USF Libraries
USF Digital Collections

Novel roles for 185delag mutant brca1 in ovarian cancer pathology

MISSING IMAGE

Material Information

Title:
Novel roles for 185delag mutant brca1 in ovarian cancer pathology
Physical Description:
Book
Language:
English
Creator:
Linger, Rebecca
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
BRAT
Matrix metalloproteinase 1
Ovarian surface epithelium
Breast cancer
Mutation
Dissertations, Academic -- Medical Sciences -- Masters -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: Familial history is the strongest risk factor for developing ovarian cancer (OC), and a significant contributor to breast cancer risk. Most hereditary breast cancers and OCs are associated with mutation of the tumor suppressor Breast and Ovarian Cancer Susceptibility Gene 1 (BRCA1). Studying risk-associated BRCA1 truncation mutations, such as the founder mutation 185delAG, may reveal signaling pathways important in OC etiology. Recent studies have shown novel BRCA1 mutant functions that may contribute to breast and OC initiation and progression independent of the loss of wtBRCA1. Previously, we have found that normal human ovarian surface epithelial (HOSE) cells expressing the 185delAG mutant, BRAT (BRCA1 185delAG Amino Terminal truncated protein), exhibit enhanced chemosensitivity and up-regulation of the OC-associated serpin, maspin. In the current study, I identify an additional target of the BRAT mutation, matrix metalloprotease 1 (MMP1), a key player in invasion and metastasis. BRAT-expressing HOSE cells exhibit increased MMP1 messenger RNA (mRNA) by real time PCR and protein by Western blotting. Pro-MMP1 levels are also higher in conditioned media of BRAT-expressing cells and HOSE cell lines derived from BRAT mutation carriers. c-Jun is critical for BRAT-mediated MMP1 up-regulation, as siRNA knockdown diminishes MMP1 levels. Luciferase reporter constructs reveal that activator Protein 1 (AP1) sites throughout the distal end of the promoter contribute to BRAT-mediated MMP1 expression, and basal activity is mediated in part by an AP1 site at (-72). Reporters containing a single nucleotide polymorphism (SNP) associated with OC risk and progression yield increased activity that is further enhanced in BRAT cells. Interestingly, BRAT-mediated changes in chemosensitivity and gene regulation are not recapitulated in a normal breast epithelial or breast cancer cell model. This suggests tissue-specific mutant BRCA1 functions may contribute to breast and ovarian tissue specificity of BRCA1 mutation-associated cancer risk and also to differential breast and ovarian cancer risk and penetrance associated with specific mutations. Early molecular and cellular changes such as MMP1 up-regulation in the ovarian surface epithelium of BRCA1 mutation carriers may promote OC initiation and progression and represent a step forward on the continuum of cellular malignancy. Further investigation is warranted, as elucidating these early changes will aid in identification of potential screening and treatment strategies.
Thesis:
Dissertation (PHD)--University of South Florida, 2010.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Rebecca Linger.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains X pages.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
usfldc doi - E14-SFE0004713
usfldc handle - e14.4713
System ID:
SFS0028020:00001


This item is only available as the following downloads:


Full Text

PAGE 1

Novel Roles for 185delAG M utant BRCA1 in O varian Cancer P athology by Rebecca J. Linger A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Pathology and Cell Biology College of Medicine University of South Florida Major Professor: Patricia A. Kruk, Ph.D. Santo V. Nicosia, M.D. Jin Q. Cheng, M.D., Ph.D. David E. Birk, Ph.D. Mumtaz Rojiani, Ph.D. Date of Approval: November 10, 2010 Keywords: BRAT, Matrix metalloprotein ase 1, ovarian surface epithelium, breast cancer, mutation Copyright 2010, Rebecca J. Linger

PAGE 2

Dedication I dedicate this dissertation to my wonderful husband, who has been a bottomless well of patience, strength, encouragement, and love throughou t its completion. I love you. I would also like to thank my parents, who have supported my every dream since they first taught me how to have them, and have believed in me every step of the way. I would like to thank Dr. Kruk, my mentor, for accepting me i nto her lab and giving me the opportunity to continue my education at USF. Thank you for teaching me to be a better scientist and writer than I ever could have been without you. Lastly, I would like to thank my lab mates, Nicole, Christina, and Kamisha, fo r keeping me going and keeping me laughing even on the worst days. I could not have survived this journey without you.

PAGE 3

Acknowledgements I would like to express my thanks to my committee members for guidance in my project and for sharing their wealth of scientific knowledge. I would also like to thank Dr. Michael Barber and Dr. Eric Bennett for welcoming me into the program, as well as the rest of the Medical Sciences program and Pathology and Cell Biology department al staff who have provided support for me during my time at the University of South Florida.

PAGE 4

i Table of Contents List of Tables ................................ ................................ ................................ ..................... iv List of Figures ................................ ................................ ................................ ...................... v List of Abbreviations ................................ ................................ ................................ ....... vii Abstract ................................ ................................ ................................ .............................. xi Chapter 1: Background ................................ ................................ ................................ ........ 1 Ovarian Cancer ................................ ................................ ................................ ........ 1 Clinical c haracteristics of o varia n c ancer ................................ .................... 1 Origins of o varian c ancer ................................ ................................ ............. 2 Models of o varian c ancer ................................ ................................ ............. 6 Risk Factors for o varian c ancer d evelopment ................................ .............. 7 BRCA1 ................................ ................................ ................................ ..................... 7 Introduction ................................ ................................ ................................ .. 7 The BRCA1 g ene p roduct ................................ ................................ ............ 8 Types of BRCA1 m utations ................................ ................................ ......... 9 Loss of f unction m utations ................................ ................................ ......... 1 1 Gain of f unction m utat ions ................................ ................................ ........ 1 4 The r ole of g ain of f unction m utations for d evelopment, c el l ular p roliferation, c hemosensitivity, a poptosis, and g ene r egulation .......... 16 Clinical i mpact of g ain of f unction m utations ................................ ........... 20 MMP1 ................................ ................................ ................................ .................... 2 2 Introduction ................................ ................................ ................................ 2 2 Structure and f unction ................................ ................................ ................ 23 Regulat ion ................................ ................................ ................................ .. 26 MMPs and c ancer ................................ ................................ ...................... 28 Rationale ................................ ................................ ................................ ................ 3 0 Central Hypothesis ................................ ................................ ................................ 3 3 Specific Aims ................................ ................................ ................................ ........ 3 3 References ................................ ................................ ................................ .............. 3 4 Chapter 2: The 185delAG BRCA1 Mutation Enhances MMP1 Expression in Human Ova rian Surface Epithelial Cells ................................ ................................ ..... 4 7 Introduction ................................ ................................ ................................ ............ 4 7 Meth ods ................................ ................................ ................................ .................. 49 Cell c ulture and t ransfection ................................ ................................ ...... 49

PAGE 5

ii Microarray ................................ ................................ ................................ .. 5 0 Western b lot ................................ ................................ ............................... 5 1 RT PCR ................................ ................................ ................................ ...... 5 2 Enzy me linked i mmunosorbant a ssay ................................ ....................... 5 3 Luciferase a ssay ................................ ................................ ......................... 5 4 Statistics ................................ ................................ ................................ ..... 5 4 Results ................................ ................................ ................................ .................... 5 4 BRAT alters expression of genes involved i n multiple cellular processes ................................ ................................ .............................. 5 4 BRAT enhances MMP1 gene expr ession in HOSE 118 cells ................... 5 5 BRAT increases expression and secretion of pro MMP1 by HOSE 118 cells ................................ ................................ ............................... 5 7 MMP1 and maspin ar e independent targets of BRAT ............................... 57 BRAT mediated MMP1 modulation is c Jun dependent ........................... 6 1 AP 1 sites in the MMP1 promoter mediate enhanced MMP 1 expression in BRAT cells ................................ ................................ .... 6 5 Increased pro MMP is detectable in BRAT mutation carrier deriv ed cellular conditioned media ................................ ...................... 7 0 Discussion ................................ ................................ ................................ .............. 7 0 References ................................ ................................ ................................ .............. 81 Chapter 3: Impact of BRAT on A poptosis, G ene R egulation, and M igration of H uman B reast C ancer C ells ................................ ................................ ......................... 8 7 Introduction ................................ ................................ ................................ ............ 8 7 Methods ................................ ................................ ................................ .................. 9 0 Cell c ulture and t ransfection ................................ ................................ ...... 9 0 Cell Viability Assay 92 Cell v iability a ssay ................................ ................................ ..................... 91 Western b lot ................................ ................................ ............................... 9 1 RT PCR ................................ ................................ ................................ ...... 9 1 Scrape a ssay ................................ ................................ ............................... 9 2 Statistics ................................ ................................ ................................ ..... 9 3 Results ................................ ................................ ................................ .................... 9 3 Endogenous BRCA1 and exogenous BRAT expression levels in normal breast epith elial and breast cancer cells ................................ ... 9 3 BRAT does not significantly impact proliferation or chemosensitivity of normal breast or breast cancer cells ..................... 9 4 BRAT does not significantly impact maspin expression in normal breast epithelial or breast cance r cells ................................ ............... 10 1 BRAT does not significantly alter MMP1 expression levels in normal breast epithelial or human breast cancer cells ....................... 10 2 BRAT does not significantly impact migr ation of breast ca ncer cells ................................ ................................ ................................ .... 10 5 Discussion ................................ ................................ ................................ ............ 10 5 References ................................ ................................ ................................ ............ 11 3 Chapter 4: Conclusions ................................ ................................ ................................ .... 118

PAGE 6

iii Origins of BRC A1 A ssociated O varian C ancer ................................ .................. 118 Future S tudies ................................ ................................ ................................ ...... 1 19 Significance ................................ ................................ ................................ .......... 12 4 References ................................ ................................ ................................ ............ 12 7 About the Author ................................ ................................ ................................ ... End Page

PAGE 7

iv List of Tables Table 1.1. Studies supporting loss or gain of function mutation as mechanisms of enhanced BC and OC risk. ................................ ................................ ............... 1 2 Table 2.1. S election of genes determined to be different ially regulated in BRAT cells ................................ ................................ ................................ .................. 5 6

PAGE 8

v List of Figures Figure 1.1. BRCA1 mutations and their cellular and physiologic impact. ........................ 10 Figure 1.2. MMP1 domain structure and potential substrates of importance in OC ........ 24 Figure 1.3. Maspin in part mediates the enhanced apoptotic response of BRAT cells to STS treatment. ................................ ................................ .................... 3 2 Figure 2.1. MMP1 mRNA is increased i n BRAT expressing HOSE cells. ...................... 5 8 Figure 2.2. BRAT increases cellular pro MMP1 and tota l secreted MMP1 in BRAT cells ................................ ................................ ................................ ..... 59 Figure 2.3. MMP1 and maspin are parallel targets of BRAT. ................................ ........... 6 2 Figure 2.4. BRAT mediated MMP1 m odulation is c Jun dependent. ............................... 6 3 Figure 2.5. AP 1 sites in the MMP1 promoter mediate enhanced M MP1 expression in BRAT cells. ................................ ................................ .............. 6 6 Figure 2.6. Increased pro MMP1 is detectable in BRAT mutation carrier derive d cellular conditioned media. ................................ ................................ ............ 7 1 Figure 2.7. ETs 1 protein leve ls are elevated in BRAT cells ................................ ............ 7 4 Figure 2.8. Constitutively active Akt reverses BRAT mediated MMP1 up regulation. ................................ ................................ ................................ ....... 7 6 Figure 3.1. Wild t ype BRCA1 levels in normal human breast epithe lial and breast cancer cells. ................................ ................................ ................................ .... 9 5 Figure 3.2. Transfection efficiency of normal breast epithelial and breast cancer cell lines. ................................ ................................ ................................ ......... 9 6 Figure 3.3. BRAT is efficiently expressed in SKBr3 cell s ................................ ................ 9 7 Figure 3.4. BRAT does not significantly impact growth or chemosensi tivity of breast cancer cells ................................ ................................ ........................... 99

PAGE 9

vi Figure 3.5. BRAT does not significantly impact maspin expre s sion in breast cancer cells. ................................ ................................ ................................ .. 10 3 Figure 3.6. MMP1 expression is not altered by BRAT in normal breast epithe lia l or breast cancer cells. ................................ ................................ ................... 10 6 Figure 3.7. Migration of SKBr3 cells is not si gnificantly impacted by BRAT ............... 10 7 Figure 4.1. Pro ditioned media of BRAT cells ............ 12 1

PAGE 10

vii List of Abbreviations (aa) Amin o acids AKT1/PKB Protein kinase B AP1 Activator protein 1 APC Adenomatous polyposis coli APMA 4 Aminophenylmercuric acetate BARD1 BRCA1 associated RING domain 1 BCL 2 B cell lymphoma 2 BCL 2A1 BCL 2 related protein A1 BRAT BR CA1 185delAG A mino T erminal truncated protein BRCA1 Breast and Ovarian Cancer Susceptibility Gene 1 BRCT BRCA1 C terminal CA 125 Cancer antigen 125 cDNA Complementary DNA cIAP1 Cellular inhibitor of apoptosis 1 CREB cAMP response element binding Ct Threshold c ycle ECL Enhanced chemiluminescence substrate ECM Extracellular matrix EGF Epidermal growth factor

PAGE 11

viii EGFR Epidermal growth factor receptor ELISA Enzyme linked immunosorbant assay EMMPRIN Extracellular Matrix Metalloprotease Inducer ERK Extracell ular signal regulated kinase ETS 1 v ets erythroblastosis virus E26 oncogene homolog 1 FBS Fetal bovine serum FOL1 Folate receptor alpha GFP Green fluorescent protein h Hours Her2 Human epidermal growth factor receptor 2 HGF Hepatocyte grow th factor HOSE Human ovarian surface epithelium HRP Horseradish peroxidase HUVEC Human umbilical vein endothelial cell IGF 1 Insulin like growth factor 1 IGF 1R Insulin like growth factor 1 receptor IL 1 Interleukin 1 JNK/SAPK c Jun N terminal kinase/stress activated protein kinase kDA Kilodalton kRAS Kirsten rat sarcoma viral oncogene homolog LATS1 Large tumor suppressor 1 LOH Loss of heterozygosity LPA Lysophosphatidic acid

PAGE 12

ix MAPK Mitogen activated protein kinase M CSF Macrophage c olony stimulating factor MMP1 Matrix metalloprotease 1 mRNA messenger RNA MSH2 Human mutS homolog 2 NES Nuclear export signal NFKB2 Nuclear factor kappa B 2 NLS Nuclear localization signal OC Ovarian cancer OVX1 OC cell line antigen P21 C yclin dependent kinase inhibitor protein 21 P300 E1A binding protein 300 P53 Tumor protein 53 PAR 1 Protease activated receptor 1 PBS Phosphate buffered saline PDGF Platelet derived growth factor PEA3 Polyoma enhancer activator protein 3 PI3K Phosphatidylinositol 3 kinase PTEN Phosphatase and tensin homolog PVDF Polyvinylidene fluoride RQ Relative mean mRNA expression SDS PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis siRNA Small interfering RNA

PAGE 13

x SNP Single nucle otide polymorphism STS Staurosporine TIMP Tissue inhibitor of metalloprotease TPD52 Tumor protein D52 uPA Urokinase plasminogen activator uPAR Urokinase plasminogen activator receptor Wt Wild type XIAP X linked i nhibitor of apoptosis protein

PAGE 14

xi Abstract Familial history is the strongest risk factor for developing ovarian cancer (OC), and a significant contributor to breast cancer risk. Most hereditary breast cancers and OCs are associated with mutation of the tu mor suppressor Breast and Ovarian Cancer Susceptibility Gene 1 (BRCA1). Studying risk associated BRCA1 truncation mutations, such as the founder mutation 185delAG, may reveal signaling pathways important in OC etiology. Recent studies have shown novel BRCA 1 mutant functions that may contribute to breast and OC initiation and progression independent of the loss of wtBRCA1. Previously, we have found that normal human ovarian surface epithelial (HOSE) cells expressing the 185delAG mutant, BRAT ( BR CA1 185delAG A mino T erminal truncated protein), exhibit enhanced chemosensitivity and up regulation of the OC associated serpin, maspin. In the current study, I identify an additional target of the BRAT mutation, matrix metalloprotease 1 (MMP1), a key player in invasio n and metastasis. BRAT expressing HOSE cells exhibit increased MMP1 messenger RNA (mRNA) by real time PCR and protein by Western blotting Pro MMP1 levels are also higher in conditioned media of BRAT expressing cells and HOSE cell lines derived from BRAT m utation carriers. c Jun is critical for BRAT mediated MMP1 up regulation, as siRNA kno ckdown diminishes MMP1 levels. Luciferase reporter constructs reveal that a ctivator Protein 1 (AP1) sites throughout the distal end of the promoter contribute to BRAT med iated MMP1

PAGE 15

xii expression, and basal activity is mediated in part by an AP1 site at ( 72). Reporters containing a single nucleotide polymorphism (SNP) associated with OC risk and progression yield increased activity that is further enhanced in BRAT cells. Inte restingly, BRAT mediated changes in chemosensitivity and gene regulation are not recapitulated in a normal breast epithelial or breast cancer cell model. This suggests tissue specific mutant BRCA1 functions may contribute to breast and ovarian tissue speci ficity of BRCA1 mutation associated cancer risk and also to differential breast and ovarian cancer risk and penetrance associated with specific mutations. Early molecular and cellular changes such as MMP1 up regulation in the ovarian surface epithelium of BRCA1 mutation carriers may promote OC initiation and progression and represent a step forward on the continuum of cellular malignancy. Further investigation is warranted, as elucidating these early changes will aid in identification of potential screening and treatment strategies.

PAGE 16

1 Chapter 1: Background Ovarian Cancer Clinical characteristics of o varian c ancer. According to the American Cancer but ranks 5th in cancer related deaths [1] The dea dliness of this disease can be attributed to multiple challenges, including lack of a conclusive screening method, the fact that early stages of OC are virtually asymptomatic, and lack of a clear molecular profile. These challenges have limited experimenta l and clinical research to little progress in increasing the survival rate for this deadly disease in the last 7 decades [1] Because early stage OC is difficult to detect, much investigation has been done to find early OC markers for use in screening. Some potential markers under investigation include osteopontin, macrophage colony stimulating factor (M CSF), OVX1 (OC cell line antigen), lysophosphatidic acid (LPA) [2] B cell lymphoma 2 ( BCL 2) [3] angiostatin [4] and the current gold standard, cancer antigen 125 (CA 251) [2] Analyzing the proteome signatures of OC patient serum has also been suggested as a screening tool, as well as a way to improve assignment of prognosis and treatment strategy [5] Other screening methods include pelvic exam and trans vaginal ultrasound [6] though so far, screening of this type does not significantly decrease mortality [2]

PAGE 17

2 The clinic al behavior of OC presents a formidable challenge to improving long term survival. Metastasis plays a major role in this difficulty. The majority of OC diagnoses are made in Stage 3 and 4, when the primary tumor has metastasized and patient survival falls below 30% [1] In contrast, stage 1 OCs, which are confined to the ovary, have a survival rate approaching 95% [1] Typically, late stage patients present with symptoms of abdominal pain and distention because of accumulating fluid and extensive tumor growth within the peritoneum. Cancer encompasses the ovari es, and shed tumor cells are found in the intraperitoneal fluid (ascites). These cells disseminate easily throughout the peritoneal cavity, and have frequently formed metastases in the omentum and peritoneum, as well as through the peritoneum and into the stroma of other organs [7] First line treatment involves debulking surgery and chemotherapy. Sixty to eighty percent of patients benefit significantly from systemic or intraperitoneal treatment with a platinum based drug, specifically carboplatin, which is often combined wi th a taxane [8] Ultimately, the majority of patients eventually develop resistance and experience disease recurrence within 18 months [9] Patients who progress further and those who do not respond to first line platinum based therapy with a remission greater than 6 months may be treated with alternative drugs, such as Gemcitabine, Bevacizumab, or Tamoxifen [10] though r esponses are uniformly poor. Despite these treatment efforts, second line therapy is generally accepted as a palliative strategy. Origins of ovarian c ancer. To better detect and treat OC, much investigation has sought the origins of OC. Ninety percent of OCs arise from the surface epithelium of the ovary [11] while the remainder are categorized as sex cord stromal tumors, germ cell tumors, or indeterminat e tumors [6] Hereafter, OC will refer to epithelial ovarian cancer.

PAGE 18

3 HOSE is a non stratified squamous or cuboidal epithelium that exhibits apical microvilli, cilia, simple desmosomes, and incomplete tight junctions and expresses keratins, integrins, and N cadherin [11] HOSE shares a common developmental progenitor with the mesothelial layer lining the peritoneal c avity. Both types of cells arise from the mesodermally derived celomic epithelium, which lines the embryonic celomic cavity. Specifically, the celomic epithelium covering the paired gonadal ridges proliferates on the surface to form the HOSE. Some cells al so migrate into the gonadal ridges through the stroma and differentiate to become granulosa cells [11] The Mullerian ducts, which later develop into the oviducts, uterus, cervix, and upper vagina, also arise from the celomic epithelium [12] The embryologic origin of HOSE is extremely important to understanding O C. In contrast to most cancer types, in which malignant cells become less differentiated as the tumor progresses, malignant HOSE cells acquire a more mature, more differentiated phenotype than normal HOSE, and resemble specific types of Mullerian epithelia Serous tumors are the most common type of epithelial OC and are comprised of cystic, solid, and papillary regions [13] The epithelium resembles that of the Fallopian tube, as cells are columnar and ciliated, and form papillae [11] Mucinous tumors are characterize d by stratified cervical or intestinal like epithelial cells that express mucin and form cysts and glands [13] E ndometrioid tumors are solid tumors with fluid filled cysts, and the cells resemble endometrial epithelium [13] Clear cell OCs exhibit tubular, solid, papillary or mixed growth, and are comprised of cells full of clear cytoplasm and peg shaped cells with apical nuclei [13]

PAGE 19

4 The mesodermal origin of the HOSE is also important for understanding OC because it imparts upon HOSE cells a unique bi potential epithelial mesenchymal hybrid phenotype, which may contribute to the ability of HOSE cells to develop a malignant phenotype. For example, HOSE cells co express the mesenchymal marker vimentin with epithelial keratins [11] On some substrates in culture, HOSE cells become contractile [14] fibroblast like, invasive, down regulate expression of some integrins, and secrete proteases and basal lamina and stromal components such as laminin, and collagen I, III, and IV [15] The potential of HOSE cells to exhibit mesenchymal characteristics such as these are likely important to their normal physiologic function of restoring the normal HOSE and extracellular matrix (ECM) structure after ovulatory rupture. This abili ty to adapt to and modify the ECM could impart an advantage to HOSE cells in invasion and metastases. Though it is clear that the embryologic development of HOSE is important for OC initiation and progression, the early stages of OC are still largely uncle ar. Unlike some cancer types, such as colon cancer, a clear stage by stage progression from normal tissue to pre cancerous neoplasia to malignant disease has not been defined. One theory is that OCs arise from the metaplastic epithelium of surface invagina tions and inclusion cysts, which are epithelium lined cysts within the ovarian stroma that have lost contact with the surface of the ovary. These regions increase in frequency with age. Much of the evidence supporting the theory that inclusion cysts and in vaginations are the origin of OC comes from prophylactically removed normal ovaries from patients with a known OC associated BRCA1 mutation or a strong family history of OC. In some studies, this tissue exhibits more invaginations in the ovary surface, dys plasia, hyperplasia, and/ or surface

PAGE 20

5 papillae compared to normal ovaries [16 18] though contrary findings have been reported [19, 20] Additionally, occlusion cysts and cyto logic changes are more common in the unaffected ovary of OC patients, and occlusion cysts frequently express markers associated with malignant OC, such as CA 125, E cadherin, and tumor protein 53 (p53) [11, 21 23] An alternative hypothesis is that serous OCs actually originate from the Fallopian tube epithelium (Reviewed in [24] ). The histologic similarity of tubal intraepithelial carcinomas to serous OC and frequency of ext ensive intraperitoneal tumor growth at diagnosis makes identification of primary tubal intraepithelial carcinoma difficult. Nonetheless, this hypothesis merits consideration, as several studies have reported genetic changes common to serous OC and putative tubal intraepithelial carcinoma in normal fallopian epithelium and benign regions of hyperplasia [25] For example, in prophylactically removed fallopian tubes of BRCA1 mutation carriers, regions of p53 overexpress ion frequently coincide with and have been found adjacent to tubal intraepithelial carcinoma, suggesting that these regions may represent a pre malignant precursor [26] Further, in at least one study, primary fallo pian tube carcinomas have been found more frequently in BRCA1 mutation carriers [27] Further study will prove valuable in determining the contribution of tubal intraepithelium to serous OC in these patients. Finall y, in contrast to the inclusion cyst and Fallopian tube hypotheses, other studies suggest low grade OCs, especially mucinous and endometrial, evolve from benign/ borderline neoplasia (Reviewed in [28] ).

PAGE 21

6 Models of ovarian c ancer. Models of OC have been difficult to develop. Most animals do not develop spontaneous OC, with the exception of some strains of mice, rats, and hens. In these animals, the disease manifests with a low frequency and highly variable phenotype [29] Other mouse models require manipulation, such as suppression of the large tumor suppressor 1 (Lats1) gene [29] Normal HOSE can be immortalized with Large T antigen, and transformed with the human papilloma virus E6/E7 genes or the addition of E cadherin to the Large T Antigen [29] however, characteristics of OC cell models vary with the oncogene used to transform the cells [30] Trans formed cells can then be injected subcutaneously or under the murine bursal membrane of the ovary to create animal models. These models have weaknesses, however, as humans do not have a bursal membrane, and as with most xenograft models, the host animal mu st be immunocompromised [30] Resulting tumors in animal models frequently do not reflect the histologic subtype of the original tumor, resulting instead in undifferentiated tumors [30] ). In contrast, intraperitoneal injecti on of cell lines derived from late stage human OC provides an excellent model for understanding OC invasion and metastasis [30] as OC metastases are most commonly found within the peritoneal cavity and represent the biggest barrier to impr oving OC survival. Another major challenge to creating animal and cell models of OC is the lack of a clear molecular profile. Mutations, amplifications, and deletions have been found in multiple pathways, though each alteration is found in only a fractio n of OC cases. Increased phosphatidylinositol 3 kinase (PI3K), Akt1, Akt2, estrogen receptor, and insulin like growth factor 1(IGF 1)/IGF 1 Receptor (IGF 1R) activity have been

PAGE 22

7 demonstrated in OC, as well as the loss of the tumor suppressor phosphatase and tensin homolog (PTEN) (Reviewed in [31] ). Kirsten rat sarcoma viral oncogene homolog (kRas) is overexpressed in 30% of OCs, human epidermal growth factor receptor 2 (Her2) in 34%, and a subset of OCs exhibit p53 mu tation or overexpression [6] OC cells often exhibit acquired telomerase activity [32] Despite these findings, however, no apparent universal culprit in OC init iation or progression has been elucidated. R isk factors for ovarian cancer d evelopment. An effective strategy to increase the proportion of OC cases diagnosed earlier, and therefore better OC survival, is to analyze risk factors for OC development. Environ mental factors such as use of talc on the genitals, cigarette smoking, radiation exposure, the use of certain medications, and diet have been associated with an increased OC risk [6] Physiologic factors may also pr omote OC, for example obesity or history of another gynecologic disorder such as pelvic inflammatory disease, polycystic ovarian syndrome, or endometriosis [6] Further, hormonal factors such as reproductive history and contraceptive use impact OC risk significantly. Early menarche and late menopause increase risk, while parity and breast feeding, as well as oral contraceptive use decrease OC risk [6] The importance of hormon e replacement therapy to OC risk is debated [33, 34] The most informative risk factor, however, is current or past OC diagnosis of a first degree relative. BRCA1 Introduction. Family history is the strongest risk factor for development of OC and a major risk factor for development of breast cancer [35] Understanding how risk associated mutations contribute to cancer initiation and progression will provide insight

PAGE 23

8 into molecular mechanisms and aid in better risk assessment, prophylaxis, and treatment for carriers. The majority of hereditary OCs a nd a significant proportion of hereditary breast cancers are associated with mutation of the BRCA1 gene [35, 36] The BRCA1 g ene p roduct. The 220 kDa, 1863 aa predominantly nuclear BRCA1 protein, which shuttles bet ween the nuclear and cytoplasmic compartments, has multiple functions in the cell [37, 38] BRCA1 plays an important role in the DNA damage response, as evidenced by the fact that BRCA1 null mice die early in embryonic development and exhibit c hromosomal aberrations which are exacerbated by a p53 mutation [39] (Reviewed in [40] [41] [42] are cyclic, and BRCA1 plays a role in the cell cycle as well, by regulating key cell cycle controllers, including cyclin dependent kinase inhibitor (p21), and by physically interacting with cell cycle regulators (Reviewed in [43] ). BRCA1 can also recruit chromatin modifying proteins, such as histone acetyltransferases and histone deacetylases and directly interact with other transcription factors to alter their function (Reviewed in [43] ). For example, BRCA1 binds and modulates phosphorylation of p53 to enhance its transactivation function [44] [45 ] Lastly, BRCA1 is capable of ubiquitin ligase activity when heterodimerized with BRCA1 associated RING domain 1 (BARD1) [46] The loss of these cellular functions of BRCA1 may contribute to cancer by promoting genomic instability and accumulation of cancer causing mutations [40] a process further accelerated by p53 mutation, a common characteristic of BRCA1 mutant OCs [47] BRCA1 mutation carriers have a 30% risk of developing OC during their lifetime [48] and a 50 80% risk of developing breast cancer before the age of 70 [40]

PAGE 24

9 Types of BRCA1 mutations. All types of mutations have been reported in the 80 kb BRCA1 gene, including frameshift, nonsense, missense, in frame insertions and deletions, splice altering mutations, mutations in the untranslated regions, as well as silent mutations. The majority of risk associated mutations ar e frameshift or nonsense mutations that result in a premature stop codon and truncated protein product (NIH Breast Cancer Information Core). Risk associated truncation mutations are found throughout the entire BRCA1 coding sequence (Figure 1. 1 ) and result in mutant proteins that vary in length and structural impairment. For example, the nonsense mutation Y1853X, which lacks the last 11 amino acids, is only missing a small portion of the second (BRCA1 C terminal) BRCT repeat, while the 39 amino acid 185delA G mutant A smaller percentage of risk associated BRCA1 mutations are point mutations classified as missense mutations. Like truncation mutations, missense mutations occur throughout the entire BRCA1 coding se quence (Figure 1.1.) [49] though it is difficult to determine the clinical importance of these mutations because of their rarity and because [50] The functional significance of the BRCA1 RING and BRCT domains as well as the substantial conservation of their sequences fuel speculation that man y missense mutations in these areas are likely to be linked to cancer predisposition. Nonetheless, several missense mutations have already been linked to breast and/or OC predisposition including C61G, M1775K, and P1749R. BRCA1 is thought to act as a class cellular functions is thought to occur through bi allelic inactivation. Carriers of mutations

PAGE 25

10 Figure 1.1. BRCA1 mutations and their cellular and physiologic impact. A. Domain structure of BRCA1 protein and location of risk associated mutations. NES (Nuclear export signal), NLS (Nuclear localization signal). B. BRCA1 mutations categorized by cellular processes in which each has been found to lack function or exhibit function different from wt. Nomenclature used for each mutation was that used in the original research article, or a structural description, if designation was not descriptive of mutation or mutant structure. (Linger and Kruk, 2010)

PAGE 26

11 have one germline hit (the inherited mutated copy of BRCA1) and, in the tumor, a second somatic hit usually through loss of heterozygosity (LOH) [40] The observed phenotype of enhanced breast and OC risk is generally thought to result from loss of some or all wild type (wt) functions of the BRCA1 gene product. However, countless studies have revealed the complexities of signaling molecule and transcription factor interactions, as well as cellular adaptations in response to the unique selective pressures of tumor initiation and progression. Therefore, it is important to investigat e all possible molecular mechanisms by which a mutation may contribute to the disease phenotype. Mutant proteins may antagonize wt proteins in a dominant negative manner resulting in loss of remaining wt function [51 ] or they may engage in unique molecular interactions and manifest novel functions independent of the loss of wt protein function [52] Likewise, BRCA1 mutations may contribute to cancer risk though loss of wt BRC A1 function or through gain of function associated with mutant BRCA1 proteins. Loss of function mutations. As mentioned previously, several lines of evidence suggest loss of wt BRCA1 function as a common mechanism for enhanced breast and OC risk (Table 1.1.). Similar to BRCA1 knockout mice and cell lines, elevated levels of aneuploidy and LOH indicative of an impaired DNA damage response have been noted in breast cancer tissue from mutation carriers compared to control breast cancers, as well as in the h uman BRCA1 truncated breast cancer cell line, HCC1937 (Reviewed in [40] ). In structural protein studies, Tischkowitz et al. suggested that structural alterations in the BRCT phosphopeptide binding pocket caused by the BRCA1 M1775K missense mutation contributed to enhanced breast and OC risk through diminished transactivation

PAGE 27

12 Table 1.1. Studies supporting loss or gain of function mutation as mechanisms of enhanced BC and OC risk. Mutation Result of Mutation In vitro In vivo Model system Endpoint Summary Reference Loss of Function Various X NA # genetic changes Mutant BCs more chromosomal gain/ los s events vs control BCs Tirkkonen et al., 1997 P1749R C64G T826K M1775R Missense P>R Missense C>G Missense T>K Missense M>R X Breast cancer DNA Damage HCC1937 cells; Mutants did not Scully et al., 1999 5382InsC Truncated: 1828 aa X Breast cancer DNA Damage, chemosensitivity wt BRCA1 rescued hyper recombination, chemosensitivity of MCF7 cells; Mutants did not Cousineau and Belmaaza, 2007 P1749R Q1756InsC Y1853 STOP Missense P>R Truncated: 1828 aa Truncated: 1852 aa X COS, colon cancer Gene regulation wt BRCA1 increased p21 expression in COS, cancer cells; Mutants did not Somasundaram et al., 1997 1835S TOP 340STOP Truncated: 1834 aa Truncated: 339 aa X X Breast cancer Cell growth, tumor growth wt BRCA1inhibited growth, tumor growth in nude mice; Mutants did not Holt et al., 1996 Gain of Function 5677InsA Truncated: 1852 aa X P rostate cancer Proliferation Mutant inhibited proliferation more efficiently than wt BRCA1 Fan et al., 1998 N terminal 602 amino acids Synthetic mutant: 602 aa X X Mouse ovarian epithelium Proliferation, chemosensitivity, tumorigenesis Mutant BRCA1 e nhanced proliferation, chemosensitivity, tumorigenesis; wt BRCA1 suppressed Sylvain et al., 2002 5677InsA N terminal 302 aa N terminal 771 aa Truncated: 1852 aa Synthetic mutant: 302 aa Synthetic mutant: 771 aa X Prostate cancer Proliferation, che mo sensitivity 5677InsA and wt BRCA1impaired proliferation, enhanced chemosensitivity; Synthetic truncations decreased sensitivity Fan et al., 2001 185delAG Truncated: 39 aa X Ovarian epithelium Apoptosis 185delAG decreased cIAP1, XIAP, P Akt, and e nhanced cleaved caspase 3, apoptosis after drug treatment 5382InsC 5677InsA Truncated: 1828 aa Truncated: 1852 aa X Breast, Ovarian Cancer Apoptosis Coexpression of mutants with wt BRCA1 a poptosis Thangaraju et al., 2000 5083del19 Truncated: 1669 aa X X HeLa Gene regulation Mutant increased periostin mRNA, protein, and mutation carrier serum, BC tissue Quaresima et al., 2008 ( L inger and Kruk, 2010)

PAGE 28

13 and binding to other DNA damage response proteins [53] Likewise, Williams et al. found that decrea sed stability of BRCA1 missense and truncation mutants resulting from aberrant protein folding contributed to loss of BRCA1 function and enhanced cancer risk [54] Expression of mutant BRCA1 constructs in the absenc e of wt BRCA1 frequently HCC1937 breast cancer cell line, which lacks wt BRCA1 and carries two 5382InsC BRCA1 alleles that code for a frameshift and premature stop signal at codon 1829, and transfection of several BRCA1 mutants into these cells failed to alter radiation sensitivity [55] In agreement, ad dition of wt BRCA1 expression into breast cancer cell lines that exhibit low wt BRCA1 expression due to the presence of a single wt BRCA1 allele inhibited growth. However, expression of the risk associated truncation mutants 1835STOP and 340STOP as w ell as the syntheti 1092, failed to alter cell growth, tumor formation and tumor progression in nude mice [56] Lastly, introduction of wt BRCA1 into HCC1937 breast cancer cells and IGROV 1 OC cells inhibited tumor initiation and growth, while a synthetic BRCA1 mutant lacking the last 542 amino acids did not [57] Interestingly, Cousineau and Belmaaza hypothesize that reduced gene dosage of wt BRCA1 in mutation carriers is so lely responsible for altered DNA damage repair, subsequent mutation accumulation, and increased cancer risk. Using MCF7 breast cancer cells that harbor a single copy of wt Cousi neau and Belmaaza showed that transfection of MCF7 cells with wt BRCA1

PAGE 29

14 diminished hyper recombination and chemosensitivity while addition of the 5382InsC BRCA1 mutation affected neither endpoint [58] These st udies further support a role for loss of wt BRCA1 function as a contributing factor to enhanced breast and OC risk. It is important to note that many of the aforementioned studies attempted to delineate BRCA1 mutant function in model systems lacking normal levels of wt BRCA1, which makes it difficult to discriminate between the contribution of BRCA1 mutants and loss of wt BRCA1 for disease risk. However, several studies utilizing a wt BRCA1 background clearly support the loss of BRCA1 wt function for cancer risk. For example, though overexpression of wt BRCA1 in several wt BRCA1cancer cell lines and COS cells up regulated p21 expression, several synthetic deletion and truncation mutants and risk associated BRCA1 mutants, including P1749R, Q1756InsC (aka 5382 InsC), and Y1853STOP (aka 5677InsA), a frameshift mutation resulting in a premature stop codon that lacks the last 11 amino acids [59] failed to alter p21 expression [60] Gain of function mutations. While mutations resulting in a premature stop codon are typically susceptible to nonsense mediated messenger RNA (mRNA) decay, mounting evidence suggests mutant mRNA and proteins are not uniformly degraded. Perrin Vidoz et al. found that several BRCA1 mutations were unaffected by mRNA decay, including 185delAG and 5382InsC [61] two of the most common risk associated BRCA1 mutations [62] Truncation mutant mRNAs may avoid decay by translation reinitiation at a methionine codon downstream of the premature stop codon [63] and consequently, may contribute aberrant gene pr oducts coding for truncation proteins exhibiting varying degrees of protein stability that may impart novel cellular functions [64] It is important to consider that detection of some mutant BRCA1 proteins in clinical

PAGE 30

15 samples has proven unsuccessful due to technical challenges such as cro ss reactivity of antibodies with wt BRCA1, however, validation studies of mutant proteins in tissue samples are ongoing and will provide a framework within which to view experimental studies of mutant function. BRCA1 mutant proteins may participate in nove l protein protein interactions as a result of aberrant cellular localization. Rodriguez et al. found that exogenous missense and truncation mutants lacking a small portion of the BRCA1 C terminus, including 5382InsC, exhibited aberrant cytoplasmic localiza tion in breast cancer cells, while larger truncations resulted in enhanced nuclear localization of mutants [65] Aberrant localization may result from m utation or loss of the nuclear localization or export signals, impaired recognition of these signals as a result of improper protein folding, or altered interaction with binding partners that impact BRCA1 localization, such as BARD1 [65] Mutant BRCA1 proteins may convey unique phenotypes by inhibiting normal function of wt BRCA1 in a dominant negative manner by binding BRCA1 and inhibiting its interacti on with other proteins, or by sequestering BRCA1 binding partners. Likewise, mutant proteins may also convey unique functions by interacting with novel proteins and/or regulating alternative genes. Indeed, a significant proportion of BRCA1 associated breas t cancer tissue samples [66] as well as primary cells from mutation carrier derived OC cell xenograft tumors [67] exhibit loss of the wt BRCA1 allele concomitant with increased mutant allele copy number. Conseq uently, mutant BRCA1 proteins have been shown to impact a range of cellular functions including development, proliferation, chemosensitivity, apoptosis, and gene regulation (Table 1 .1. ).

PAGE 31

16 Role of g ain of f unction mutations for development, cellular prolife ration, chemosensitivity, apoptosis and gene r egulation. Essentially all BRCA1 knockouts are embryonic lethal in mice (Reviewed in [68] ), however, mice homozygous for a specific synthetic mutation truncating the BRCA1 protein by half are viable, though highly suscept ible to multiple tumor types, including lymphomas, sarcomas, and carcinomas/ adenocarcinomas of the colon, endometrium, lung, liver, and mammary gland [69] Interestingly, introduction of a synthetic BRCA1 truncation mutant encoding the first 300 BRCA1 amino acids inhibits mammary gland differentiation and structural formation during murine development, despite the presence of wt BRCA1 [70] Likewise, when injected into the cleared murine mammary fat pad, pr imary human breast epithelial cells W1777Stop, (which mimics the human 1835STOP mutation), undergo limited differentiation and branching and develop extensive hyperplasia [71] The 5677InsA insertion mutation, resulting in a frameshift and premature stop signal at codon 1853, inhibits proliferation of DU145 human prostate cancer cells expressing a low level of wt BRCA1 more efficiently than exogenous wt B RCA1 [72] while a synthetic N terminal mutant was found to inhibit physical interaction of wt BRCA1 and cyclin D1 [73] In contrast, an exogenous C terminal fragment of BRCA 1 can enhance normal breast epithelial cell growth, possibly by acting in a dominant [74] Similarly, while overexpression of wt BRCA1 in the ID8 mouse ovari an epithelial cell line diminished proliferation, chemosensitivity, and tumorigenicity of intraperitoneally injected cells, expression of a synthetic truncation mutant encoding the first 602 amino

PAGE 32

17 acids of BRCA1 yielded enhanced proliferation and chemosens itivity. Further, when injected intraperitoneally, cells expressing the mutant were significantly more tumorigenic [75] It should be noted, however, that BRCA1 mutants have also been shown to exhibit some residual wt growth function as a result of remaining intact exhibited a failed G2 M checkpoint [76] while breast cancer cells expressing only the 53 82InsC mutant maintained an intact G2 M checkpoint [55] In DU145 prostate cancer cells expressing low levels of wt BRCA1, Fan et al. reported that overexpression of wt BRCA1 or 5677InsA increased topoisomerase inhibit or cytotoxicity, which could be reversed by transfection of synthetic mutants Eco RI (amino acids (aa) 1 302) and Kpn I ( aa 1 771), yielding chemoresistant cells [73] Likewise, in the HCC1937 breast cancer cell mo del system lacking endogenous wt BRCA1, addition of exogenous wt BRCA1 enhanced chemoresistance, which was reversed by co transfection of Eco RI and Kpn I [73] This suggests that mutants can, at least in part, over turn wt BRCA1 function, thereby supporting a role for gain of function BRCA1 mutations. The 185delAG (BRAT) mutation, which imparts upon carriers a 66% lifetime risk of developing OC [77] arises from the deletion o f two nucleotides (AG) in the second exon of the BRCA1 gene. This deletion results in a reading frame shift that produces a premature stop signal at codon 39 and a truncated protein product. Using SV 40 transfected HOSE cells from women with the BRAT mutat ion, we found that mutant cells exhibited enhanced apoptosis and caspase 3 activation in response to staurosporine [78] possibly related to diminished levels of phospho Akt/protein kin ase B, X linked

PAGE 33

18 inhibitor of apoptosis protein (XIAP), and cellular inhibitor of apoptosis protein 1 (c IAP1) [79] To rule out the possible contribution of wt BRCA1 haploinsufficiency to altered apoptosis in 185del AG cells, BRAT was expressed in wt BRCA1 HOSE cells. In agreement with our earlier studies, BRAT enhanced caspase3 mediated apoptosis and diminished levels of phospho Akt, cellular inhibitor of apoptosis 1 (cIAP1), and x linked inhibitor of apoptosis 1 (XI AP) [80] In more recent studies, we found that BRAT upregulated expression of maspin [81] a tumor suppres sor important in apoptosis, invasion, and metastasis that is uniquely overexpressed in several tumor types, including OC [82] Maspin expression has been correlated with cisplatin sensitivity in OC cell lines and lo nger progression free and overall survival times in OC patients [83] and may be involved in BRAT mediated enhanced chemosensitivity [81] Lastly, Thangaraju et al. found that co expression of 5382InsC and 5677InsA with wt BRCA1 inhibited the wt [84] Several studies support a role for BRCA1 mutants in gene regulation. For example, wt BRCA1 and 5677InsA inhibited exogenous estrogen receptor alpha transactivation, but co transfection of Bam HI, Kpn I, and Eco RI reversed this phenomenon [73] 1863), which encodes a protein less than a third the length of wt, inhibited wt BRCA1 mediated activation of a p53 reporter [44] Likewise, using the mouse mammary gland specific expressi on of wt BRCA1, a risk associated mutation that truncates the protein at amino acid 340, or a BRCA1 splice variant that omits the N terminal 72 amino acids, Hoshino et al. showed that the splice variant mediated hyperproliferation and enhanced lobule forma tion in the mammary gland. In addition, tumorigenesis and death were accelerated in mice

PAGE 34

19 expressing the splice variant [85] In separate studies, Quaresima and colleagues performed microarray analysis on HeLa cells stably expressing vector, wt BRCA1, or the founder mutation 5083del19, which encodes a BRCA1 protein missing the last 193 amino acids, and, consequently both BRCT domains, and found differential regulation of multiple genes, including up regulation of peri ostin. Further, periostin levels were also increased in serum and breast cancer tissue from a small number of patients carrying this mutation [86] In other studies, expression of a synthetic truncation mutant maint aining the first third of the BRCA1 protein enhanced p53 expression in 1D8 mouse epithelial OC cells and down regulated constituents of the c Jun N terminal kinase/stress activated protein kinase (JNK/SAPK) and mitogen activated protein kinase/ extracellul ar signal regulated kinase (MAPK/ERK) pathways [87] Finally, the missense mutation Ser1841Asn, which is associated with enhanced breast cancer risk, up regulates tumor protein D52 (TPD52) and the folate receptor a lpha (FOL1) in HeLa cells [88] This regulation is clinically relevant since expression of these genes correlates with tumor progression in breast [89] [90] and OCs [91] [92] Taken together, these studies support a gain of function role for some mutations. The presence or absence of a mutant function as well as its impact on the cell is likely very specific to each mutation and factors impacting mutant function, including mutant protein size, loss/ maintenance of various domains, or structural changes resulting in novel domains. These studies must also be viewed in a cautionary manner. Gain and loss of function experiments provide valuable insight into the mechanism of BRCA1 mutant functions, however, until the presence of stable mutant proteins is validated clinically, it

PAGE 35

20 is necessary to remain mindful of the limitations as well as the promise of these types of experimental studies. Clinical impact of gain of function m utations. Studies investigating the effect of BRCA1 m utant proteins in the context of wt BRCA1 are clinically important. They represent the genotypic and phenotypic state of disease free mutation carriers before loss of both wt BRCA1 alleles. Novel functions mediated by mutant proteins have been shown in var ious model systems to significantly impact proliferation and apoptosis, and therefore, have the potential to influence cancer initiation, progression, and ultimately prognosis for patients carrying mutations. While some mutants may retain specific wt BRCA1 functions, others may enhance the risk of cancer development by antagonizing is warranted, as a better understanding of the function of specific mutations could greatly improve risk assessment and prognostic value for mutation carriers. A better understanding of BRCA1 mutant functions may also help identify novel drug targets for treatment and prophylaxis of mutation carriers. Novel interacting proteins and signaling path ways as well as downstream target genes may reveal as yet unidentified players in BRCA1 mutation associated breast and OC. Data from our lab suggests that genes important for cancer initiation and progression, such as maspin, are differentially regulated i n normal human ovarian epithelial cells expressing the BRAT mutation [81] Further, compared to sporadic breast cancer tissue, BRCA1 mutation associa ted breast cancer samples reveal more chromosomal aberrations in specific regions, potentially containing additional tumor suppressors important in BRCA1 dependent tumor initiation and progression [93] An understan ding of specific interacting

PAGE 36

21 proteins, signaling pathways, and target genes involved in the mechanism of enhanced breast and OC risk conveyed by each mutation provides the opportunity for mutation specific personalized therapy for mutation carriers. Simila r mutations may also share common functions and respond to similar therapeutic strategies. Further, targeting functions of BRCA1 mutants that likely contribute to pre malignancy, cancer initiation, and early stages of tumor growth holds great promise for e ffective prophylactic measures that are less invasive than oophorectomy and mastectomy. It is interesting to speculate that cells heterogeneous for risk associated mutations, though non tumorigenic in their current state, may represent an initial step tow ard cellular transformation, though additional changes may be necessary for these cells to become malignant. Likewise, early changes that may promote malignant transformation, including enhanced telomeric instability, have been observed in cell lines gener ated from normal ovarian surface epithelial cells of women with a strong family history of OC [94] (Reviewed in [95] ). As mentioned previously, several studies have found more frequent occurrence of deep invaginations in t he ovary surface, dysplasia, hyperplasia, and/ or surface papillae in high risk prophylactically removed ovaries versus normal ovaries [16] [17] [18] su carriers. The possibility of independent mutant BRCA1 functions does not exclude the contribution of other oncogenes, tumor suppressors, or invasion/ metastasis promoting proteins. Conv ersely, these early changes are likely to facilitate further cellular changes that manifest in the aggressive phenotype seen clinically in hereditary breast and OC. Though the specificity of BRCA1 mutations for increasing the risk of breast and OC is well established, few studies have investigated differences in risk and etiology

PAGE 37

22 between BRCA1 mutation associated breast and OC. This question warrants investigation, as the lifetime risk for development of breast cancer is higher than that for OC [14] [96] Further, families with predisposition to both breast and OC exhibit variation in the ratio of breast to OC occurrence [97] and this ratio is dependent in part on the location of the mutation within the BRCA1 gene (Reviewed in [98] ). Disparate risk levels of breast and OC suggest mutant proteins may mediate different functions in different tissues, which in turn may exhibit tissue specific degrees of importance for the specific functions lost or gained as a result of each mutation. In conclusion, it is clear from a wide range of model systems and endpoints that BRCA1 mutations are capable o f significant physiologic impacts. Further, molecular and phenotypic changes are evident in mutation carriers. These changes may result from loss of wt BRCA1 function, gain of function mutations, or both. Consequently, further experimental and clinical stu dies of mutant BRCA1 proteins are warranted, and will provide a better understanding of mutation associated breast and OC and improve the strength of prognosis and efficacy of prophylaxis and treatment for mutation carriers. MMP1 Introduction. The aggress ive clinical course of OC illustrates the importance of invasion and metastasis in OC progression. One of the normal physiologic processes that cancer cells frequently exploit to attain these capabilities is cleavage of extracellular matrix (ECM) component s and other substrates by matrixmetalloproteases (MMPS). This adaptation that can ultimately promote tumor growth, invasion, and metastasis through

PAGE 38

23 multiple mechanisms (Reviewed in [99] Preliminary microarray data from our lab suggest that the gene encod ing MMP1 may be differentially regulated in HOSE cells expressing BRAT. Structure and f unction. MMPs are a family of proteases that utilize Zinc at their active site to cleave a wide variety of substrates. Specifically, MMP1 cleaves fibrillar collagens, bu t has also been shown in vitro to cleave other substrates, including ECM constituents, pro growth factors, growth factor receptors, and cell cell adhesion mediators [100] The N terminal 18 30 amino acids of MMPs comprise a signal peptide (Figure 1.2.), which directs translation of the protein to the endop lasmic reticulum, and is cleaved off before secretion [101] (amino acid 73 of MMP1), that occupies the active site zinc with a su lfhydryl group, thereby rendering the enzyme inactive [102] The catalytic domain is comprised of a five stranded beta sheet and two alpha helices [102] 160 170 amino acids, and contains the sequence HELGHXXGXXH [101] The three histidines within this sequence bind the catalytic zinc molecule and are crucial for enzymatic function [101] MMPs bind one structural zinc and a calcium as well. The hinge, or linker, domain follows. This region is variable in lengt h and sequence in MMPs and is thought to be involved in disrupting the triple helix structure of collagen I to increase accessibility of the cleavage site. Lastly, the structure of the C terminal domain varies, and contains a transmembrane spanning region in some MMPs. MMP1 is classified structurally by its C terminus as a simple hemopexin domain family member. This domain, comprised of four repeat regions that form a four bladed beta propeller [102] is similar in s equence to vitronectin, and may mediate

PAGE 39

24 Figure 1.2. MMP1 domain structure and potential substrates of importance in OC.

PAGE 40

25 binding to ECM components, and/or help lock collagen into the active site for more efficient cleavage [101] MMPs are synthesized and secreted as zymogens. In the inactive form, the cysteine residue within the pro domain inhibits ac tivation by binding the catalytic zinc molecule, preventing its interaction with a water molecule that is crucial for catalysis [101] Pro MMPs can be activated by mercurial compounds (such as 4 aminophenylmercury acetate (APMA)), other thiol reactive reagents, reactive ox ygen species, heat treatment, and other compounds by occupation of the cysteine and disruption of the cysteine zinc interaction. Biologically, MMPs are activated by other MMPs and proteases, such as trypsin, through cleavage and partial removal of the pro domain, thereby freeing the active site zinc. MMP1 subsequently autocleaves to remove an additional portion of the pro domain, however, this 42 kilodalton (kDa) MMP1 is only about 20% active. MMP1 is fully activated by cleavage at residue 80 into a 41 kDa product. This may be achieved by MMP2, 3, 7, 10, or 11. In the absence of one of these proteases, MMP1 may further autocleave at residue 81 or 82, resulting in a 30 40% active enzyme [101] MMPs cleave a variety of physiologically important substrates, but do not cleave a t a strict consensus sequence. In fact, there are few specific characteristics shared by substrates. MMP1 is one of a small group of proteases capable of cleaving native, or fibrillar, collagens, which are the most abundant collagens in interstitial connec tive tissue [103] The ovarian stroma is composed mostly of collagens I and III and fibronectin, while fibulin 1, perlecan and other heparin sulfate proteoglycans (syndecans and glypicans), lecticans, decorin, and hyaluronan chains are also present (Reviewed in

PAGE 41

26 [104] ). At the surface of the ovary, beneath the HOSE lies the basal lamina, which is comprised primarily of networks of collagen type IV and laminin, as well as nidogen/ entactin and perlecan [10 4] A dense network of collagen fibrils called the tunica albuginea underlies the basal lamina. MMP1 substrates with potential importance in OC pathology are shown in Figure 1.2. As frequent metastasis is a highly important feature of OC, and the omentum is the most common site of OC metastases [105] the occurrence of MMP1 substrates in the omental ECM and stroma are also listed. Though these substrates have been identified in vitro, their importance in vivo is sti ll being investigated. Regulation. MMPs are regulated by proteolytic activation, as mentioned previously, as well as through pericellular localization. MMPs can be regulated by localized availability of activators, such as the membrane associated urokinase plasminogen activator (uPA), while other MMPs are membrane bound. MMP family members are also regulated by expression. Transcriptional regulation of MMP 1 occurs in part through activator protein 1 (AP1) [106] and v ets erythroblastosis virus E26 oncogene homolog 1 (Ets) [107] sites in the promoter. The most proximal AP1 site is located at ( 73) and is necessary for basal transcription, though other AP1 and Ets sites upstream also contribute to basal transcription. IL 1 and TNFalpha mediated up regulation occurs through c Jun and an AP1 site as well, though there may also be promoter regions through which IL 1 negatively impacts expression. Expression of MMP1 is also modulated by other cytokines and growth factors. For example, platelet derived growth factor (PDGF) and EFG up regulate MMP1, while [108] Epidermal growth factor (EGF) an

PAGE 42

27 MMP1 mRNA stability [109, 110] These impacts are cell type specific, however, and factors may exert alternative context dependent effects. MMPs are also up regulated by Extracellular Matrix Metalloprotease Inducer, or EMMPRIN. EMMPRIN a member of the immunoglobulin superfamily, is heavily glycosylated and localizes to the cell surface. Staining for EMMPRIN is frequently observed at the leading invasive edge of tumors [111] EMMPRIN w as originally isolated from the membranes of cancer cells, however, it is secreted by and affects both cancer and normal stromal cells. Transfection into breast cancer cells increases tumorigenicity in nude mice and expression of MMP2 and 9 in tumors [112] Expression is elevated in malignant ovarian tumors compared to normal tissue [113] and correlates with poor survival in serous OC [ 114] The mechanism by which EMMPRIN induces MMP expression has not been completely elucidated, though clustering of EMMPRIN with itself and caveolin 1 has been implicated, as well as signaling through p38 MAPK and JNK [115] [116] MMPs are regulated extracellularly by the binding of several protein types. The cules that bind MMPs in a 1:1 ratio and displace the water molecule usually associated with the catalytic zinc [101] Specifically, MMP1 is inhibited by all four TIMP proteins (1 4) [101] The importance of TIMPs in some types of cancer has been illustrated. Melanoma cells overexpressing T IMP3 exhibit decreased invasive ability and undergo apoptosis [117] TIMP secretion from stromal cells also influences MMP activi ty greatly, as brain metastases of fibrosarcoma cells were significantly diminished in mice with brain specific overexpression of TIMP1 [118] MMPs are also inhibited by the large serum

PAGE 43

28 MMP [108] and the complex is subsequently endocytosed [101] MMPs and c ancer. MMPs are involved in normal physiologic pr ocesses, including wound healing, mammary gland and uterine involution, and cervical dilation [119] In the ovary, MMPs are up regulated in the pre ovulatory follicle [120] and are secreted by ovarian surface epithelial cells from lysosomes [121] Both sources of proteases may aid in release of the oocyte during ovulation. Conversely, MMPs have been implicated in cancer. Mutations and gene amplifications are not generally reported, but MMP expression increases i n multiple cancer types, including ovarian [99] Microarray data suggest MMP12 may be a useful serum marker for breast cancer [122] while MMPs 2 and 19 may be useful biomarkers for OC [123] Specifically, MMP1 expression has been associated with poor prognosis in breast, colorectal, and esophageal cancer [124 126] MMPs are crucial for invasion of tumor cells into and through the bas ement membrane, thereby promoting metastasis [127] Cleavage of ECM constituents may reveal binding sites in the ECM that modulate migration and adhesion. MMPs also cleave and release pro growth factors that may promote tumor cell growth (Reviewed in [99] ). Kenny et al. found that adhesion of SkOV3 OC cells to mouse peritoneum and a 3 D peritoneal model decreased after MMP2 inhibition or knock down, and that MMP2 expression was enhanced in adherent cells [105] MMP family mem bers also participate in multiple novel mechanisms of cancer progression, including angiogenesis, apoptosis, and the immune response to cancer

PAGE 44

29 (Reviewed in [99] ). The importance of MMPs in angiogenesis is especially relevant to OC. ECM remodeling allows m igration of endothelial cells through the ECM. MMPs also cleave and release pro and anti angiogenic factors from the ECM (Reviewed in [99] ). Interestingly, recent studies have also demonstrated the ability of aggressive OC cells to form vascular like st ructures in 3D culture, and integrate into the tumor MMP1 have been detected within the vascular structures [128] and inhibiting MMPs diminishes the formation of vascular structures by the OC cells [129] In addition to interactions of tumor cells with the ECM, stromal tumor cell interactions are known to be important in multiple facets of tumor progression, including paracrine growth signaling and angiogenesis. For example, normal sheep ovarian stromal cells were found to inhibit the growth of OC cell lines in vitro an d in vivo [130] Conversely, tumors formed from subcutaneously injected OC cells exhibited regions of host stromal tissue integrated into the tumor that could promote further tumor growth [131] Mouse ovarian stromal cells stimulated anchorage independent growth of HOSE cells [31] Co culture also enhanced estrogen stimulated growth of rabbit OSE cells [132] It is possible that TIMPS or MMP regulators may be secreted by ovarian stromal cells in vivo. This phenomenon has been examined in detail in a melanoma cell model that highly expresses MMP1. Melanoma cells exhibited invasion through a type I collagen matrix only when co cultured with fibroblasts or treated with fibroblast conditioned media. MMP3 and an unidentified serine protease secreted by the fibroblasts cleaved and activated MMP 1 s ecreted by the melanoma cells. The activated MMP1 subsequently facilitated invasion [133]

PAGE 45

30 The specific pathological role for matrix metalloprotease 1 in OC has not yet been made clear. Knockout mice of several other MMPs have been studied, and reveal a general theme of decreased tumorigenesis and angiogenesis [134] Unfortunately, however, there is not a sufficiently similar homologue to MMP1 in the mouse genome, so an MMP1 knockout mouse has not yet been created. Howeve r, using intraperitoneal injection of human OC cells into mice, Agarwal et al. implicate MMP1 in the activation of protease activated receptor 1 (PAR 1) and reveal the importance of this pathway to ascites formation, metastasis, and angiogenesis [135] In a 1998 study utilizing a leukocyte gene library, a single nucleotide nucleotide was found to increase the efficacy of an Ets (erythroblast osis virus E26 oncogene homolog) transcription factor binding site and increase MMP1 expression [136] A later study found that the percentage of OC patients with the SNP was disproportionately high compared to norm al women, and that tumors with the 2G allele expressed greater than seven times the MMP1 expression levels of tumors without a 2G allele, suggesting that MMP1 is indeed important in OC pathology [103] Further, presence of the 2G poly morphism was associated with decreased disease free and overall survival in OC patients [137] Rationale We have previously found that BRAT plays an important role in the enhanced apoptotic response of immortalized HOSE cells to drug treatment. Immortalized HOSE cell lines derived from BRAT mutation carriers exhibit enhanced caspa se 3 activation and apoptosis as a result of diminished levels of apoptotic inhibitors XIAP and cIAP1 and

PAGE 46

31 reduced Akt activation [78, 79] Enhanced chemosensitivity is mediated by the BRAT mutation, independently of the loss of wt BRCA1, as transfection of BRAT into wt HOSE and OC cells recapitulates the effects on XIAP, caspase 3, and apoptosis [79, 80] .These findings are in agreement with studies illustrating better initial chemotherapeutic response in BRCA1 mutation carrier OC patients compared to control patients [138, 139] More recently, we have identified the tumor suppressor maspin as a downstream target of BRAT. Maspin mRNA and protein levels are increased in wt 118 HOSE cells transiently and stably expressing BRAT. Maspin up regulation is transcriptional, and occurs in part through c Jun, as maspin promoter activity is significantly decreased by c Jun knockdown as well as trunca tion of the maspin promoter and elimination of several transcription factor binding sites, including an AP1 site [81] c Jun is critical for enhanced BR AT cell chemosensitivity as well. c Jun knockdown decreases caspase 3 cleavage [81] Preliminary data also suggest maspin plays a role in BRAT cell chem osensitivity, as maspin knockdown results in diminished caspase 3 cleavage as well (Figure 1.3., [81] ). These findings are clinically relevant, as cytop lasmic maspin correlates with cisplatin sensitivity in OC cell lines, and treatment response and overall survival in OC patients [83] It is clear from these studies that the BRAT mutation mediates unique molecular and cellular changes in HOSE and OC cells independent of the loss of wt BRCA1 function, and that these changes have great potential for physiologic impact in carriers of the BRAT mutation. Consequently, it is worthwhile to pursue identification of addition al BRAT targets and cellular processes important in OC initiation and progression. The

PAGE 47

32 Figure 1.3. Maspin, in part, mediates the enhanced apoptotic response of BRAT cells to sta urosporine (STS) treatment. Stable BRAt cells were transfected with Si Con or Si Maspin, and 48 hours later, were treated with 1 M STS. Lysates were collected six hours after treatment. Samples were analyzed for cleaved caspase 3, pro caspase 3, maspin, and actin protein levels via

PAGE 48

33 185delAG mutation is associated with increased risk of breast cancer risk as well as OC, however mutation associated breast and OC occur with different penetrance in fam ilies and individuals. Therefore, it is also important to determine whether the cellular functions of BRAT are tissue specific and could contribute to epidemiologic and etiologic differences between 185delAG associated breast and OC. Central Hypothesis I hypothesize that expression of the 185delAG BRCA1 mutant protein product, BRAT, alters the regulation and/or activity of several potentially important players in BRAT associated OC pathology, including matrix metalloprotease 1. I hypothesize that BRAT mediated MMP1 up regulation involves Akt and the transcription factor c Jun, and occurs in part t hrough specific AP1 sites in the MMP1 promoter I also hypothesize that BRAT mediates differential effects on apoptosis, gene regulation, and migration in normal HOSE and ovarian cancer cells compared to normal breast epithelial and breast cancer cells. B RAT mediated molecular and cellular changes in ovarian surface epithelial cells may serve, then, as an intermediate state in the transformation of these cells from normal to malignant. Specific Aims To address these hypotheses, I propose execution of three specific aims. 1. Confirm MMP1 as a downstream target of BRAT in immortalized human ovarian surface epithelial cells. 2. Determine the signaling pathways and transcription factors involved in BRAT mediated MMP1 up regulation. 3. Demonstrate the specific ity of BRAT function in ovarian compared to breast migration in normal human breast epithelial cells and breast cancer cells.

PAGE 49

34 References 1. Jemal A, Siegel R, X u J & Ward E (2010) Cancer Statistics, 2010. CA Cancer J Clin doi: caac.20073 [pii]10.3322/caac.20073. 2. Reynolds EA & Moller KA (2006) A review and an update on the screening of epithelial ovarian cancer. Curr Probl Cancer 30 203 232, doi: S0147 0272(0 6)00033 X [pii]10.1016/j.currproblcancer.2006.06.001. 3. Anderson NS, Bermudez Y, Badgwell D, Chen R, Nicosia SV, Bast RC, Jr. & Kruk PA (2009) Urinary levels of Bcl 2 are elevated in ovarian cancer patients. Gynecol Oncol 112 60 67, doi: S0090 8258(08)00 806 8 [pii]10.1016/j.ygyno.2008.09.037. 4. Drenberg CD, Saunders BO, Wilbanks GD, Chen R, Nicosia RF, Kruk PA & Nicosia SV (2010) Urinary angiostatin levels are elevated in patients with epithelial ovarian cancer. Gynecol Oncol 117 117 124, doi: S0090 825 8(09)01012 9 [pii]10.1016/j.ygyno.2009.12.011. 5. Stevens EV, Liotta LA & Kohn EC (2003) Proteomic analysis for early detection of ovarian cancer: a realistic approach? Int J Gynecol Cancer 13 Suppl 2 133 139, doi: 13358 [pii]. 6. Holschneider CH & Berek JS (2000) Ovarian cancer: epidemiology, biology, and prognostic factors. Semin Surg Oncol 19 3 10, doi: 10.1002/1098 2388(200007/08)19:1<3::AID SSU2>3.0.CO;2 S [pii]. 7. Stack MS, Ellerbroek SM & Fishman DA (1998) The role of proteolytic enzymes in the pa thology of epithelial ovarian carcinoma. Int J Oncol 12 569 576. 8. Markman M (2008) Pharmaceutical management of ovarian cancer : current status. Drugs 68 771 789, doi: 6864 [pii]. 9. Lage H & Denkert C (2007) Resistance to chemotherapy in ovarian carci noma. Recent Results Cancer Res 176 51 60. 10. Markman M & Bookman MA (2000) Second line treatment of ovarian cancer. Oncologist 5 26 35. 11. Auersperg N, Wong AS, Choi KC, Kang SK & Leung PC (2001) Ovarian surface epithelium: biology, endocrinology, and pathology. Endocr Rev 22 255 288. 12. Gilbert SF (2006) Developmental Biology, Eigth Edition Sinauer Associates, Inc, Sunderland, Massachusetts. 13. Kaku T, Ogawa S, Kawano Y, Ohishi Y, Kobayashi H, Hirakawa T & Nakano H (2003) Histological classificat ion of ovarian cancer. Med Electron Microsc 36 9 17, doi: 10.1007/s007950300002.

PAGE 50

35 14. Kruk PA & Auersperg N (1992) Human ovarian surface epithelial cells are capable of physically restructuring extracellular matrix. Am J Obstet Gynecol 167 1437 1443. 15. Kruk PA, Uitto VJ, Firth JD, Dedhar S & Auersperg N (1994) Reciprocal interactions between human ovarian surface epithelial cells and adjacent extracellular matrix. Exp Cell Res 215 97 108, doi: S0014 4827(84)71320 6 [pii]10.1006/excr.1994.1320. 16. Salaz ar H, Godwin AK, Daly MB, Laub PB, Hogan WM, Rosenblum N, Boente MP, Lynch HT & Hamilton TC (1996) Microscopic benign and invasive malignant neoplasms and a cancer prone phenotype in prophylactic oophorectomies. J Natl Cancer Inst 88 1810 1820. 17. Wernes s BA, Afify AM, Bielat KL, Eltabbakh GH, Piver MS & Paterson JM (1999) Altered surface and cyst epithelium of ovaries removed prophylactically from women with a family history of ovarian cancer. Hum Pathol 30 151 157. 18. Casey MJ, Bewtra C, Hoehne LL, Ta tpati AD, Lynch HT & Watson P (2000) Histology of prophylactically removed ovaries from BRCA1 and BRCA2 mutation carriers compared with noncarriers in hereditary breast ovarian cancer syndrome kindreds. Gynecol Oncol 78 278 287, doi: 10.1006/gyno.2000.586 1S0090 8258(00)95861 X [pii]. 19. Piek JM, Verheijen RH, Menko FH, Jongsma AP, Weegenaar J, Gille JJ, Pals G, Kenemans P & van Diest PJ (2003) Expression of differentiation and proliferation related proteins in epithelium of prophylactically removed ovarie s from women with a hereditary female adnexal cancer predisposition. Histopathology 43 26 32, doi: 1654 [pii]. 20. Stratton JF, Buckley CH, Lowe D & Ponder BA (1999) Comparison of prophylactic oophorectomy specimens from carriers and noncarriers of a BRCA 1 or BRCA2 gene mutation. United Kingdom Coordinating Committee on Cancer Research (UKCCCR) Familial Ovarian Cancer Study Group. J Natl Cancer Inst 91 626 628. 21. Hutson R, Ramsdale J & Wells M (1995) p53 protein expression in putative precursor lesions of epithelial ovarian cancer. Histopathology 27 367 371. 22. Schlosshauer PW, Cohen CJ, Penault Llorca F, Miranda CR, Bignon YJ, Dauplat J & Deligdisch L (2003) Prophylactic oophorectomy: a morphologic and immunohistochemical study. Cancer 98 2599 2606, doi: 10.1002/cncr.11848. 23. Nnene IO, Nieto JJ, Crow JC, Sundaresan M, MacLean AB, Perrett CW & Hardiman P (2004) Cell cycle and apoptotic proteins in relation to ovarian epithelial morphology. Gynecol Oncol 92 247 251, doi: S0090825803006164 [pii]. 24. Salvador S, Gilks B, Kobel M, Huntsman D, Rosen B & Miller D (2009) The fallopian tube: primary site of most pelvic high grade serous carcinomas. Int J Gynecol

PAGE 51

36 Cancer 19 58 64, doi: 10.1111/IGC.0b013e318199009c00009577 200901000 00012 [pii]. 25. Chen EY, Mehra K, Mehrad M, Ning G, Miron A, Mutter GL, Monte N, Quade BJ, McKeon FD, Yassin Y, et al. (2010) Secretory cell outgrowth, PAX2 and serous carcinogenesis in the Fallopian tube. J Pathol 222 110 116, doi: 10.1002/path.2739. 26. Lee Y, Miron A, Drapkin R, Nucci MR, Medeiros F, Saleemuddin A, Garber J, Birch C, Mou H, Gordon RW, et al. (2007) A candidate precursor to serous carcinoma that originates in the distal fallopian tube. J Pathol 211 26 35, doi: 10.1002/path.2091. 27. Piek JM, Torrenga B, Hermsen B, Verheijen RH, Zweemer RP, Gille JJ, Kenemans P, van Diest PJ & Menko FH (2003) Histopathological characteristics of BRCA1 and BRCA2 associated intraperitoneal cancer: a clinic based study. Fam Cancer 2 73 78, doi: 5142097 [pii]. 28. Bell DA (2005) Or igins and molecular pathology of ovarian cancer. Mod Pathol 18 Suppl 2 S19 32, doi: 3800306 [pii]10.1038/modpathol.3800306. 29. Vanderhyden BC, Shaw TJ & Ethier JF (2003) Animal models of ovarian cancer. Reprod Biol Endocrinol 1 67, doi: 10.1186/1477 782 7 1 671477 7827 1 67 [pii]. 30. Garson K, Shaw TJ, Clark KV, Yao DS & Vanderhyden BC (2005) Models of ovarian cancer -are we there yet? Mol Cell Endocrinol 239 15 26, doi: S0303 7207(05)00158 9 [pii]10.1016/j.mce.2005.03.019. 31. Jiang F, Saunders BO, Hal ler E, Livingston S, Nicosia SV & Bai W (2003) Conditionally immortal ovarian cell lines for investigating the influence of ovarian stroma on the estrogen sensitivity and tumorigenicity of ovarian surface epithelial cells. In Vitro Cell Dev Biol Anim 39 3 04 312, doi: 10.1290/1543 706X(2003)039<0304:CIOCLF>2.0.CO;20306040 [pii]. 32. Counter CM, Hirte HW, Bacchetti S & Harley CB (1994) Telomerase activity in human ovarian carcinoma. Proc Natl Acad Sci U S A 91 2900 2904. 33. Whittemore AS, Harris R & Itnyre J (1992) Characteristics relating to ovarian cancer risk: collaborative analysis of 12 US case control studies. II. Invasive epithelial ovarian cancers in white women. Collaborative Ovarian Cancer Group. Am J Epidemiol 136 1184 1203. 34. Purdie DM, Bain CJ, Siskind V, Russell P, Hacker NF, Ward BG, Quinn MA & Green AC (1999) Hormone replacement therapy and risk of epithelial ovarian cancer. Br J Cancer 81 559 563, doi: 10.1038/sj.bjc.6690731. 35. Lux M, Fasching P & Beckmann M (2006) Hereditary breast an d ovarian cancer: review and future perspectives. Journal of Molecular Medicine 84 16 28.

PAGE 52

37 36. Ford D, Easton DF, Bishop DT, Narod SA & Goldgar DE (1994) Risks of cancer in BRCA1 mutation carriers. Breast Cancer Linkage Consortium. Lancet 343 692 695. 37. Thompson M (2010) BRCA1 16 Years Later: Nuclear Import and Export Processes. FEBS Journal In press 38. Yang E. S. XF (2010) BRCA1 16 Years Later: DNA damage induced BRCA1 shuttling. FEBS Journal In Press 39. Shen SX, Weaver Z, Xu X, Li C, Weinstein M, C hen L, Guan XY, Ried T & Deng CX (1998) A targeted disruption of the murine Brca1 gene causes gamma irradiation hypersensitivity and genetic instability. Oncogene 17 3115 3124, doi: 10.1038/sj.onc.1202243. 40. Deng CX (2006) BRCA1: cell cycle checkpoint, genetic instability, DNA damage response and cancer evolution. Nucleic Acids Res 34 1416 1426, doi: 34/5/1416 [pii]10.1093/nar/gkl010. 41. Boulton SJ (2006) Cellular functions of the BRCA tumour suppressor proteins. Biochem Soc Trans 34 633 645, doi: BST 0340633 [pii]10.1042/BST0340633. 42. Gudmundsdottir K & Ashworth A (2006) The roles of BRCA1 and BRCA2 and associated proteins in the maintenance of genomic stability. Oncogene 25 5864 5874, doi: 1209874 [pii]10.1038/sj.onc.1209874. 43. Mullan PB, Quinn J E & Harkin DP (2006) The role of BRCA1 in transcriptional regulation and cell cycle control. Oncogene 25 5854 5863, doi: 1209872 [pii]10.1038/sj.onc.1209872. 44. Zhang H, Somasundaram K, Peng Y, Tian H, Bi D, Weber BL & El Deiry WS (1998) BRCA1 physically associates with p53 and stimulates its transcriptional activity. Oncogene 16 1713 1721, doi: 10.1038/sj.onc.1201932. 45. Xu X, Qiao W, Linke SP, Cao L, Li WM, Furth PA, Harris CC & Deng CX (2001) Genetic interactions between tumor suppressors Brca1 and p 53 in apoptosis, cell cycle and tumorigenesis. Nat Genet 28 266 271, doi: 10.1038/9010890108 [pii]. 46. Jhanwar Uniyal M (2003) BRCA1 in cancer, cell cycle and genomic stability. Front Biosci 8 s1107 1117. 47. Prat J, Ribe A & Gallardo A (2005) Hereditar y ovarian cancer. Hum Pathol 36 861 870, doi: S0046 8177(05)00283 2 [pii]10.1016/j.humpath.2005.06.006. 48. Whittemore AS, Gong G & Itnyre J (1997) Prevalence and contribution of BRCA1 mutations in breast cancer and ovarian cancer: results from three U.S. population based case control studies of ovarian cancer. Am J Hum Genet 60 496 504.

PAGE 53

38 49. Szabo CI, Worley T & Monteiro AN (2004) Understanding germ line mutations in BRCA1. Cancer Biol Ther 3 515 520, doi: 841 [pii]. 50. Easton DF, Deffenbaugh AM, Pruss D, Frye C, Wenstrup RJ, Allen Brady K, Tavtigian SV, Monteiro AN, Iversen ES, Couch FJ, et al. (2007) A systematic genetic assessment of 1,433 sequence variants of unknown clinical significance in the BRCA1 and BRCA2 breast cancer predisposition genes. Am J Hum Genet 81 873 883, doi: S0002 9297(07)63865 8 [pii]10.1086/521032. 51. Yudt MR, Jewell CM, Bienstock RJ & Cidlowski JA (2003) Molecular origins for the dominant negative function of human glucocorticoid receptor beta. Mol Cell Biol 23 4319 4330. 52. Song H, Hollstein M & Xu Y (2007) p53 gain of function cancer mutants induce genetic instability by inactivating ATM. Nat Cell Biol 9 573 580, doi: ncb1571 [pii]10.1038/ncb1571. 53. Tischkowitz M, Hamel N, Carvalho MA, Birrane G, Soni A, van Beers EH, Jo osse SA, Wong N, Novak D, Quenneville LA, et al. (2008) Pathogenicity of the BRCA1 missense variant M1775K is determined by the disruption of the BRCT phosphopeptide binding pocket: a multi modal approach. Eur J Hum Genet 16 820 832, doi: ejhg200813 [pii] 10.1038/ejhg.2008.13. 54. Williams RS, Chasman DI, Hau DD, Hui B, Lau AY & Glover JN (2003) Detection of protein folding defects caused by BRCA1 BRCT truncation and missense mutations. J Biol Chem 278 53007 53016, doi: 10.1074/jbc.M310182200M310182200 [pi i]. 55. Scully R, Ganesan S, Vlasakova K, Chen J, Socolovsky M & Livingston DM (1999) Genetic analysis of BRCA1 function in a defined tumor cell line. Mol Cell 4 1093 1099, doi: S1097 2765(00)80238 5 [pii]. 56. Holt JT, Thompson ME, Szabo C, Robinson Beni on C, Arteaga CL, King MC & Jensen RA (1996) Growth retardation and tumour inhibition by BRCA1. Nat Genet 12 298 302, doi: 10.1038/ng0396 298. 57. Randrianarison V, Marot D, Foray N, Cabannes J, Meret V, Connault E, Vitrat N, Opolon P, Perricaudet M & Feu nteun J (2001) BRCA1 carries tumor suppressor activity distinct from that of p53 and p21. Cancer Gene Ther 8 759 770, doi: 10.1038/sj.cgt.7700366. 58. Cousineau I & Belmaaza A (2007) BRCA1 haploinsufficiency, but not heterozygosity for a BRCA1 truncating mutation, deregulates homologous recombination. Cell Cycle 6 962 971, doi: 4105 [pii].

PAGE 54

39 59. Monteiro AN, August A & Hanafusa H (1996) Evidence for a transcriptional activation function of BRCA1 C terminal region. Proc Natl Acad Sci U S A 93 13595 13599. 6 0. Somasundaram K, Zhang H, Zeng YX, Houvras Y, Peng Y, Wu GS, Licht JD, Weber BL & El Deiry WS (1997) Arrest of the cell cycle by the tumour suppressor BRCA1 requires the CDK inhibitor p21WAF1/CiP1. Nature 389 187 190, doi: 10.1038/38291. 61. Perrin Vido z L, Sinilnikova OM, Stoppa Lyonnet D, Lenoir GM & Mazoyer S (2002) The nonsense mediated mRNA decay pathway triggers degradation of most BRCA1 mRNAs bearing premature termination codons. Hum Mol Genet 11 2805 2814. 62. Ramus SJ & Gayther SA (2009) The co ntribution of BRCA1 and BRCA2 to ovarian cancer. Mol Oncol 3 138 150, doi: S1574 7891(09)00027 1 [pii]10.1016/j.molonc.2009.02.001. 63. Buisson M, Anczukow O, Zetoune AB, Ware MD & Mazoyer S (2006) The 185delAG mutation (c.68_69delAG) in the BRCA1 gene tr iggers translation reinitiation at a downstream AUG codon. Hum Mutat 27 1024 1029, doi: 10.1002/humu.20384. 64. Anczukow O, Ware MD, Buisson M, Zetoune AB, Stoppa Lyonnet D, Sinilnikova OM & Mazoyer S (2008) Does the nonsense mediated mRNA decay mechanism prevent the synthesis of truncated BRCA1, CHK2, and p53 proteins? Hum Mutat 29 65 73, doi: 10.1002/humu.20590. 65. Rodriguez JA, Au WW & Henderson BR (2004) Cytoplasmic mislocalization of BRCA1 caused by cancer associated mutations in the BRCT domain. Ex p Cell Res 293 14 21, doi: S0014482703005445 [pii]. 66. Staff S, Nupponen NN, Borg A, Isola JJ & Tanner MM (2000) Multiple copies of mutant BRCA1 and BRCA2 alleles in breast tumors from germ line mutation carriers. Genes Chromosomes Cancer 28 432 442, do i: 10.1002/1098 2264(200008)28:4<432::AID GCC9>3.0.CO;2 J [pii]. 67. Indraccolo S, Tisato V, Agata S, Moserle L, Ferrari S, Callegaro M, Persano L, Palma MD, Scaini MC, Esposito G, et al. (2006) Establishment and characterization of xenografts and cancer c ell cultures derived from BRCA1 / epithelial ovarian cancers. Eur J Cancer 42 1475 1483, doi: S0959 8049(06)00321 2 [pii]10.1016/j.ejca.2006.01.057. 68. Evers B & Jonkers J (2006) Mouse models of BRCA1 and BRCA2 deficiency: past lessons, current underst anding and future prospects. Oncogene 25 5885 5897, doi: 1209871 [pii]10.1038/sj.onc.1209871.

PAGE 55

40 69. Ludwig T, Fisher P, Ganesan S & Efstratiadis A (2001) Tumorigenesis in mice carrying a truncating Brca1 mutation. Genes Dev 15 1188 1193, doi: 10.1101/gad.8 79201. 70. Brown MA, Nicolai H, Howe K, Katagiri T, Lalani el N, Simpson KJ, Manning NW, Deans A, Chen P, Khanna KK, et al. (2002) Expression of a truncated Brca1 protein delays lactational mammary development in transgenic mice. Transgenic Res 11 467 478 71. Bachelier R, Vincent A, Mathevet P, Magdinier F, Lenoir GM & Frappart L (2002) Retroviral transduction of splice variant Brca1 Delta11 or mutant Brca1 W1777Stop causes mouse epithelial mammary atypical duct hyperplasia. Virchows Arch 440 261 266, do i: 10.1007/s004280100500. 72. Fan S, Wang JA, Yuan RQ, Ma YX, Meng Q, Erdos MR, Brody LC, Goldberg ID & Rosen EM (1998) BRCA1 as a potential human prostate tumor suppressor: modulation of proliferation, damage responses and expression of cell regulatory pr oteins. Oncogene 16 3069 3082, doi: 10.1038/sj.onc.1202116. 73. Fan S, Yuan R, Ma YX, Meng Q, Goldberg ID & Rosen EM (2001) Mutant BRCA1 genes antagonize phenotype of wild type BRCA1. Oncogene 20 8215 8235, doi: 10.1038/sj.onc.1205033. 74. Larson JS, Ton kinson JL & Lai MT (1997) A BRCA1 mutant alters G2 M cell cycle control in human mammary epithelial cells. Cancer Res 57 3351 3355. 75. Sylvain V, Lafarge S & Bignon YJ (2002) Dominant negative activity of a Brca1 truncation mutant: effects on proliferati on, tumorigenicity in vivo, and chemosensitivity in a mouse ovarian cancer cell line. Int J Oncol 20 845 853. 76. Xu X, Weaver Z, Linke SP, Li C, Gotay J, Wang XW, Harris CC, Ried T & Deng CX (1999) Centrosome amplification and a defective G2 M cell cycle checkpoint induce genetic instability in BRCA1 exon 11 isoform deficient cells. Mol Cell 3 389 395, doi: S1097 2765(00)80466 9 [pii]. 77. Satagopan JM, Boyd J, Kauff ND, Robson M, Scheuer L, Narod S & Offit K (2002) Ovarian cancer risk in Ashkenazi Jewis h carriers of BRCA1 and BRCA2 mutations. Clin Cancer Res 8 3776 3781. 78. Johnson NC & Kruk PA (2002) BRCA1 Zinc RING Finger Domain Disruption Alters Caspase Response in Ovarian Surface Epithelial Cells. Cancer Cell Int 2 7. 79. Johnson NC, Dan HC, Cheng JQ & Kruk PA (2004) BRCA1 185delAG mutation inhibits Akt dependent, IAP mediated caspase 3 inactivation in human ovarian surface epithelial cells. Exp Cell Res 298 9 16, doi: 10.1016/j.yexcr.2004.04.003S0014482704001922 [pii].

PAGE 56

41 80. O'Donnell JD, Johnson N C, Turbeville TD, Alfonso MY & Kruk PA (2008) BRCA1 185delAG truncation protein, BRAt, amplifies caspase mediated apoptosis in ovarian cells. In Vitro Cell Dev Biol Anim 44 357 367, doi: 10.1007/s11626 008 9122 0. 81. O'Donnell JD, Linger RJ & Kruk PA (20 09) BRCA1 185delAG mutant protein, BRAt, up regulates maspin in ovarian epithelial cells. Gynecol Oncol doi: S0090 8258(09)00840 3 [pii]10.1016/j.ygyno.2009.10.052. 82. Sood AK, Fletcher MS, Gruman LM, Coffin JE, Jabbari S, Khalkhali Ellis Z, Arbour N, Se ftor EA & Hendrix MJ (2002) The paradoxical expression of maspin in ovarian carcinoma. Clin Cancer Res 8 2924 2932. 83. Surowiak P, Materna V, Drag Zalesinska M, Wojnar A, Kaplenko I, Spaczynski M, Dietel M, Zabel M & Lage H (2006) Maspin expression is ch aracteristic for cisplatin sensitive ovarian cancer cells and for ovarian cancer cases of longer survival rates. Int J Gynecol Pathol 25 131 139, doi: 10.1097/01.pgp.0000183050.30212.2f00004347 200604000 00003 [pii]. 84. Thangaraju M, Kaufmann SH & Couch FJ (2000) BRCA1 facilitates stress induced apoptosis in breast and ovarian cancer cell lines. J Biol Chem 275 33487 33496, doi: 10.1074/jbc.M005824200M005824200 [pii]. 85. Hoshino A, Yee CJ, Campbell M, Woltjer RL, Townsend RL, van der Meer R, Shyr Y, Hol t JT, Moses HL & Jensen RA (2007) Effects of BRCA1 transgene expression on murine mammary gland development and mutagen induced mammary neoplasia. Int J Biol Sci 3 281 291. 86. Quaresima B, Romeo F, Faniello MC, Di Sanzo M, Liu CG, Lavecchia A, Taccioli C Gaudio E, Baudi F, Trapasso F, et al. (2008) BRCA1 5083del19 mutant allele selectively up regulates periostin expression in vitro and in vivo. Clin Cancer Res 14 6797 6803, doi: 14/21/6797 [pii]10.1158/1078 0432.CCR 07 5208. 87. Sylvain V, Lafarge S & B ignon YJ (2001) Molecular pathways involved in response to ionizing radiation of ID 8 mouse ovarian cancer cells expressing exogenous full length Brca1 or truncated Brca1 mutant. Int J Oncol 19 599 607. 88. Crugliano T, Quaresima B, Gaspari M, Faniello MC Romeo F, Baudi F, Cuda G, Costanzo F & Venuta S (2007) Specific changes in the proteomic pattern produced by the BRCA1 Ser1841Asn missense mutation. Int J Biochem Cell Biol 39 220 226, doi: S1357 2725(06)00237 8 [pii]10.1016/j.biocel.2006.08.005. 89. Bo utros R, Fanayan S, Shehata M & Byrne JA (2004) The tumor protein D52 family: many pieces, many puzzles. Biochem Biophys Res Commun 325 1115 1121, doi: S0006 291X(04)02409 X [pii]10.1016/j.bbrc.2004.10.112.

PAGE 57

42 90. Hartmann LC, Keeney GL, Lingle WL, Christian son TJ, Varghese B, Hillman D, Oberg AL & Low PS (2007) Folate receptor overexpression is associated with poor outcome in breast cancer. Int J Cancer 121 938 942, doi: 10.1002/ijc.22811. 91. Byrne JA, Balleine RL, Schoenberg Fejzo M, Mercieca J, Chiew YE, Livnat Y, St Heaps L, Peters GB, Byth K, Karlan BY, et al. (2005) Tumor protein D52 (TPD52) is overexpressed and a gene amplification target in ovarian cancer. Int J Cancer 117 1049 1054, doi: 10.1002/ijc.21250. 92. Miotti S, Canevari S, Menard S, Mezzan zanica D, Porro G, Pupa SM, Regazzoni M, Tagliabue E & Colnaghi MI (1987) Characterization of human ovarian carcinoma associated antigens defined by novel monoclonal antibodies with tumor restricted specificity. Int J Cancer 39 297 303. 93. Tirkkonen M, J ohannsson O, Agnarsson BA, Olsson H, Ingvarsson S, Karhu R, Tanner M, Isola J, Barkardottir RB, Borg A, et al. (1997) Distinct somatic genetic changes associated with tumor progression in carriers of BRCA1 and BRCA2 germ line mutations. Cancer Res 57 1222 1227. 94. Kruk PA, Godwin AK, Hamilton TC & Auersperg N (1999) Telomeric instability and reduced proliferative potential in ovarian surface epithelial cells from women with a family history of ovarian cancer. Gynecol Oncol 73 229 236, doi: S0090 8258(99) 95348 9 [pii]10.1006/gyno.1999.5348. 95. Wong AS & Auersperg N (2003) Ovarian surface epithelium: family history and early events in ovarian cancer. Reprod Biol Endocrinol 1 70, doi: 10.1186/1477 7827 1 701477 7827 1 70 [pii]. 96. Billack B & Monteiro AN (2005) BRCA1 in breast and ovarian cancer predisposition. Cancer Lett 227 1 7, doi: S0304 3835(04)00864 X [pii]10.1016/j.canlet.2004.11.006. 97. Gayther SA, Warren W, Mazoyer S, Russell PA, Harrington PA, Chiano M, Seal S, Hamoudi R, van Rensburg EJ, Dunn ing AM, et al. (1995) Germline mutations of the BRCA1 gene in breast and ovarian cancer families provide evidence for a genotype phenotype correlation. Nat Genet 11 428 433, doi: 10.1038/ng1295 428. 98. Hohenstein P & Fodde R (2003) Of mice and (wo)men: g enotype phenotype correlations in BRCA1. Hum Mol Genet 12 Spec No 2 R271 277, doi: 10.1093/hmg/ddg258ddg258 [pii]. 99. Egeblad M & Werb Z (2002) New functions for the matrix metalloproteinases in cancer progression. Nat Rev Cancer 2 161 174, doi: 10.1038 /nrc745. 100. Sternlicht MD & Werb Z (2001) How matrix metalloproteinases regulate cell behavior. Annu Rev Cell Dev Biol 17 463 516, doi: 10.1146/annurev.cellbio.17.1.46317/1/463 [pii].

PAGE 58

43 101. Nagase H & Woessner JF, Jr. (1999) Matrix metalloproteinases. J Biol Chem 274 21491 21494. 102. Pardo A & Selman M (2005) MMP 1: the elder of the family. Int J Biochem Cell Biol 37 283 288, doi: S1357 2725(04)00256 0 [pii]10.1016/j.biocel.2004.06.017. 103. Kanamori Y, Matsushima M, Minaguchi T, Kobayashi K, Sagae S, Kudo R, Terakawa N & Nakamura Y (1999) Correlation between expression of the matrix metalloproteinase 1 gene in ovarian cancers and an insertion/deletion polymorphism in its promoter region. Cancer Res 59 4225 4227. 104. Ricciardelli C & Rodgers RJ (2006) Extracellular matrix of ovarian tumors. Semin Reprod Med 24 270 282, doi: 10.1055/s 2006 948556. 105. Kenny HA, Kaur S, Coussens LM & Lengyel E (2008) The initial steps of ovarian cancer cell metastasis are mediated by MMP 2 cleavage of vitronectin and f ibronectin. J Clin Invest 118 1367 1379, doi: 10.1172/JCI33775. 106. Gutman A & Wasylyk B (1990) The collagenase gene promoter contains a TPA and oncogene responsive unit encompassing the PEA3 and AP 1 binding sites. EMBO J 9 2241 2246. 107. Nishikawa A, Iwasaki M, Akutagawa N, Manase K, Yamashita S, Endo T & Kudo R (2000) Expression of various matrix proteases and Ets family transcriptional factors in ovarian cancer cell lines: correlation to invasive potential. Gynecol Oncol 79 256 263, doi: 10.1006/gy no.2000.5944S0090 8258(00)95944 4 [pii]. 108. Vincenti MP, White LA, Schroen DJ, Benbow U & Brinckerhoff CE (1996) Regulating expression of the gene for matrix metalloproteinase 1 (collagenase): mechanisms that control enzyme activity, transcription, and m RNA stability. Crit Rev Eukaryot Gene Expr 6 391 411. 109. Delany AM & Brinckerhoff CE (1992) Post transcriptional regulation of collagenase and stromelysin gene expression by epidermal growth factor and dexamethasone in cultured human fibroblasts. J Cell Biochem 50 400 410, doi: 10.1002/jcb.240500409. 110. Vincenti MP, Coon CI, Lee O & Brinckerhoff CE (1994) Regulation of collagenase gene expression by IL 1 beta requires transcriptional and post transcriptional mechanisms. Nucleic Acids Res 22 4818 4827 111. Gabison EE, Hoang Xuan T, Mauviel A & Menashi S (2005) EMMPRIN/CD147, an MMP modulator in cancer, development and tissue repair. Biochimie 87 361 368, doi: S0300 9084(04)00170 1 [pii]10.1016/j.biochi.2004.09.023. 112. Zucker S, Hymowitz M, Rollo EE Mann R, Conner CE, Cao J, Foda HD, Tompkins DC & Toole BP (2001) Tumorigenic potential of extracellular matrix metalloproteinase inducer. Am J Pathol 158 1921 1928.

PAGE 59

44 113. Jin JS, Yao CW, Loh SH, Cheng MF, Hsieh DS & Bai CY (2006) Increasing expression of extracellular matrix metalloprotease inducer in ovary tumors: tissue microarray analysis of immunostaining score with clinicopathological parameters. Int J Gynecol Pathol 25 140 146, doi: 10.1097/01.pgp.0000189244.57145.8400004347 200604000 00004 [pii]. 114. Davidson B, Goldberg I, Berner A, Kristensen GB & Reich R (2003) EMMPRIN (extracellular matrix metalloproteinase inducer) is a novel marker of poor outcome in serous ovarian carcinoma. Clin Exp Metastasis 20 161 169. 115. Iacono KT, Brown AL, Greene MI & Saouaf SJ (2007) CD147 immunoglobulin superfamily receptor function and role in pathology. Exp Mol Pathol 83 283 295, doi: S0014 4800(07)00111 6 [pii]10.1016/j.yexmp.2007.08.014. 116. Nabeshima K, Iwasaki H, Koga K, Hojo H, Suzumiya J & Kikuchi M (20 06) Emmprin (basigin/CD147): matrix metalloproteinase modulator and multifunctional cell recognition molecule that plays a critical role in cancer progression. Pathol Int 56 359 367, doi: PIN [pii]10.1111/j.1440 1827.2006.01972.x. 117. Ahonen M, Baker AH & Kahari VM (1998) Adenovirus mediated gene delivery of tissue inhibitor of metalloproteinases 3 inhibits invasion and induces apoptosis in melanoma cells. Cancer Res 58 2310 2315. 118. Kruger A, Sanchez Sweatman OH, Martin DC, Fata JE, Ho AT, Orr FW, Rut her U & Khokha R (1998) Host TIMP 1 overexpression confers resistance to experimental brain metastasis of a fibrosarcoma cell line. Oncogene 16 2419 2423, doi: 10.1038/sj.onc.1201774. 119. Yu WH & Woessner JF, Jr. (2001) Heparin enhanced zymographic detec tion of matrilysin and collagenases. Anal Biochem 293 38 42, doi: 10.1006/abio.2001.5099S0003 2697(01)95099 7 [pii]. 120. Fata JE, Ho AT, Leco KJ, Moorehead RA & Khokha R (2000) Cellular turnover and extracellular matrix remodeling in female reproductive tissues: functions of metalloproteinases and their inhibitors. Cell Mol Life Sci 57 77 95. 121. Auersperg N, Maclaren IA & Kruk PA (1991) Ovarian surface epithelium: autonomous production of connective tissue type extracellular matrix. Biol Reprod 44 717 724. 122. Schummer M, Green A, Beatty JD, Karlan BY, Karlan S, Gross J, Thornton S, McIntosh M & Urban N (2010) Comparison of breast cancer to healthy control tissue discovers novel markers with potential for prognosis and early detection. PLoS One 5 e91 22, doi: 10.1371/journal.pone.0009122. 123. Pitteri SJ, JeBailey L, Faca VM, Thorpe JD, Silva MA, Ireton RC, Horton MB, Wang H, Pruitt LC, Zhang Q, et al. (2009) Integrated proteomic analysis of human cancer

PAGE 60

45 cells and plasma from tumor bearing mice for ova rian cancer biomarker discovery. PLoS One 4 e7916, doi: 10.1371/journal.pone.0007916. 124. McGowan PM & Duffy MJ (2008) Matrix metalloproteinase expression and outcome in patients with breast cancer: analysis of a published database. Ann Oncol 19 1566 15 72, doi: mdn180 [pii]10.1093/annonc/mdn180. 125. Murray GI, Duncan ME, O'Neil P, Melvin WT & Fothergill JE (1996) Matrix metalloproteinase 1 is associated with poor prognosis in colorectal cancer. Nat Med 2 461 462. 126. Murray GI, Duncan ME, O'Neil P, Mc Kay JA, Melvin WT & Fothergill JE (1998) Matrix metalloproteinase 1 is associated with poor prognosis in oesophageal cancer. J Pathol 185 256 261, doi: 10.1002/(SICI)1096 9896(199807)185:3<256::AID PATH115>3.0.CO;2 A [pii]10.1002/(SICI)1096 9896(199807)18 5:3<256::AID PATH115>3.0.CO;2 A. 127. Liotta LA, Tryggvason K, Garbisa S, Hart I, Foltz CM & Shafie S (1980) Metastatic potential correlates with enzymatic degradation of basement membrane collagen. Nature 284 67 68. 128. Sood AK, Seftor EA, Fletcher MS, Gardner LM, Heidger PM, Buller RE, Seftor RE & Hendrix MJ (2001) Molecular determinants of ovarian cancer plasticity. Am J Pathol 158 1279 1288. 129. Sood AK, Fletcher MS, Coffin JE, Yang M, Seftor EA, Gruman LM, Gershenson DM & Hendrix MJ (2004) Function al role of matrix metalloproteinases in ovarian tumor cell plasticity. Am J Obstet Gynecol 190 899 909, doi: 10.1016/j.ajog.2004.02.011S0002937804001310 [pii]. 130. Wang Johanning F, Huang M, Liu J, Rycaj K, Plummer JB, Barnhart KF, Satterfield WC & Johan ning GL (2007) Sheep stromal epithelial cell interactions and ovarian tumor progression. Int J Cancer 121 2346 2354, doi: 10.1002/ijc.22960. 131. Parrott JA, Nilsson E, Mosher R, Magrane G, Albertson D, Pinkel D, Gray JW & Skinner MK (2001) Stromal epithe lial interactions in the progression of ovarian cancer: influence and source of tumor stromal cells. Mol Cell Endocrinol 175 29 39, doi: S0303 7207(01)00436 1 [pii]. 132. Bai W, Oliveros Saunders B, Wang Q, Acevedo Duncan ME & Nicosia SV (2000) Estrogen s timulation of ovarian surface epithelial cell proliferation. In Vitro Cell Dev Biol Anim 36 657 666, doi: 10.1290/1071 2690(2000)036<0657:ESOOSE>2.0.CO;2. 133. Benbow U, Schoenermark MP, Mitchell TI, Rutter JL, Shimokawa K, Nagase H & Brinckerhoff CE (199 9) A novel host/tumor cell interaction activates matrix

PAGE 61

46 metalloproteinase 1 and mediates invasion through type I collagen. J Biol Chem 274 25371 25378. 134. Westermarck J & Kahari VM (1999) Regulation of matrix metalloproteinase expression in tumor invasi on. FASEB J 13 781 792. 135. Agarwal A, Covic L, Sevigny LM, Kaneider NC, Lazarides K, Azabdaftari G, Sharifi S & Kuliopulos A (2008) Targeting a metalloprotease PAR1 signaling system with cell penetrating pepducins inhibits angiogenesis, ascites, and pro gression of ovarian cancer. Mol Cancer Ther 7 2746 2757, doi: 7/9/2746 [pii]10.1158/1535 7163.MCT 08 0177. 136. Rutter JL, Mitchell TI, Buttice G, Meyers J, Gusella JF, Ozelius LJ & Brinckerhoff CE (1998) A single nucleotide polymorphism in the matrix met alloproteinase 1 promoter creates an Ets binding site and augments transcription. Cancer Res 58 5321 5325. 137. Six L, Grimm C, Leodolter S, Tempfer C, Zeillinger R, Sliutz G, Speiser P, Reinthaller A & Hefler LA (2006) A polymorphism in the matrix metall oproteinase 1 gene promoter is associated with the prognosis of patients with ovarian cancer. Gynecol Oncol 100 506 510, doi: S0090 8258(05)00759 6 [pii]10.1016/j.ygyno.2005.08.049. 138. Boyd J, Sonoda Y, Federici MG, Bogomolniy F, Rhei E, Maresco DL, Sai go PE, Almadrones LA, Barakat RR, Brown CL, et al. (2000) Clinicopathologic features of BRCA linked and sporadic ovarian cancer. JAMA 283 2260 2265, doi: joc91391 [pii]. 139. Cass I, Baldwin RL, Varkey T, Moslehi R, Narod SA & Karlan BY (2003) Improved su rvival in women with BRCA associated ovarian carcinoma. Cancer 97 2187 2195, doi: 10.1002/cncr.11310.

PAGE 62

47 Chapter 2: The 185delAG BRCA1 M utation E nhances MMP1 E xpression in H uman O varian S urface E pithelial C ells Introduction Ovarian cancer is the 9th m ost common cancer in women, but ranks 5th in cancer related deaths [1] The deadliness of this disease can be attributed in part to the fact that early stages of OC are not well understood and are virtually asymptomatic. The majority of OC diagnoses are made in Stage 3 and 4, whe n the primary tumor has metastasized and patient survival falls below 30% [1] In stark contrast, stage 1 OCs, which are confined to the ovary, have a survival rate approaching 95% [1] As evidenced by this, improving OC survival will require a better understanding of early stages of the disease, as wel l as the mechanisms by which OCs become invasive and metastatic. Studies investigating hereditary OC risk and early stage disease have determined that the majority of hereditary OCs are associated with mutation of the BRCA1 gene [2] Carriers of a BRCA1 mutation have a 30% 40% risk of developing OC during their lifetime [3, 4] The gene product of the BRCA1 gene is the multifunctional tumor suppressor BRCA1, which is involv ed in cell cycle, DNA damage response, chromatin remodeling [5] and ubiquitin ligase activity [6] Founder mutations of BRCA1 occur at a high frequency in genetically isolated p opulations, such as the Ashkenazi Jewish population. The 185delAG founder mutation, BRAT, is the deletion of two nucleotides

PAGE 63

48 (AG) in the second exon of the BRCA1 gene. This deletion results in a reading frame shift and likely results in translation of a pr emature stop signal at codon 39 and a truncated protein product. Though the BRAT mutation is detected in clinical samples and solidly correlates with OC risk, cross reactivity of antibodies with wt BRCA1 has made detection of the truncated protein in clini cal samples unsuccessful. However, recent studies suggest that mutant BRCA1 proteins may contribute to cancer by unique gain of function activities, independent of the loss of normal BRCA1 function, by influencing proliferation, apoptosis, and gene regulat ion (Reviewed in [7] ). For example, we have previously found that expression of BRAT in normal HOSE cells increases expression of the tumor suppressor maspin, which is uniquely up regulated in OC [8, 9] Preliminary microarray data reveal an additional downstream target of BRAT, the matrix metalloprotease 1 gene. MMP1 is a member of the matrix metalloprotease family of enzymes, which utilize Zinc at the active site to cleave a broad spectrum of substrates, including ECM constituents, pro grow th factors, growth factor receptors, and cell cell adhesion mediators [10] MMPs are secreted as zymogens and activated upon cleavage and removal of their auto inhibitory pro domain by other MMPs or serine proteases [11] Specifically, MMP1, also known as interstitial collagenase I, is capable of cleavi ng several substrates of potential importance for OC, including collagens I and III. In vitro, MMP1 also cl eaves fibronectin, and laminin, which are present in the ovarian and omental extracellular matrix, as well as pro MMP2 and 9 and pro [12 14] In the normal ovary, MMPs are up regulated in the pre ovulatory foll icle [15] and may be secreted by HOSE cells from lysosomes [16] to aid in release of the oocyte during ovulation. MMP mutations and gene amplifications are not generally reported, but

PAGE 64

49 MMP expression is increased in multiple cancer types, including ovarian [11] For example, Kenny et al. demonstrate that adhesion of SkOV3 OC cells to mouse peritoneum decreases after MMP2 inhibition or knock down, and that MMP2 expression is enhanced in adherent cells [12] Agarwal et al. implicate MMP1 in the a ctivation of protease activated receptor 1 (PAR 1) and demonstrate the importance of this pathway for OC ascites formation, metastasis, and angiogenesis [17] In this chapter, I demonstrate that the BRAT mutation in creases MMP1 expression and pro MMP1 secretion by HOSE cells, and that this up regulation occurs through c Jun and specific AP 1 sites in the MMP1 promoter. Further, I demonstrate that immortalized HOSE derived from BRAT mutation carriers also express sign ificantly elevated levels of pro MMP1. In accordance with these data, I hypothesize that enhanced MMP1 expression and secretion by the OSE of patients carrying the BRAT mutation may represent an initial step toward cellular malignancy and ultimately mutati on associated OC initiation and progression. Methods Cell culture and t ransfection. The SV 40 Large T Ag transfected HOSE cells: wt BRCA1 confirmed: (HOSE 118 [18] ), negative family history of OC: HOSE 121, IMCC5, a nd 185delAG confirmed: (3261 77a, 3261 77b [19] 1816 686a, and 1816 686b [20] ) were cultured in Medium 199/ MCDB 105 (Sigma, St. Louis, MO) with 10% fetal bovine serum (FBS) and gentamicin. Multiple stable BRAT clones wer e generated by transfection of 2 3 million HOSE 118 cells with 2 2.5ug of PCDNA3.1 or Flag BRAT [18] Stable lines were maintained in 1 mg/ml G418 selection media and confirmed to express BRAT by RT PCR [18] All cells were incubated at 37C with 5% CO 2 Two and

PAGE 65

50 a half million cells were transiently transfected as previously described [18] using Program X 005, Kit V, and the Nucleofecto r device (Amaxa/ Lonza, Walkersville, MD) with 1.5 2.5 ug of plasmid (BRIT, Flag BRAT [18] pGL4.74 Renilla Luciferase/TK (Promega, Madison, WI), human MMP1 luciferase reporters (1G and 2G wt (full length), 1G and 2 G ( 3292), 1G and 2G ( 2942), ( 1546), and ( 517) [21] [22] or green fluorescent protein (GFP). The control plasmid BRIT was generated by inserting a frameshift mutation to abrogate the BRAT sequence from amino acids 22 38 in the BRAT plasmid, and has been previously characterized as an appropriate control [18] The full length MMP1 promoter consists of the 4372 base pairs directly upstream of MMP1 gene start codon, and extends to +63. The reporter plasmids in the truncation series are truncated from t 1607) of the full length promoter in which the AP1 site at the indicated location has been mutated and rendered non functional. For kn ockdown studies, cells were co transfected with 2ug Smartpool small interfering RNA (siRNA) targeting c Jun (Si c Jun) or Smartpool non targeting control siRNA (Si Con) from Dharmacon (Chicago, IL). Microarray. HOSE 118 cells were serum starved for 24 hou rs (h), and transfected with 3ug of indicated transfectant (PCDNA3.1 or flag BRAT) using Lipofectamine reagent (Life Technologies, Inc., Grand Island, NY) [23] Twenty four hours after transfection, cells were colle cted in Trizol reagent (Invitrogen, Carlsbad, CA). Total RNA was purified using the RNeasy cleanup procedure (Qiagen Inc., Valencia, CA). The quality of total RNA was assessed by agarose gel electrophoresis and A260/A280 ratio or by analysis on the Agilen t 2100 Bioanalyzer.

PAGE 66

51 Five micrograms of total RNA from each sample was processed for microarray analysis. The poly(A) RNA was specifically converted to complementary DNA (cDNA) and then amplified and labeled with biotin following the procedure initially de scribed by Van Gelder et al. [24] Hybridization with the biotin labeled RNA, staining, and scanning of the chips followed the prescribed procedure outlined in the Affymetrix technical manual and has been previously described [25] Probe arrays: The oligonucleotide probe arrays were the Affymetrix U133A human arra ys. These arrays consist of 22,215 probe sets, which target known and suspected genes as well as a number of suspected splice variants. Data Analysis: Scanned output files were visually inspected for hybridization artifacts and then analyzed using Affymetr ix Microarray 5.0 software. Signal intensity was scaled to a trimmed mean intensity of 500 prior to output. For direct comparison analysis the MAS 5.0 software was used to identify differentially s ided signed rank test was used to assess the behavior of all oligonucleotide probes in each probeset [26] Probe sets that yielded a change p value less than 0.005 were identified as changed (increased or decreased ). The analyses of replicate experimental pairs were intersected to produce the final list. Using the MAS 5.0 calculated signal value the list was further reduced by removing probesets with low expression value in all samples and where the average change i n signal value between the control condition and the experimental condition was less than 1.4 fold. Western blot. Cells were washed in phosphate buffered saline (PBS), trypsinized, pelleted, and washed 1 2 times in cold PBS. Cells were lysed for 30 minutes on ice in modified CHAPS buffer, and lysate was centrifuged at 115,000 xg, at 4 degrees C, for 1h.

PAGE 67

52 polyacrylamide gel electrophoresis (SDS PAGE). Proteins were transferred to Polyvin ylidene fluoride (PVDF) membranes, dried, and blocked in 5% milk in Tween 20 Tris buffered Saline. Blots were incubated in their respective antibodies overnight, followed by incubation with a horseradish peroxidase (HRP) conjugated secondary (Fisher, Pitts burgh, PA), and developed via enhanced chemiluminescence substrate (ECL) (Pierce/ Fisher, Pittsburgh, PA). Antibodies: c Jun (1:1000) Cat. #9165, Phospho c Jun (1:500) Cat. #9261, Cell Signaling Technology (Beverly, MA), Actin clone AC 40 (1:10,000) Cat. # 4700 Sigma (St. Louis, MO), MMP1 (2ug/mL) Cat. #MAB901 R&D Systems, Inc. (Minneapolis, MN), Ets 1 (1:500) Cat. #sc 56674 Santa Cruz (Santa Cruz, CA). RT PCR. RNA samples were isolated using TRIzol reagent from Invitrogen (Carlsbad, CA) per manufacturers pr otocol and DNAse treated. For semi quantitative PCR, 1 microgram total RNA, oligo(dT), and reverse transcriptase were used to generate single strand cDNA as previously described [18] The cDNA samples were amplifi ed using the Applied Biosystems GeneAmp RNA PCR Core Kit (Foster City, CA). Primers used were: Flag BRAT sense (CGATGACAAAATGGATTTATCTGC), Flag BRAT antisense (GAGACAGGTTCCTTCATCAACTCC), MMP1 sense (GAGCAAACACATCTGAGGTACAGGA), MMP1 antisense (TTGTCCCGATGAT CTCCCCTGACA) [27] actin (98 base pairs) sense (GGGAATTCAAAACTGGAACGGTGAAGG), and actin (98 base pairs) antisense (GGAAGCTTATCAAAGTCCTCGGCCACA). The amplified products were separated

PAGE 68

53 by electrophoresis on a 10% poly acrylamide gel, stained with SYBR Green (Lonza, Rockland, ME), and photographed with the Kodak EDS 120 Digital Analysis System. The net intensity of each band was normalized to the respective endogenous control band. For real time PCR, 100 ng total RNA was reverse transcribed to generate single strand cDNA as previously described [18] The cDNA samples were amplified using Fast SYBR Green Master Mix (Applied Biosystems) on an Applied Biosystems Step One Plus instrume nt. RQ (relative mean mRNA expression level) is calculated by the Step One software version 2.0. Using standard curves constructed for target and endogenous control genes, an arbitrary quantitative gene expression value is determined from the threshold cyc le (Ct) for each gene for each sample. Target gene values are normalized to control gene values, and fold difference is determined by dividing by the designated reference/ calibrator sample. Enzyme linked immunosorbant a ssay. For conditioned media analysi s, media containing 0.1% FBS was added to cells 24 h after transfection/ plating. Twenty four hours later, cells were counted and media was collected and centrifuged to remove debris, aliquoted, and stored at ( 80)C. To assess MMP1 activity, MMP1Emzyme Li nked Immunosorbant Assay (ELISA) Enzyme Activity Assay (R&D Systems, Inc, Minneapolis, MN) was performed on un concentrated conditioned media samples in detectable by a ddition of APMA MMP activating agent to all sample wells and standards. Fluorescence was read on a Fluorostar Galaxy plate reader. Resultant values were derived from a standard curve and expressed as the mean MMP1 concentration of triplicate samples +/ st andard error. When cell viability varied significantly, MMP1 concentration

PAGE 69

54 was normalized to average cell number at time of conditioned media collection. MMP2 and 3 ELISAs (R&D Systems, Inc, Minneapolis, MN) were performed in triplicate on un concentrated Luciferase assay. Stable 118 PCDNA3.1 or BRAT cells were transfected with 0.15ug Renilla Luciferase reporter and 1.5ug MMP1 luciferase reporter. Twenty four hours later, cells were collected in Promega Pass ive Lysis Buffer and subjected to 2 freeze thaw cycles. Lysates were centrifuged at 10,600 xg for 1 minute at 4 degrees C, and supernatant was collected. Luciferase activity was assessed using a manual luminometer and the Promega Dual Luciferase Assay Syst em according to manufacturer protocol. For knockdown reporter studies, siRNA was co transfected and cells were collected 48 hours after transfection. Statistics. For real time PCR, error bars illustrate RQmin and RQmax, which are calculated as: RQave div confidence interval, for 5 degrees freedom) and RQave times (standard deviation^ This range represents the confidence interval at the 95% confidence level. For ELISA replicates. For ELISA comparison of MMP1 in conditioned media in cell lines, data did not follow a normal dis tribution; therefore, a nonparametric Wilcoxon test was performed. Results BRAT alters expression of genes involved in multiple cellular processes. Several studies supporting the importance of independent BRCA1 mutant functions

PAGE 70

55 report modulation of gene e xpression by mutants. The periostin gene was up regulated in HeLa cells stably expressing the risk associated BRCA1 mutation 5083del19, which lacks the C terminal 193 amino acids, but not wt BRCA1, while increased periostin levels were also found in breast cancer tissue and serum of patients carrying the mutation [28] Similarly, mRNA and protein of D52 (TD52) and the folate receptor alpha (FOL1) were elevated in Hela cells expressing the Ser1841Asn breast cancer ris k associated BRCA1 mutation [29] and a synthetic BRCA1 truncation mutant comprising the N terminal third of the protein up regulated p53 gene expression and down regulated constituents of the JNK/SAPK and MAPK/ERK pathways in mouse epithelial OC cells [30] Preliminary microarray analysis of HOSE 118 cells (wt BRCA1), transiently transfected with the BRAT mutation revealed numerous differentially regulated genes (Table 2.1.), including elevated expression of the gene encoding matrix metalloprotease 1. BRAT enhances MMP1 gene expression in HOSE 118 cells. MMP family members are important for invasion and metastasis and are overexpressed in OC [11] In n PAR 1 activation in OC [17] a polymorphism in the MMP1 promoter that enhances expression [22] was found more frequently in OC patients compared to normal women. Further, tumors with the allele expressed seven times more MMP1 than tumors without the allele [31] Therefore, I decided to further explore MMP1 as a downstream target of BRAT in HOSE cells. To confirm that BRAT enhances MMP1expression transcriptionally, I performed semi quantitative RT PCR to measure the MMP1 mRNA level in HOSE 118 cells stably expressing BRAT or the control vector PCDNA3.1. While vector expressing cells exhibited undetectab le levels of MMP1 by this method, MMP1 mRNA levels were

PAGE 71

56 Table 2.1. Selection of genes determined to be differentially regulated in BRAT cells. Gene Change PCDNA3.1 vs BRAT Average fold change IL1 alpha I 4.61 BCL2A1 I 4.55 IL1 be ta I 3.84 NFKB2 I 3.60 MMP1 I 2.70 IL6 I 2.50 IL11 I 2.06 Collagen I alpha 1 D 1.84 Collagen III alpha 1 D 2.65

PAGE 72

57 significantly enhanced in both BRAT clones 6 and 7 (Figure 2.1. A). MMP1 mRNA levels were also evaluated by real time RT PCR, and BRAT cells exhibited MMP1 mRNA levels 16 18 fold higher than PCDNA3.1 cells (Figure 2.1. B). This data supports the hypothesis that BRAT enhances transcription of the MMP1 gene in HOSE 118 cells. BRAT increases expression and secretion of pro MMP1 by HOSE 118 cells. To evaluate the impact of BRAT expression on intracellular protein levels of MMP 1, Western blotting was performed on lysates of stable HOSE 118 BRAT and PCDNA3.1 cells. As expected, active (cleaved) MMP 1 was not detectable in lysates, however levels of pro MMP1 were 5 21 fold higher in BRAT clones 6 and 7 compa red to PCDNA3.1 cells (Figure 2.2. A.). To determine whether BRAT expression also results in increased pro MMP1 protein secretion, the MMP1 Enzyme Activity Assay was utilized to measure enzyme activity in conditioned media of cultured cells. Addition of a chemical MMP activating reagent, 4 Aminophenylmercuric acetate (APMA), allows measurement of total MMP1 (pro and active). Endogenously activated MMP1 was not detectable in un concentrated conditioned media of HOSE 118 cells, however, total MMP1 levels were 6 8 fold higher in conditioned media of BRAT clones 6 and 7 compared to PCDNA3.1 cells (Figure 2.2. B). BRAT mediated up regulation was specific to M MP1, as MMP2 and 3 were undetectable in conditioned media of transiently transfected BRIT or BRAT cells (Figure 2.2. C). These data indicate that BRAT specifically enhances expression and secretion of pro MMP1 by HOSE 118 cells. MMP1 and maspin are indepe ndent targets of BRAT. As mentioned previously, maspin was determined to be up regulated in BRAT expressing HOSE cells [8] Maspin is a member of the serine protease inhibitor (serpin) family that was

PAGE 73

58 Figure 2.1. MMP1 mRNA is increased in BRAT expressing HOSE cells. Cells stably expressing BRA T or the PCDNA vector were plated at equal densities and collected. RNA was isolated, DNAse treated, and reverse transcribed. A. Semi quantitative PCR was performed for MMP1 and actin. PCR products were electrophoresed on a 10% acrylimide gel, stained with SYBR green, and imaged. B. Real time PCR was performed in triplicate for MMP1 and actin using SYBR green detection. RQ (relative mean mRNA expression level) was calculated by the Step One software version 2.0. Using standard curves constructed for target and endogenous control genes, an arbitrary quantitative gene expression value is determined from the Ct for each gene for each sample. Target gene values are normalized to control gene values, and fold difference is determined by dividing by the designate d reference/ calibrator sample.

PAGE 74

59

PAGE 75

60 Figure 2.2. BRAT increases cellular pro MMP1 and total secreted MMP1 in BRAT cells. A. Cells stably expressing PCDNA or BRAT were plated at equal densities, collected, and lysed. Protein lysate was separated using SD S PAGE and Western blotting was performed using the indicated antibodies. Relative band intensity was determined by dividing the pro MMP1 band intensity by the actin band intensity for each lane. B. Stable cells were plated at equal densities, allowed to a ttach, and then serum starved in media containing 0.1% fetal bovine serum for 24 hours. Conditioned media was collected and debris and dead cells were removed by centrifugation. Total MMP1 levels in un concentrated conditioned media were determined in trip licate by an MMP1 ELISA activity assay using the addition of the MMP activating reagent APMA. Graph indicates averages +/ standard error. C. Cells were transiently transfected with indicated transfectant and conditioned media was collected as described. T otal MMP levels in un concentrated conditioned media were determined in triplicate by ELISA kits. Graphs illustrate averages +/ standard error, except positive control human dermal fibroblast and human umbilical vein endothelial cell (HUVEC) conditioned m edia.

PAGE 76

61 identified by its diminished expression in breast tumor samples compared to normal breast tissue [32] Maspin is non inhibitory due to a shortened and non conserved reactive site loop, the serpin domain responsible for protease inh ibition [32] Maspin expre ssion is low or absent in normal HOSE [9, 33] but in OC samples correlates with high tumor grade and shorter overall survival [9] Exogenous maspin expression inhibits migra tion, angiogenesis, invasion, and metastasis in multiple cancer models in vitro and in vivo, including breast, prostate, and OC cells [9, 34 36] Because maspin has been identified as a target of BRAT and maspin mod ulates migration, invasion, and metastasis, I decided to test whether maspin impacts MMP1 expression in BRAT cells. MMP1 mRNA levels were not significantly impacted by maspin knockdown (Figure 2.3), suggesting maspin and MMP1 are parallel targets of BRAT. BRAT mediated MMP1 modulation is c Jun dependent. MMPs are regulated extracellularly by pericellular localization [11] proteolytic activation, and binding of tissue inhibitors of metalloproteases (TIMPS) [37] as well as in tracellularly by transcription. To begin to elucidate the mechanism of MMP1 gene up regulation in BRAT cells, I chose to evaluate the importance of c Jun, as this transcription factor was previously implicated in BRAT mediated maspin up regulation in HOSE 118 cells [8] and because multiple AP1 sites in the MMP1 promoter are important in gene regulation (Reviewed in [38 40] ). HOSE 118 cells were transiently co transfected with BRIT or BRAT and Si Con or Si c Jun. BRIT/BRAT expression was confirmed by semi quantitative PCR (Figure 2.4. A). Greater than 95% knockdown of c Jun was confirmed by Western Blot (Inset in F igure 2.4. B). c Jun knockdown diminished MMP1 mRNA levels by 60% in BRIT cells, and by 80% in BRAT cells (Figure 2.4. B). Further, c Jun

PAGE 77

62 Figure 2.3. MMP1 and maspin are parallel targets of BRAT. HOSE 118 cells stably expressing PCDNA or BRAT were transiently transfected with siRNA targeting maspin. Cells were collected after 48 hours, and RNA was isolated, DNAse treated, revers e transcribed, and real time PCR was performed in triplicate for MMP1 and actin using SYBR green detection. Semi quanitative PCR was performed for maspin and actin, and PCR products were run on a 10% acrylimide gel, stained with SYBR green, and imaged.

PAGE 78

63

PAGE 79

64 Figure 2.4. BRAT mediated MMP1 modulation is c Jun dependent. A. 118 HOSE cells were transien tly transfected with indicated transfectant and cells were collected 48 hours after transfection. RNA was isolated, DNAse treated, reverse transcribed, and semi quantitative PCR was performed for BRIT/BRAT and actin. PCR products were electrophoresed on a 10% acrylimide gel, stained with SYBR green, and imaged. B. Protein lysates were collected in parallel for knock down analysis by Western blot. Real time PCR was performed in triplicate for MMP1 and actin using SYBR green detection. C. Conditioned media wa s collected in parallel. MMP1 ELISA activity assay was performed in triplicate as described, however, because cell viability differed significantly, cell counts were performed upon conditioned media collection, and total MMP1 levels were normalized to cell number. Graph illustrates averages +/ standard error.

PAGE 80

65 knockdown also reduced total MMP1 level in conditioned media by 69% in PCDNA cells, and 81% in BRAT cells (Figure 2.4. C). Interestingly, c Jun protein levels were elevated in BRAT cells (1.4 fold) (Figure 2.4. B), suggesting that BRAT mediated MMP1 up regulation may occur at least, in part, through increased c Jun levels. AP 1 sites in the MMP1 promoter mediate enhanced MMP1 expression in BRAT cel ls. Specific AP1 sites in the MMP1 promoter have been shown to impact MMP1 gene expression. The AP1 site at ( 72) is important for basal as well as induced MMP1 expression [41, 42] In ad dition, an AP1 site at ( 1602) is important for regulation, and this region is of critical importance in OC. A single nucleotide polymorphism in the was found to increase the efficacy of an Ets transcription factor binding site adjacent to the AP1 site at ( 1602), and increase MMP1 expression in normal human fibroblasts and melanoma cells [22] Interestingly, compared to the 1G allele, the 2G allele was present in a higher proportion of OC patients compared to normal controls [31] To determine whether BRAT mediates 1G/2G allele specific regulation of the MMP1 promoter, a set of MMP1 luciferase reporter constructs was obtained (Figure 2.5. A). Each construct contains the full length MMP1 promoter with eithe r the 1G or 2G allele at ( 1607) in control of the firefly luciferase gene. Activity of the 1G wt reporter was 1.7 fold higher in stable BRAT cells compared to stable PDCNA cells, while activity of the 2G wt reporter was greater than 2 fold higher in BRAT cells (Figure 2.5. B). Further, the 2G wt reporter construct mediated significantly more activity than the 1G promoter in both PCDNA (3.4 fold) and BRAT cells (4.4 fold). The importance of the ( 72) and ( 1602) AP1 sites was also determined

PAGE 81

66

PAGE 82

67

PAGE 83

68 Figure 2.5. AP 1 sites in the MMP1 promoter mediate enhanced MMP1 expression in BRAT cells. A. Human MMP1 promoter luciferase reporter constructs. B. Cells stably expressing PCDNA or BRAT were transiently transfected with the indicated MMP1 reporter construct an d a Renilla constitutive luciferase reporter plasmid for normalization. Lysates were collected, subjected to two freeze thaw cycles, and assayed in triplicate on a manual normal ized to Renilla luciferase activity for each triplicate, averaged, and results are expressed +/ standard error. C. Stable cells were also co transfected with non targeting control siRNA or siRNA targeting c Jun, collected, and assayed similarly. Protein l ysates were collected in parallel for knock down analysis.

PAGE 84

69 by utilizing 1 G and 2G full length promoter constructs in which the indicated AP1 site, ( 72) or ( 1602), was mutated to be non functional (Figure 2.5. A). In reporter constructs containing either 1G or 2G version of the SNP, MMP1 promoter activity was diminished signi ficantly by mutation of either AP1 si te, ( 72) or ( 1602) (Figure 2. 5 B). These data suggest that AP1 sites at ( 72) and ( 1602) are critical for BRAT mediated enhancement of MMP1 expression. Further, the presence of an Ets binding site adjacent to the di stal AP1 site further augments c Jun mediated MMP1 transcription. To dissect the contribution of other regions of the promoter to BRAT mediated MMP1 up regulation, a second set of luciferase reporter constructs was utilized. The constructs consist of a ser firefly luciferase gene (Figure 2.5. A). The full length (FL), ( 3292), and ( 2942) constructs have the 2G version of the SNP, while the smaller constructs, ( 1546) and ( 517) lack this region. SiRNA against c Jun was used concomitantly to validate the importance of c Jun for BRAT mediated MMP1 promoter activity mediated by each construct. Activity of the ( 329 2) truncation, in which an OCTA3 site, a PEA 3 site, an AP1 site, and several silencers are lost, was decreased by 24% compared to the full length reporter (Figure 2.5. C). Truncation to ( 2942) results in loss of cAMP response element binding (CREB) and p olyoma enhancer activator protein (PEA3) sites from the promoter. Transfection of ( 2942) yielded 18% lower activity than the full length promoter as well. Notably, c Jun knockdown in BRAT cells reduced full length, ( 3292), and ( 2942) reporter activity 6 1, 62, and 66.5% respectively, confirming the importance of c Jun for BRAT mediated MMP1 expression. Similarly, c Jun knockdown significantly diminished remaining activity of the ( 1546) and ( 517) constructs. These

PAGE 85

70 data suggest that proximal portions of t he MMP1 promoter are important for BRAT mediated up regulation, and that AP1 sites throughout the promoter are necessary for MMP1 expression in BRAT cells. Increased pro MMP is detectable in BRAT mutation carrier derived cellular conditioned media. To eva luate the clinical impact of BRAT on MMP1 levels, BRAT mutation carrier derived immortalized HOSE cell lines were utilized. MMP1 levels in conditioned media of immortalized HOSE cell lines from the ovaries of women carrying a BRAT mutation were compared to lines without a family history of OC or with a confirmed wt genotype. Total conditioned media MMP1 levels were significantly higher in BRAT carrier HOSE cell lines (3261 77a, 3261 77b, 1816 686a, and 1816 686b) compared to non carrier HOSE cell lines (121 118, IMCC5) (Figure 2.6.). These data suggest that BRAT mediated MMP1 up regulation is detectable in cells of patients carrying this mutation. Discussion We have previously shown a role for the 185delAG BRCA1 mutation, BRAT, in STS induced apoptosis of normal HOSE a nd OC cells [18] as well as in the up regulation of the OC associated serpin, maspin, in normal cells [8] H ere, I identify a novel downstream target of BRAT, MMP1, and show that MMP1 is up regulated transcriptionally through a mechanism involving c Jun. Further, ELISA reveals higher total MMP1 secretion by HOSE cell lines derived from BRAT mutation carriers. I nterestingly, several of the genes differentially regulated in BRAT expressing HOSE cells encode proteins that localize to the extracellular space and are potentially important in OC (collagen I, and collagen III, IL 6, IL 1alpha, IL 1beta, and MMP1).

PAGE 86

71 Figure 2.6. Increased pro MMP is detectable in BRAT mutation carrier derived cellular conditioned media. Cells were plated in triplicate at similar densities and conditioned media was collected as de scribed. MMP1 ELISA activity assay was performed in triplicate as described, however, because cell viability differed significantly, cell counts were performed upon conditioned media collection, and total MMP1 levels were normalized to cell number. Graph i llustrates averages +/ standard error.

PAGE 87

72 Coll agens I and III are present in the extracellular matrix of the ovary and/or the omentum [12, 13] IL [43] and up [44] another potential BRAT target and mitogenic factor for HOSE cel ls [14] while IL 6 can enhance invasion of OC cell lines [45] MMP1 cleaves collagens I and III and can also cleave pro laminin, which are present in the ovarian and omental ECM, and pro MMP 2 and 9, which cleave multiple extracellular matrix constituents [11] Taken together, these targets of BRAT could promote motility, invasion, and metastasis of normal HOSE and potential tumor cells of mutation carriers. c ulation has been well established [41, 42] and in my model system, c Jun is crucial for BRAT mediated MMP1 up regulation. Increased c Jun protein levels in BRAT cells likely contribute to MMP1 up regulation. In agr eement, c Jun mRNA levels increase significantly prior to TNF 1 induced MMP1 up regulation [46] Future studies may reveal additional c Jun responsive genes differentially regulated by BRAT. I have begun to elucidate specific AP1 sites and other MMP1 promoter elemen ts necessary for BRAT mediated MMP1 up regulation. Truncation of the full length MMP1 promoter to ( 3292) significantly decreases reporter activity in BRAT cells, which indicates the importance of one or more distal promoter elements for activity. Indeed, binding sites for AP1 and PEA3, which has been shown to transactivate the MMP1 promoter [47] are located here. In some experiments, activity of the ( 2942) construct was marginally higher. Loss of a PEA3 site at this position could make available additional PEA3, which has been shown to synergize with c Ju n [47] BRAT cell reporter

PAGE 88

73 activity of the three lar gest constructs was dramatically decreased by c Jun knockdown. Reduced activity was comparable to that of the full length promoter in PCDNA3.1 cells, confirming the importance of c Jun for BRAT mediated MMP1 expression. The greatest loss in reporter activi ty relative to full length occurs by truncation of the promoter to ( 1546) or ( 517), by which several elements are eliminated, including two AP1 sites. Specific disruption of the ( 1602) AP1 site significantly decreases reporter activity as well. I n agreement with the literature (Reviewed in [38] ), one or more of the most proximal AP1 sites ( 1062, 891, 562, 436, 181, 72) contribute to basal BRAT mediated MMP1 promoter activ ity, as c Jun knockdown significantly diminishes remaining activity of the ( 1546) and ( 517) constructs. Further, specific disruption of the ( 72) AP1 site also abrogates reporter activity. Taken together, these data reveal the necessity of c Jun in BRAT mediated MMP1 up regulation. The presence of the 2G MMP1 promoter polymorphism increases promoter activity [22] and is associated with decreased disease free and overall survival in OC patients [48] As expected, BRAT cells exhibited significantly higher activity than PCDNA3.1 cells when measu ring 1G and 2G versions of the promoter. In agreement with previous findings, the 2G wt reporter construct mediated significantly more activity than the 1G promoter in both PCDNA3.1 and BRAT cells. Interestingly, the enhancement in promoter activity mediat ed by the additional G nucleotide was even more apparent in BRAT cells, and Ets 1 levels were increased in BRAT cells compared to PCDNA cells (Figure 2.7.). Greater MMP1 2G promoter activity in BRAT cells may occur through cooperation of Ets 1 with increas ed c Jun, as Ets 1 and c Jun physically interact and can synergistically transactivate promoter expression [49] Further, AP1 and

PAGE 89

74 Figure 2.7. Ets 1 protein levels are elevated in BRAT cells. Cells stably expressing PCDNA or BRAT were plated at eq ual densities, collected, and lysed. Protein lysate was separated using SDS PAGE and Western blotting was performed using the indicated antibodies. Relative band intensity was determined by dividing the Ets 1 band intensity by the actin band intensity for each lane.

PAGE 90

75 Ets 1 sites are found in the Ets 1 promoter [50] therefore increased Ets 1 levels in BRAT cells may o ccur in part through increased c Jun transactivation. Alternatively, Ets 1 may represent an additional independent signaling pathway alternatively regulated in BRAT cell. It would be interesting to determine whether BRAT mutation associated OCs exhibit a h igh frequency of 2G alleles, as the combination of this allele with elevated c Jun protein could potentially augment OC progression or metastasis by up regulating MMP1. I have determined that maspin and MMP1 are parallel targets of BRAT, as maspin does not significantly impact MMP1 expression in BRAT cells. Interestingly, MMP1 is activated in vitro in a stepwise manner by uPA and MMP3 (stromelysin) [51] and maspin has been shown to negatively regulate uPA activity by enhancing uPA/uPAR internalization and by inhibiting activation of pro uPA [52] appear to regulate MMP1 expression, it may be important in regulation of MMP1 activity. Indeed, DU145 prostate cancer c ells stably expressing maspin exhibit decreased collagen cleavage in collagen degradation assays [53] We have previously found significantly lower levels of phospho Akt concurrent with enhanced apoptosis in BRAT c ells treated with cytotoxic drugs [18] It would be interesting to determine whether diminished Akt activity is necessary for MMP1 up regulation in BRAT cells, and the signaling pathways involved. Indeed, preliminar y data suggest Akt signaling is involved in BRAT mediated MMP1 up regulation. Expression of a constitutively active Akt construct diminishes MMP1 mRNA expression and total MMP1 in conditioned media of BRAT cells (Figure 2.8.). Interestingly, Akt inhibition has been shown to enhance activation of the MAPK pathway [54] which in turn

PAGE 91

76 Figure 2.8. Constitutively active Akt reverses BRAT mediated MMP1 up regulation. A. 118 HOSE cells were transi ently transfected with indicated transfectant and collected 24 hours later. RNA was isolated, DNAse treated, reverse transcribed, and real time PCR was performed in triplicate for MMP1 and actin using SYBR green detection. Protein lysates were collected in parallel for analysis of CA Akt expression. B. Conditioned media was collected in parallel. MMP1 ELISA activity assay was performed in triplicate as described, however, because cell viability differed significantly, cell counts were performed upon conditi oned media collection, and total MMP1 levels were normalized to cell number. Graph illustrates averages +/ standard error.

PAGE 92

77 enhances activity of the transcription factor c Jun. It will be interesting to determine in future studies the mechanism by which Akt mod ulates MMP1 expression. Normal cell lines and prophylactically removed ovaries from BRCA1 mutation carriers provide model systems in which to study early genetic, cellular, and histologic steps in OC initiation and progression. Immunohistochemical analysis revealed intermediate levels of Ki67 and p53 staining for prophylactically removed ovaries, while normal ovaries had the lowest staining and OC specimens exhibited the highest staining [55] Not all of the prophyl actically removed ovaries were from patients with confirmed BRCA1 mutations, however, and no correlation was found between any of the markers and presence of a BRCA1 mutation [55] In contrast, Piek et al. found no histologic change s in prophylactically removed ovaries compared to normal ovaries, and no difference in staining of Ki67, p21, p27, p53, Cyclin A, cyclin D1, Her2, ERalpha, and PR. Only Bcl 2 expression was significantly higher than in normal ovaries [56] Kirkpatrick et al. devised a multiphoton microscopy method to image ovarian surface epithelium and collagen fibrils of the ECM immediately after oophorectomy. Changes in collagen fibril organization similar to cancer specimens wer e detected in high risk ovaries [57] Similarly, abnormal regions of OSE, such as invaginations, inclusions cysts, papillary and stratified areas, adenomas, and microscopic adenocarcinomas, lacked a detectable basem ent membrane, as defined by collagen IV and laminin staining [58] These studies suggest that alteration in the ECM integrity may be a characteristic of BRCA1 mutant OC pathology. Early molecular and cytological cha nges have also been seen in cell lines generated from normal OSE cells of women with a strong family history of OC,

PAGE 93

78 including irregular cellular morphology and organization in culture, elevated CA 125 and E cadherin, and amplification of various signaling pathways such as hepatocyte growth factor (HGF) and the PI3K pathway (Reviewed in [59] ). Immortalized HOSE from these patients also exhibited higher telomeric instability when compared to cells from patients withou t a strong family history [20] Our investigation reveals BRAT mutation associated phenotypic changes, as mutation carrier derived cell lines exhibit elevated MMP1secretion. Cleavage of ECM components, cell cell adhesion molecules, growth factors/ receptors, and other proteases is a crucial step in cancer cell migration, invasion, and metastasis. Consequently, up regulation and enhanced secretion of pro MMP1 from the HOSE of BRAT mutation carriers could prime these cells for transformation and metastasis. Cleavage of pro growth factors and release of ECM bound growth factors potentially promote survival and, therefore, accumulation of cancer promoting mutations. ECM remodeling also alters cell ECM contacts, which influence cell survival and migration as well. Final ly, as mentioned previously, OCs are highly prone to metastasis through cell shedding, and MMPs are critical for OC cell attachment at metastatic sites and establishment of metastases [12] Though MMP inhibitors hav e been largely ineffective in clinical trials, this may be in part because they are administered after metastases are already established [11] In contrast, animal models reveal preventative treatment diminishes tumor development [11] Confirming the imp ortance of MMP1 in a subset of OCs could improve survival by identifying patient populations that will respond best to treatment strategies targeting MMPs.

PAGE 94

79 It is important to remember that in vivo, stromal cells, epithelial cells, and endothelial cells al l contribute to the MMPs found in the extracellular environment [48] This conc Instead, the potential exists for even greater enhancement of motility and invasive capability. MMP1 can be activated by multiple other MMPs that may be present in the ECM from an y cell source. Further, MMP1 activates several other proteases that cleave substrates it cannot. For example, MMP1 aids in activation of MMP2, which cleaves collagen IV, a major constituent of the ovarian basement membrane. Regardless of the mechanism, alt eration of MMP activity likely has far reaching consequences for the local ECM and epithelial stromal interplay in vivo. In these cells, BRAT mediated changes conducive to development of a malignant phenotype may have begun. It is interesting to speculate that BRAT cells, though non tumorigenic in their current state [18] may represent a step forward on the continuum of cellular malignancy. Loss of DNA damage repair through BRCA1 mutation and LOH as well as gain of function mutant activities such as gene regulation both likely contribute to further accumulation of genetic changes that promote OC progression and are characteristic of late stage BRCA1 mutation associated OC. I have identified another downstream target of the 185delAG BRCA1 mutant, BRAT. MMP1 expression is increased in BRAT cells transcriptionally in a c Jun dependent mechanism, and BRAT cells exhibit increased MMP1 secretion. Mutation associated changes early in OC development could poise cells in norm al tissue of mutation carriers for transformation or acquisition of invasive or metastatic ability.

PAGE 95

80 Further exploration of these changes can increase our understanding of early steps of OC development and help identify potential screening and treatment str ategies.

PAGE 96

81 References 1. Jemal A, Siegel R, Xu J & Ward E (2010) Cancer Statistics, 2010. CA Cancer J Clin doi: caac.20073 [pii]10.3322/caac.20073. 2. Holschneider CH & Berek JS (2000) Ovarian cancer: epidemiology, biology, and prognos tic factors. Semin Surg Oncol 19 3 10, doi: 10.1002/1098 2388(200007/08)19:1<3::AID SSU2>3.0.CO;2 S [pii]. 3. Whittemore AS, Gong G & Itnyre J (1997) Prevalence and contribution of BRCA1 mutations in breast cancer and ovarian cancer: results from three U. S. population based case control studies of ovarian cancer. Am J Hum Genet 60 496 504. 4. Lux M, Fasching P & Beckmann M (2006) Hereditary breast and ovarian cancer: review and future perspectives. Journal of Molecular Medicine 84 16 28. 5. Mullan PB, Qu inn JE & Harkin DP (2006) The role of BRCA1 in transcriptional regulation and cell cycle control. Oncogene 25 5854 5863, doi: 1209872 [pii]10.1038/sj.onc.1209872. 6. Jhanwar Uniyal M (2003) BRCA1 in cancer, cell cycle and genomic stability. Front Biosci 8 s1107 1117. 7. Linger RJ & Kruk PA (2010) BRCA1 16 years later: risk associated BRCA1 mutations and their functional implications. FEBS J 277 3086 3096, doi: EJB7735 [pii]10.1111/j.1742 4658.2010.07735.x. 8. O'Donnell JD, Linger RJ & Kruk PA (2009) BRCA 1 185delAG mutant protein, BRAt, up regulates maspin in ovarian epithelial cells. Gynecol Oncol doi: S0090 8258(09)00840 3 [pii]10.1016/j.ygyno.2009.10.052. 9. Sood AK, Fletcher MS, Gruman LM, Coffin JE, Jabbari S, Khalkhali Ellis Z, Arbour N, Seftor EA & Hendrix MJ (2002) The paradoxical expression of maspin in ovarian carcinoma. Clin Cancer Res 8 2924 2932. 10. Sternlicht MD & Werb Z (2001) How matrix metalloproteinases regulate cell behavior. Annu Rev Cell Dev Biol 17 463 516, doi: 10.1146/annurev.cel lbio.17.1.46317/1/463 [pii]. 11. Egeblad M & Werb Z (2002) New functions for the matrix metalloproteinases in cancer progression. Nat Rev Cancer 2 161 174, doi: 10.1038/nrc745. 12. Kenny HA, Kaur S, Coussens LM & Lengyel E (2008) The initial steps of ovar ian cancer cell metastasis are mediated by MMP 2 cleavage of vitronectin and fibronectin. J Clin Invest 118 1367 1379, doi: 10.1172/JCI33775. 13. Ricciardelli C & Rodgers RJ (2006) Extracellular matrix of ovarian tumors. Semin Reprod Med 24 270 282, doi: 10.1055/s 2006 948556.

PAGE 97

82 14. Auersperg N, Wong AS, Choi KC, Kang SK & Leung PC (2001) Ovarian surface epithelium: biology, endocrinology, and pathology. Endocr Rev 22 255 288. 15. Fata JE, Ho AT, Leco KJ, Moorehead RA & Khokha R (2000) Cellular turnover an d extracellular matrix remodeling in female reproductive tissues: functions of metalloproteinases and their inhibitors. Cell Mol Life Sci 57 77 95. 16. Auersperg N, Maclaren IA & Kruk PA (1991) Ovarian surface epithelium: autonomous production of connecti ve tissue type extracellular matrix. Biol Reprod 44 717 724. 17. Agarwal A, Covic L, Sevigny LM, Kaneider NC, Lazarides K, Azabdaftari G, Sharifi S & Kuliopulos A (2008) Targeting a metalloprotease PAR1 signaling system with cell penetrating pepducins inh ibits angiogenesis, ascites, and progression of ovarian cancer. Mol Cancer Ther 7 2746 2757, doi: 7/9/2746 [pii]10.1158/1535 7163.MCT 08 0177. 18. O'Donnell JD, Johnson NC, Turbeville TD, Alfonso MY & Kruk PA (2008) BRCA1 185delAG truncation protein, BRAt amplifies caspase mediated apoptosis in ovarian cells. In Vitro Cell Dev Biol Anim 44 357 367, doi: 10.1007/s11626 008 9122 0. 19. Berman DB, Wagner Costalas J, Schultz DC, Lynch HT, Daly M & Godwin AK (1996) Two distinct origins of a common BRCA1 mutat ion in breast ovarian cancer families: a genetic study of 15 185delAG mutation kindreds. Am J Hum Genet 58 1166 1176. 20. Kruk PA, Godwin AK, Hamilton TC & Auersperg N (1999) Telomeric instability and reduced proliferative potential in ovarian surface epi thelial cells from women with a family history of ovarian cancer. Gynecol Oncol 73 229 236, doi: S0090 8258(99)95348 9 [pii]10.1006/gyno.1999.5348. 21. Rutter JL, Benbow U, Coon CI & Brinckerhoff CE (1997) Cell type specific regulation of human interstiti al collagenase 1 gene expression by interleukin 1 beta (IL 1 beta) in human fibroblasts and BC 8701 breast cancer cells. J Cell Biochem 66 322 336, doi: 10.1002/(SICI)1097 4644(19970901)66:3<322::AID JCB5>3.0.CO;2 R [pii]. 22. Rutter JL, Mitchell TI, Butt ice G, Meyers J, Gusella JF, Ozelius LJ & Brinckerhoff CE (1998) A single nucleotide polymorphism in the matrix metalloproteinase 1 promoter creates an Ets binding site and augments transcription. Cancer Res 58 5321 5325. 23. Alfonso De Matte MY, Yang H, Evans MS, Cheng JQ & Kruk PA (2002) Telomerase is regulated by c Jun NH2 terminal kinase in ovarian surface epithelial cells. Cancer Res 62 4575 4578.

PAGE 98

83 24. Van Gelder RN, von Zastrow ME, Yool A, Dement WC, Barchas JD & Eberwine JH (1990) Amplified RNA synt hesized from limited quantities of heterogeneous cDNA. Proc Natl Acad Sci U S A 87 1663 1667. 25. Dobbin KK, Beer DG, Meyerson M, Yeatman TJ, Gerald WL, Jacobson JW, Conley B, Buetow KH, Heiskanen M, Simon RM, et al. (2005) Interlaboratory comparability s tudy of cancer gene expression analysis using oligonucleotide microarrays. Clin Cancer Res 11 565 572, doi: 11/2/565 [pii]. 26. Liu WM, Mei R, Di X, Ryder TB, Hubbell E, Dee S, Webster TA, Harrington CA, Ho MH, Baid J, et al. (2002) Analysis of high densi ty expression microarrays with signed rank call algorithms. Bioinformatics 18 1593 1599. 27. Deroanne CF, Hamelryckx D, Ho TT, Lambert CA, Catroux P, Lapiere CM & Nusgens BV (2005) Cdc42 downregulates MMP 1 expression by inhibiting the ERK1/2 pathway. J C ell Sci 118 1173 1183, doi: jcs.01707 [pii]10.1242/jcs.01707. 28. Quaresima B, Romeo F, Faniello MC, Di Sanzo M, Liu CG, Lavecchia A, Taccioli C, Gaudio E, Baudi F, Trapasso F, et al. (2008) BRCA1 5083del19 mutant allele selectively up regulates periostin expression in vitro and in vivo. Clin Cancer Res 14 6797 6803, doi: 14/21/6797 [pii]10.1158/1078 0432.CCR 07 5208. 29. Crugliano T, Quaresima B, Gaspari M, Faniello MC, Romeo F, Baudi F, Cuda G, Costanzo F & Venuta S (2007) Specific changes in the proteo mic pattern produced by the BRCA1 Ser1841Asn missense mutation. Int J Biochem Cell Biol 39 220 226, doi: S1357 2725(06)00237 8 [pii]10.1016/j.biocel.2006.08.005. 30. Sylvain V, Lafarge S & Bignon YJ (2001) Molecular pathways involved in response to ionizi ng radiation of ID 8 mouse ovarian cancer cells expressing exogenous full length Brca1 or truncated Brca1 mutant. Int J Oncol 19 599 607. 31. Kanamori Y, Matsushima M, Minaguchi T, Kobayashi K, Sagae S, Kudo R, Terakawa N & Nakamura Y (1999) Correlation b etween expression of the matrix metalloproteinase 1 gene in ovarian cancers and an insertion/deletion polymorphism in its promoter region. Cancer Res 59 4225 4227. 32. Zhang M (2004) Multiple functions of maspin in tumor progression and mouse development. Front Biosci 9 2218 2226, doi: 1392 [pii]. 33. Rose SL, Fitzgerald MP, White NO, Hitchler MJ, Futscher BW, De Geest K & Domann FE (2006) Epigenetic regulation of maspin expression in human ovarian carcinoma cells. Gynecol Oncol 102 319 324, doi: S0090 8 258(05)01131 5 [pii]10.1016/j.ygyno.2005.12.025. 34. Seftor RE, Seftor EA, Sheng S, Pemberton PA, Sager R & Hendrix MJ (1998) maspin suppresses the invasive phenotype of human breast carcinoma. Cancer Res 58 5681 5685.

PAGE 99

84 35. Abraham S, Zhang W, Greenberg N & Zhang M (2003) Maspin functions as tumor suppressor by increasing cell adhesion to extracellular matrix in prostate tumor cells. J Urol 169 1157 1161, doi: 10.1097/01.ju.0000040245.70349.37S0022 5347(05)63917 1 [pii]. 36. Shi HY, Zhang W, Liang R, Kittr ell F, Templeton NS, Medina D & Zhang M (2003) Modeling human breast cancer metastasis in mice: maspin as a paradigm. Histol Histopathol 18 201 206. 37. Pardo A & Selman M (2005) MMP 1: the elder of the family. Int J Biochem Cell Biol 37 283 288, doi: S1 357 2725(04)00256 0 [pii]10.1016/j.biocel.2004.06.017. 38. Benbow U & Brinckerhoff CE (1997) The AP 1 site and MMP gene regulation: what is all the fuss about? Matrix Biol 15 519 526. 39. Westermarck J & Kahari VM (1999) Regulation of matrix metalloprotei nase expression in tumor invasion. FASEB J 13 781 792. 40. Vincenti MP, White LA, Schroen DJ, Benbow U & Brinckerhoff CE (1996) Regulating expression of the gene for matrix metalloproteinase 1 (collagenase): mechanisms that control enzyme activity, transc ription, and mRNA stability. Crit Rev Eukaryot Gene Expr 6 391 411. 41. Lee JS, See RH, Deng T & Shi Y (1996) Adenovirus E1A downregulates cJun and JunB mediated transcription by targeting their coactivator p300. Mol Cell Biol 16 4312 4326. 42. Doyle GA Pierce RA & Parks WC (1997) Transcriptional induction of collagenase 1 in differentiated monocyte like (U937) cells is regulated by AP 1 and an upstream C/EBP beta site. J Biol Chem 272 11840 11849. 43. Vincenti MP, Coon CI, Lee O & Brinckerhoff CE (199 4) Regulation of collagenase gene expression by IL 1 beta requires transcriptional and post transcriptional mechanisms. Nucleic Acids Res 22 4818 4827. 44. Wu S, Boyer CM, Whitaker RS, Berchuck A, Wiener JR, Weinberg JB & Bast RC, Jr. (1993) Tumor necrosi s factor alpha as an autocrine and paracrine growth factor for ovarian cancer: monokine induction of tumor cell proliferation and tumor necrosis factor alpha expression. Cancer Res 53 1939 1944. 45. Obata NH, Tamakoshi K, Shibata K, Kikkawa F & Tomoda Y ( 1997) Effects of interleukin 6 on in vitro cell attachment, migration and invasion of human ovarian carcinoma. Anticancer Res 17 337 342. 46. Conca W, Kaplan PB & Krane SM (1989) Increases in levels of procollagenase messenger RNA in cultured fibroblasts induced by human recombinant interleukin 1 beta or serum follow c jun expression and are dependent on new protein synthesis. J Clin Invest 83 1753 1757, doi: 10.1172/JCI114077.

PAGE 100

85 47. de Launoit Y, Baert JL, Chotteau A, Monte D, Defossez PA, Coutte L, Pelcza r H & Leenders F (1997) Structure function relationships of the PEA3 group of Ets related transcription factors. Biochem Mol Med 61 127 135, doi: S1077315097926053 [pii]. 48. Six L, Grimm C, Leodolter S, Tempfer C, Zeillinger R, Sliutz G, Speiser P, Reint haller A & Hefler LA (2006) A polymorphism in the matrix metalloproteinase 1 gene promoter is associated with the prognosis of patients with ovarian cancer. Gynecol Oncol 100 506 510, doi: S0090 8258(05)00759 6 [pii]10.1016/j.ygyno.2005.08.049. 49. Logan SK, Garabedian MJ, Campbell CE & Werb Z (1996) Synergistic transcriptional activation of the tissue inhibitor of metalloproteinases 1 promoter via functional interaction of AP 1 and Ets 1 transcription factors. J Biol Chem 271 774 782. 50. Dittmer J (2003 ) The biology of the Ets1 proto oncogene. Mol Cancer 2 29, doi: 10.1186/1476 4598 2 291476 4598 2 29 [pii]. 51. Suzuki K, Enghild JJ, Morodomi T, Salvesen G & Nagase H (1990) Mechanisms of activation of tissue procollagenase by matrix metalloproteinase 3 (stromelysin). Biochemistry 29 10261 10270. 52. Yin S, Lockett J, Meng Y, Biliran H, Jr., Blouse GE, Li X, Reddy N, Zhao Z, Lin X, Anagli J, et al. (2006) Maspin retards cell detachment via a novel interaction with the urokinase type plasminogen activator /urokinase type plasminogen activator receptor system. Cancer Res 66 4173 4181, doi: 66/8/4173 [pii]10.1158/0008 5472.CAN 05 3514. 53. Cher ML, Biliran HR, Jr., Bhagat S, Meng Y, Che M, Lockett J, Abrams J, Fridman R, Zachareas M & Sheng S (2003) Maspin e xpression inhibits osteolysis, tumor growth, and angiogenesis in a model of prostate cancer bone metastasis. Proc Natl Acad Sci U S A 100 7847 7852, doi: 10.1073/pnas.13313601001331360100 [pii]. 54. Irie HY, Pearline RV, Grueneberg D, Hsia M, Ravichandran P, Kothari N, Natesan S & Brugge JS (2005) Distinct roles of Akt1 and Akt2 in regulating cell migration and epithelial mesenchymal transition. J Cell Biol 171 1023 1034, doi: jcb.200505087 [pii]10.1083/jcb.200505087. 55. Schlosshauer PW, Cohen CJ, Penaul t Llorca F, Miranda CR, Bignon YJ, Dauplat J & Deligdisch L (2003) Prophylactic oophorectomy: a morphologic and immunohistochemical study. Cancer 98 2599 2606, doi: 10.1002/cncr.11848. 56. Piek JM, Verheijen RH, Menko FH, Jongsma AP, Weegenaar J, Gille JJ Pals G, Kenemans P & van Diest PJ (2003) Expression of differentiation and proliferation related proteins in epithelium of prophylactically removed ovaries from women with a hereditary female adnexal cancer predisposition. Histopathology 43 26 32, doi: 1654 [pii].

PAGE 101

86 57. Kirkpatrick ND, Brewer MA & Utzinger U (2007) Endogenous optical biomarkers of ovarian cancer evaluated with multiphoton microscopy. Cancer Epidemiol Biomarkers Prev 16 2048 2057, doi: 16/10/2048 [pii]10.1158/1055 9965.EPI 07 0009. 58. Rol and IH, Yang WL, Yang DH, Daly MB, Ozols RF, Hamilton TC, Lynch HT, Godwin AK & Xu XX (2003) Loss of surface and cyst epithelial basement membranes and preneoplastic morphologic changes in prophylactic oophorectomies. Cancer 98 2607 2623, doi: 10.1002/cnc r.11847. 59. Wong AS & Auersperg N (2003) Ovarian surface epithelium: family history and early events in ovarian cancer. Reprod Biol Endocrinol 1 70, doi: 10.1186/1477 7827 1 701477 7827 1 70 [pii].

PAGE 102

87 Chapter 3: Impact of BRAT on A poptosis, G ene R egu lation, and M igration in N ormal B reast E pithelial and B reast C ancer C ells Introduction Though BRCA1 mutation carriers have a slightly elevated risk for cervical, uterine, and pancreatic cancer [1] the most significant cancer risk associated with a BRCA1 mutation is for breast and OC [2] Though it is not known why the disease manifests preferentially in these tissues, several hypotheses have be en put forth: 1) BRCA1 mutation results in impaired DNA damage repair, accumulation of DNA damage, and apoptosis. Cells in the breast and ovary, however, could have a mechanism by which to delay apoptosis and accumulate mutations, resulting in cell surviva l and tumorigenesis [3] ; 2) Higher rates of LOH may occur in the breast and ovary [3] which could result in loss of wt function and emphasize the importance of mutant BRCA1 functions in these tissues; and 3) Increased risk for breast and OC may result in part from the influences of hormone signaling. Estrogen is clear ly important for normal breast development and lactation and also in sporadic breast cancer. Expression of estrogen receptor alpha, which mediates the proliferative effects of estrogen for breast epithelial cells, is over expressed in more than half of spo radic breast cancers [4] and selective estrogen receptor modulators, such as tamoxifen, are highly effective in tre ating breast cancers that express estrogen receptor alpha. Despite the fact that most BRCA1

PAGE 103

88 associated breast tumors are estrogen receptor alpha negative [5] evidence indicates an interplay between BRCA1 and estrogen signaling. BRCA1 inhibits estrogen receptor dependent tra nsactivation function and down regulates the co activator p300 (E1A binding protein 300) (Reviewed in [6] ). Consequently, aberrant estrogen signaling in the breast and ovary, either directly or indirectly through paracrine signaling, may contribute to cancer in these tissues by enhancing survival despite impaired DNA damage repair due to BRCA1 mu tation (Reviewed in [2] ). Very few epidemiologic studies have attempted to determine whether specific BRCA1 mutations confer differential risk for breast or OC. Individuals who carry the same BRCA1 mutation may develop either breast or OC, whi le some individuals develop both. In population studies, families with predisposition to both breast and OC exhibit variation in the ratio of breast to OC occurrence [7] possibly as a result of the mutation they sh are. These observations suggest specific mutations have tissue specific functions that contribute to risk of cancer in the breast and/or ovary. Neuhausen et al. did not observe a significant difference in proportion of OC and breast cancer incidence mediat ed by specific mutations [8] In contrast, utilizing a population of 191 Ashkenazi Jewish OC patients, Moslehi and colleagues compared the estimated risk for breast or OC to 75 years of age mediated by three founder mutations. The three mutations conferred a similar risk of breast cancer, however risk of OC was greater in 185delAG mutation carriers compared to 5382InsC and 6174delT carriers (odds ratio 36.6, 20.8, and 14.2 respectively) [9] Differential risk of OC mediated by specific mutations may result from gain of function activity mediated by BRCA1 mutants in the ovary, while similar functions are not conferred, or have less impact in the breast.

PAGE 104

89 Studies estimating risk levels for specific mutations are inherently difficult to interpret, however, because risk estimates are dependent on the study population. For example, risk estimations are higher in studies involving high risk families, and depend on biologic factors su ch as prophylactic oophorectomy or mastectomy and age [10] Environmental factors such as diet or oral contraceptive use further complicate risk assessmen t. As a result, estimated ranges of risk associated with BRCA1 mutation for ovarian or breast cancer are wide, and statistical differences in risk between specific mutations are not typically reported [10] Larger studies examining mutations grouped by their location within the BRCA1 gene have attempted to strengthen epidemiologic analysis. Such studies have reported differential ovarian and breast cancer risk based on the location of truncation mutations 4191) contribute to a signif icantly higher proportion of breast to OC incidence [7, 11] Conversely, Thompson et al. identified a region between nucleotides 2401 and 4190 in which mutations contribute to a higher proportion of OC to breast can cer [12] The location of a truncation mutation within the gene determines the predicted truncated protein size, which potentially influences the function of the mutant within the breast or ovary and, for some mutants, the relative ratio of breast to OC associated with a specific mutation. Indeed, clinical disease characteristics have been shown previously to be portions of the adenomatous polyposis coli (APC) g ene result in a less severe version of familial adenomatous polyposis [11]

PAGE 105

90 I have previously observed that the BRAT mutation confers molecular and cellular changes in HOSE that may promote OC development. In order to understand the unique functions may preferentially promote OC, I examined the cellular and molecular impact of BRAT in normal breast epithelial and breast cancer cells. I hav e investigated several cellular and molecular processes previously found to be influenced by BRAT in normal HOSE or OC cells, including apoptosis and gene regulation, as well as cell migration. Methods Cell culture and t ransfection. MCF7, SkBr3, and MDA M B 231 human breast cancer cells were cultured in Medium 199/ MCDB 105 (Sigma, St. Louis, MO) with 10% fetal bovine serum and gentamicin. MCF10A normal human breast epithelial cells were cultured in DMEM/F12 (Mediatech, Manassas, VA) supplemented with 15mM HEPES, insulin 10ug/mL, EGF 20ng/mL (Sigma, St. Louis, MO), choleratoxin 100ng/mL (Biomol, Plymouth Meeting, PA), hydrocortisone 0.5ug/mL (BD Biosciences, Sparks, MD), L glutamine (MP Biomedicals, Solon, OH), glucose, sodium bicarbonate, 10% fetal bovine s erum and gentamicin. All cells were incubated at 37C with 5% CO 2 Two million cells were transiently transfected as previously described [13] using Program X 005 (for MCF7 cells), E 09 (for SkBr3 cells), X 013 (for 231 cells), T 024 (for MCF10A cells), Kit V, and the Nucleofector device (Amaxa/ Lonza, Walkersville, MD) with 2.5 3.5 ug of plasmid (GFP, PCDNA3.1 or Flag BRAT [13] ).

PAGE 106

91 Cell viability a ssay. Twenty four hours afte r transfection, cells were trypsinized, counted, and plated at sub confluence in triplicate in 96 well plates with media containing vehicle or 2 10uM cisplatin. After 1 hour, cells were assayed using the CellTiter 96 AQueous One Solution Cell Proliferatio n MTS (Promega, Madison, WI) colorimetric microplate reader (Bio then assayed every 24 hours for 72 hours. Re sults were expressed as the mean absorbance standard error. Western blot. Cells were PBS washed, trypsinized, pelleted, and washed 1 2 times in cold PBS. Cells were lysed for 30 minutes on ice in modified CHAPS buffer, and lysate was centrifuged at 115, 000 separated via 10% SDS PAGE. Proteins were transferred to PVDF membranes, dried at 37 C for 1 hour, and blocked in 5% milk or bovine serum albumin in Tween 20 TBS. Blots were incubated in their respectiv e antibodies overnight, followed by incubation with an HRP conjugated secondary (Fisher Scientific), and developed via ECL (Pierce). Antibodies: BRCA1 (Calbiochem), cleaved caspase 3, caspase 3 (Cell Signaling Technology, Beverly, MA), actin (clone AC 40, Sigma, St. Louis, MO), and maspin (BD Biosciences, San Jose, CA). RT PCR. RNA samples were isolated using TRIzol reagent from Invitrogen quantitaive PCR, one microgram total RNA, oligo( dT), and reverse transcriptase were used to generate single strand cDNA as previously described [13] The cDNA samples were amplified using the Applied Biosystems GeneAmp RNA PCR Core Kit (Foster City,

PAGE 107

92 CA). Primers used were: Flag BRAT sense (CGATGACAAAATGGATTTATCTGC), Flag BRAT antisense (GAGACAGGTTCCTTCATCAACTCC), MMP1 sense (GAGCAAACACATCTGAGGTACAGGA), MMP1 antisense (TTGTCCCGATGATCTCCCCTGACA) [14] actin (98 base pairs) se nse (GGGAATTCAAAACTGGAACGGTGAAGG), and actin (98 base pairs) antisense (GGAAGCTTATCAAAGTCCTCGGCCACA) Maspin sense (GGAGGCCACGTTCTGTAT) and Maspin antisense (CCTGGCACCTCTATGGA). The amplified products were separated by electrophoresis on a 10% polyacrylamid e gel, stained with SYBR Green (Lonza, Rockland, ME), and photographed with the Kodak EDS 120 Digital Analysis System. The net intensity of each band was normalized to the respective endogenous control band. For real time PCR, one hundred ng total RNA was reverse transcribed to generate single strand cDNA as previously described [13] The cDNA samples were amplified using Fast SYBR Green Master Mix (Applied Biosystems) on an Applied Biosystems Step One Plus instrumen t. RQ (relative mean mRNA expression level) was calculated by the Step One software version 2.0. Using standard curves constructed for target and endogenous control genes, an arbitrary quantitative gene expression value was determined from the Ct for each gene from each sample. Target gene values were normalized to control gene values, and fold difference was determined by dividing by the designated reference/ calibrator sample. Scrape Assay. Following transfection, cells were plated at near confluence in 60millimeter dishes. Sixteen to twenty four hours later, cells were washed one time with PBS, and a scrape was made down the center of the dish using a sterile rubber cell

PAGE 108

93 scraper. Cells were washed 2 times with PBS, and imaged immediately and every 24 hou rs for 72 hours using an Olympus 1X71 microscope with D870 camera. Statistics. Samples for MTS assays were run in triplicate, and the data were Results Endogenous BRCA1 and exogenous BRAT expression levels in normal breast epithelial and breast cancer cells. Etiologic studies have revealed a possible role for hormones and their receptors in BRCA1 associated breast cancer. For example, earlier age at first pregnancy, parity, a nd later first menarche decrease breast cancer risk in non mutation carriers, however, studies have shown opposite or absent trends in BRCA1 mutation carriers [6] In contrast, breast feeding reduces risk and oral contraceptive use increases risk similarly to non mutation carriers [6] Prophylactic oophorectomy, which eliminates a major source of estrogen production before menopause, significantly reduces breast cancer risk in mutation carriers as well [15] For this reason, multiple breast cancer cell lines, estrogen receptor positive and negative, were chosen for analysis. Each cell line represents human breast adenocarcinoma cells isolated from pleural effusion fluid, including: MCF7 cells are estrogen receptor posi tive, tumorigenic and metastatic in nude mice [16 18] SkBr3 cells are tumorigenic, estrogen receptor negative, and overexpress Her2 [19] [20] MDA MB 231 cells are tumorigenic and estrogen receptor negative [16] and used as a model for highly aggressive breast cancer. One normal breast epithelial cell line, MCF10A was also analyzed. MCF10A cells are a spontaneously immortalized sub population of normal,

PAGE 109

94 non tumorigenic breast epithelial cells derived from a patient wi th fibrocystic disease [16] that are frequently utilized for comparison with breast cancer cell lines. The breast cancer cell lines util ized exhibit varying levels of BRCA1 expression. MCF7 cells are reported to have genomic loss of one BRCA1 allele [21] and to express low levels of BRCA1 mRNA and protein [22] SkBr3 cells are also re ported to express low basal levels of BRCA1 [23] The studies reporting BRCA1 levels in these cell lines have utilized different methods of detection (i.e. RT PCR for mRNA level, Western blotting for protein level), and different reagents. To determine the relative expression of BRCA1 in the cell lines utilized, lysates were collected from each cell line and Western blotting was performed. SkBr3 cells expressed the highest levels of BRCA1, followed by MCF7 cells, MDA MB 231 cells, and MCF10A cells (Figure 3.1). Optimal transfection conditions for cell number, amount of DNA, and electroporation parameters were elucidated by transfection of GFP and followed by microscopic or flow cytometric analysis of the percentage o f transfected cells (transfection efficiency). Transfection efficiencies were approximately 40 70% (Figure 3.2.). Transfection of BRAT was then performed under the optimized conditions for each cell line and confirmed by semi quantitative PCR. Figure 3.3. illustrates a representative figure confirming the 120 nucleotide BRAT PCR product efficiently expressed in SkBr3 cells from 24 72 hours after transfection. Expression was confirmed in each remaining cel l line (data not shown). BRAT does not significantly impact proliferation or chemosensitivity of normal breast or breast cancer cells. Previous studies from our lab have shown that expression of BRAT in normal HOSE and OC cells increases the sensitivity o f these cells

PAGE 110

95 Figure 3.1. Wild type BRCA1 levels in normal human breast epithelial and breast cancer cells. Cells were plated at equal densities, colle cted, and lysed. Protein lysate was separated using SDS PAGE and Western blotting was performed using the indicated antibodies. Relative band intensity was determined by dividing the BRCA1 band intensity by the actin band intensity for each lane.

PAGE 111

96 Figure 3.2. Transfection efficiencies of normal breast epithelial and breast cancer cell lines. Indicated cell lines were transfected with GFP using the appropriate Amaxa nucleofector program. After 24 hours, cells were imaged using fluorescent microscopy, and p ercent GFP positive cells was estimated. Representative fluorescence images at 10X magnification for each cell line are pictured with the concomitant phase contrast image. For flow cytometry, cells were collected by centrifugation and resuspended in PBS. L iving cells were gated for GFP positivity.

PAGE 112

97 Figure 3.3. BRAT is efficiently expressed in SkBr3 cells. SkBr3 cells were transiently transfected with BRAT plasmid, and cells were collected 24 72 hours after transfection. RNA was isolated, DNAse treated, re verse transcribed, and semi quantitative PCR was performed for BRAT. PCR products were electrophoresed on a 10% acrylimide gel, stained with SYBR green, and imaged.

PAGE 113

98 to cytotoxic drug treatment [24] Therefore, to test whether BRAT impacts chemosensitivity of breast cancer cells and normal breast epithelial cells, the MTS assay was performed on vehicle and cisplatin treated cells. No significant change in cell viability was observed in MCF7 cells treated with vehicle or 10uM cisplatin up to 72 hours after transfection (Figure 3.4. A). Similar resul ts were observed in MDA MB 231 and MCF10A cells (data not shown). SkBr3 cells transfected with BRAT exhibited cell viability similar to control PCDNA transfected cells (Figure 3.4. B). However, cisplatin mediated cytotoxicity was 17% greater in SKBr3 BRAT cells at 24 hours. The decrease in BRAT cell viability was most pronounced at 48 hours (24%), and a moderate decrease was still evident at 72h (15%) (Figure 3.4. B). The enhanced chemosensitivity observed in BRAT HOSE cells was previously found to involve induction of apoptosis through caspase 3 activation [13, 24] Therefore, to further investigate the effect of BRAT on chemosensitivity of SkBr3 cells and determine whether caspase 3 is involved, Western blotting wa s performed to measure the level of cleaved (activated) caspase 3. No significant difference was observed in cleaved caspase 3 levels of BRAT transfected SkBr3 cells compared to control PCDNA SkBr3 cells wh en treated with vehicle or cisplatin (Figure 3.4. C). This data suggests that BRAT does not enhance apoptosis by caspase 3 activation in SkBr3 breast cancer cells. The transfection efficiency of 118 HOSE was previously found to be greater than 97% [24] Transfection of MCF10A and breast cancer cells was efficient, but not as high.(Figure 3.2.). To rule out the possibility that BRAT failed to modula te chemosensitivity because of lower transfection efficiency and, therefore, copy number in transiently transfected cells, stable cell lines were generated. SkBr3 cells were transfected

PAGE 114

99

PAGE 115

100 Figure 3.4. BRAT does not significantly impact grow th or chemosensitivity of breast cancer cells. A. MCF7 or B. SkBr3 cells were transiently transfected with PCDNA or BRAT and plated in 96 well plates. Proliferation was measured via MTS assay at indicated time points on triplicate samples of untreated or 1 0 M cisplatin treated cells. Graphs illustrate average absorption at 450 nm SE. C. SkBr3 cells were transiently transfected with PCDNA or BRAT and plated. Cells were treated with 10 uM cisplatin for the indicated time point, lysed, and protein lysate wa s electrophoresed on a 10% SDS PAGE gel. After transfer to PVDF membrane, blotting was performed with indicated antibodies. Relative band intensity was calculated by dividing cleaved caspase 3 band intensity by actin band intensity for each lane.

PAGE 116

101 with PCDNA or BRAT and maintained in G418 selection media. BRAT expres sion was confirmed by semi quantitative PCR to be similar to or higher than that of 118 stable cells (Data not shown). SkBr3 cells stably expressing BRAT exhibited 14% decrease in viability compared to PCDNA3.1 cells after 48 hours of cisplatin treatment, though viabilities were similar to PCDNA cells at other time points (data not shown). This data suggests that the BRAT mutation mediates ovary specific effects on cell growth and chemosensitivity. BRAT does not significantly impact maspin expression in nor mal breast epithelial or breast cancer cells. In addition to its impacts on chemosensitivity in HOSE cells, BRAT was previously found to increase expression of the 42 kDa serine protease inhibitor, maspin. Maspin is unable to undergo the conformational cha nge necessary for normal serpin function [25] Maspin was identified by its diminished expression in breast tumor samples compared to normal breast tissue [26] Interestingly, maspin expression is low in normal HOSE, but is uniquely up regul ated in OC and correlates with high tumor grade and shorter overall survival [27, 28] maspin has the potential to impact several imp ortant processes in breast cancer cells. Increased maspin is associated with enhanced drug sensitivity in breast cancer models [29] Maspin has been shown to increase adhesion and diminish invasion and metastasis [ 30, 31] of breast cancer cells as well. Therefore, I next sought to determine whether BRAT impacts maspin expression in normal human breast epithelial cells and breast cancer cells as it does in HOSE cells.

PAGE 117

102 To this end, I first performed Western blotting to determine basal levels of maspin in each cell line. As expected, maspin expression was robust in normal MCF10A cells and undetectable in MCF7, SkBr3, and MDA MB 231 breast cancer cells (Figure 3.5. A). Transfection of BRAT into MCF10A cells did not sign ificantly alter maspin mRNA levels as measured by semi quantitative PCR (Figure 3.5. B). Further, transfection of BRAT into SkBr3 cells did not result in detectable maspin expression (Figure 3.5. C), suggesting that BRAT does not significantly modulate mas pin expression in normal human breast epithelial cells, nor does BRAT activate maspin expression in human breast cancer cells. BRAT does not significantly alter MMP1 expression levels in normal breast epithelial or human breast cancer cells. My data indica te elevation of the gene encoding matrix metalloproteinase 1 (MMP1) in HOSE cells transfected with BRAT (Chapter 2). MMP1 is clearly important for breast cancer progression. MMP1 gene expression is elevated in breast tumor tissue from tumors that metastasi zed to bone compared to tissue from non metastatic breast cancer [32] Further, inhibition of MMP1 enhances apoptosis and inhibits metastasis of human breast cancer cells from the mammary fad pat of nude mice [33] Because BRAT regulates MMP1 expression in normal HOSE cells, and because of a possible role for MMP1 in breast cancer progressio n, I evaluated the impact of BRAT on MMP1 expression in normal breast epithelial and human breast cancer cells. MMP1 expression was undetectable in MCF10A, SkBr3, and MCF7 cells by real time PCR, and transfection of BRAT did not result in increased express ion (data not shown). Similarly, MMP1 expression was not detected by semi quantitative PCR in

PAGE 118

103 Figure 3.5. BRAT does not significantly impact maspin expressi on in breast cancer cells. A. Cells were plated at equal densities, collected, and lysed. Protein lysate was separated using SDS PAGE and Western blotting was performed for maspin. MCF10A (B.) or SkBr3 (C.) cells were transiently transfected with BRAT pla smid. Cells were collected 24 72 hours after transfection. RNA was isolated, DNAse treated, reverse transcribed,

PAGE 119

104 and semi quantitative PCR was performed for maspin and actin. PCR products were electrophoresed on a 10% acrylimide gel, stained with SYBR gree n, and imaged.

PAGE 120

105 MCF10A or SkBr3 cells (Figure 3.6.). While a 185 nt PCR product representing MMP1 mRNA was detectable in MDA MB 231 cells, levels were not significantly altered b y expression of BRAT (Figure 3.6.), suggesting MMP1 up regulation is a tissue specific function of the BRAT mutation. BRAT does not significantly impact migration of breast cancer cells. Though BRAT did not appear to significantly impact apoptosis or regulation of targets previously identified in HOSE, it has not yet been determined whether BRAT impacts migration in any cell system. MMP1 is a major contributor to extracellular matrix remodeling, cell migration, invasion, and metastasis, therefore, in addition to MMP1 regulation, I chose to investigate whether BRAT modulates cell migration of breast cancer cells. To this end, a scrape assay was performed. For MDA MB 231 and MCF7 cells, images of scraped edge appeared similar for PCDNA and BRAT transfected cells (data not shown). SkBr3 control PCDNA cells exhibited slightly mo re frequent patches of cells growing within the scraped area compared to BRAT cells (Figure 3.7.), however, changes were minimal. These data suggest BRAT does not significantly alter breast cancer cell migration. Discussion BRCA1 m utation associated breast cancers are significantly more aggressive than their sporadic counterparts. Mutation associated tumors are frequently ductal carcinomas [5] highly proliferative [34] of a higher grade [35, 36] exhibit enhanced genomic instability [34] and result in poorer survival than sporadic breast cancer [37] Like BRCA1 mutation associated OC, BRCA1 associated breast cancer cells are more sensitive to cisplatin treatment [37] BRCA1 associated tumors are also more frequently estrogen receptor alpha, progesterone receptor, and Her2 negative [5] characteristics that

PAGE 121

106 Figure 3.6. MMP1 expression is not alter ed by BRAT in normal breast epithelial or breast cancer cells. Indicated cells were transiently transfected with BRAT plasmid. Cells were collected 24 hours after transfection. RNA was isolated, DNAse treated, reverse transcribed, and semi quantitative PCR was performed for MMP1 and actin. PCR products were electrophoresed on a 10% acrylimide gel, stained with SYBR green, and imaged.

PAGE 122

107 Figure 3.7. Migration of SkBr3 cells is not significantly impacted by BRAT. SkBr3 cells were plated at near confluence, a llowed to attach overnight, and a single continuous scrape was made down the center of the dish. Detached cells were removed and remaining adherent cells were washed with PBS and imaged at 4X immediately and every 24 hours for 72 hours.

PAGE 123

108 are frequently associated with more aggressive disease and preclude treatment with anti est rogens. In contrast to BRCA1 associated OCs, BRCA1 associated breast cancers exhibit a unique gene expression profile, including up regulation of DNA repair genes, such as Rad51 and human mutS homolog 2 (MSH2) [38] and genes associated with a basal like tumor histology, such as cytokeratin 5 and 17 (Reviewed in [39] ). Because of the aggressive clinical nature of BRCA1 mutation assoc iated breast cancers, decisions about screening and prophylaxis for mutation carriers are critical. Therefore, it is important to understand clinical characteristics specific to each mutation. For example, classification of mutations as having low penetran ce for breast cancer would afford carriers the choice to avoid radical prophylactic procedures, such as mastectomy. Instead of grouping all BRCA1 mutations, clinical data such as tumor histology, breast/ ovarian specificity, and aggressiveness should be an alyzed for each mutation. Further, the molecular changes that mediate tumor initiation and progression are likely dependent on BRCA1 mutant function, and are, therefore, specific to each mutation. In addition to epidemiologic data for each BRCA1 mutation, study of mutant functions in cell and animal model systems will reveal mechanisms by which each mutation promotes cancer in the breast or ovary and aid in identification of targets for more effective treatment of mutation associated breast and OC. To this end, specific BRCA1 mutants have been shown previously to impact important cellular processes in breast epithelial and breast cancer models through gain of function or dominant negative activities. For example, mouse mammary gland specific expression of w t BRCA1 delays mutagen induced tumors, however, expression of a BRCA1 splice variant lacking the

PAGE 124

109 first 72 amino acids accelerates tumorigenesis and death of transgenic mice [40] A synthetic BRCA1 truncation mutant encoding the first 300 BRCA1 amino acids inhibits mammary gland differentiation and development in wt mice [41] HCC1937 breast cancer cells are homozygous for the 5382InsC mutation, carry a p53 mutation with concom itant loss of the wt allele, and exhibit deletion of PTEN and other genetic aberrations implicated in breast cancer [42] When transfected with wt BRCA1, these cells exhibit chemo resistance, however, resistance is reversed upon co transfection of C terminal BRCA1 mutants [43] Co expression of 5382InsC and 5677InsA with wt BRCA1 in breast cancer cells exerts a dominant negative effect by inhibiting the wt enhance apoptosis [44] Of the three breast cancer cell lines tested, only the SkBr3 breast cancer cell line exhibited an increase in cisplatin sensitivity. Interestingly, this cell line over expresses Her2, a memb er of the EGF receptor family that has no specific ligand, but preferentially dimerizes with and activates other family members. This dimerization amplifies activation of MAPK and PI3K pathways and promotes survival, proliferation, migration, invasion, met astasis, and angiogenesis [45] Her 2 is over expressed in 25 30% of all breast and OCs [46] and correlates with poor progno sis [47] As mentioned previously, Her2 is frequently absent in BRCA1 mutation associated breast cancers, however, data is unavailable for each mutation. It would be interesting to examine whether Her2 over expression is associated with some BRCA1 mutations and not others in tumor samples as well as whether Her2 promotes or cooperates with mutant BRCA1 functions in mutation associated breast and ovarian mod el systems.

PAGE 125

11 0 In contrast, some BRCA1 mutants do not mediate significant activity in breast cancer models independent of the loss of wt BRCA1 function. HCC1937 cells are more sensitive to ionizing radiation compared to breast cancer cells without a known BRC A1 mutation, but restoration of wt BRCA1 partially reverses this sensitivity. Interestingly, expression of other BRCA1 mutants, M1775R, T C64G, and P1749R, does not reverse sensitivity [48] While wt BRCA1 reduces hyper recombination and enhances homologous DNA repair in MCF7 cells, which have a single wt BRCA1 copy, the 5382InsC mutation does not mediate these functions [49] A breast epithelial cell line has been established that harbors one wt BRCA1 copy and one copy of the 185delAG mutation [50] Analysis of this line revealed no detectable difference in growth, anchorage independence, response to ionizing radiation and hydrogen peroxide treatment, or tumorigenicity compared to breast epithelial cells with two wt copies of BRCA1 [50] Though most studies investigate mutant function in only one model system, Holt and colleagues compared the effect of two BRCA1 truncation mutants of 340 and 1835 amino acids on growth of breast and OC cells. In agreement with my findings, cell type specific effects were observed. The mutants did not significantly impact growth of breast cancer cells, however, growth inhibition was observed in three OC cell lines [21] You et al. found cell type specific BRCA1 mutant functions, as well. While a synthetic BRCA1 mutant lacking the N terminal 302 amino acids enhanced apoptosis and inhibited growth of MCF10A cells, growth of HeLa cells was unaffected [51] Reproductive organs and breast tissues are sometimes grouped together under a

PAGE 126

111 these tissues are overlooked. Tissue s pecific effects in the context of cancer are a concept that has been demonstrated before. For example, tamoxifen is categorized as a selective estrogen receptor modulator because it exerts growth inhibitory effects on breast cancer cells and stimulatory ef fects on the uterine lining [52 ] These disparate impacts are likely related to the complement of transcription factors and co regulators expressed in each tissue type. Likewise, similar differences likely dictate the function of BRCA1 mutant proteins by providing different expression and stoichiometry of interacting proteins as well as redundancy for pathways inhibited by mutant function. Changes in gene regulation are observed in BRCA1 mutation carriers, and likely contribute to tissue specific mutant function as well. Indeed, compar ative genomic hybridization revealed that amplifications or deletions of specific chromosome regions was significantly more frequent in breast tumors from mutation carriers versus control tumors [53] Conversely, Ja zaeri et al. found similar patterns of gene expression in BRCA1/2 mutant ovarian tumors compared to sporadic tumors [54] Whether these changes in expression are correlative or occur as a result of BRCA1 mutation, t here is great potential for differential mutant BRCA1 protein function as a result of differential tissue specific gene expression. Lastly, splice variants of the BRCA1 gene have been confirmed [55] It has been suggested that tissue of wt protein expression [7] Tissue specific alteration of the balance of mutant and wt protein or repression of the mutant protein in this manner could result in significant impacts on cell physiology. Indeed, BRC a significantly lower proportion of OC compared to breast cancer incidence [7]

PAGE 127

112 However, it has been difficult to determine differences in risk associated with spec ific mutations because of limited sample numbers. It is clear from this study, then, that the BRAT mutation confers tissue specific effects on apoptosis and gene regulation. Tissue specific mutant functions may contribute significantly to differential bre ast and OC risk and penetrance. It remains to be determined whether other BRCA1 mutations confer similar functions and, therefore, similarly impact cancer risk in the breast and ovary. Elucidating the mechanism by which mutations confer enhanced cancer ris k in the breast and ovary will allow for a better understanding of mutation associated cancer etiology and therefore better treatment for mutation carriers. Further, this information will improve prognostic accuracy and allow physicians and patients to mak e better decisions regarding treatment and prophylaxis. We have previously reported BRAT mediated changes in normal HOSE and OC cells that modulate cytotoxicity and regulation of genes potentially important in BRAT mpact on these cellular processes in normal apoptosis and regulation of MMP1 and maspin are specific to the ovary, and the BRAT mutation likely increases risk of cancer in the breast by an alternative and yet undiscovered mechanism.

PAGE 128

113 References 1. Thompson D & Easton DF (2002) Cancer Incidence in BRCA1 mutation carriers. J Natl Cancer Inst 94 1358 1365. 2. Billack B & Monteiro AN (2005) BRCA1 in breast and ovarian cancer predisposition. Cancer Lett 227 1 7, doi: S0304 3835(04)00864 X [pii]10.1016/j.canlet.2004.11.006. 3. Monteiro AN (2003) BRCA1: the enigma of tissue specific tumor development. Trends Genet 19 312 315, doi: S0168952503001100 [pii]. 4. Fowl er AM & Alarid ET (2007) Amping up estrogen receptors in breast cancer. Breast Cancer Res 9 305, doi: bcr1748 [pii]10.1186/bcr1748. 5. Johannsson OT, Idvall I, Anderson C, Borg A, Barkardottir RB, Egilsson V & Olsson H (1997) Tumour biological features of BRCA1 induced breast and ovarian cancer. Eur J Cancer 33 362 371, doi: S0959804997890077 [pii]. 6. Rosen EM, Fan S & Isaacs C (2005) BRCA1 in hormonal carcinogenesis: basic and clinical research. Endocr Relat Cancer 12 533 548, doi: 12/3/533 [pii]10.167 7/erc.1.00972. 7. Gayther SA, Warren W, Mazoyer S, Russell PA, Harrington PA, Chiano M, Seal S, Hamoudi R, van Rensburg EJ, Dunning AM, et al. (1995) Germline mutations of the BRCA1 gene in breast and ovarian cancer families provide evidence for a genotype phenotype correlation. Nat Genet 11 428 433, doi: 10.1038/ng1295 428. 8. Neuhausen SL, Mazoyer S, Friedman L, Stratton M, Offit K, Caligo A, Tomlinson G, Cannon Albright L, Bishop T, Kelsell D, et al. (1996) Haplotype and phenotype analysis of six recurr ent BRCA1 mutations in 61 families: results of an international study. Am J Hum Genet 58 271 280. 9. Moslehi R, Chu W, Karlan B, Fishman D, Risch H, Fields A, Smotkin D, Ben David Y, Rosenblatt J, Russo D, et al. (2000) BRCA1 and BRCA2 mutation analysis o f 208 Ashkenazi Jewish women with ovarian cancer. Am J Hum Genet 66 1259 1272, doi: S0002 9297(07)60155 4 [pii]10.1086/302853. 10. Fackenthal JD & Olopade OI (2007) Breast cancer risk associated with BRCA1 and BRCA2 in diverse populations. Nat Rev Cancer 7 937 948, doi: nrc2054 [pii]10.1038/nrc2054. 11. Hohenstein P & Fodde R (2003) Of mice and (wo)men: genotype phenotype correlations in BRCA1. Hum Mol Genet 12 Spec No 2 R271 277, doi: 10.1093/hmg/ddg258ddg258 [pii]. 12. Thompson D & Easton D (2002) Vari ation in BRCA1 cancer risks by mutation position. Cancer Epidemiol Biomarkers Prev 11 329 336.

PAGE 129

114 13. O'Donnell JD, Johnson NC, Turbeville TD, Alfonso MY & Kruk PA (2008) BRCA1 185delAG truncation protein, BRAt, amplifies caspase mediated apoptosis in ovaria n cells. In Vitro Cell Dev Biol Anim 44 357 367, doi: 10.1007/s11626 008 9122 0. 14. Deroanne CF, Hamelryckx D, Ho TT, Lambert CA, Catroux P, Lapiere CM & Nusgens BV (2005) Cdc42 downregulates MMP 1 expression by inhibiting the ERK1/2 pathway. J Cell Sci 118 1173 1183, doi: jcs.01707 [pii]10.1242/jcs.01707. 15. Rosen EM, Fan S, Pestell RG & Goldberg ID (2003) BRCA1 in hormone responsive cancers. Trends Endocrinol Metab 14 378 385, doi: S1043276003001607 [pii]. 16. Soule HD & McGrath CM (1980) Estrogen re sponsive proliferation of clonal human breast carcinoma cells in athymic mice. Cancer Lett 10 177 189. 17. Osborne CK, Hobbs K & Clark GM (1985) Effect of estrogens and antiestrogens on growth of human breast cancer cells in athymic nude mice. Cancer Res 45 584 590. 18. Shafie SM & Liotta LA (1980) Formation of metastasis by human breast carcinoma cells (MCF 7) in nude mice. Cancer Lett 11 81 87. 19. Fogh J, Fogh JM & Orfeo T (1977) One hundred and twenty seven cultured human tumor cell lines producing t umors in nude mice. J Natl Cancer Inst 59 221 226. 20. Hudziak RM (1997) Monoclonal antibodies directed to the Her2 receptor US Patent 5,677,171 21. Holt JT, Thompson ME, Szabo C, Robinson Benion C, Arteaga CL, King MC & Jensen RA (1996) Growth retardati on and tumour inhibition by BRCA1. Nat Genet 12 298 302, doi: 10.1038/ng0396 298. 22. Thompson ME, Jensen RA, Obermiller PS, Page DL & Holt JT (1995) Decreased expression of BRCA1 accelerates growth and is often present during sporadic breast cancer progr ession. Nat Genet 9 444 450, doi: 10.1038/ng0495 444. 23. Blagosklonny MV, An WG, Melillo G, Nguyen P, Trepel JB & Neckers LM (1999) Regulation of BRCA1 by protein degradation. Oncogene 18 6460 6468, doi: 10.1038/sj.onc.1203068. 24. O'Donnell JD, Linger RJ & Kruk PA (2009) BRCA1 185delAG mutant protein, BRAt, up regulates maspin in ovarian epithelial cells. Gynecol Oncol doi: S0090 8258(09)00840 3 [pii]10.1016/j.ygyno.2009.10.052. 25. Law RH, Irving JA, Buckle AM, Ruzyla K, Buzza M, Bashtannyk Puhalovich TA, Beddoe TC, Nguyen K, Worrall DM, Bottomley SP, et al. (2005) The high resolution crystal structure of the human tumor suppressor maspin reveals a novel conformational switch in the G helix. J Biol Chem 280 22356 22364, doi: M412043200 [pii]10.1074/jb c.M412043200.

PAGE 130

115 26. Zhang M (2004) Multiple functions of maspin in tumor progression and mouse development. Front Biosci 9 2218 2226, doi: 1392 [pii]. 27. Rose SL, Fitzgerald MP, White NO, Hitchler MJ, Futscher BW, De Geest K & Domann FE (2006) Epigenetic r egulation of maspin expression in human ovarian carcinoma cells. Gynecol Oncol 102 319 324, doi: S0090 8258(05)01131 5 [pii]10.1016/j.ygyno.2005.12.025. 28. Sood AK, Fletcher MS, Gruman LM, Coffin JE, Jabbari S, Khalkhali Ellis Z, Arbour N, Seftor EA & He ndrix MJ (2002) The paradoxical expression of maspin in ovarian carcinoma. Clin Cancer Res 8 2924 2932. 29. Jiang N, Meng Y, Zhang S, Mensah Osman E & Sheng S (2002) Maspin sensitizes breast carcinoma cells to induced apoptosis. Oncogene 21 4089 4098, do i: 10.1038/sj.onc.1205507. 30. Seftor RE, Seftor EA, Sheng S, Pemberton PA, Sager R & Hendrix MJ (1998) maspin suppresses the invasive phenotype of human breast carcinoma. Cancer Res 58 5681 5685. 31. Shi HY, Zhang W, Liang R, Kittrell F, Templeton NS, Me dina D & Zhang M (2003) Modeling human breast cancer metastasis in mice: maspin as a paradigm. Histol Histopathol 18 201 206. 32. Bohn OL, Nasir I, Brufsky A, Tseng GC, Bhargava R, MacManus K & Chivukula M (2009) Biomarker profile in breast carcinomas pre senting with bone metastasis. Int J Clin Exp Pathol 3 139 146. 33. Yang E, Boire A, Agarwal A, Nguyen N, O'Callaghan K, Tu P, Kuliopulos A & Covic L (2009) Blockade of PAR1 signaling with cell penetrating pepducins inhibits Akt survival pathways in breast cancer cells and suppresses tumor survival and metastasis. Cancer Res 69 6223 6231, doi: 0008 5472.CAN 09 0187 [pii]10.1158/0008 5472.CAN 09 0187. 34. Drost RM & Jonkers J (2009) Preclinical mouse models for BRCA1 associated breast cancer. Br J Cancer 10 1 1651 1657, doi: 6605350 [pii]10.1038/sj.bjc.6605350. 35. Lakhani SR, Jacquemier J, Sloane JP, Gusterson BA, Anderson TJ, van de Vijver MJ, Farid LM, Venter D, Antoniou A, Storfer Isser A, et al. (1998) Multifactorial analysis of differences between spor adic breast cancers and cancers involving BRCA1 and BRCA2 mutations. J Natl Cancer Inst 90 1138 1145. 36. (1997) Pathology of familial breast cancer: differences between breast cancers in carriers of BRCA1 or BRCA2 mutations and sporadic cases. Breast Can cer Linkage Consortium. Lancet 349 1505 1510, doi: S0140673696101094 [pii]. 37. Lux M, Fasching P & Beckmann M (2006) Hereditary breast and ovarian cancer: review and future perspectives. Journal of Molecular Medicine 84 16 28.

PAGE 131

116 38. Martin RW, Orelli BJ, Yamazoe M, Minn AJ, Takeda S & Bishop DK (2007) RAD51 up regulation bypasses BRCA1 function and is a common feature of BRCA1 deficient breast tumors. Cancer Res 67 9658 9665, doi: 67/20/9658 [pii]10.1158/0008 5472.CAN 07 0290. 39. Honrado E, Osorio A, Pal acios J & Benitez J (2006) Pathology and gene expression of hereditary breast tumors associated with BRCA1, BRCA2 and CHEK2 gene mutations. Oncogene 25 5837 5845, doi: 1209875 [pii]10.1038/sj.onc.1209875. 40. Hoshino A, Yee CJ, Campbell M, Woltjer RL, Tow nsend RL, van der Meer R, Shyr Y, Holt JT, Moses HL & Jensen RA (2007) Effects of BRCA1 transgene expression on murine mammary gland development and mutagen induced mammary neoplasia. Int J Biol Sci 3 281 291. 41. Brown MA, Nicolai H, Howe K, Katagiri T, Lalani el N, Simpson KJ, Manning NW, Deans A, Chen P, Khanna KK, et al. (2002) Expression of a truncated Brca1 protein delays lactational mammary development in transgenic mice. Transgenic Res 11 467 478. 42. Tomlinson GE, Chen TT, Stastny VA, Virmani AK, Spillman MA, Tonk V, Blum JL, Schneider NR, Wistuba, II, Shay JW, et al. (1998) Characterization of a breast cancer cell line derived from a germ line BRCA1 mutation carrier. Cancer Res 58 3237 3242. 43. Fan S, Yuan R, Ma YX, Meng Q, Goldberg ID & Rosen EM (2001) Mutant BRCA1 genes antagonize phenotype of wild type BRCA1. Oncogene 20 8215 8235, doi: 10.1038/sj.onc.1205033. 44. Thangaraju M, Kaufmann SH & Couch FJ (2000) BRCA1 facilitates stress induced apoptosis in breast and ovarian cancer cell lines. J Biol Chem 275 33487 33496, doi: 10.1074/jbc.M005824200M005824200 [pii]. 45. Menard S, Pupa SM, Campiglio M & Tagliabue E (2003) Biologic and therapeutic role of HER2 in cancer. Oncogene 22 6570 6578, doi: 10.1038/sj.onc.12067791206779 [pii]. 46. Slamon DJ, Godolphin W, Jones LA, Holt JA, Wong SG, Keith DE, Levin WJ, Stuart SG, Udove J, Ullrich A, et al. (1989) Studies of the HER 2/neu proto oncogene in human breast and ovarian cancer. Science 244 707 712. 47. Auersperg N, Wong AS, Choi KC, Kang SK & Leu ng PC (2001) Ovarian surface epithelium: biology, endocrinology, and pathology. Endocr Rev 22 255 288. 48. Scully R, Ganesan S, Vlasakova K, Chen J, Socolovsky M & Livingston DM (1999) Genetic analysis of BRCA1 function in a defined tumor cell line. Mol C ell 4 1093 1099, doi: S1097 2765(00)80238 5 [pii].

PAGE 132

117 49. Cousineau I & Belmaaza A (2007) BRCA1 haploinsufficiency, but not heterozygosity for a BRCA1 truncating mutation, deregulates homologous recombination. Cell Cycle 6 962 971, doi: 4105 [pii]. 50. Anna b LA, Terry L, Cable PL, Brady J, Stampfer MR, Barrett JC & Afshari CA (2000) Establishment and characterization of a breast cell strain containing a BRCA1 185delAG mutation. Gynecol Oncol 77 121 128, doi: 10.1006/gyno.2000.5734S0090 8258(00)95734 2 [pii] 51. You F, Chiba N, Ishioka C & Parvin JD (2004) Expression of an amino terminal BRCA1 deletion mutant causes a dominant growth inhibition in MCF10A cells. Oncogene 23 5792 5798, doi: 10.1038/sj.onc.12077391207739 [pii]. 52. Singh MN, Stringfellow HF, P araskevaidis E, Martin Hirsch PL & Martin FL (2007) Tamoxifen: important considerations of a multi functional compound with organ specific properties. Cancer Treat Rev 33 91 100, doi: S0305 7372(06)00185 X [pii]10.1016/j.ctrv.2006.09.008. 53. Tirkkonen M, Johannsson O, Agnarsson BA, Olsson H, Ingvarsson S, Karhu R, Tanner M, Isola J, Barkardottir RB, Borg A, et al. (1997) Distinct somatic genetic changes associated with tumor progression in carriers of BRCA1 and BRCA2 germ line mutations. Cancer Res 57 12 22 1227. 54. Jazaeri AA, Yee CJ, Sotiriou C, Brantley KR, Boyd J & Liu ET (2002) Gene expression profiles of BRCA1 linked, BRCA2 linked, and sporadic ovarian cancers. J Natl Cancer Inst 94 990 1000. 55. Orban TI & Olah E (2003) Emerging roles of BRCA1 alt ernative splicing. Mol Pathol 56 191 197.

PAGE 133

118 Chapter 4: Conclusions Origins of BRCA1 associated Ovarian Cancer A better understanding is needed of the mechanism by which normal HOSE of BRCA1 mutation carriers becomes malignant. Models of several cance r types, such as changes that promote tumorigenesis. Because OC is frequently diagnosed at late stage, identification and characterization of a pre malignant state has prove n difficult, however, studies suggest histologic and cytologic changes in non tumor ovarian tissue of patients with a family history of OC or a confirmed BRCA1 mutation. For example, more frequent deep invaginations in the ovary surface, dysplasia, hyperpl asia, and/ or surface papillae have been observed in prophylactically removed ovaries versus normal ovaries [1 3] These abnormal regions are hypothesized to be the origin of epithelial OC. The role of BRCA1 mutatio ns in the development of histologically abnormal regions is not yet understood, though the high frequency of these regions in mutation carriers suggests a role for BRCA1 mutants. Indeed, carcinoma was found to originate in inclusion cysts of several prophy lactically removed ovaries of mutation carriers, and the same p53 mutation was found in tumor tissue and tumor adjacent dysplastic and normal surface epithelium [4] This evidence supports the hypothesis of morphologically abnormal regions of HOSE as BRCA1 associated OC precursors, and for p53 mutation

PAGE 134

119 and BRCA1 LOH as early events in BRA1 mutation associated OC development [4 ] fallopian tube epithelium from BRCA1 mutation carriers, though this phenomenon was detected in a similar proportion of BRCA1 mutation carriers and control patients [5 7] HOSE cells stably expressing BRAT have previously been characterized as non tumorigenic by lack of growth in soft agar and lack of telomerase activity [8] Though BRAT ce lls do not exhibit malignant characteristics, it is possible that changes conducive to development of a malignant phenotype have begun. I propose that BRAT cells, like the ovarian surface epithelium of BRCA1 mutation carriers, may represent forward movemen t on the continuum of cellular malignancy. Additional changes or mutations may be necessary for cells to become malignant. Indeed, the model I propose does not exclude the contribution of other oncogenes, tumor suppressors, or invasion/ metastasis promotin g proteins. Loss of DNA damage repair through BRCA1 mutation and LOH as well as gain of function mutant activities such as gene regulation both likely contribute to further accumulation of genetic changes that promote OC progression and are characteristic of late stage BRCA1 mutation associated OC. Future Studies The role of BRAT and other BRCA1 mutants in early pre malignant changes conducive to OC development requires further investigation. First, it is crucial to identify other BRCA1 mutants that mediate gain of function or dominant negative activity and the specific pathways and contexts in which they function. Other BRCA1 mutations found to elude nonsense mediated RNA decay, such as 5382insC, 5677insA, 188del11, and Arg1835ter [9] are promisi ng avenues for further study. Interestingly, the 188del11

PAGE 135

120 mutation results in a STOP codon at codon 39 and a predicted protein product of similar size to BRAT, and may, therefore, mediate similar functions and specificity for ovarian cells. The stability o f BRCA1 mutant mRNAs should also be tested in breast and ovarian cell lines, because previous studies were performed in lymphoblastoid cells [9] Similarly, it is critical to continue seeking BRCA1 mutant proteins in cell lines and clinical speci mens, as some mutant proteins may exhibit instability [10] As demonstrated by our studies, tissue specificity is an important factor in BRAT function. It is likely that other mutants besides BRAT mediate tissue specific effects. HOSE 118 cells would be an ideal model in which to determine the impact of other BRCA1 mutations that exhibited gain of function activity in other model systems. For example, 5083del19, which increased periostin expression in HeLa cells and breast cancer tissue [11] may reg ulate other genes in the ovary. Cellular processes previously demonstrated to be altered by BRCA1 mutants provide direction for identifying additional downstream targets. For example, several of the genes found by microarray to be differentially regulated in BRAT expressing HOSE cells encode proteins that localize to the extracellular space and are potentially important in OC motility, invasion, and metastasis (collagen I, and collagen III, IL 6, IL 1alpha, IL 1beta, and MMP1). IL 1 found at higher levels in conditioned media of BRAT cells compared to PCDNA cells (Figure 4.1). As mentioned previously, IL 1 enhances MMP1 mRNA expression and stability [12] and promotes HOSE cell proliferation indirectly by up regulating the [13] Further, as demonstrated by our s tudies, BRCA1 mutation carrier derived normal cell lines can reveal mutant functions that promote early

PAGE 136

121 Figure 4.1. Pro HOSE 118 cells were transiently transfected with indicated transfectan t. Cells were serum starved in media with 0.1% FBS for 24 hours. Conditioned media was collected, concentrated 47 fold, and run on a 10% SDS PAGE gel. Membrane was blotted with

PAGE 137

122 p re malignant changes and transformation (Chapter 2), while expression of BRCA1 mutations in cancer cell models can reveal mutant functions that impact cancer progression through apoptosis [14] growth, invasion, or metastasis. as up regulation of both maspin and MMP1 involves c importance in enhanced chemosensitivity of BRAT cells, preliminary data also indicate a role for Akt in MMP1 up involvement in BRAT mediated MMP1 up regulation, and determine whether the MAPK signaling cascade is also affected by BRAT. It remains to be determined whether these and ot her as yet undiscovered functions of BRAT will share common mechanisms or signaling pathways. Cell models allow mechanistic studies of BRCA1 mutant function at the molecular level, however, discerning the physiologic impact of BRCA1 mutant functions in vi vo is vital to establishing clinical relevance. Staining of BRAT mutation associated OC tissue and adjacent normal HOSE from patients is currently ongoing to determine whether MMP1 expression is elevated in these tissues compared to tissue from patients wi thout a family history of OC. Though sample size will be limited, this data will confirm the clinical relevance of BRAT mediated MMP up regulation. To execute additional in vivo studies, a transgenic mouse model heterozygous for BRAT or other risk associa ted BRCA1 mutations could be created to confirm the presence of pre malignant changes similar to those found in human mutation carriers. BRCA1 heterozygous knockout mice do not spontaneously develop mammary or ovarian tumors [15] possibly because the mouse lifespan is not long enough to accumulate the

PAGE 138

123 additional genetic changes necessary to achieve tu morigenesis [15] BRCA1 knockout mouse models also fail to recapitulate BRCA1 mutant protein funct ions that likely contribute to tumorigenesis. In contrast, a transgenic BRCA1 mutant mouse model would address this shortcoming. Indeed, BRCA1 variants besides wt contribute significantly to mammary tumor development, as BRCA1 knockout mice that retain the develop tumors that are morphologically and genotypically distinct from knockout models designed to eliminate the entire BRCA1 gene [15] BRCA1 mutation associated breast and OCs exhibit frequent chromosomal aberrations and it is clear that accumulation of additional mutations is necessary for tumorigenesis. For example, mouse mammary gland s pecific BRCA1 knockout mice that harbor a p53 mutation develop tumors with shorter latency [16] It would be informative to investigate latency and tumor characteristics of BRCA1 mutant transgenic mice with concomit ant overexpression of oncogenes previously shown to be important in OC, such as Ras, epidermal growth factor receptor (EGFR), or Her2, or in the context of a p53 mutant background. Transgene expression specific to the reproductive epithelium has been achie ved using the Mullerian inhibitory substance type II receptor [17] Further, hormonal factors in BRCA1 mutation associated OC development could be addressed by observing the effect of hormone treatment or reproducti on on cancer incidence of heterozygous BRCA1 mutant mice. Recapitulation of breast cancers and OCs similar to those of mutation carriers could reveal targets and pathways of potential importance for treatment of BRCA1 mutation carriers. The utility of a tr ansgenic BRCA1 mutant mouse models has some limitations, however. Specifically for BRAT, interpretation would be complicated by the lack of a

PAGE 139

124 mouse homolog to the human MMP1 gene. An animal model with a longer lifespan and greater potential for stochastic mutation accumulation than the mouse would be beneficial as well. The rabbit ovary may be useful for this endeavor, as the normal histology of the rabbit ovarian surface has been described [18] Further, in contrast to humans, a bursal membrane surrounds the murine ovary, whi ch potentially alters the stromal/tumor microenvironment and acquisition of invasive and metastatic capabilities by tumor cells. In addition to animal models, mining previously collected epidemiologic data could further support a role for BRAT or other BRC A1 mutants in development of OC. For example, if mutation designation were available, other genetic alterations observed in prophylactically removed ovaries or BRCA1 mutation associated OCs could hint at downstream targets of specific BRCA1 mutants or addi tional mutations that promote tumorigenesis in carriers of that mutation. Significance The scope of importance of BRAT and its impacts are broad in the field of OC pathology and treatment. Functions or targets of the BRAT protein may be common to other sim ilar BRCA1 mutants. The similarity of breast cancer to OC ratios for BRCA1 truncation mutants of similar sizes suggests BRCA1 mutants may share common mechanisms of action. If there are common themes, this discovery could advance understanding of and treat ment of many high risk patients. Information gleaned about BRCA1 mutation associated OCs may also be applied to sporadic cancers. Differences between sporadic and BRCA1 mutation associated OC are less well defined than for breast cancer. Unlike BRCA1 mutat ion associated breast

PAGE 140

125 cancers, which are frequently more proliferative and higher grade [19 21] reports disagree as to whether stage and grade differ significantly between BRCA1 associated and sporadic OC [22, 23] In contrast to BRCA1 associated breast cancers, BRCA1 OCs lack a unique molecular profile compared to sporadic OCs [24, 25] BRCA1 mutation associated and sporadic OCs may s hare common downstream targets, such as Akt, c Jun, or MMP1. Common signaling mediators shared between BRCA1 mutation associated and sporadic OC increase the utility of drugs targeting these pathways by increasing the population of patients that will likel y respond. Most studies reveal that BRCA1 associated OCs are more frequently categorized as serous carcinomas and rarely as mucinous [23, 26] The histologic subtypes of OC not only have different clinical impacts (ie treatment response and survival rates), but are thought to arise from distinct precursor regions, undergo distinct stepwise histologic changes, and occur though deregulation of distinct molecular pathways (Reviewed in [27] ). Subty pe specific pre malignant changes may be similar in BRCA1 and sporadic OCs. Indeed, surface invaginations and inclusion cysts, which are hypothesized to be the origin of some types of OC, occur more frequently in BRCA1 mutation carriers, but are present in the ovaries of the general population and increase with age [13] contributi on to OC and breast cancer risk may have limited application to prognosis nd treatment of the general population. Regardless, increasing knowledge about BRAT will greatly benefit confirmed mutation carriers and patients through better risk assessment, deci sions about prophylaxis and treatment, and treatment efficacy.

PAGE 141

126 I have identified MMP1 as a novel target of the BRAT BRCA1 mutation in HOSE. I have determined that BRAT increases MMP1 gene expression and enhances cellular and secreted pro MMP1 in a c Jun d ependent manner involving several AP1 sites and gene regulation are specific for the ovary. Taken together, these early molecular changes could poise cells for transformat ion or acquisition of invasive or metastatic ability. Further exploration of these changes can increase our understanding of early steps of OC development and help identify potential screening and treatment strategies.

PAGE 142

127 References 1. S alazar H, Godwin AK, Daly MB, Laub PB, Hogan WM, Rosenblum N, Boente MP, Lynch HT & Hamilton TC (1996) Microscopic benign and invasive malignant neoplasms and a cancer prone phenotype in prophylactic oophorectomies. J Natl Cancer Inst 88 1810 1820. 2. Wer ness BA, Afify AM, Bielat KL, Eltabbakh GH, Piver MS & Paterson JM (1999) Altered surface and cyst epithelium of ovaries removed prophylactically from women with a family history of ovarian cancer. Hum Pathol 30 151 157. 3. Casey MJ, Bewtra C, Hoehne LL, Tatpati AD, Lynch HT & Watson P (2000) Histology of prophylactically removed ovaries from BRCA1 and BRCA2 mutation carriers compared with noncarriers in hereditary breast ovarian cancer syndrome kindreds. Gynecol Oncol 78 278 287, doi: 10.1006/gyno.2000.5 861S0090 8258(00)95861 X [pii]. 4. Pothuri B, Leitao MM, Levine DA, Viale A, Olshen AB, Arroyo C, Bogomolniy F, Olvera N, Lin O, Soslow RA, et al. (2010) Genetic analysis of the early natural history of epithelial ovarian carcinoma. PLoS One 5 e10358, doi : 10.1371/journal.pone.0010358. 5. Shaw PA, Rouzbahman M, Pizer ES, Pintilie M & Begley H (2009) Candidate serous cancer precursors in fallopian tube epithelium of BRCA1/2 mutation carriers. Mod Pathol 22 1133 1138, doi: modpathol200989 [pii]10.1038/modpa thol.2009.89. 6. Lee Y, Miron A, Drapkin R, Nucci MR, Medeiros F, Saleemuddin A, Garber J, Birch C, Mou H, Gordon RW, et al. (2007) A candidate precursor to serous carcinoma that originates in the distal fallopian tube. J Pathol 211 26 35, doi: 10.1002/pa th.2091. 7. Folkins AK, Jarboe EA, Saleemuddin A, Lee Y, Callahan MJ, Drapkin R, Garber JE, Muto MG, Tworoger S & Crum CP (2008) A candidate precursor to pelvic serous cancer (p53 signature) and its prevalence in ovaries and fallopian tubes from women with BRCA mutations. Gynecol Oncol 109 168 173, doi: S0090 8258(08)00007 3 [pii]10.1016/j.ygyno.2008.01.012. 8. O'Donnell JD, Johnson NC, Turbeville TD, Alfonso MY & Kruk PA (2008) BRCA1 185delAG truncation protein, BRAt, amplifies caspase mediated apoptosis in ovarian cells. In Vitro Cell Dev Biol Anim 44 357 367, doi: 10.1007/s11626 008 9122 0. 9. Perrin Vidoz L, Sinilnikova OM, Stoppa Lyonnet D, Lenoir GM & Mazoyer S (2002) The nonsense mediated mRNA decay pathway triggers degradation of most BRCA1 mRNAs b earing premature termination codons. Hum Mol Genet 11 2805 2814. 10. Anczukow O, Ware MD, Buisson M, Zetoune AB, Stoppa Lyonnet D, Sinilnikova OM & Mazoyer S (2008) Does the nonsense mediated mRNA decay

PAGE 143

128 mechanism prevent the synthesis of truncated BRCA1, CHK2, and p53 proteins? Hum Mutat 29 65 73, doi: 10.1002/humu.20590. 11. Quaresima B, Romeo F, Faniello MC, Di Sanzo M, Liu CG, Lavecchia A, Taccioli C, Gaudio E, Baudi F, Trapasso F, et al. (2008) BRCA1 5083del19 mutant allele selectively up regulates pe riostin expression in vitro and in vivo. Clin Cancer Res 14 6797 6803, doi: 14/21/6797 [pii]10.1158/1078 0432.CCR 07 5208. 12. Vincenti MP, Coon CI, Lee O & Brinckerhoff CE (1994) Regulation of collagenase gene expression by IL 1 beta requires transcripti onal and post transcriptional mechanisms. Nucleic Acids Res 22 4818 4827. 13. Auersperg N, Wong AS, Choi KC, Kang SK & Leung PC (2001) Ovarian surface epithelium: biology, endocrinology, and pathology. Endocr Rev 22 255 288. 14. Johnson NC, Dan HC, Cheng JQ & Kruk PA (2004) BRCA1 185delAG mutation inhibits Akt dependent, IAP mediated caspase 3 inactivation in human ovarian surface epithelial cells. Exp Cell Res 298 9 16, doi: 10.1016/j.yexcr.2004.04.003S0014482704001922 [pii]. 15. Bouwman P & Jonkers J ( 2008) Mouse models for BRCA1 associated tumorigenesis: from fundamental insights to preclinical utility. Cell Cycle 7 2647 2653, doi: 6266 [pii]. 16. Brodie SG, Xu X, Qiao W, Li WM, Cao L & Deng CX (2001) Multiple genetic changes are associated with mamma ry tumorigenesis in Brca1 conditional knockout mice. Oncogene 20 7514 7523, doi: 10.1038/sj.onc.1204929. 17. Connolly DC, Bao R, Nikitin AY, Stephens KC, Poole TW, Hua X, Harris SS, Vanderhyden BC & Hamilton TC (2003) Female mice chimeric for expression o f the simian virus 40 TAg under control of the MISIIR promoter develop epithelial ovarian cancer. Cancer Res 63 1389 1397. 18. Nicosia SV & Johnson JH (1984) Surface morphology of ovarian mesothelium (surface epithelium) and of other pelvic and extrapelvi c mesothelial sites in the rabbit. Int J Gynecol Pathol 3 249 260. 19. Drost RM & Jonkers J (2009) Preclinical mouse models for BRCA1 associated breast cancer. Br J Cancer 101 1651 1657, doi: 6605350 [pii]10.1038/sj.bjc.6605350. 20. Lakhani SR, Jacquemie r J, Sloane JP, Gusterson BA, Anderson TJ, van de Vijver MJ, Farid LM, Venter D, Antoniou A, Storfer Isser A, et al. (1998) Multifactorial analysis of differences between sporadic breast cancers and cancers involving BRCA1 and BRCA2 mutations. J Natl Cance r Inst 90 1138 1145. 21. (1997) Pathology of familial breast cancer: differences between breast cancers in carriers of BRCA1 or BRCA2 mutations and sporadic cases. Breast Cancer Linkage Consortium. Lancet 349 1505 1510, doi: S0140673696101094 [pii].

PAGE 144

129 22. Boyd J, Sonoda Y, Federici MG, Bogomolniy F, Rhei E, Maresco DL, Saigo PE, Almadrones LA, Barakat RR, Brown CL, et al. (2000) Clinicopathologic features of BRCA linked and sporadic ovarian cancer. JAMA 283 2260 2265, doi: joc91391 [pii]. 23. Prat J, Ribe A & Gallardo A (2005) Hereditary ovarian cancer. Hum Pathol 36 861 870, doi: S0046 8177(05)00283 2 [pii]10.1016/j.humpath.2005.06.006. 24. Johannsson OT, Idvall I, Anderson C, Borg A, Barkardottir RB, Egilsson V & Olsson H (1997) Tumour biological feature s of BRCA1 induced breast and ovarian cancer. Eur J Cancer 33 362 371, doi: S0959804997890077 [pii]. 25. Martin RW, Orelli BJ, Yamazoe M, Minn AJ, Takeda S & Bishop DK (2007) RAD51 up regulation bypasses BRCA1 function and is a common feature of BRCA1 def icient breast tumors. Cancer Res 67 9658 9665, doi: 67/20/9658 [pii]10.1158/0008 5472.CAN 07 0290. 26. Boyd J & Rubin SC (1997) Hereditary ovarian cancer: molecular genetics and clinical implications. Gynecol Oncol 64 196 206, doi: S0090 8258(96)94572 2 [pii]10.1006/gyno.1996.4572. 27. Bell DA (2005) Origins and molecular pathology of ovarian cancer. Mod Pathol 18 Suppl 2 S19 32, doi: 3800306 [pii]10.1038/modpathol.3800306.

PAGE 145

About the Author Rebecca Linger completed her undergraduate studies at West Virginia Wesleyan College, where she graduated with a B.S. degree in Biology and a minor in Chemistry. During this time, she received a Mary Babb Randolph Cancer Center Undergraduate Research Fellowship at West Virginia University, where she completed a su mmer research project. Rebecca received her M.S. in Molecular Physiology and Biological Physics from the University of Virginia, where she was awarded a Congressionally Directed Medical Research Programs Department of Defense Breast Cancer Research Predoct oral Traineeship. She was also invited to the American Association for Cancer Research Edward A. Smuckler Memorial Pathobiology of Cancer Workshop in Aspen, CO. Rebecca joined the Medical Science Ph.D. Program in the USF College of Medicine in 2007. She pr esented her research at the 2010 American Association for Cancer Research Annual Meeting in Washington, D.C. and at USF Health Research Day in 2009 and 2010, where she was awarded Outstanding Poster Presentation in 2010. Rebecca was active in the Associati on of Medical Science Graduate Students, and served as the Student Leadership Award for ou tstanding leadership and service.


xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim
leader nam 22 Ka 4500
controlfield tag 007 cr-bnu---uuuuu
008 s2010 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0004713
035
(OCoLC)
040
FHM
c FHM
049
FHMM
090
XX9999 (Online)
1 100
Linger, Rebecca.
0 245
Novel roles for 185delag mutant brca1 in ovarian cancer pathology
h [electronic resource] /
by Rebecca Linger.
260
[Tampa, Fla] :
b University of South Florida,
2010.
500
Title from PDF of title page.
Document formatted into pages; contains X pages.
502
Dissertation (PHD)--University of South Florida, 2010.
504
Includes bibliographical references.
516
Text (Electronic thesis) in PDF format.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
3 520
ABSTRACT: Familial history is the strongest risk factor for developing ovarian cancer (OC), and a significant contributor to breast cancer risk. Most hereditary breast cancers and OCs are associated with mutation of the tumor suppressor Breast and Ovarian Cancer Susceptibility Gene 1 (BRCA1). Studying risk-associated BRCA1 truncation mutations, such as the founder mutation 185delAG, may reveal signaling pathways important in OC etiology. Recent studies have shown novel BRCA1 mutant functions that may contribute to breast and OC initiation and progression independent of the loss of wtBRCA1. Previously, we have found that normal human ovarian surface epithelial (HOSE) cells expressing the 185delAG mutant, BRAT (BRCA1 185delAG Amino Terminal truncated protein), exhibit enhanced chemosensitivity and up-regulation of the OC-associated serpin, maspin. In the current study, I identify an additional target of the BRAT mutation, matrix metalloprotease 1 (MMP1), a key player in invasion and metastasis. BRAT-expressing HOSE cells exhibit increased MMP1 messenger RNA (mRNA) by real time PCR and protein by Western blotting. Pro-MMP1 levels are also higher in conditioned media of BRAT-expressing cells and HOSE cell lines derived from BRAT mutation carriers. c-Jun is critical for BRAT-mediated MMP1 up-regulation, as siRNA knockdown diminishes MMP1 levels. Luciferase reporter constructs reveal that activator Protein 1 (AP1) sites throughout the distal end of the promoter contribute to BRAT-mediated MMP1 expression, and basal activity is mediated in part by an AP1 site at (-72). Reporters containing a single nucleotide polymorphism (SNP) associated with OC risk and progression yield increased activity that is further enhanced in BRAT cells. Interestingly, BRAT-mediated changes in chemosensitivity and gene regulation are not recapitulated in a normal breast epithelial or breast cancer cell model. This suggests tissue-specific mutant BRCA1 functions may contribute to breast and ovarian tissue specificity of BRCA1 mutation-associated cancer risk and also to differential breast and ovarian cancer risk and penetrance associated with specific mutations. Early molecular and cellular changes such as MMP1 up-regulation in the ovarian surface epithelium of BRCA1 mutation carriers may promote OC initiation and progression and represent a step forward on the continuum of cellular malignancy. Further investigation is warranted, as elucidating these early changes will aid in identification of potential screening and treatment strategies.
590
Advisor: Patricia A. Kruk, Ph.D.
653
BRAT
Matrix metalloproteinase 1
Ovarian surface epithelium
Breast cancer
Mutation
690
Dissertations, Academic
z USF
x Medical Sciences
Masters.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.4713