GT) lesions; 2 cases of LMP were also included. Mean uAS (ng/mL) indicated for ea ch category. ROC AUC analyses of uAS in EOC vs (D.) healthy controls and (E.) women with benign gynecologic diseases.

PAGE 58

42 The distribution of uAS was evaluated by histological EOC subtype, including serous carcinomas representing over 75% of the pilot coho rt. There was a trend for elevated uAS with increasing tumor grade (189 ng/mL42.3 for Grade 2 neoplasms to 269 ng/mL53.2 for Grade 3 carcinomas) and especially stage (115 ng/mL39.2 for Stage I to 208, 246 ng/mL49.2, and 333 ng/mL90.5 for Stages 2, 3, and recurrent respectively) although these were not st atistically different (Figures 5A, 6 A B). Of interest, on average, uAS levels of Stage I EOCs were 5 and 3 fold higher than in healthy controls or women with benign disease, respectively; likewise, al was 2 fold lower than late stage EOC (Figures 5A, 6 B). Similarly, there was a non statistical tendency for elevated uAS with tumor size (108.7 ng/mL34.9, 393.3 ng/mL112.2, 247.6 ng/mL42.3, fo r microscopic, <2 cm, an d >2 cm, respectively) (Figure 6 B). In contrast, patient age did not appear to be related to elevated uAS (Table 1). uAS was also analyzed in women with benign ovarian lesions or non ovarian GT lesions (Figure 6 C, Table 1). uAS in patients with benign ovarian ng/mL and 7/54 samples with levels ranging from 64 to 176 ng/mL (95% confidence interval = 24.9 73.9) (Figure 6 C). Interestingly, the 3 highest uAS va lues were noted in 1 case of serous surface papillomatosis and 2 serous cystadenomas; unfortunately, these were blinded samples and follow up information on these patients was not available.

PAGE 59

43 ROC analyses indicated sensitivity and specificity of uAS for distinguishing healthy controls from cancer patients as 88% a nd 92.3%, respectively (Figure 6 D). Additionally, the set cutoff threshold (16 ng/mL) was >90% accurat e with an AUC of 0.953 (Figure 6 D). Sensitivity and specificity for distinguishing ben ign samples from cancer patients were 84.1% and 84.4%, respectiv ely (Figure 6 E), while the set cutoff threshold of 80 ng/mL as determined by a 95% confidence interval was 83% accura te with an AUC of 0.88 (Figure 6 E). Levels of uAS were also compared in 1 1 patients immediately prior to and within 3 weeks following initial cytoreductive surgery (Figure 7 A); no chemotherapy was administered during this interval. uAS decreased to control levels in those patients (# 17, 21, 22 and 42) in which chart review indicated successful tumor ablation and to a lesser extent in suboptimally debulked patient # 40. A postoperative increase was observed in patient # 20 who developed ascites. Urinary samples were also collected in patients # 5, 27, 43, 49 and 51 at 7 and /or 12 months after initial surgery (Figure 7 A). In these 5 patients, uAS was indicative of resistant (# 5, 43 and 51) or sensitive (# 27 and 49) disease. These data suggest, then, that uAS levels may correlate with surgical debulking and/or recurrent EOC and warrant further investigation.

PAGE 60

44 Figure 4. Elevated uAS correlates with recurrent EOC and complements CA125 measurements. (A.) uAS was evaluated by lysine ELISA before and after surgery in 11 patients. Samples were examined in duplicate an d data expressed as mean ng/mL per patient. A 3 weeks after surgery, B 7 months after surgery, and C 12 months after surgery. (B.) uAS and blood levels of CA125 were measured from the same healthy controls and EOC patients (muc, mucinous; serous, sero us adenocarcinoma; PP, primary peritoneal) prior to initial cytoreductive surgery. uAS data expressed as mean ng/mL per patient and CA125 data expressed as mean U/mL per patient. False positive or False negative

PAGE 61

45 Elevated uAS levels complement CA125 values While studies continue to identify EOC biomarkers ( 132 133 ) CA125 pelvic examination. CA125 is useful in the follow up of EOC patients after surgical and chemotherapeutic management but it s value in early detection and ( 27 ) and to the fact that this malignancy is neithe r rare nor frequent ( 115 ) While nearly 2/3 of patients with clinical disease will have elevated CA125 levels, less than 50% of early stage EOC will be detected by CA125. Therefore, in this initial evaluation, we compared uAS to CA125 levels in 12 healthy controls and 23 cancer patients to address the potential for uAS to serve as a biomarker for EOC (Figure 7 B). Elevated uAS (>16ng/mL) was associated with 88% EOC detection, correctly identifying 15/17 serous, 3/4 mucinous and 2/2 PP carcino mas in cancer patients (Figure 7 B). In contrast, CA125 levels (>35 U/mL) from matched samples was associated with only 74% EOC detection, correctly identifying 13/17, 3/4, and 1/2 of patients with serous, mucinous and PP cancer, respective ly, as ca ncer positive (Figure 7 B). All healthy controls were correctly classified as cancer negative by uAS (<16 ng/mL) whereas 2/12 healthy controls were incorrectly identified as cancer positive by CA125 (Fi gure 7 B). In addition, PPV and NPV were 09.23 and 0.83 6, respectively; and 95% confidence intervals were 133.5 316.6 ng/mL for uAS and 97.6 285.8 U/mL for CA125. Lastly, 0.0007 between uAS and CA125. Therefore, there is evidence of a statistically

PAGE 62

46 significant positive correlation indicative of complementarity between uAS and CA125 in the ability to detect ovarian cancer. Further, EOC could be detected in 91.3% (21/23) of samples when using the criteria that one or both of these bio markers were elevated. Discussion While angiogenesis is an essential biological process for embryonic development and normal physiological processes, it is also involved in a number of pathologic conditions including chronic inflammation, immunological diseases, and cancer ( 134 ) Angiogenesis is regulated by several factors that can either promote or inhibit the development of new blood vessels and since EOCs are generally highly vascularized tumors our study aimed at the evaluation of angioregulators in bodily fluids as potential biomarkers for EOC. Inv estigated angioregulators included VEGF, HGF, ES and AS. VEGF, a 30 42 kDa homodimer produced by a variety of cell types including cancer cells, has emerged as a critical regulator of the angiogenic process by promoting endothelial migration, proliferation protease activity and capillary tube formation ( 53 ) VEGF levels in various body fluids are increased during cancer progression ( 72 121 ) HGF is a pleiotropic growth factor that is implicated in the growth an d spread of some epithelial tumors ( 124 ) and is present in benign and malignant ovarian tissues, cysts and ascites ( 122 ) A proportion of ovarian tumors also express high levels of the HGF receptor, c Met ( 135 ) and this expression may

PAGE 63

47 add a selective growth advantage to a narrow subset of differentiated EOCs. ES i s a 20 kDa C terminal fragment of collagen XVIII originally isolated from a murine hemangioendothelioma that has been shown to specifically inhibit endothelial cell proliferation, angiogenesis and tumor growth ( 128 ) Blood and urinary levels of ES have been reported as elevated in vulvar and other malignant disease ( 129 131 136 ) but the role of ES in EOC has not yet been explored. AS is a specific 38kDa internal fra gment of plasminogen that inhibits angiogenesis by blocking endothelial cell growth via its kringle 1 3 regions ( 129 131 137 ) AS synergizes with ES in inhibiting angiogenesis and EOC growth ( 138 ) and the two angiostatic molecules may thus be valid targets for anti angiogenic therapy in cancer via recombinant viral strategies ( 134 139 ) AS and other plasminogen cleaved products are present in malignant ascites and may contribute to the net anti angiogenic properties of this fluid ( 73 ) In a single immunohistochemical study of AS expression in EOC, survival time was longer in patients with AS positive and VEGF negative tumors than in patients with AS negative and VEGF positive tumors ( 127 ) AS has also been spa ringly reported as elevated in the urine of leukemic and some solid cancer patients suggesting that urinary detection of this angiogenesis inhibitor may provide new diagnostic, prognostic and potentially therapeutic tools ( 129 131 ) O ur study suggests that uAS provides a more sensitive marker than other angioregulators. Specifically, our data indicates significantly elevated uAS discriminates EOC from healthy controls and women with benign gynecologic

PAGE 64

48 disease. Further, the most appar ent clinical features related to uAS are detection of early stage EOC and complementarity with CA125. While the former represents an important target group associated with high survival (>95%), the latter suggests potentially important diagnostic and progn ostic roles for uAS; especially when both biomarkers were taken into consideration over 91% of ovarian cancer was detected and all normal individuals were identified as healthy. In future, ELISA or spot assays of combined or dominant urinary proteins may be used for diagnostic and prognostic applications. These assays may be used in combination with tests currently utilized to detect EOC at an earlier stage, thereby decreasing patient mortality. After surgery, patients could also be evaluated for recurr ence by easily monitoring the urine for such proteins. Measuring these angiogenic regulators may also be pursued in other readily accessible body fluids such as saliva as done for other disease s ( 140 ) Finally, the identification of an EOC related angiogenic profile may lead to the formulation of adjuvant therapies utilizing target specific anti angiogenic drugs. Validation of AS as a urina ry biomarker for the clinical detection may offer a non invasive, convenient, and cost effective screening and diagnostic tool for detection of this most lethal gynecologic malignancy. This would allow women to make better decisions about their health opt ions and potentially reduce the mortality associated with this insidious disease.

PAGE 65

49 C HAPTER III EXPRESSION OF SEMAPH ORIN 3F AND ITS RECE PTORS IN EPITHELIAL OVARIAN CANCER, FALL OPIAN TUBES AND SECO NDARY MLLERIAN TISSUES Abstract While semaphorins and their receptors appear to play a role in tumor carcinogenesis, little is known about the role of SEMA3F in EOC development. Therefore, we sought to determine the clinical relationship between S3F and its receptors, NP 2 and NP 1 with EOC progression. We analyzed the immunohistological expression of S EMA 3F, NP 2 and NP 1 in clinical specimens of normal ovaries (N), benign cyst adenomas (Cy), well differentiated adenocarcinomas (WD), poorly differentiated adenocarcinomas (PD), inclusio n cysts (IC), paraovarian cysts (PC), and fallopian tubes (FT). Tissue sections were evaluated for staining intensity and percentage of immunoreactive epithelia. We found that expression of S EMA 3F and NP 2 decreased while NP 1 expression increased with E OC progression. Interestingly, we also found elevated expression of S EMA 3F, NP 2, and NP 1 in epithelia of ICs, PCs, and

PAGE 66

50 FT. Our findings indicate that loss or deregulation of semaphorin signaling may play an important role in EOC development. Introduction EOC is the most lethal and the second most commonly diagnosed gynecological malignancy. It is estimated that in 2009, it will strike over 21,000 women seventy percent of whom will be first diagnosed at advanced stages an d will die within fi ve years ( 141 ) In general, EOC is characterized by poor prognosis due to lack of early symptoms, which contributes to advanced stage of disease at presentation, and by the absence of accurate screening methods to detect early stages of the disease. The origin of this malignancy has been traditionally attributed to the OSE However, alternative theories to a coelomic origin attribute the source of EOC to primary or secondary Mllerian system derivatives such as the fimbriated end of the fallopian tube and paraovarian vestigial structures, respectively ( 7 19 20 ) The Mllerian system theory would explain w hy epithelial ovarian neoplasms present as morphological variants of fallopian tube (serous adenocarcinoma), uterus (endometrioid), or endocervix (mucinous adenocarcinoma) epithelia without requiring an intermediate metaplastic step ( 19 ) Independently of its cell of origin, the pathogenesis of this most lethal gynecologic malignancy is, however, not well understood. Semaphorins are a large family of transmembrane, secreted, or GPI anchor ed, proteins involved in axon guidance and growth cone collapse through

PAGE 67

51 interaction with their receptors, the neuropilins and plexins ( 82 ) There are eight classes of semaphorin genes all of which are characterized by a conserved 500 amino acid, cysteine rich Sema domain, which mediates binding specificity and is necessary for signaling ( 82 ) Plexins are transmembrane receptors that form complexes with NP transmembrane receptors which only directly interact with SEMA3 members, and mediate signal transduction following binding to a semaphorin ( 87 ) Additional biological functions for semaphorins and their receptors include regulation of angiogenesis as well as tumor progression and metastasis ( 142 143 ) Wit h regard to angiogenesis, SEMA3s are of interest since members of this class have demonstrated either pro or anti tumorigenic functions. SEMA3s are unique in that they directly bind NP homo or hetero dimeric receptors and are unable to bi nd directly to plexins w ith the exception of SEMA3E ( 85 86 144 145 ) However, signaling is regulated through an oligomeric complex involving a NP dimer and one of four type A plexins ( 87 146 148 ) Interestingly, NP s also function as co receptors with VEGFRs for VEGF whose over expression contributes to tumor growth and metastasis ( 89 ) In addition to VEGF family members, NPs also interact with other heparin dependent growth factors like bFGF and HGF ( 93 ) Of interest is S EMA 3F, a class 3 secreted protein which plays a critical role during neural develop ment in both the peripheral and central nervous systems through interaction with its high affinity receptor NP 2 and low affinity receptor NP 1 ( 148 ) S EMA 3F has also been shown to inhibit angiogenesis by decreasing blood vessel density and through competition with

PAGE 68

52 VEGF for a shared receptor complex ( 108 149 ) Specifically S EMA 3F induces a poorly vascularized, encapsulated, non metastatic phenotype through chemorepulsion of endothelial cells in melanoma ( 150 ) In breast cancer, S EMA 3F disrupts intercell ular contacts of MCF7 breast cancer cells through delocalization of E catenin ( 142 ) Further, S EMA 3F and VEGF demonstrate opposing effects for cell attachment and spreading ( 151 ) as well as migration ( 152 ) S EMA 3F loss or delocalization has been shown to correlate with advanced tumor stage in a number of cancers including lung ( 110 ) ; however, a correlation between S EMA 3F and tumor stage, grade, and histological subtype remains to be demonstrated in ovarian cancer. In order to begin to better understand epithelial ovarian carcinogenesis, we sought to determine the clinical relationship between S EMA 3F and EOC progression. Therefore, we analyzed the immunohistochemical expression of S EMA 3F and its two receptors NP 1 and NP 2 in c linical specimens. Materials and Methods Tissue Specimens With institutional approval, 44 specimens were retrieved from the tissue bank at H. Lee Moffitt Cancer Center and Research Institute. Serial 4 sections were hematoxylin and eosin stained an d classified according to FIGO criteria (International Federation of Gynecology and Obstetrics) as normal

PAGE 69

53 ovaries (N, n = 12), benign serous cyst adenomas (Cy, n = 10), well differentiated serous cystadenocarcinomas (WD, n = 4), poorly differentiated serou s cystadenocarcinomas (PD, n = 6) and fallopian tubes (FT, n = 4). Three of 4 WD carcinomas were late stage (III IV) whereas all PD specimens were of late stage. We also evaluated epithelia of inclusion cysts (IC, n = 6) and paraovarian cysts (PC, n = 2) from patients with otherwise normal ovaries and fallopian tubes. Immunohistochemistry Immunohistochemical staining was performed on serial paraffin embedded sections by the horseradish peroxidase (HRP) conjugated system using a Dako Autostainer Plus (Dak o North America, Inc., Carpinteria, CA). Microwave antigen retrieval was achieved using 10x Antigen Retrieval AR 10 (Tris) (BioGenex, San Ramon, CA) or 10mM citrate buffer for 17 minutes. Endogenous peroxidase was blocked with 3% aqueous hydrogen peroxid e. Sections were rinsed twice with deionized water, washed in Tris buffered saline (TBS)/Tween for 5 minutes and immunostained on the Dako Autostainer with the following: rabbit anti S EMA 3F polyclonal antibody (Chemicon, Billerica, MA) at 1:50 for 1 ho ur at room temperature, rabbit anti neuropilin 1 polyclonal antibody (ECM Biosciences, Versailles, KY) at 1:200 overnight at 4C, and the mouse anti NP 2 monoclonal antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) at 1:75 for 1 hour at room temper ature. Secondary antibodies for S EMA 3F and NP 2 were Vector Elite ABC Perox idase, using rabbit IgG and mouse IgG, respectively; DAB was the chromogen. The secondary antibody for

PAGE 70

54 NP 1 wa s EnVision+ Peroxidase polymer. Sections were counterstained with mo Immunostaining of S EMA 3F, NP 1, and NP 2 was evaluated by two independent observers ( SVN and CD ) and scored based on staining intensity from 1 to 3 (0, negative; 1, weak; 2, moderate; and 3, strong) and percent of positive epit helial cells (1, 1 10%; 2, 10 50%; and 3, >50%). Cellular localization of S EMA 3F, NP 1, and NP 2 was also assessed. To confirm the specificity of the antibodies, non immune rabbit IgG and goat IgG were used as negative controls in place of primary antibodies for tissue specimens. Specificity was further confirmed by Western blot analyses of cell lysates and visualization of the corresponding protein bands at the appropriate molecular weights for the respective antibodies (data not shown). Statistical analyses Statistical analysis of staining for S EMA 3F, NP 1, and NP 2 among clinical samples was analyzed by Spearman rank correlation and Fisher exact test for differences in staining intensity and histological type. ANOVA analyses were performed to determine significant differences in percentage of positively stained epithelia between N, N combine d with FT, Cy, and cancer (WD combined with PD) groups. Spearman and Fisher exact tests were performed with SAS version 9.2 (SAS Institute, Cary, NC) and ANOVA tests were performed with Microsoft Excel (Microsoft, Redmond, WA). P values < 0.5 were consid ered statistically significant.

PAGE 71

55 Results S EMA 3F expression decreases with epithelial ovarian cancer progression. When all histological subtypes were considered, the expression level of S EMA 3F in epithelial cells was relatively weak and decreased with tumor progression. We found a significant inverse correlation between S EMA 3F staining intensity and histology where 83.3% (10/12) of N, 80% (8/10) of Cy, and 75% (3/4) of WD specimens expressed weak S EMA 3F staining, whereas the majority of PD specimens, 6 7% (4/6), completely lacked S EMA3F expression (Figures 8 9 ) (p<0.0001). No differences were observed as function of stage. Interestingly, when we evaluated the percentage of positive epithelia in the sections expressing S EMA 3F a significantly higher perc entage of normal OSE was immunoreactive compared to Cy (p<0.00 1) and cancer (p<0.001) (Table 3 ). The staining pattern throughout the tissue sections was predominantly cytoplasmic though a small portion (<20%) of epithelial cells demonstrated basal membran ous staining pattern in normal, benign, and well dif ferentiated carcinomas (Figure 8 ). Stromal cells of all histological groups did not express S EMA 3F with the exception of endothelial cells that, together with positive control placental tissues, express ed S EMA 3F in a cytoplasmic and membranous localization (Figure 8 arrow), thus providing in our cohort an internal positive control for S EMA 3F expression. Immunostaining was not observed in negative control samples (Figure 8 inset).

PAGE 72

56 Table 3 Epithelial expression of S EMA 3F and NP 2 decreases while NP 1 increases with ovarian epithelial tumor progression. S EMA 3F NP 2 NP 1 N 67.5 1.6 71.4 3.0 80.5 1.4 Cy 42.9 2.3 48.8 2.1 0.001 86.5 1.8 0.001 WD 21.6 3.9 0.05 19.2 4.4 0.001 100 0.001 PD 29.5 1.5 0.05 17.1 2.3 0.001 100 0.001 IC 100 100 100 PC 100 85.7 4.5 82.5 2 FT 100 72.2 3.6 100 Note: N vs Cy ** N + FT vs WD+PD Abbreviations: normal (N), serous cystadenoma (Cy), well differentiated serous adenocarcinoma (WD), poorly differentiated serous adenocarcinoma (PD), inclusion cyst (IC), paraovarian cyst (PC) and fallopian tube (FT) Data represent the average percent of positive epithelium expressing S EMA 3F, NP 2, and NP 1 SE

PAGE 73

57 Figure 8 S EMA 3F expression decreases while NP 1 increase s with epithelial ovarian cancer progression. Representative illustrations of immunohistochemical staining of normal (N), serous cystadenoma (Cy), well differentiated (WD) and poorly differentiated (PD) serous adenocarcinomas) for S EMA 3F, NP 2, and NP 1. Placental tissue was used for positive control (C) and arrow indicates expression of S EMA 3F by endothelial cells. Primary antibodies were replaced with non immune serum in negative control sections (inset). Original magnification: 400x.

PAGE 74

58 Figure 9 Graphical depiction of S EMA 3F, NP 2, and NP 1 expression with epithelial ovarian cancer progression. Immunohistochemically stained sections of normal (N), serous cyst adenomas (Cy), well differentiated (WD) and poorly differentiated (PD) serou s adenocarcinomas were evaluated for expression of SEMA3F NP 2 and NP 1 and scored as negative (Neg), weak (W), moderate (M), or strong (S) as described in Materials and Methods.

PAGE 75

59 NP 2 expression decreases with epithelial ovarian cancer progression. NP 2 was generally weakly expressed in all histological groups but the proportion of positive epithelial cells significantly decreased with tumor progression. The expression of NP 2 in 33% (4/12), 20% (2/10), 50% (2/4), 33% (2/6) of N, Cy, WD, and PD was generally weak (Figures 8 9 ) and with no significant statistical difference. In contrast to normal ovaries where 71.4% of OSE positively expressed NP 2, the percentage of positive epithelia was significantly lower in Cy, WD and PD where only 48.8%, 19.2%, and 17.1% were positive, respectively (p<0.001) (Table 3 ). The overall staining pattern was cytoplasmic and membranous in all histological groups (Figure 8 ). Interestingly, most cells expressing NP 2 in the examined WD carcinomas were localized in highl y distinctive clusters within the tissue specimens of early stage compared to late stage (Figure 10). In contrast to epithelial cells, over 90% of stromal cells in normal ovaries strongly expressed NP 2 (Figure 8). Similar to normal tissue, stromal cells in Cy, WD, and PD tissues expressed NP 2, however, the level of expression was moderate (Figure 8). Like SEMA3F, all endothelial cells within the stroma and positive control placental tissues expressed NP 2 immunostaining.

PAGE 76

60 Figure 10 NP 2 expressio n occurs in distinct clusters of tumor cells. Representa tive illustration of NP 2 expre ssion in well differentiat ed serous adenocarcinoma (WD). Original magnification 100x and inset 200x. NP 1 expression increases with epithelial ovarian cancer progression. In contrast to S EMA 3F and NP 2, the overall expression of NP 1 increased significantly with tumor progression. Most (93.8%, 30/32) of the tissues examined expressed NP 1 ( Figure 9 ). The overall staining intensity of NP 1 in N and Cy sections ranged from weak, 58% (7/12) and 60% (6/10), to moderate, 25% (3/12) and 30% (3/10), respectively (Figures 8 9, Table 3 ). In contrast, the vast majority of cancerous tissues, 75% (3/4) of WD and 83% (5/6) of PD samples, st rongly expressed NP 1 (F igures 8 9 ); however, no differences were observed as function of stage. The percentage of positive epithelial cells also significantly increased as 80.5%, 86.5%, and 100% of epithelia were positive for NP 1 in N, Cy and cancer tissues, respectively, (Tab le 3 ).

PAGE 77

61 Most stromal cells in N and Cy tissues expressed NP 1, although the staining intensity was less than for NP 2. Stromal staining was less in cancerous than in N and Cy tissues (not shown). S EMA 3F, NP 2, and NP 1 expression is elevated in inclusion c ysts, paraovarian cysts, and fallopian tube epithelium. G iven the uncertain cellular origin of EOC, coelomic versus extrauterine Mllerian, we also evaluated the immunohistochemical expression of S EMA 3F, NP 2, and NP 1 in ICs, PCs, and FT tissues. W e fo und an elevated staining intensity and percentage of epithelial cells expressing S EMA 3F and its receptors in ICs, PCs, and FT sections when compared to normal ovarian and cancerous tissues ( Figures 11 12 Table 3 ). In contrast to WD and PD tissues where o nly 21.6% and 29.5% of the epithelium were positive, 100% of the epithelium linin g the ICs expressed S3F (Table 3 ). All PCs and FT epithelia expressed S EMA 3F either moderately or strongly (Figures 11 12, Table 3 ). Similar to the normal ovary, only endothe lial cells, but no other surrounding stromal cells expressed S EMA 3F.

PAGE 78

62 Figure 11 S EMA 3F expression is elevated in inclusion cysts, paraovarian cysts, and fallopian tubes. Representative illustrations of immunohistochemical staining of normal ovary (N), inclusion cyst (IC), paraovarian cyst (PC), and fallopian tube (FT) for S EMA 3F, NP 2, and NP 1. Original magnification 400x.

PAGE 79

63 Figure 12 Graphical depiction of S EMA 3F, NP 2, and NP 1 expression in inclusion cysts, paraovarian cysts, and fallopian tubes compared to normal ovaries. Immunohistochemically stained sections of normal ovary (N), inclusion cysts (IC), paraovarian cysts (PC) and fallopian tubes (FT) were evaluated for staining intensity and designated as negative, weak, moderate, or strong following staining with antibodi es directed against S EMA 3F, NP 2, and NP 1.

PAGE 80

64 NP 2 expression but not intensity was comparable to S EMA 3F in epithelial cell s of ICs and PCs (Figures 11 12, Table 3 ). In contrast to WD and PD where only 19.2% and 17.1% of the epithelial cells were positive for NP 2, respectively, 100%, 85.7%, and 72.2% of the epithelia lining ICs, PCs, and FT, respectively, were positive (Table 3 ). In contrast to the strongly staining stromal cells of the normal ovary, weak NP 2 stromal staining was found in FT and PCs. Al l endothelial cells were strongly immunoreactive for NP 2. Epithelial expression of NP 1 in ICs, PCs, and FT was universal (Table 3 ) and similar to cancerous tissues; in contrast to normal ovaries, 50%, 50%, and 25%, respectively of IC, PC, and FT epithelia exhibited strong NP 1 staining (Figures 11 12 ). Similar to NP 2, stromal cells displayed negative to weak NP 1 expression while all endothelial cells were positive. Discussion Loss or delocalization of S EMA 3F has been shown to correlate with advanced tumor stage in lung cancer ( 110 153 ) In this study, we sought to determine the clinical relatio nship between S EMA 3F and epithelial ovarian cancer progression. Overall, we observed a significant decrease in both intensity and frequency of S EMA 3F staining with EOC progression. Although, tumors of high grade and advanced stage expressed the least amo unt of S EMA 3F, tumor grade was the only parameter that indicated a significant relationship between S EMA 3F expression and EOC progression in this initial cohort of patients.

PAGE 81

65 Levels of SEMA 3A have also been reported to be significantly reduced in advanced EOC and metastases ( 111 ) Taken together, these findings suggest that the loss or deregulation of semaphorin signaling may play an important role in EOC progression and support a tumor suppressor function for t his molecule ( 108 ) In contrast, the S EMA 3F receptors NP 2 and NP 1 have been reported to be over expressed in some cancers, including EOC ( 111 153 ) In agreement wi th previous reports, we found that the staining intensity and percentage of epithelium expressing NP 1 significantly increased with EOC progression and was predominantly cytoplasmic. However, we found that NP 2 expression decreased with EOC progression. Differences in these results compared to other reported findings may reflect methodological differences in sample preparation, scoring of immunostaining, and case distribution. Interestingly, we observed prominent staining of NP 2 in isolated, but highly distinct clusters of tumor cells in early stage and low grade (WD) ovarian cancer tissues similar to that described by Brambilla et al. ( 110 ) in non small cell lung cancer. These observations, in addition to the cytoplasmic localization of receptors we observed and previou sly reported in both lung and ovarian cancers ( 111 153 ) may further support a role for a S EMA 3F NP pathway in epithelial c ell adhesion and/or migration. Carcinomas arising from the ovary, FT and peritoneum have histological and clinical similarities ( 20 ) Histological similarities with epithelia lining ICs, PCs, and FT have also been documented and explained on the basis of common coelomic or Mllerian system origin ( 19 20 ) In the present study, while there

PAGE 82

66 was only weak expression of S EMA 3F and NP 2 in EOC, OSE, and IC there was strong expression of NP 1 in FT, PC, and EOC. This shared phenotype indirectly supports a common Mllerian origin for e pithelial ovarian cancer. Given the slightly younger pre menopausal age of normal individuals compared to the peri to post menopausal age of benign and ovarian cancer patients, a potential contribution of menopausal status on S EMA 3F expression cannot be ruled out. Although in this initial series, there was no noticeable difference in S EMA 3F expression among normal specimens, additional studies are needed to further evaluate independency from hormonal status. Interestingly, Joseph et al. recently reported on regulation of SEMA3B and SEMA3F by gonadotropins (FSH and LH) and estradiol in ovarian cancer cell lines ( 154 ) SEMA3F express ion was enhanced by estradiol only indicating that SEMA3F was less sensitive to hormone treatment compared to SEMA3B, which was stimulated by FSH and LH in addition to estradiol ( 1 54 ) Therefore, these studies suggest that hormonal regulation of S EMA3F may play a role in the ovary a nd EOC certainly, additional studies are necessary to further elucidate the mechanism(s) involved in hormonal regulation of SEMA3F. In conclusion, our data suggests that the S EMA 3F NP pathway may be deregulated in EOC pathogenesis. Further investigation of S EMA 3F and its receptors in epithelial ovarian cancer is warranted to delineate the molecular pathway(s) by which such deregulati on may promote tumor progression and, if so, provide novel molecular targets for therapeutic intervention.

PAGE 83

67 CHAPTER IV SEMAPHORIN 3F DYSFUN CTION INDUCES TELOME RASE ACTIVITY IN OVARIAN CANCER CELLS Abstract SEMA3F is a secreted with potent angiostatic activity and a lthough studies have indicated that loss expression of SEMA3F correlates with cancer progression, including EOC, less is known about SEMA3F regulation and/or dysregulation. Since studies of the nervous system suggest that calcium influences SEMA3 signaling and since cyclic adenosine monophosphate (cAMP) response element binding protein (CREB) is activated by calcium, we investigated the potential for calcium and CREB to regulate SEMA3F in OSE and ovarian cancer cells. In the present study, we demonstrated that both calcium and CREB suppress SEMA3F expression and CREB could specifically target the 4810 to 4418 region of the SEMA3F promoter. Since we have previously demonstrated that VEGF can target specific Sp1 sites within the hTERT promoter to stimulate telomerase activity and given the antagonistic relationship between SEMA3F and VEGF, we also evaluated the relationship between SEMA3F and telomerase using semi quantitative RT PCR, Western blot

PAGE 84

68 analyses, and PCR ELISA. We found a significant inverse relationship, in addition SEMA3F could regulate telomerase activity by targeting regions of the hTERT promoter, alternative to the VEGF responsive regions. These results demonstrate that calcium and CREB negatively regulate SEMA3F expression in OSE and ovarian cancer cells. SEMA3F loss is associated with an increase in telomerase activity. Mo reover, ectopic expression of SEMA3F could mediate suppression of telomerase activity. Together, these data provide evidence that calcium and CREB can negatively regulate SEMA3F, in addition telomerase appears to be a novel molecular target of SEMA3F. Introduction Semaphorins are a large family of secreted, transmembrane, or GPI anchored proteins that play a critical role as axon guidance molecules in the developing nervous system. However, they are also widely expressed outside the nervous system and influence a variety of cellular mechanisms includin g migration, proliferation, cytoskeleton rearrangement angiogenesis and cancer progressio n ( 80 103 155 157 ) Secreted SEMA3s ( 158 ) which are distinguished by the presence of a C terminal basic domain and function in a paracrine manner through a NP/plexin holoreceptor complex ( 82 ) Unlike other semaphorin family members SEMA3s directly bind NP receptors with the exception of SEMA 3E, however similar to other semaphorin family members the plexin receptor initiates signal transduction ( 82 )

PAGE 85

69 SEMA3F was originally isolated from a recurrent homozygous deletion in the 3p21.3 chromosomal r egion in small cell lung cancer ( 159 161 ) a region also frequently lost in ovarian cancer ( 107 ) Normally SEMA3F functions to suppress tumor formation and/or progression. More specifically, exogenous SE MA3F inhibits tumor formation in several xenograft models ( 108 149 150 ) In addition, SEMA 3F ex pression is associated with reduced blood vessel density and a nonmetastatic tumor phenotype, suggestive of angiostatic acti vity ( 150 ) T he angiostatic activity of SEMA3F is due, in part, to competition of overlapping NP binding site s with the angiogenic factor VEGF ( 104 ) Alternatively, re expression of SEMA3F in H157 lung cancer cells negatively affects VEGF mRNA expression due to decreased signal transducer and activator of transcription 3 (S TAT3) phosphorylation and loss of Akt dependent hypoxia (HI F ) protein ( 109 112 ) As seen in lung cancer ( 153 ) we and others have previously demonstrated decreased SEMA 3F expression with EOC progression ( 154 162 ) however the positive and negative mechanisms regulating SEMA 3F expression remain unclear. To date, DNA methylation correlates with suppression of SEMA3F expression ( 106 ) Similarly Clarhaut et al. reported that the zinc finger transcription factor and key regulator in epithelial mesenchymal transition, ZEB 1, down regulates SEMA3F by target ing a specific E box site s located in the CpG island of the SEMA3F promoter ( 112 ) Alternatively, chromatin remodeling by histone deacetylase inhibition contribute s to SEMA 3F activation ( 106 ) R ecently Joseph et al. demonstrated reproductive hormonal regulation of SEM A 3F and

PAGE 86

70 SEMA 3B in ovarian cancer cells, such that, FSH LH and estradiol stimulate d SEMA3B, whereas SEMA3F could only be stimulated by estradiol ( 154 ) The modulation of growt h cone turning by guidance cues, like SEMA3F, is facilitated by calcium an essential signaling molecule ( 163 ) Interestingly, levels of calcium fluctuate in preparation for rupture of th e ovarian follicle and changes in calcium can stimulate damaged OSE to proliferate ( 164 ) Moreover, inhibition of calcium influx reportedly r esults in inhibition of ovarian cancer cell proliferation, invasion, and angiogenesis ( 165 ) Conversely, hormonal stimulation of SEMA3B and SEMA3F block s invasion and angiogenesis in ovarian cancer cells ( 154 ) Since loss of SE MA3F correlates with EOC progression and given the effects of calcium on SEMA3F in the nervous system and OSE in the ovary, calcium could potentially regulate SEMA3F in OSE and ovarian cancer cells. In the present study, we investigated mechanisms that po sitively and negatively regulate SEMA3F and how loss may be related to tumor progression. W e found that calcium suppressed SEMA3F expression in both OSE and ovarian cancer cell lines. We also identified the basic/leucine zipper (bZIP) transcription facto r, CREB as a novel SEMA3F transcriptional repressor while two GC boxes are important for transcriptional activation of SEMA3F Additionally we found, an inverse relationship between SEMA3F expression and telomerase activity such that, SEMA3F appears to suppress telomerase in a transcription dependent manner. Consequences of decreased SEMA3F thus, involve mechanisms that promote cancer progression through induction of telomerase activity.

PAGE 87

71 Methods and Materials Cell lines and culture A panel of ovarian carcinoma cell lines, including A2780s, A2780cp, C 13, CaOV3 ES 2, OV90, OV432, OV433, OV2008, OVCAR3, OVCAR5, PA I, SW626, TOV21G and TOV112D cell lines, and SV40 lar ge T antigen immortalized ovarian surface epithelial (IOSE) cell lines, including familial history human immortalized ovarian surface epithelial 114 (FHIOSE 114), FHIOSE 117 FHIOSE 118 immortalized Moffitt Cancer Center 3 (I MCC 3 ) and IMCC 5 were used in this study ( 166 ) Cells were maintained in Medium 199/MDCB 105 (1:1) (Sigma, St. Louis, MO) supplemented with 5% fetal bovine serum (FBS) in a humidified 5% CO 2 /95% air atmo sphere. Treatment with SEMA3F, VEGF, CBO P11, calcium BAPTA and metal ions Two million IOSE and ovarian cancer cells were treated with recombinant SEMA3F (0.212g/mL or 0.424g/mL) (a generous gift from Dr. Klagsbrun), VEGF (50ng/mL) dissolved in BSA ( Biosource, Camarillo, CA) and/or 1.3 M VEGF receptor inhibitor, CBO P11, dissolved in Milli Q water (Calbiochem, La Jolla, CA). Cultures were harvested at 24 hours and assayed for telomerase activity. In order to determine the role of calcium in SEMA3F re gulation, three million IOSE and ovarian cancer cells were treated 10 mM CaCl 2 or 1,2 bis(2

PAGE 88

72 aminophenoxy)ethane tetraacetic acid (BAPTA, Sigma Aldrich, St. Louis, MO), a calcium chelator ( 167 ) Cells were also treated with additional divalent cations in the form of chlorine salts. The salts used were ZnCl 2 ( 100 M, 1mM), MgCl 2 (10mM), CuCl 2 ( 10 M, 100 M), and CsCl 2 (1mM) ( Sigma Aldrich, St. Louis, MO ) Following suspension of metal salts into medium, pH was adjusted to 7.4 then the solution was filtered using a 0.2 um syringe filter and added to cells in culture. Cells were harvested at 24 hours and assessed for SEMA3F expression. Transient transfection and small interfering RNA transfection Two million IOSE and ovarian c ancer cell lines were transiently transfected using Program X 005 and Kit V on the Nucleofector device (Amaxa/Lonza, Walkersville, MD) with pSecTag (Invitrogen Carlsbad, CA ), pSecTag S3F (generous gift from Dr. Tessier Levigne ) which encodes for the long splice form of SEMA3F GFP (Amaxa/Lonza, Walkersville, MD), or pSG3 CREB (kindly provided by Dr. Cheng) plasmids. To inhibit expression of SEMA3F, two million OSE and ovarian cancer cells were transfected with SEMA3F siRNA or non targeting control siRNA ( Qiagen Valencia, CA ). Cells were harvested at 24 or 48 hours post transfection. Each transfection was performed in three independent experiments.

PAGE 89

73 RT PCR To verify expression of SEMA3F and to determine the contribution of SEMA3F for transcriptional regulation of human telomerase reverse transcriptase (hTERT), semi quantitative RT PCR studies were performed, with each experiment repeated a minimum of three separate times. Total RNA was collected using TRizol reagent (GIBCO BRL Grand Island, NY ). On RNA, oligo(dT), and reverse transcriptase were used to generate single strand cDNA for each sample. To ensure there was no DNA contamination, each sample for reverse transcription was prepared in duplicate with one sample lacking reverse trans criptase. The cDNA samples were amplified using Applied Biosystems GeneAmp kit (Foster City, CA). The SEMA3F primers used were SEMA3F Sense (AGCAGACCCAGGACGTGAG) and SEMA3F Antisense (AAGACCATGCGAATATCAGCC) oligonucleotides (Sigma Genosys, The Woodlands, TX) and hTERT primers used were hTERT Sense (CGGAAGAGTGTCTGGAGCAA) and hTERT Antisense (GGATGAAGCGGAGTCTGGA) oligonucleotides (Sigma Genosys, The actin primers were used; actin Sense (GGGAATTCAAAACTGGAACGGTGAAGG) and actin Antisense (GGAAGCTTATCAAAGTCCTCGGCCACA). PCR for S3F was performed for 35 actin primers were added at cycle 18. PCR for hTERT was performed for 33 cycles of 95C for 20 s, 68C for actin primers were added at cycle 17. Amplified products were then separated by gel electrophoresis, stained with 1x

PAGE 90

74 SybrGreen (Cambrex Bioscience Rockland, Inc., Rockland, ME) and analyzed with the Kodak EDAS 120 Digital Analy sis System. Telomerase assay To quantitatively detect changes in telomerase activity levels, cell lysates were assayed using the telomerase polymerase chain reaction enzyme linked immunosorbant assay (PCR ELISA) (Roche Applied Science, Indianapolis, IN ) trypsinized, and spun at 500 x g for 10 min. Pellets were washed twice in PBS, then resuspended in lysis buffer and kept on ice for 30 min, after which the lysates were ce ntrifuged at 100,000 x g for 1 hour at 4C. Lysates were then assayed using the Bio Rad DC Protein Assay (Bio Rad, Hercules, CA) for the instructions. In order to perform the telomer ase PCR ELISA within a linear ELISA, telomerase activity was detected using a EL x 800 microplate reader (Bio Tek Instruments, Winooski, VT) and recorded as absorbance units. West ern blot analysis For Western blot analysis, cell lysates were solubilized in SDS gel loading buffer (60 mM Tris base, 2% SDS, 10% glycerol, and 5% b mercaptoethanol), separated via 10% SDS PAG E and electroblotted onto (0.45m ) PVDF membranes ( Millipore, Billerica, MA ) by wet transfer. Immunoblotting was

PAGE 91

75 performed using antibodies directed against SEMA3F (1:5000, Millipore Billerica, MA ), phospho CREB (1:2500, Cell Signaling Danvers, MA ), total CREB (1:2500, Cell Signaling Danvers, MA ), phospho Akt ( 1 :2500, Cell Signaling Danvers, MA ), and total Akt (1:2500, Cell Signaling Danvers, MA actin (1:10,000, Sigma Aldrich, St. Louis, MO) was used as a loading control. Blots were visualized using the ECL Western Blotting Analysis System (Millipore Bil lerica, MA scanned with ImageQuant image analysis software (GE Healthcare Bio Sciences Corp., Piscataway, NJ). Data represent mean relative intensities for S3F, phospho CREB, total CR EB, phospho Akt, and total Akt, from three independent actin levels and expressed as mean net intensity. Luciferase reporter assay To measure promoter activity, 1.5g SEMA3F luciferas e reporter promoter constructs pGL3 6310 4013, 5131 3765, 5836 4013 ; previously described ( 106 112 ) and pGL3 4810 4418 and 4810 4013 or hTERT full length and deletion constructs pGL3 1375, 117 5, 976, 776, 5 78, 378, 181; hTERT constructs previously described ( 168 ) were transfected into IOSE and/or ovarian cancer cells using Program X 005 and Kit V on the Nucleofector d evice (Amaxa/Lonza, Walkersville, MD). In each experiment, the pRL TK plasmid (100ng), encoding Renilla luciferase (Promega, Madison, WI), was co transfected for normalization purposes. Luminescence was measured 48 hours after transfection using the

PAGE 92

76 Dual Luciferase Reporter Assay System (Promega, Madison, WI). The pGL3 basic (promoterless) plasmid was used in each experiment to determine basal levels of luciferase. Reporter activity was normalized by calculating the ratio of Firefly/Renilla values and t ranscriptional activity was expressed as relative luciferase activity from triplicate S.E. from three independent experiments. Statistical analysis Samples for telomerase PCR ELISA were run in triplicate from three independent experiments and the data subjected to Student t test analysis for determination of statistical significance for S3F suppression of telomerase. To determine the relationship bet ween SEMA3F and telomerase activity we used a Spearman correlation coefficient (a nonparametric analog to the Pearson correlation coefficient) for statistical analysis. Results Calcium suppresses SEMA3F expression in I OSE and ovarian cancer cells In agre ement with earlier studies ( 154 162 ) SEM A3F levels were lower in ovarian cancer versus normal cell lines (>45%). To ascertain whether calcium could mediate SEMA3F expression, we treated I OSE and ovarian canc er cells with calcium for 24 hours. SEMA3F mRNA and protein expression were evaluated u sing semi quantitative RT PCR and Western blotting, respectively (Figures 13A B) C alcium suppressed SEMA3F mRNA expression in I OSE in

PAGE 93

77 ovarian cancer cell lines (Figure 13 A, top panel). Likewise, SEMA3F protein expression was suppressed in both I OSE and ovarian cancer cells following treatment with calcium ( Figure1 3 B, top panel) Densitometric analyses indicated c alcium suppressed SEMA3F protein expression in I OSE in ovarian cancer cell lines by 83% and 67% respectively (Figure 1 3 B, top panel) To verif y a role for calcium in SEMA3F inhibition, I OSE and ovarian cancer cells were treated with a calcium chelator, BAPTA, for 24 hours and assessed for SEMA3F RNA and protein expression. In agreement with above calcium chelation with BAPTA induced SEMA 3F exp ression by two fold (Figures 1 3 A B bottom panels ). Cell viability following BAPTA treatment was not compromised as determined by trypan blue exclusion (data not shown). Additionally, to confirm specificity for calciu m to suppress SEMA 3F expression FHI OSE 118 cells were treated with various divalent cations at varying concen trations for 24 hours (Figure 1 3 C ). Following treatment, samples were collected and assessed for SEMA3F protein expression. Additional metal salts examined resulted in SEMA3F expre ssion similar to that of the control samples.

PAGE 94

78 Figure 1 3 Calcium mediates SEMA3F Suppression in I OSE and Ovarian Cancer Cells. Cells were treated with 10mM CaCl2 or BAPTA and were harvested at 24 hours to measure SEMA3F mRNA (A) by semi quant itative and protein (B) expression by Western blot analyses. B actin was used as a loading control and values are expressed as relative intensity of SEMA3F/Actin. (C) To confirm specificity of CaCl2, cells were treated with additional divalent cations and measured for SEMA3F protein expression at 24 hours after treatment.

PAGE 95

79 Calcium mediated suppression of SEMA3F is CREB dependent The bZIP transcriptio n factor, CREB, has been implicated in regulating OSE survival and proliferation in response to gonadotropin s during ovulation ( 169 170 ) Furthermore in vitro and in vivo studies indicate CREB is frequently over expressed in a number of human tumors, inclu ding EOC ( 170 ) Since CREB activation is dependent on calcium and cAMP ( 171 172 ) we examined whether CREB contribute s to negative regulation of SEMA3F expression. I OSE and ovarian cancer cells were transiently transfected with a CREB expression construct. CREB expression was verified by Western blot analysis (Figure 14 A left panel ) Compared to control cells, ectopic expression of CREB inhibited SEMA3F mRNA and protein expression in I OSE and ovarian cancer cells by 75% and 68%, respectively (Figure 14A ). To determine whether CREB represents a novel transcriptional repressor of the SEMA 3F gene, we performed luciferase reporter assay s using [6310 4013] SEMA3F promoter and deletion constructs (previously described 16005989, 19177200) cotransfected CREB expression construct, to iden tify the promoter region(s) responsive to CREB. As shown in Figure 14B, greatest endogenous SEMA3F promoter activity occurred in the 4810 to 4418 region. CREB decreased luciferase reporter activity in I OSE cells by 54.2%, targeting the 4810 to 4418 S EMA3F promoter region (Figure 14B ).

PAGE 96

80

PAGE 97

81 Figure 14 CREB down regulates SEMA3F transcription in OSE and ovarian cancer cells. (A.) FHIOSE 118 and OV2008 c ells were transiently transfected with control or CREB expression vector and were harvested at 24 hours to measure SEMA3F mRNA by semi quantitative RT PCR and protein expression by Western blot analyses. B actin was used as a loading control and values are expressed as relative intensity of SEMA 3F/Actin. (B. ) The SEMA3F luciferase reporter constructs were transfected CREB expression vector into FH IOSE 118 Firefly luciferase activity was measured and normalized to Renilla luciferase activity of the cotransfected plasmid pRL TK for three independent experimen ts done in triplicate. (C. ) The luciferase reporter constructs, with the [ 6310 4013] SEMA3F promoter fragment, mutated or not (WT) for each or both 3 and 4 of the GC boxes present in the CpG island of this fragment, were transfected into F HIOSE 118 cells Firefly luciferase activity was measured and normalized to Renilla luciferase activity of the cotransfected plasmid pRL TK for three independent experiments done in triplicate. test: *p<0.05, **p<0.01.

PAGE 98

82 SEMA 3F promoter region 4810 to 4418 is required for expression in I OSE MCF7 breast cancer cells which express high levels of SEMA3F, have promoter activity in a region surrounding the CpG island ( 106 ) whereas I OSE and ovarian cancer cells that express SEMA3F demonstrate the highest luciferase induction within a portion of the CpG island located at 4810 to 4418 This region excludes two E box sites but contains four putative GC box sites (Figure 14B C ). Theref ore, our results suggest that the GC box sites are important for positive regulation of SEMA 3F in I OSE and ovarian cancer cells. To determine the contribution of e ach GC box site for SEMA3F promoter activity we performed a dditional luciferase reporter ass ay s with [ 6310 4013] SEMA 3F promoter reporter constructs containing all the GC box sites and with promoter constructs with mutations in each GC box (GC mut1, GC mut2, GC mut3, GC mut4) or combined GC box mutations (GC mut3 4). Mutation s in GC box 2 or 4, significantly decreased luciferase activity (54%, 58.6%) in FHIOSE 118 cell s (Figure 14C, right panel ) compared to the wild type sequence 4810 4418 which had the highest promoter activity. Taken together, these results suggest that GC box sites 2 and 4 are necessary to induce SEMA3F expression in IOSE and ovarian cancer cells, while, a nearby CREB binding site negatively regulates SEMA3F.

PAGE 99

83 SEMA3F expression is inversely correlated with telomerase in I OSE and ovarian cancer cell lines In the ovary, telome rase is absent in normal OSE and pre malignant lesions, while tumor cells from both ascites fluid and ovarian carcinomas express telomerase activity ( 173 174 ) Previously we reported that VEGF can induce telomerase activity in an ERK1/2 dependent manner in ovarian cancer cells by targeting Sp1 binding sites within the proximal 976 to 378 regions of the hTERT promoter ( 175 ) Additio nally, we have demonstrated that calcium promotes de novo telomerase activation in telomerase negative I OSE cells and elevates endogenous activity in telomerase positive ovarian cancer cell lines ( 167 ) Using semi quantitative RT PCR, we surve yed normal and ovarian cancer cell lines for expression of SEMA3F and hTERT, the reverse transcriptase and rate limiting component of telomerase. SEMA3F RNA was strongly expressed in IOSE cell lines, while there was a marked decrease in SEMA 3F expression in ovarian cancer cell lines (Figure 15 A ). As expected telomerase negative IOSE cells demonstrated no hTERT expression, whereas all ovarian cancer cell lines expressed strongly hTERT mRNA (Figure 15A ). SEMA3F protein expression was significant ly inversely corr elated with telomerase activity, as determined by Western blot and PCR ELISA, respectively (Spearman correlation coefficient, r = 0.47, p = 0.035; Figure 15 ) Interestingly, supporting a role for loss of SEMA3F with increasing tumor progres sion and EOC progression (i.e. tumor aggressiveness), we observed that p arental chemo sensitive cell lines A2780s, OV2008, and OV432 demonstrated

PAGE 100

84 higher SEMA3F expression and lower telomerase activity compared to the chemo resistant daughter cell lines A27 80cp, C 13, and OV433 ( Figure 15B ). Figure 15 SEMA3F expression is inversely correlated with telomerase in OSE and ovarian cancer cells. (A.) Endogenous hTERT mRNA and SEMA3F protein expression were measured in IOS E and ovarian cancer cell lines by semi quantitative RT PCR and Western blot, actin was used as a loading control. (B .) Graphical depiction of denistometric analyses of SEMA3F / actin protein expression and t elomerase activity which was measured by PCR ELISA and values are expressed as relative telomerase activity f rom triplicate samples. (Inset) Western blot indicating h igher SEMA3F expression in cancer cells correlates with chemo sensitive cell lines versus their respective chemo resistant daughter cell lines.

PAGE 101

85 SEMA3 F mediates suppression of telomerase activity in ovarian cancer cells Given the inverse relationship we found between SEMA3F and telomerase we examined whether SEMA3F could regulate telomerase activity in ovarian cancer cells. Ectopic expression of SEMA3F in OV2008 and C 13 cell lines was confirmed by semi quantitative RT PCR and Western blot and resulted in a marked decrease in hTERT mRNA expression in ovarian cancer cells compared to empty vector (Figure 16A ). Similarl y, telomerase activity was suppressed on average by 35% as determined by PCR ELISA (Figure 16 B) To further validate the specificity of SEMA3F for telomerase suppression we used siRNA t o inhibit SEMA3F in FH IOSE 118 and OV2008 cell lines (Figure 16 C ). Interestingly, suppression of SEMA3F in OSE resulted in de novo telomerase activity (42.6%). L ikewise, telomerase activity increased in ovarian cancer cells by 43.5% (Figure 16C ). SEMA 3F targe ts the 378 region and 181 region of the hTERT promoter Since, ectopic expression of SEMA3F decreased hTERT mRNA (Figure 16A, right panel) using full length and deletion reporter constructs of the hTERT promoter, we performed a luciferase reporter as say to identify the promoter region(s) responsive to negative regulation by SEMA3F ( Figure 16 D) Compared to endogenous promoter activity, SEMA3F suppressed luciferase activity in the 378 bp and 181 bp hTERT promoter regions in OV2008 cells ( Figure 16D ). In contrast, SEMA3F failed to suppress activity of the full length, 1175 bp, 976 bp,

PAGE 102

86 and 776 bp hTERT promoter regions. The highest luciferase inhibition was achieved using the 181 bp or core hTERT promoter, where we observ ed a 1.5 fold decrease (Figu re 16D ). These results demonstrate that SEMA3F can negatively regulate telomerase by targeting the 378 bp and 181 bp regions of the hTERT promoter, in ovarian cancer cells.

PAGE 103

87 Figure 16 SEMA3F suppresses telomerase activity in ovarian cancer cells. OV2008, C 13, and other ovarian cancer cells were transiently transfected with control or SEMA3F cDNA and were harvested a t 24 hours after transfection. Over expression of S EMA 3F was confirmed by (A left panel ) semi quantitative RT PCR and (A, right panel ) Western blot analysis. Values are expressed as relative intensity of S EMA 3F normalized to acti n. (B) Transfectants were assessed for telomerase activity by PCR ELISA. Values are expressed as relative telomerase activity (Absorbance450nm Absorbance690nm ) of triplicate samples. (C.) FHIOSE 118 and OV2008 cells were transiently transfected with control or SEMA 3F siRNA and were harvested at 48 hours after transfection. Silencing of S EMA 3F was confirmed by Western blot analysis. Values are expressed as relat ive intensity of S EMA 3F normalized to acti n. Transfectants were assessed for telomerase activity by PCR ELISA. Values are expressed as relative telomerase activity (Absorbance450nm Absorbance690nm) of triplicate samples. (D.) OV2008 cells were transfecte d with full length and deleted hTERT luciferase reporter constructs SEMA3F expression vector. Firefly luciferase activity was measured and normalized to Renilla luciferase activity of the cotransfected plasmid pRL TK for three independent experiments don e in triplicate. test: *p<0.05, **p<0.01.

PAGE 104

88 SEMA3F and VEGF have opposing effects on telomerase activity SEMA3F and VEGF are secreted proteins that share common co receptors and activate signaling pathways but with opposing effects ( 151 ) therefore, SEMA3F may compete with VEGF to suppress telomerase activity. To validate a role for negative regulation of telomerase by SEMA3F and to expand upon the antagonistic relationsh ip between SEMA 3F and VEGF, we treated FH IOSE 118, PA I and SW626 cells with recombinant SEMA3F VEGF or CB O P11, a known VEGFR 2 inhibitor. As expected treatment with VEGF induced telomerase activity in ovarian cancer cells, whereas SEMA3F suppressed telomerase activity in a dose dependent manner (Figure 17 ). When VEGF was administered with a lower concentration of SEMA3F telomerase activity was similar to that of the control; however with a higher concentration SEMA3F was able to overcome competiti on with VEGF and suppress telomerase activity (Figure 17 ) Additionally, SEMA3F inhibition of telomerase appears to occur, in part, through the VEGFR 2 signaling pathway as indicated by the recovery of telomerase activity following treatment with both SEMA3F and CBO P11 (Figure 17 ).

PAGE 105

89 Figure 17 SEMA3F and VEGF have opposing effects on telomerase activity. FHIOSE 118, SW626, and PA I cells were treate d with VEGF, recombinant SEMA3F, CBO P11. Cells were harvested at 24 hours after treatment and assessed for telomerase activity by PCR ELISA. Transfectants were assessed for telomerase activity by PCR ELISA. Values are expressed as percent of relativ e telomerase activity of triplicate samples. Discussion Given the correlation between SEMA 3F dys regulation and EOC progression, it is imperative to elucidate the cellular mechanisms involved in SEMA3F regulation in normal physiological conditions and dur ing neoplastic transformation in order to exploit the therapeutic potential of SEMA 3F The present study attempted to identify positive and negative regulators of SEMA3F in I OSE and ovarian cancer cells. We found that calcium specifically suppressed

PAGE 106

90 both SEMA3F mRNA and protein expression since treatment with additional metal cations had no effect on SEMA3F expression. Of interest are ongoing clinical trials investigating the potential of therapeutic strategies targeting inhibition of calcium influx via carboxyamidotriazole (CAI) treatment in ovarian cancers ( 176 ) CAI inhibits the influx of calcium into non excitable cells, like endothelial or epithelial cells, and treatment with CAI results in inhibition of angiogenesis and signaling pathways that promote adhesion ( 165 176 ) Taken together, these findings suggest SEMA 3F may be a clinically useful downstream target of CAI therapy in the treatment of EOC. Because calcium activates CREB ( 62 171 172 ) we investigated the potential involvement of CREB in calcium media ted SEMA3F suppression. We identified two possible CREB binding sites in the SEMA3F promoter, one located near four putative GC box sites within the CpG island and the second site just upstream flanking the CpG island. We also determined that the 4810 t o 4418 SEMA3F promoter region, which contains a portion of the CpG island, had the highest endogenous luciferase activity i n IOSE and ovarian cancer cells and was most responsive to CREB. Differences in effectiveness for CREB to repress SEMA3F promoter activity at CREB binding sites within and outside the CpG island may be attributed to the presence of multiple transcriptional start sites within the CpG island, direct interaction with other transcription factors/basal transcription machinery or interfere nce due to methylation outside the CpG island ( 106 ) Preferential CREB mediated S EMA3F promoter activity in the CpG island may

PAGE 107

91 involve the Sp/KLF family of transcripti on factors which recognize e lements within this region and which have been shown to interact with CREB ( 177 ) Conversely, Sp1 demonstrates a central role in TATA less promoters and has been suggested to be an activator of SEMA3F ( 106 178 ) Furthermore, our results indicate that GC boxes 2 and 4 were necessary and positive regulators for SEMA3F promoter activity in IOSE and ovarian cancer cells, so that discrete regions of the SEMA3F promoter are important for its expression. Future studies should address the interactions between CREB and other transcription factors or a component of the basal transcriptional machinery whic h may be involved is this indirect negative regulation of the SEMA3F gene. In addition, studies are warranted to further elucidate which specific Sp1/KLF family members are involved in positive regulation of the SEMA3F promoter via GC box binding sites 2 and 4. Telomerase is a multimeric ribonucleoprotein that adds telomeric repeats to chromosomal ends, thereby stabilizing chromosome ends and conferring immortality to cells ( 173 179 ) Since telomerase is expressed in more than 90% of human tumors and absent from most normal somatic cells and its expression correlates with tumor aggressiveness, telomerase is an attractive target for therapeutic intervention. Epithelial o varian can cers have a propensity for therapeutic failure due to development of drug resistance and changes in telomerase may predict therapeutic outcome. We have previously reported that inhibition of telomerase improves chemosensitivity to cisplatin in cisplatin r esistant ovarian cancer cell lines ( 180 ) In the present study, we found that

PAGE 108

92 chemo resistant cell lines (A2780cp, C 13, OV433) were associated with increased telomerase activity compared to their respective parental cell lines (A2780s, OV2008, OV432), and subsequently compared to non tumorigenic IOSE cells. Moreover telomerase activity was not only inversely related to SEMA3F expression but was transcriptionally regulated by SEMA3F. Interestingly, while we have previously shown VEGF and LPA activate telo merase activity by targeting Sp1 sites in the 978 to 378 region of the hTERT promoter ( 175 ) here we show that SEMA3F suppresses telomerase activity by targeting the 378 region and hTERT core promoter region. These results are consistent with earlier studies showing that expression of SEMA3F confers a poorly vascularized and non metastatic phenotype ( 150 ) so that together, these results sugge st that as an alternative to inhibiting angiogenesis, SEMA3F may also inhibit tumor progression and survival by negatively targeting telomerase. Several transcription factors have been reported as positive and negative regulators of hTERT transcription. Sp1 protein has been shown to specifically target the hTERT core promoter and studies indicate that Sp1 sites may contribute to basal promoter act ivity ( 181 183 ) Additionally, mechanisms involving E box binding proteins which are known to heterodimerize with a variety of transcription factors with helix loop helix domains, such as c Myc or Mad related family members, are implicated in both activation and repression of hTERT ( 184 185 ) Several lines of evidence indicate transcriptional repression is associated with the function of a putative telomerase/hTERT repressor gene located on the short arm of chromosome 3 ( 186 187 ) Furthermore, loss of this

PAGE 109

93 region as a consequence of deletion or inactivating mutation may occur during neoplastic transformatio n ( 181 187 ) Interestingly, this 3p region corresponds to the known 3p21.3 loci of the SEMA3F gene. These studies taken together with our findings indicating a significant inverse relationship between SEMA3F expression and telomerase activity, further implicates SEMA3F may function as a repressor of telomerase activity in telomerase negative normal cells and this mechanism becomes defective during the carcinogenic process. Lastly, the angiostatic activity of SEMA3F may be due to competition with VEGF for common co receptors. In the present study, SEMA3F abrogated the ability of VEGF to enhance telomerase activity. SEMA3F mediated telomerase occurred, in part, through VEGFR 2 supporting an antagonistic relationship between SEMA3F and VEGF due to competition for shared receptors as well as promoting opposing effects on a common downstream target. SEMA3F acts like a tumor suppressor and dysregulation results in loss of expression which can promote tumor progression, angiogenesis and survival. To our knowledge, this is the first report of differential SEMA3F regulation in OSE and ovarian cancer cel ls. We found that the SEMA3F promoter was negatively regulated at 4810 to 4418 in a calcium and/or CREB dependent manner, whereas positive regulation was mediated at GC box 2 and 4 within this same region. Additionally, we identified telomerase as a no vel molecular target of SEMA3F. Since reactivation of telomerase is critical for cellular immortalization and malignant transformation, inhibition of telomerase by SEMA3F demonstrates an additional tumor suppressor function and may have clinical utility a s adjuvant

PAGE 110

94 therapy for enhanced chemosensitization. Clearly, further studies are warranted to exploit the therapeutic potential of these emerging and dynamic cancer regulators

PAGE 111

95 CHAPTER V CONCLUDING REMARKS Although most studies have focused on the role of angiogenic regulators for cancer development ( 37 42 53 65 ) angiogenesis involves a delicate balance between angiostatic and angiogenic regulators and dysregulation of angiostatic regulators also contributes to neoplastic transformation, promotes tumor progression, and supports chemoresistanc e. Therefore, given the overall poor outcome of patients with ovarian cancer filling fundamental gaps in knowledge regarding dysregulation of angiostatic regulators is both positively and clinically relevant for therapeutic implications. Novel findings herein define new role s for the angiostatic regulators AS and SEMA 3F, in ovarian cancer. We report that AS, a potent inhibitor of angiogenesis, may be a useful urinary biomarker of high grade and early stage ovarian carcinomas. uAS was shown to effecti vely discriminate normal healthy individuals from women with a broad range of benign gynecological pathologies, as well as ovari an cancer patients. However, g iven that several genetic insults are required for malignant transformation of OSE into neoplasti c cells and since so many environmental variables influence the effectiveness of a screening method for ovarian cancer,

PAGE 112

96 the possibility of a single biomarker to detect ovarian cancer seems unlikely. Recall, a recently proposed pathway which postulates tha t components of the Mllerian system, including the fallopian tube, may be the source of high grade serous epithelial ovarian cancer rather than, or in addition to, the more traditionally accepted OSE ( 19 20 ) This alternative cell of origin has been carcinoma (STIC) and high grade serous histological subtypes ( 26 ) Similarly, the over exp ression of high mobility group AT hook 2 (HMGA2) occurs in 70 80% of high grade serous ovarian carcinomas and STIC and may represent an additional biomarker candidate ( 188 ) Therefore, establishing an association of high grade serous carcinoma growth with increased production of p53, HMGA 2 and/or other HMG family members, may identify additional ovarian cancer biomarkers in urine as well as other readily available bodily fluids such as saliva as done for other diseases ( 140 188 189 ) Consequently, the future of early ovarian cancer detection is likely reliant upon the development of a panel of biomarkers, possibly including uAS, that collectively complement one another and meet the requirements for sensitivity, without compromising specificity. Such a sophisticated panel of biomarkers in conjunction with CA125, could then be used to augment imaging technologies and provide a viable two step approach to screening. Certainly, improvements in early detection of ovarian cancer will r educe the mortality associated with this insidious disease.

PAGE 113

97 This work also established a clinical and molecular relationship between loss of SEMA F expression with EOC progression and in agreement with previous studies suggesting a tumor suppressor like role for SEMA3F ( 108 149 150 159 ) In agreement w ith studies indicating calcium regulates SEMA3s in the nervous system, we found that SEMA3F was negatively regulated in a calcium/CREB dependent manner in ovarian cancer cells while specific GC regions in the SEMA3F promoter are essential for SEMA3F expres sion in our ovarian model system. In an attempt to expand upon the antagonistic relationship between SEMA3F and VEGF, we found an inverse relationship between SEMA3F expression and telomerase activity in IOSE and ovarian cancer cell lines so that, this is the first report to identify telomerase as a novel molecular target of SEMA3F. Consequently, loss of SEMA3F not only alleviates competition with VEGF which promotes angiogenesis, but also induces telomerase activity which confers immortality, tumor aggres siveness, and chemosensitivity. These studies, then, further support the antagonistic relationship between SEMA3F and VEGF such that activation of common co receptors may activate different signaling pathways which results in opposing effects on a common downstream molecular target (Figure 18). Future studies are warranted to delineate the mechanisms contributing to SEMA3F function and dysregulation in ovarian cancer especially as it may pertain to tumor angiogenesis but also with regards to normal physio logical ovarian processes.

PAGE 114

98 Figure 18 Schematic of proposed SEMA3F signaling pathway. In this s chematic representation of the antagonistic relationship between SEMA3F and VEGF, we illustrate our findings of an opposing effect on a common downstream molecular target, telomerase. We found that SEMA3F uses contrasting signaling pathways compared to VE GF. Additionally, SEMA3F could transcriptionally target specific regions of the hTERT promoter alternative to regions targeted by VEGF.

PAGE 115

99 Lastly, AS is generated by cancer mediated proteolysis of plasminogen and this is supported by reports identifying ad ditional plasminogen cleavage products which demonstrate different degrees of angiostatic potency ( 75 77 ) Similar to AS, s everal lines of evidence implicate that regulati on of SEMA3s, including SEMA3F, also invol ve proteolytic processing by pro protein convertases, which are a family of calcium dependent serine endopeptidases ( 190 192 ) These enzymes cleave substrates like hormones, growth factors, or neuropeptides, at specific consensus sequences to facilit ate maturation from an inactive precursor form t o biologically active peptides ( 190 ) Interestingly, all SEMA3s contain a conserved RXRR sequence in the C terminal region, which is the major recognition site of the best studied pro protein convertase, furin ( 190 ) Most recently it has been obse rved that furin processing of SEMA3F can affect its angiostatic potency ( 191 ) Likewise, furin like pro protein convertases reportedly target SEMA3B and render it inactivate (Varshavsky 18757406). Furin has been associated with enhanced tumor invasiveness and metastasis since many su bstrates it activates are cancer associated proteins ( 193 ) Overall, proteolytic processin g by furin and other pro protein convertases can either activate or inactivate SEMA3 signaling ( 191 ) Taken our findings that calcium suppressed SEMA3F and given that furin is calcium dependent, in our ovarian model system proteolytic processing may be an important mechanism involved in SEMA3F regulation. Since elevated le vels of proteases have been linked to the malignant phenotype in a wide variety of tumors, including serous epithelial carcinoma of the ovary ( 125 ) future studies investigating dysregulation

PAGE 116

100 of angioregulators, including the interrelationships between AS and SEMA3F, may provide clinically important information about the consequences of aberrant expression of enzymes and proteins involved in proteoly tic cleavage. In summary, research focused on angiostatic regulators, such as AS and SEMA 3F, may not only benefit ovarian cancer patients, but may also have im plications for other cancers. By elucidating the mechanism(s) responsible for dysregulation of SEMA3F, it may be possible to deve lop a therapeutic intervention that would not only disturb the vasculature by acting as a VEGF competitor but by targeting telomerase positive cells, could act specifically on tumor cells. Likewise, AS not only has ther apeutic potential but has promise as a biomarker for early detection of ovarian cancer. Therefore, a broader understanding of the wider roles of angiostatic regulators, as well as delineating the molecular mechanisms contributing to dysregulation of angio static regulators can provide insight into the etiology, clinical presentation and treatment of ovarian cancer. This may eventually allow women more choices for treatment and hopefully, reduce the mortality associated with this insidious disease.

PAGE 117

101 LIS T OF REFERENCE S 1. Jemal A, Siegel R, Xu J, Ward E. Cancer statistics, 2010. CA Cancer J Clin.60(5):277 300. 2. Coleman MP, Esteve J, Damiecki P, Arslan A, Renard H. Trends in cancer incidence and mortality. IARC Sci Publ. 1993(121):1 806. 3. Scully RE. Pathology of ovarian cancer precursors. J Cell Biochem Suppl. 1995;23:208 18. 4. Shelling AN, Foulkes W. Molecular genetics of ovarian cancer. Mol Biotechnol. 2001;19(1):13 28. 5. Chu CS, Rubin SC. Screening for ovarian ca ncer in the general population. Best Pract Res Clin Obstet Gynaecol. 2006;20(2):307 20. 6. Cramer DW, Hutchison GB, Welch WR, Scully RE, Knapp RC. Factors affecting the association of oral contraceptives and ovarian cancer. N Engl J Med. 1982;307(17):1047 51. 7. Williams TI, Toups KL, Saggese DA, Kalli KR, Cliby WA, Muddiman DC. Epithelial ovarian cancer: disease etiology, treatment, detection, and investigational gene, metabolite, and protein biomarkers. J Proteome Res. 2007;6(8):2936 62. 8. Auersperg N, Maines Bandiera SL, Dyck HG, Kruk PA. Characterization of cultured human ovarian surface epithelial cells: phenotypic plasticity and premalignant changes. Lab Invest. 1994;71(4):510 8. 9. Pieretti M, Hopenhayn Rich C, Khattar NH, Cao Y, Huang B, Tucker TC. Heterogeneity of ovarian cancer: relationships among histological group, stage of disease, tumor markers, patient characteristics, and survival. Cancer Invest. 2002;20(1):11 23.

PAGE 118

102 10. Hollingsworth HC, Kohn EC, Steinberg SM, Rothenberg ML, Merino MJ. T umor angiogenesis in advanced stage ovarian carcinoma. Am J Pathol. 1995;147(1):33 41. 11. Fathalla MF. Incessant ovulation -a factor in ovarian neoplasia? Lancet. 1971;2(7716):163. 12. Godwin AK, Testa JR, Handel LM, Liu Z, Vanderveer LA, Tracey PA, et al. Spontaneous transformation of rat ovarian surface epithelial cells: association with cytogenetic changes and implications of repeated ovulation in the etiology of ovarian cancer. J Natl Cancer Inst. 1992;84(8):592 601. 13. Nicosia SV, Johnson JH. Surf ace morphology of ovarian mesothelium (surface epithelium) and of other pelvic and extrapelvic mesothelial sites in the rabbit. Int J Gynecol Pathol. 1984;3(3):249 60. 14. Casagrande JT, Louie EW, Pike MC, Roy S, Ross RK, Henderson BE. "Incessant ovulatio n" and ovarian cancer. Lancet. 1979;2(8135):170 3. 15. Cramer DW, Welch WR. Determinants of ovarian cancer risk. II. Inferences regarding pathogenesis. J Natl Cancer Inst. 1983;71(4):717 21. 16. Stadel BV. Letter: The etiology and prevention of ovarian c ancer. Am J Obstet Gynecol. 1975;123(7):772 4. 17. Vihko KK. Gonadotropins and ovarian gonadotropin receptors during the perimenopausal transition period. Maturitas. 1996;23 Suppl:S19 22. 18. Parrott JA, Doraiswamy V, Kim G, Mosher R, Skinner MK. Express ion and actions of both the follicle stimulating hormone receptor and the luteinizing hormone receptor in normal ovarian surface epithelium and ovarian cancer. Mol Cell Endocrinol. 2001;172(1 2):213 22. 19. Dubeau L. The cell of origin of ovarian epitheli al tumours. Lancet Oncol. 2008;9(12):1191 7. 20. Piek JM, Kenemans P, Verheijen RH. Intraperitoneal serous adenocarcinoma: a critical appraisal of three hypotheses on its cause. Am J Obstet Gynecol. 2004;191(3):718 32. 21. Weinberg RA. The molecular basis of oncogenes and tumor suppressor genes. Ann N Y Acad Sci. 1995;758:331 8.

PAGE 119

103 22. Slamon DJ, Godolphin W, Jones LA, Holt JA, Wong SG, Keith DE, et al. Studies of the HER 2/neu proto oncogene in human breast and ovarian cancer. Science. 1989;244(4905):7 07 12. 23. Hennessy BT, Mills GB. Ovarian cancer: homeobox genes, autocrine/paracrine growth, and kinase signaling. Int J Biochem Cell Biol. 2006;38(9):1450 6. 24. Naora H. The heterogeneity of epithelial ovarian cancers: reconciling old and new paradigm s. Expert Rev Mol Med. 2007;9(13):1 12. 25. Siemens CH, Auersperg N. Serial propagation of human ovarian surface epithelium in tissue culture. J Cell Physiol. 1988;134(3):347 56. 26. Lee Y, Miron A, Drapkin R, Nucci MR, Medeiros F, Saleemuddin A, et al. A candidate precursor to serous carcinoma that originates in the distal fallopian tube. J Pathol. 2007;211(1):26 35. 27. Bast RC, Jr., Badgwell D, Lu Z, Marquez R, Rosen D, Liu J, et al. New tumor markers: CA125 and beyond. Int J Gynecol Cancer. 2005;15 S uppl 3:274 81. 28. An HJ, Miyamoto S, Lancaster KS, Kirmiz C, Li B, Lam KS, et al. Profiling of glycans in serum for the discovery of potential biomarkers for ovarian cancer. J Proteome Res. 2006;5(7):1626 35. 29. Bourne TH, Campbell S, Reynolds KM, Whit ehead MI, Hampson J, Royston P, et al. Screening for early familial ovarian cancer with transvaginal ultrasonography and colour blood flow imaging. Bmj. 1993;306(6884):1025 9. 30. Sato S, Yokoyama Y, Sakamoto T, Futagami M, Saito Y. Usefulness of mass scr eening for ovarian carcinoma using transvaginal ultrasonography. Cancer. 2000;89(3):582 8. 31. van Nagell JR, Jr., DePriest PD, Reedy MB, Gallion HH, Ueland FR, Pavlik EJ, et al. The efficacy of transvaginal sonographic screening in asymptomatic women at risk for ovarian cancer. Gynecol Oncol. 2000;77(3):350 6. 32. Skates SJ, Xu FJ, Yu YH, Sjovall K, Einhorn N, Chang Y, et al. Toward an optimal algorithm for ovarian cancer screening with longitudinal tumor markers. Cancer. 1995;76(10 Suppl):2004 10.

PAGE 120

104 33. S utphen R, Xu Y, Wilbanks GD, Fiorica J, Grendys EC, Jr., LaPolla JP, et al. Lysophospholipids are potential biomarkers of ovarian cancer. Cancer Epidemiol Biomarkers Prev. 2004;13(7):1185 91. 34. Xu Y, Shen Z, Wiper DW, Wu M, Morton RE, Elson P, et al. Ly sophosphatidic acid as a potential biomarker for ovarian and other gynecologic cancers. Jama. 1998;280(8):719 23. 35. Anderson NS, Bermudez Y, Badgwell D, Chen R, Nicosia SV, Bast RC, Jr., et al. Urinary levels of Bcl 2 are elevated in ovarian cancer patients. Gynecol Oncol. 2009;112(1):60 7. 36. Badgwell D, Lu Z, Cole L, Fritsche H, Atkinson EN, Somers E, et al. Urinary mesothelin provides greater sensitivity for early stage ovarian cancer than serum mesothelin, urinary hCG free beta subunit and urin ary hCG beta core fragment. Gynecol Oncol. 2007;106(3):490 7. 37. Folkman J. Tumor angiogenesis. Adv Cancer Res. 1985;43:175 203. 38. Wagner RC. Endothelial Cell Embryology and Growth. In: Altura BM, editor. Advances in microcirculation. Basel: New York; 1980. p. 45 75. 39. Jakob W, Jentzsch KD, Mauersberger B, Oehme P. Demonstration of angiogenesis activity in the corpus luteum of cattle. Exp Pathol (Jena). 1977;13(4 5):231 6. 40. Fromer CH, Klintworth GK. An evaluation of the role of leukocytes in the pathogenesis of experimentally induced corneal vascularization. Am J Pathol. 1975;79(3):537 54. 41. Sidky YA, Auerbach R. Lymphocyte induced angiogenesis: a quantitative and sensitive assay of the graft vs. host reaction. J Exp Med. 1975;141(5):1084 100. 42. Holleb AI, Folkman J. Tumor angiogenesis. CA Cancer J Clin. 1972;22(4):226 9. 43. Gross JL, Moscatelli D, Jaffe EA, Rifkin DB. Plasminogen activator and collagenase production by cultured capillary endothelial cells. J Cell Biol. 1982;95(3):974 81. 44. Kalebic T, Garbisa S, Glaser B, Liotta LA. Basement membrane collagen: degradation by migrating endothelial cells. Science. 1983;221(4607):281 3.

PAGE 121

105 45. Madri JA, Williams SK. Capillary endothelial cell cultures: phenotypic modulation by matrix component s. J Cell Biol. 1983;97(1):153 65. 46. Ausprunk DH, Folkman J. Migration and proliferation of endothelial cells in preformed and newly formed blood vessels during tumor angiogenesis. Microvasc Res. 1977;14(1):53 65. 47. Nicosia RF, Tchao R, Leighton J. A ngiogenesis dependent tumor spread in reinforced fibrin clot culture. Cancer Res. 1983;43(5):2159 66. 48. Covassin L, Amigo JD, Suzuki K, Teplyuk V, Straubhaar J, Lawson ND. Global analysis of hematopoietic and vascular endothelial gene expression by tiss ue specific microarray profiling in zebrafish. Dev Biol. 2006;299(2):551 62. 49. Martyn U, Schulte Merker S. Zebrafish neuropilins are differentially expressed and interact with vascular endothelial growth factor during embryonic vascular development. Dev Dyn. 2004;231(1):33 42. 50. Armstrong LC, Bornstein P. Thrombospondins 1 and 2 function as inhibitors of angiogenesis. Matrix Biol. 2003;22(1):63 71. 51. Flowers B, Cantley TC, Martin MJ, Day BN. Episodic secretion of gonadotrophins and ovarian steroids in jugular and utero ovarian vein plasma during the follicular phase of the oestrous cycle in gilts. J Reprod Fertil. 1991;91(1):101 12. 52. Nicosia RF, Villaschi S. Autoregulation of angiogenesis by cells of the vessel wall. Int Rev Cytol. 1999;185:1 43 53. Ferrara N. Vascular endothelial growth factor: basic science and clinical progress. Endocr Rev. 2004;25(4):581 611. 54. Taylor PD, Hillier SG, Fraser HM. Effects of GnRH antagonist treatment on follicular development and angiogenesis in the primate ovary. J Endocrinol. 2004;183(1):1 17. 55. Frederick JL, Shimanuki T, diZerega GS. Initiation of angiogenesis by human follicular fluid. Science. 1984;224(4647):389 90. 56. Zimmermann RC, Xiao E, Bohlen P, Ferin M. Administration of antivascular endothe lial growth factor receptor 2 antibody in the early follicular phase delays follicular selection and development in the rhesus monkey. Endocrinology. 2002;143(7):2496 502.

PAGE 122

106 57. Zimmermann RC, Xiao E, Husami N, Sauer MV, Lobo R, Kitajewski J, et al. Short te rm administration of antivascular endothelial growth factor antibody in the late follicular phase delays follicular development in the rhesus monkey. J Clin Endocrinol Metab. 2001;86(2):768 72. 58. McClure N, Macpherson AM, Healy DL, Wreford N, Rogers PA. An immunohistochemical study of the vascularization of the human Graafian follicle. Hum Reprod. 1994;9(8):1401 5. 59. Jaffe RB, Midgley AR, Jr., Goebelsmann U, Snyder DL. Regulation of human gonadotropins. Gynecol Invest. 1970;1(3):169 78. 60. Azmi TI, O'Shea JD. Mechanism of deletion of endothelial cells during regression of the corpus luteum. Lab Invest. 1984;51(2):206 17. 61. Zhang Z, Yu Y, Xu F, Berchuck A, van Haaften Day C, Havrilesky LJ, et al. Combining multiple serum tumor markers improves detec tion of stage I epithelial ovarian cancer. Gynecol Oncol. 2007;107(3):526 31. PMCID: 2171045. 62. Gospodarowicz D, Thakral KK. Production a corpus luteum angiogenic factor responsible for proliferation of capillaries and neovascularization of the corpus l uteum. Proc Natl Acad Sci U S A. 1978;75(2):847 51. 63. Nicosia SV, Diaz J, Nicosia RF, Saunders BO, Muro Cacho C. Cell proliferation and apoptosis during development and aging of the rabbit corpus luteum. Ann Clin Lab Sci. 1995;25(2):143 57. 64. Folkman J. Tumor angiogenesis: therapeutic implications. N Engl J Med. 1971;285(21):1182 6. 65. Ziche M, Gullino PM. Angiogenesis and neoplastic progression in vitro. J Natl Cancer Inst. 1982;69(2):483 7. 66. Brem SS, Gullino PM, Medina D. Angiogenesis: a marke r for neoplastic transformation of mammary papillary hyperplasia. Science. 1977;195(4281):880 2. 67. Brem SS, Jensen HM, Gullino PM. Angiogenesis as a marker of preneoplastic lesions of the human breast. Cancer. 1978;41(1):239 44.

PAGE 123

107 68. Deane BR, Lantos PL The vasculature of experimental brain tumours. Part 2. A quantitative assessment of morphological abnormalities. J Neurol Sci. 1981;49(1):67 77. 69. Hirano A, Matsui T. Vascular structures in brain tumors. Hum Pathol. 1975;6(5):611 21. 70. Maniotis AJ, Folberg R, Hess A, Seftor EA, Gardner LM, Pe'er J, et al. Vascular channel formation by human melanoma cells in vivo and in vitro: vasculogenic mimicry. Am J Pathol. 1999;155(3):739 52. 71. Richardson M, Gunawan J, Hatton MW, Seidlitz E, Hirte HW, Singh G Malignant ascites fluid (MAF), including ovarian cancer associated MAF, contains angiostatin and other factor(s) which inhibit angiogenesis. Gynecol Oncol. 2002;86(3):279 87. 72. Hazelton D, Nicosia RF, Nicosia SV. Vascular endothelial growth factor lev els in ovarian cyst fluid correlate with malignancy. Clin Cancer Res. 1999;5(4):823 9. 73. Jandu N, Richardson M, Singh G, Hirte H, Hatton MW. Human ovarian cancer ascites fluid contains a mixture of incompletely degraded soluble products of fibrin that collectively possess an antiangiogenic property. Int J Gynecol Cancer. 2006;16(4):1536 44. 74. O'Reilly MS, Holmgren L, Shing Y, Chen C, Rosenthal RA, Moses M, et al. Angiostatin: a novel angiogenesis inhibitor that mediates the suppression of metastases by a Lewis lung carcinoma. Cell. 1994;79(2):315 28. 75. Machovich R, Owen WG. An elastase dependent pathway of plasminogen activation. Biochemistry. 1989;28(10):4517 22. 76. Soff GA. Angiostatin and angiostatin related proteins. Cancer Metastasis Rev. 2000;19(1 2):97 107. 77. Stathakis P, Lay AJ, Fitzgerald M, Schlieker C, Matthias LJ, Hogg PJ. Angiostatin formation involves disulfide bond reduction and proteolysis in kringle 5 of plasmin. J Biol Chem. 1999;274(13):8910 6. 78. Moser TL, Stack MS, Aspl in I, Enghild JJ, Hojrup P, Everitt L, et al. Angiostatin binds ATP synthase on the surface of human endothelial cells. Proc Natl Acad Sci U S A. 1999;96(6):2811 6. 79. Carmeliet P, Tessier Lavigne M. Common mechanisms of nerve and blood vessel wiring. Na ture. 2005;436(7048):193 200.

PAGE 124

108 80. Klagsbrun M, Eichmann A. A role for axon guidance receptors and ligands in blood vessel development and tumor angiogenesis. Cytokine Growth Factor Rev. 2005;16(4 5):535 48. 81. Larrivee B, Freitas C, Suchting S, Brunet I Eichmann A. Guidance of vascular development: lessons from the nervous system. Circ Res. 2009;104(4):428 41. 82. Neufeld G, Shraga Heled N, Lange T, Guttmann Raviv N, Herzog Y, Kessler O. Semaphorins in cancer. Front Biosci. 2005;10:751 60. 83. Koppel AM, Feiner L, Kobayashi H, Raper JA. A 70 amino acid region within the semaphorin domain activates specific cellular response of semaphorin family members. Neuron. 1997;19(3):531 7. 84. Bork P, Doerks T, Springer TA, Snel B. Domains in plexins: links to i ntegrins and transcription factors. Trends Biochem Sci. 1999;24(7):261 3. 85. He Z, Tessier Lavigne M. Neuropilin is a receptor for the axonal chemorepellent Semaphorin III. Cell. 1997;90(4):739 51. 86. Kolodkin AL, Levengood DV, Rowe EG, Tai YT, Giger RJ Ginty DD. Neuropilin is a semaphorin III receptor. Cell. 1997;90(4):753 62. 87. Tamagnone L, Artigiani S, Chen H, He Z, Ming GI, Song H, et al. Plexins are a large family of receptors for transmembrane, secreted, and GPI anchored semaphorins in vertebra tes. Cell. 1999;99(1):71 80. 88. Oinuma I, Ishikawa Y, Katoh H, Negishi M. The Semaphorin 4D receptor Plexin B1 is a GTPase activating protein for R Ras. Science. 2004;305(5685):862 5. 89. Soker S, Takashima S, Miao HQ, Neufeld G, Klagsbrun M. Neuropilin 1 is expressed by endothelial and tumor cells as an isoform specific receptor for vascular endothelial growth factor. Cell. 1998;92(6):735 45. 90. Fuh G, Garcia KC, de Vos AM. The interaction of neuropilin 1 with vascular endothelial growth factor and its receptor flt 1. J Biol Chem. 2000;275(35):26690 5. 91. Gluzman Poltorak Z, Cohen T, Herzog Y, Neufeld G. Neuropilin 2 is a receptor for the vascular endothelial growth factor (VEGF) forms VEGF 145 and VEGF 165 [corrected]. J Biol Chem. 2000;275(24):18 040 5.

PAGE 125

109 92. Gluzman Poltorak Z, Cohen T, Shibuya M, Neufeld G. Vascular endothelial growth factor receptor 1 and neuropilin 2 form complexes. J Biol Chem. 2001;276(22):18688 94. 93. West DC, Rees CG, Duchesne L, Patey SJ, Terry CJ, Turnbull JE, et al. Int eractions of multiple heparin binding growth factors with neuropilin 1 and potentiation of the activity of fibroblast growth factor 2. J Biol Chem. 2005;280(14):13457 64. 94. Toyofuku T, Zhang H, Kumanogoh A, Takegahara N, Suto F, Kamei J, et al. Dual rol es of Sema6D in cardiac morphogenesis through region specific association of its receptor, Plexin A1, with off track and vascular endothelial growth factor receptor type 2. Genes Dev. 2004;18(4):435 47. PMCID: 359397. 95. Yazdani U, Terman JR. The semapho rins. Genome Biol. 2006;7(3):211. 96. Chen H, Chedotal A, He Z, Goodman CS, Tessier Lavigne M. Neuropilin 2, a novel member of the neuropilin family, is a high affinity receptor for the semaphorins Sema E and Sema IV but not Sema III. Neuron. 1997;19(3):5 47 59. 97. Gu C, Limberg BJ, Whitaker GB, Perman B, Leahy DJ, Rosenbaum JS, et al. Characterization of neuropilin 1 structural features that confer binding to semaphorin 3A and vascular endothelial growth factor 165. J Biol Chem. 2002;277(20):18069 76. 9 8. Karpanen T, Heckman CA, Keskitalo S, Jeltsch M, Ollila H, Neufeld G, et al. Functional interaction of VEGF C and VEGF D with neuropilin receptors. FASEB J. 2006;20(9):1462 72. 99. Makinen T, Olofsson B, Karpanen T, Hellman U, Soker S, Klagsbrun M, et a l. Differential binding of vascular endothelial growth factor B splice and proteolytic isoforms to neuropilin 1. J Biol Chem. 1999;274(30):21217 22. 100. Sulpice E, Plouet J, Berge M, Allanic D, Tobelem G, Merkulova Rainon T. Neuropilin 1 and neuropilin 2 act as coreceptors, potentiating proangiogenic activity. Blood. 2008;111(4):2036 45. 101. Wise LM, Ueda N, Dryden NH, Fleming SB, Caesar C, Roufail S, et al. Viral vascular endothelial growth factors vary extensively in amino acid sequence, receptor bind ing specificities, and the ability to induce vascular permeability yet are uniformly active mitogens. J Biol Chem. 2003;278(39):38004 14.

PAGE 126

110 102. Gu C, Yoshida Y, Livet J, Reimert DV, Mann F, Merte J, et al. Semaphorin 3E and plexin D1 control vascular patter n independently of neuropilins. Science. 2005;307(5707):265 8. 103. Bachelder RE, Lipscomb EA, Lin X, Wendt MA, Chadborn NH, Eickholt BJ, et al. Competing autocrine pathways involving alternative neuropilin 1 ligands regulate chemotaxis of carcinoma cells Cancer Res. 2003;63(17):5230 3. 104. Miao HQ, Soker S, Feiner L, Alonso JL, Raper JA, Klagsbrun M. Neuropilin 1 mediates collapsin 1/semaphorin III inhibition of endothelial cell motility: functional competition of collapsin 1 and vascular endothelial growth factor 165. J Cell Biol. 1999;146(1):233 42. 105. Luo Y, Raible D, Raper JA. Collapsin: a protein in brain that induces the collapse and paralysis of neuronal growth cones. Cell. 1993;75(2):217 27. 106. Kusy S, Potiron V, Zeng C, Franklin W, Bramb illa E, Minna J, et al. Promoter characterization of Semaphorin SEMA3F, a tumor suppressor gene. Biochim Biophys Acta. 2005;1730(1):66 76. 107. Zabarovsky ER, Lerman MI, Minna JD. Tumor suppressor genes on chromosome 3p involved in the pathogenesis of lung and other cancers. Oncogene. 2002;21(45):6915 35. 108. Xiang R, Davalos AR, Hensel CH, Zhou XJ, Tse C, Naylor SL. Semaphorin 3F gene from human 3p21.3 suppresses tumor formation in nude mice. Cancer Res. 2002;62(9):2637 43. 109. Potiron VA, Sharma G Nasarre P, Clarhaut JA, Augustin HG, Gemmill RM, et al. Semaphorin SEMA3F affects multiple signaling pathways in lung cancer cells. Cancer Res. 2007;67(18):8708 15. 110. Brambilla E, Constantin B, Drabkin H, Roche J. Semaphorin SEMA3F localization in ma lignant human lung and cell lines: A suggested role in cell adhesion and cell migration. Am J Pathol. 2000;156(3):939 50. PMCID: 1876858. 111. Osada R, Horiuchi A, Kikuchi N, Ohira S, Ota M, Katsuyama Y, et al. Expression of semaphorins, vascular endothel ial growth factor, and their common receptor neuropilins and alleic loss of semaphorin locus in epithelial ovarian neoplasms: increased ratio of vascular endothelial growth factor to semaphorin is a poor prognostic factor in ovarian carcinomas. Hum Pathol. 2006;37(11):1414 25.

PAGE 127

111 112. Clarhaut J, Gemmill RM, Potiron VA, Ait Si Ali S, Imbert J, Drabkin HA, et al. ZEB 1, a repressor of the semaphorin 3F tumor suppressor gene in lung cancer cells. Neoplasia. 2009;11(2):157 66. PMCID: 2631140. 113. Futamura M, Ka mino H, Miyamoto Y, Kitamura N, Nakamura Y, Ohnishi S, et al. Possible role of semaphorin 3F, a candidate tumor suppressor gene at 3p21.3, in p53 regulated tumor angiogenesis suppression. Cancer Res. 2007;67(4):1451 60. 114. Jemal A, Siegel R, Ward E, Hao Y, Xu J, Murray T, et al. Cancer statistics, 2008. CA Cancer J Clin. 2008;58(2):71 96. 115. Bast RC, Jr., Brewer M, Zou C, Hernandez MA, Daley M, Ozols R, et al. Prevention and early detection of ovarian cancer: mission impossible? Recent Results Cancer Res. 2007;174:91 100. 116. Moore RG, Brown AK, Miller MC, Skates S, Allard WJ, Verch T, et al. The use of multiple novel tumor biomarkers for the detection of ovarian carcinoma in patients with a pelvic mass. Gynecol Oncol. 2008;108(2):402 8. 117. Rosen DG, Wang L, Atkinson JN, Yu Y, Lu KH, Diamandis EP, et al. Potential markers that complement expression of CA125 in epithelial ovarian cancer. Gynecol Oncol. 2005;99(2):267 77. 118. S. V. Nicosia NNKK, B. Oliveros Saunders, G. Giacomini, E. Pierro, J. Mayer, and R.F. Nicosia. Ovarian Mesothelium (Surface Epithelium) in Normal, Pathological and Experimental Conditions. In: Motta PM, editor. Recent Advances in Microscopy of Cells, Tissues, and Organs. Rome: Antonio Delfino Editore; 1997. p. 509 17. 119. H olash J, Wiegand SJ, Yancopoulos GD. New model of tumor angiogenesis: dynamic balance between vessel regression and growth mediated by angiopoietins and VEGF. Oncogene. 1999;18(38):5356 62. 120. Rubatt JM, Darcy KM, Hutson A, Bean SM, Havrilesky LJ, Grace LA, et al. Independent prognostic relevance of microvessel density in advanced epithelial ovarian cancer and associations between CD31, CD105, p53 status, and angiogenic marker expression: A Gynecologic Oncology Group study. Gynecol Oncol. 2009;112(3):469 74.

PAGE 128

112 121. Alvarez Secord A, Sayer R, Snyder SA, Broadwater G, Rodriguez GC, Berchuck A, et al. The relationship between serum vascular endothelial growth factor, persistent disease, and survival at second look laparotomy in ovarian cancer. Gynecol Oncol. 2004;94(1):74 9. 122. Fuhrmann Benzakein E, Ma MN, Rubbia Brandt L, Mentha G, Ruefenacht D, Sappino AP, et al. Elevated levels of angiogenic cytokines in the plasma of cancer patients. Int J Cancer. 2000;85(1):40 5. 123. Nguyen M, Watanabe H, Budson AE, Richie JP, Hayes DF, Folkman J. Elevated levels of an angiogenic peptide, basic fibroblast growth factor, in the urine of patients with a wide spectrum of cancers. J Natl Cancer Inst. 1994;86(5):356 61. 124. Sowter HM, Corps AN, Smith SK. Hepatocyte growt h factor (HGF) in ovarian epithelial tumour fluids stimulates the migration of ovarian carcinoma cells. Int J Cancer. 1999;83(4):476 80. 125. Murthi P, Barker G, Nowell CJ, Rice GE, Baker MS, Kalionis B, et al. Plasminogen fragmentation and increased prod uction of extracellular matrix degrading proteinases are associated with serous epithelial ovarian cancer progression. Gynecol Oncol. 2004;92(1):80 8. 126. Nathan FE, Hernandez E, Dunton CJ, Treat J, Switalska HI, Joseph RR, et al. Plasma thrombospondin l evels in patients with gynecologic malignancies. Cancer. 1994;73(11):2853 8. 127. Yabushita H, Noguchi M, Obayashi Y, Kishida T, Noguchi Y, Sawaguchi K, et al. Angiostatin expression in ovarian cancer. Oncol Rep. 2003;10(5):1225 30. 128. Yokoyama Y, Sedg ewick G, Ramakrishnan S. Endostatin binding to ovarian cancer cells inhibits peritoneal attachment and dissemination. Cancer Res. 2007;67(22):10813 22. 129. Cao Y, Veitonmaki N, Keough K, Cheng H, Lee LS, Zurakowski D. Elevated levels of urine angiostatin and plasminogen/plasmin in cancer patients. Int J Mol Med. 2000;5(5):547 51. 130. Linder Stragliotto C, Strander H, Munck Wikland E, Sten Linder M. Low levels of endostatin in the urine from patients with malignant disease. Tumour Biol. 2002;23(4):222 7.

PAGE 129

113 131. Sten Linder M, Linder C, Strander H, Munck Wikland E, Wersall P, Linder S, et al. Angiostatin fragments in urine from patients with malignant disease. Anticancer Res. 1999;19(4C):3409 14. 132. Lu KH, Patterson AP, Wang L, Marquez RT, Atkinson EN, Baggerly KA, et al. Selection of potential markers for epithelial ovarian cancer with gene expression arrays and recursive descent partition analysis. Clin Cancer Res. 2004;10(10):3291 300. 133. Nicosia SV, Wilbanks GD, Saunders B, Mayer J, Cardosi RJ, Kr uk PA, et al. Cytology of human ovarian surface epithelial brushings. Cancer. 2004;102(1):1 10. 134. Folkman J. Fighting cancer by attacking its blood supply. Sci Am. 1996;275(3):150 4. 135. Zhou HY, Pon YL, Wong AS. HGF/MET signaling in ovarian cancer. Curr Mol Med. 2008;8(6):469 80. 136. Hata K, Dhar DK, Kanasaki H, Nakayama K, Fujiwaki R, Katabuchi H, et al. Serum endostatin levels in patients with epithelial ovarian cancer. Anticancer Res. 2003;23(2C):1907 12. 137. Perri SR, Martineau D, Francois M, Lejeune L, Bisson L, Durocher Y, et al. Plasminogen Kringle 5 blocks tumor progression by antiangiogenic and proinflammatory pathways. Mol Cancer Ther. 2007;6(2):441 9. 138. Yokoyama Y, Dhanabal M, Griffioen AW, Sukhatme VP, Ramakrishnan S. Synergy betwe en angiostatin and endostatin: inhibition of ovarian cancer growth. Cancer Res. 2000;60(8):2190 6. 139. Persano L, Crescenzi M, Indraccolo S. Anti angiogenic gene therapy of cancer: current status and future prospects. Mol Aspects Med. 2007;28(1):87 114. 140. Lawrence HP. Salivary markers of systemic disease: noninvasive diagnosis of disease and monitoring of general health. J Can Dent Assoc. 2002;68(3):170 4. 141. Jemal A, Siegel R, Ward E, Hao Y, Xu J, Thun MJ. Cancer statistics, 2009. CA Cancer J Clin. 2009;59(4):225 49.

PAGE 130

114 142. Nasarre P, Kusy S, Constantin B, Castellani V, Drabkin HA, Bagnard D, et al. Semaphorin SEMA3F has a repulsing activity on breast cancer cells and inhibits E cadherin mediated cell adhesion. Neoplasia. 2005;7(2):180 9. PMCID: 1501131. 143. Neufeld G, Kessler O. The semaphorins: versatile regulators of tumour progression and tumour angiogenesis. Nat Rev Cancer. 2008;8(8):632 45. 144. Giger RJ, Urquhart ER, Gillespie SK, Levengood DV, Ginty DD, Kolodkin AL. Neuropilin 2 is a r eceptor for semaphorin IV: insight into the structural basis of receptor function and specificity. Neuron. 1998;21(5):1079 92. 145. Takahashi T, Nakamura F, Jin Z, Kalb RG, Strittmatter SM. Semaphorins A and E act as antagonists of neuropilin 1 and agonists of neuropilin 2 receptors. Nat Neurosci. 1998;1(6):487 93. 146. Suto F, Murakami Y, Nakamura F, Goshima Y, Fujisawa H. Identification and characterization of a novel mouse plexin, plexin A4. Mech Dev. 2003;120(3):385 96. 147. Takahashi T, Fourni er A, Nakamura F, Wang LH, Murakami Y, Kalb RG, et al. Plexin neuropilin 1 complexes form functional semaphorin 3A receptors. Cell. 1999;99(1):59 69. 148. Takahashi T, Strittmatter SM. Plexina1 autoinhibition by the plexin sema domain. Neuron. 2001;29(2): 429 39. 149. Kessler O, Shraga Heled N, Lange T, Gutmann Raviv N, Sabo E, Baruch L, et al. Semaphorin 3F is an inhibitor of tumor angiogenesis. Cancer Res. 2004;64(3):1008 15. 150. Bielenberg DR, Hida Y, Shimizu A, Kaipainen A, Kreuter M, Kim CC, et al. Semaphorin 3F, a chemorepulsant for endothelial cells, induces a poorly vascularized, encapsulated, nonmetastatic tumor phenotype. J Clin Invest. 2004;114(9):1260 71. PMCID: 524226. 151. Nasarre P, Constantin B, Rouhaud L, Harnois T, Raymond G, Drabkin HA et al. Semaphorin SEMA3F and VEGF have opposing effects on cell attachment and spreading. Neoplasia. 2003;5(1):83 92. PMCID: 1502125.

PAGE 131

115 152. Kusy S, Nasarre P, Chan D, Potiron V, Meyronet D, Gemmill RM, et al. Selective suppression of in vivo tumorigenici ty by semaphorin SEMA3F in lung cancer cells. Neoplasia. 2005;7(5):457 65. PMCID: 1501157. 153. Lantuejoul S, Constantin B, Drabkin H, Brambilla C, Roche J, Brambilla E. Expression of VEGF, semaphorin SEMA3F, and their common receptors neuropilins NP1 and NP2 in preinvasive bronchial lesions, lung tumours, and cell lines. J Pathol. 2003;200(3):336 47. 154. Joseph D, Ho SM, Syed V. Hormonal regulation and distinct functions of semaphorin 3B and semaphorin 3F in ovarian cancer. Mol Cancer Ther. 2010;9(2):49 9 509. PMCID: 2820590. 155. Chedotal A, Kerjan G, Moreau Fauvarque C. The brain within the tumor: new roles for axon guidance molecules in cancers. Cell Death Differ. 2005;12(8):1044 56. 156. Guttmann Raviv N, Kessler O, Shraga Heled N, Lange T, Herzog Y Neufeld G. The neuropilins and their role in tumorigenesis and tumor progression. Cancer Lett. 2006;231(1):1 11. 157. Nasarre P, Potiron V, Drabkin H, Roche J. Guidance molecules in lung cancer. Cell Adh Migr. 2010;4(1):130 45. PMCID: 2852570. 158. Uni fied nomenclature for the semaphorins/collapsins. Semaphorin Nomenclature Committee. Cell. 1999;97(5):551 2. 159. Roche J, Boldog F, Robinson M, Robinson L, Varella Garcia M, Swanton M, et al. Distinct 3p21.3 deletions in lung cancer and identification of a new human semaphorin. Oncogene. 1996;12(6):1289 97. 160. Sekido Y, Bader S, Latif F, Chen JY, Duh FM, Wei MH, et al. Human semaphorins A(V) and IV reside in the 3p21.3 small cell lung cancer deletion region and demonstrate distinct expression patterns. Proc Natl Acad Sci U S A. 1996;93(9):4120 5. PMCID: 39497. 161. Xiang RH, Hensel CH, Garcia DK, Carlson HC, Kok K, Daly MC, et al. Isolation of the human semaphorin III/F gene (SEMA3F) at chromosome 3p21, a region deleted in lung cancer. Genomics. 1996;3 2(1):39 48.

PAGE 132

116 162. Drenberg CD, Livingston S, Chen R, Kruk PA, Nicosia SV. Expression of Semaphorin 3F and Its Receptors in Epithelial Ovarian Cancer, Fallopian Tubes, and Secondary Mullerian Tissues. Obstet Gynecol Int. 2009;2009:730739. PMCID: 2796214. 1 63. Gasperini R, Choi Lundberg D, Thompson MJ, Mitchell CB, Foa L. Homer regulates calcium signalling in growth cone turning. Neural Dev. 2009;4:29. PMCID: 2734570. 164. Hobson SA, McNeil SE, Lee F, Rodland KD. Signal transduction mechanisms linking incre ased extracellular calcium to proliferation in ovarian surface epithelial cells. Exp Cell Res. 2000;258(1):1 11. 165. Friedrich MJ. Ovarian cancer investigators aim at cell signaling pathways. Jama. 1999;281(11):973 5. 166. Maines Bandiera SL, Kruk PA, A uersperg N. Simian virus 40 transformed human ovarian surface epithelial cells escape normal growth controls but retain morphogenetic responses to extracellular matrix. Am J Obstet Gynecol. 1992;167(3):729 35. 167. Alfonso De Matte MY, Moses Soto H, Kruk PA. Calcium mediated telomerase activity in ovarian epithelial cells. Arch Biochem Biophys. 2002;399(2):239 44. 168. Yang H, Ou CC, Feldman RI, Nicosia SV, Kruk PA, Cheng JQ. Aurora A kinase regulates telomerase activity through c Myc in human ovarian and breast epithelial cells. Cancer Res. 2004;64(2):463 7. 169. Gubbay O, Rae MT, McNeilly AS, Donadeu FX, Zeleznik AJ, Hillier SG. cAMP response element binding (CREB) signalling and ovarian surface epithelial cell survival. J Endocrinol. 2006;191(1):275 85 170. Linnerth NM, Greenaway JB, Petrik JJ, Moorehead RA. cAMP response element binding protein is expressed at high levels in human ovarian adenocarcinoma and regulates ovarian tumor cell proliferation. Int J Gynecol Cancer. 2008;18(6):1248 57. 171. Sh eng M, McFadden G, Greenberg ME. Membrane depolarization and calcium induce c fos transcription via phosphorylation of transcription factor CREB. Neuron. 1990;4(4):571 82. 172. Sheng M, Thompson MA, Greenberg ME. CREB: a Ca(2+) regulated transcription fac tor phosphorylated by calmodulin dependent kinases. Science. 1991;252(5011):1427 30.

PAGE 133

117 173. Kim NW, Piatyszek MA, Prowse KR, Harley CB, West MD, Ho PL, et al. Specific association of human telomerase activity with immortal cells and cancer. Science. 1994;26 6(5193):2011 5. 174. Murakami J, Nagai N, Ohama K, Tahara H, Ide T. Telomerase activity in ovarian tumors. Cancer. 1997;80(6):1085 92. 175. Bermudez Y, Yang H, Saunders BO, Cheng JQ, Nicosia SV, Kruk PA. VEGF and LPA induced telomerase in human ovarian cancer cells is Sp1 dependent. Gynecol Oncol. 2007;106(3):526 37. 176. Kohn EC, Reed E, Sarosy GA, Minasian L, Bauer KS, Bostick Bruton F, et al. A phase I trial of carboxyamido triazole and paclitaxel for relapsed solid tumors: potential efficacy of the combination and demonstration of pharmacokinetic interaction. Clin Cancer Res. 2001;7(6):1600 9. 177. Sunahori K, Juang YT, Tsokos GC. Methylation status of CpG islands flanking a cAMP response element motif on the protein phosphatase 2Ac alpha promoter d etermines CREB binding and activity. J Immunol. 2009;182(3):1500 8. PMCID: 2676107. 178. Pugh BF, Tjian R. Mechanism of transcriptional activation by Sp1: evidence for coactivators. Cell. 1990;61(7):1187 97. 179. Morin GB. The human telomere terminal tra nsferase enzyme is a ribonucleoprotein that synthesizes TTAGGG repeats. Cell. 1989;59(3):521 9. 180. Shoup B, Lowell N, Kruk P. Inhibition of telomerase improves chemosensitivity in cisplatin resistant ovarian cancer cells. Cancer Therapy. 2004;2:501 10. 181. Horikawa I, Cable PL, Mazur SJ, Appella E, Afshari CA, Barrett JC. Downstream E box mediated regulation of the human telomerase reverse transcriptase (hTERT) gene transcription: evidence for an endogenous mechanism of transcriptional repression. Mol Biol Cell. 2002;13(8):2585 97. PMCID: 117927. 182. Kyo S, Takakura M, Taira T, Kanaya T, Itoh H, Yutsudo M, et al. Sp1 cooperates with c Myc to activate transcription of the human telomerase reverse transcriptase gene (hTERT). Nucleic Acids Res. 2000;28(3 ):669 77. PMCID: 102554.

PAGE 134

118 183. Poole JC, Andrews LG, Tollefsbol TO. Activity, function, and gene regulation of the catalytic subunit of telomerase (hTERT). Gene. 2001;269(1 2):1 12. 184. Greenberg RA, O'Hagan RC, Deng H, Xiao Q, Hann SR, Adams RR, et al. Telomerase reverse transcriptase gene is a direct target of c Myc but is not functionally equivalent in cellular transformation. Oncogene. 1999;18(5):1219 26. 185. Gunes C, Lichtsteiner S, Vasserot AP, Englert C. Expression of the hTERT gene is regulated at the level of transcriptional initiation and repressed by Mad1. Cancer Res. 2000;60(8):2116 21. 186. Horikawa I, Oshimura M, Barrett JC. Repression of the telomerase catalytic subunit by a gene on human chromosome 3 that induces cellular senescence. Mol Carcinog. 1998;22(2):65 72. 187. Tanaka H, Shimizu M, Horikawa I, Kugoh H, Yokota J, Barrett JC, et al. Evidence for a putative telomerase repressor gene in the 3p14.2 p21.1 region. Genes Chromosomes Cancer. 1998;23(2):123 33. 188. Mahajan A, Liu Z, Gellert L, Zou X, Yang G, Lee P, et al. HMGA2: a biomarker significantly overexpressed in high grade ovarian serous carcinoma. Mod Pathol. 2010;23(5):673 81. 189. Wei JJ, Wu J, Luan C, Yeldandi A, Lee P, Keh P, et al. HMGA2: a potential biomarker compleme nt to P53 for detection of early stage high grade papillary serous carcinoma in fallopian tubes. Am J Surg Pathol. 2010;34(1):18 26. 190. Adams RH, Lohrum M, Klostermann A, Betz H, Puschel AW. The chemorepulsive activity of secreted semaphorins is regulat ed by furin dependent proteolytic processing. EMBO J. 1997;16(20):6077 86. PMCID: 1326291. 191. Parker MW, Hellman LM, Xu P, Fried MG, Vander Kooi CW. Furin processing of semaphorin 3F determines its anti angiogenic activity by regulating direct binding a nd competition for neuropilin. Biochemistry. 2010;49(19):4068 75. PMCID: 2868107. 192. Varshavsky A, Kessler O, Abramovitch S, Kigel B, Zaffryar S, Akiri G, et al. Semaphorin 3B is an angiogenesis inhibitor that is inactivated by furin like pro protein co nvertases. Cancer Res. 2008;68(17):6922 31.

PAGE 135

119 193. Bassi DE, Fu J, Lopez de Cicco R, Klein Szanto AJ. Proprotein convertases: "master switches" in the regulation of tumor growth and progression. Mol Carcinog. 2005;44(3):151 61.

PAGE 136

120 APPENDICES

PAGE 137

121 Appendix I List of Publications Chapter II of this thesis has been published as: Drenberg CD, Livingston S, Chen R, Kruk PA, Nicosia SV. Expression of semaphorin 3F and its receptors change with epithelial ovarian cancer progression. Obstetrics and Gynecology International. Vol 2009 Article ID 730739; 8pages, 2009. Chapter III of this thesis has been published as: Drenberg CD, Saunders BO, Wilbanks GD, Chen R, Nicosia RF, Kruk PA, Nicosia SV. Urinary angiostatin levels are elevated in patients with epithelial ovarian cancer. Gynecologic Oncology 2010 April; 117(1): 117 24. Cha pter IV of this thesis has been submitted for publication as: Drenberg CD, Clarhaut J, Roche J, Nicosia SV, Kruk PA. S EMA 3F Dysregulation Induces Telomerase Activity in Ovarian Cancer Cell Submitted to Neoplasia December 2010

PAGE 138

ABOUT THE AUTHOR Christina D. Drenberg received a Bachelor of Science degree in Biomedi cal Science with a minor in History, from the University of South Florida (USF). She entered the Ph.D. program in Fall of 2006 a of Medicine, joined the Department of Pathology and Cell Biology in January 2007 egree in Medical Science in 2008. While in the Ph.D. program, Ms. Drenberg was a Captain for a Relay for Life Team for the Association of Medical Science Graduate Students (AMSGS) and raised money for the American Cancer Society. In addition, she has served as Department Representative fo r AMSGS and represented the Graduate students by serving as Honor Council Representative. Ms. Drenberg has received several awards including Outstanding Presentation at the USF Health Research Day, the Dr. K Graduate Student Award for Leadership and Servi ce, and Student Government Conference Presentation Program Grant Award. She has also been selected as a Department of Defense Teal Pre doctoral Scholar in accordance with a New Idea Grant. Most recently, she was invited to present her research at the 201 0 National Institute of Health National Graduate Student Research Festival and Ms. Drenberg will continue her training at St. Jude doctoral Fellow.