USF Libraries
USF Digital Collections

The role of microrna-155 in human breast cancer

MISSING IMAGE

Material Information

Title:
The role of microrna-155 in human breast cancer
Physical Description:
Book
Language:
English
Creator:
Kong, William
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
MicroRNA
EMT
Apoptosis
TGF-beta
Post-transcriptional Regulation
Dissertations, Academic -- Medical Sciences -- Masters -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: Recent statistics reveal breast cancer as the most common cancer among women and accounts for approximately 41,000 mortalities per year. In diagnosis, features such as stage, grade, lymph node metastasis are important prognostic indicators that help guide physicians and oncologist towards optimal patient care. Presence of established pathological markers such as ER, PR, and Her2/neu status would indicate ideal adjuvant therapy situation. Although treatment of these types of breast cancer is well established, cancer that lack all three receptors, "triple negatives" or "basal like" do not respond to adjuvant therapy and are considered more aggressive in that patients tend to recur early and experience visceral metastasis. Although scientists have uncovered numerous molecular biology mechanisms in search of an understanding in cancer, leading to development of fields such as apoptosis or growth pathways; cell cycle; angiogenesis; metastasis; and more recently cancer stem cells, much work remains as cancer is still not eradicated. MicroRNAs (miRNAs) are post transcriptional regulators of gene expression. Their discovery and functional understanding have only been uncovered in the past ten years. Long pri-miRNAs are transcribed from the genome and processed into pre-miRNAs by Dicer; and then into short single stranded mature miRNAs complexed with Argonaute proteins to inhibit protein translation. The first link of miRNAs to cancer was made only relatively recently, but the field has expanded exponentially since. TGF-beta induced Epithelial to Mesenchymal Transition model in Normal Mouse Mammary Gland Epithelia Cells (NMuMG) is a commonly used model to dissect the molecular processes of breast cancer metastasis. Using miRNA microarray, we demonstrated miR-155 was upregulated along with alterations of other miRNAs. This observation was validated with Northern and qRT-PCR analysis. Promoter and ChIP analysis revealed TGF-beta activated the Smad4 transcriptional complex to induce the expression of miR-155. The reduction of RhoA protein levels by ubiquitination has been described to be a critical step during EMT, and we showed miR-155 down regulates RhoA proteins without degrading its mRNA levels; therefore, preventing de novo synthesis of RhoA proteins in the course of EMT. The interaction between miR-155 and RhoA's 3'UTR was confirmed by reporter assays. In summary, we reported the importance of miR-155 during TGF-beta induced EMT in NMuMG cells. FOXO3a is a well studied tumor suppressor transcriptional factor and resides in the nucleus to transcribe pro-apoptotic genes such as Bim, or p27 in the active state. During conditions when cells are signaled to grow and divide, it is phosphorylated by oncogenes such as AKT or IKK-beta, becomes inactivated and translocates into the cytoplasm. We have shown for the first time that FOXO3a activity is also regulated by miRNAs, specifically miR-155. Western and Northern analysis revealed a correlation between FOXO3a protein and mature miR-155 RNA levels in breast cancer cell lines along with breast tumor and normal tissues. Specifically, miR-155 expression is low in BT474 and high in HS578T, and inversely correlates with endogenous FOXO3a protein levels. Overexpression of miR-155 decreased endogenous FOXO3a protein and knockdown of miR-155 HS578T rescued its expression. Reporter assay experiments validated the interaction between miR-155 and FOXO3a 3'UTR. More importantly, overexpression of miR-155 in BT474 protected the cells from apoptosis induced by drugs while knockdown of miR-155 in HS578T initiated cell death even in the absence of drugs. In summary, we have shown the importance of miR-155 in chemosensitivity by targeting FOXO3a in breast cancer. MiR-155 has been previously shown up-regulated in multiple types of malignancies, including breast cancer. In addition, miR-155 expression was reported to correlate very strongly to survival in lung and pancreatic cancer. We validated by qRT-PCR and Northern analysis that miR-155 expression is detected only in breast tumors and not normal breast tissue. In situ hybridization of breast cancer tissue microarrays revealed similar results. In light of previous studies that showed a correlation between miR-155 and survival in lung and pancreatic cancers, we performed an X-tile analysis to determine an optimal cut point for miR-155 level in our breast cancer sample population that would correlate to ten years overall survival. Verification using Kaplan-Meier validated a cut point at 90.14 to significantly correlate to overall survival (P=0.007). In addition, Chi-square analysis revealed miR-155 expression to correlate with high tumor stage, grade and lymph node metastasis. However, miR-155 expression did not correspond to ER, PR, or HER2/neu status, but this is hardly surprising since computational analysis does not predict miR-155 to target these genes. In summary, we have shown deviant expression of miR-155 in breast cancer. Due to its correlation with overall survival; higher grade and stage; lymph node metastasis, and triple negative subtype, miR-155 may prove to be a valuable prognostic marker and therapeutic target for breast cancer intervention.
Thesis:
Dissertation (PHD)--University of South Florida, 2010.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by William Kong.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains X pages.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
usfldc doi - E14-SFE0004737
usfldc handle - e14.4737
System ID:
SFS0028036:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim
leader nam 22 Ka 4500
controlfield tag 007 cr-bnu---uuuuu
008 s2010 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0004737
035
(OCoLC)
040
FHM
c FHM
049
FHMM
090
XX9999 (Online)
1 100
Kong, William.
0 245
The role of microrna-155 in human breast cancer
h [electronic resource] /
by William Kong.
260
[Tampa, Fla] :
b University of South Florida,
2010.
500
Title from PDF of title page.
Document formatted into pages; contains X pages.
502
Dissertation (PHD)--University of South Florida, 2010.
504
Includes bibliographical references.
516
Text (Electronic thesis) in PDF format.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
3 520
ABSTRACT: Recent statistics reveal breast cancer as the most common cancer among women and accounts for approximately 41,000 mortalities per year. In diagnosis, features such as stage, grade, lymph node metastasis are important prognostic indicators that help guide physicians and oncologist towards optimal patient care. Presence of established pathological markers such as ER, PR, and Her2/neu status would indicate ideal adjuvant therapy situation. Although treatment of these types of breast cancer is well established, cancer that lack all three receptors, "triple negatives" or "basal like" do not respond to adjuvant therapy and are considered more aggressive in that patients tend to recur early and experience visceral metastasis. Although scientists have uncovered numerous molecular biology mechanisms in search of an understanding in cancer, leading to development of fields such as apoptosis or growth pathways; cell cycle; angiogenesis; metastasis; and more recently cancer stem cells, much work remains as cancer is still not eradicated. MicroRNAs (miRNAs) are post transcriptional regulators of gene expression. Their discovery and functional understanding have only been uncovered in the past ten years. Long pri-miRNAs are transcribed from the genome and processed into pre-miRNAs by Dicer; and then into short single stranded mature miRNAs complexed with Argonaute proteins to inhibit protein translation. The first link of miRNAs to cancer was made only relatively recently, but the field has expanded exponentially since. TGF-beta induced Epithelial to Mesenchymal Transition model in Normal Mouse Mammary Gland Epithelia Cells (NMuMG) is a commonly used model to dissect the molecular processes of breast cancer metastasis. Using miRNA microarray, we demonstrated miR-155 was upregulated along with alterations of other miRNAs. This observation was validated with Northern and qRT-PCR analysis. Promoter and ChIP analysis revealed TGF-beta activated the Smad4 transcriptional complex to induce the expression of miR-155. The reduction of RhoA protein levels by ubiquitination has been described to be a critical step during EMT, and we showed miR-155 down regulates RhoA proteins without degrading its mRNA levels; therefore, preventing de novo synthesis of RhoA proteins in the course of EMT. The interaction between miR-155 and RhoA's 3'UTR was confirmed by reporter assays. In summary, we reported the importance of miR-155 during TGF-beta induced EMT in NMuMG cells. FOXO3a is a well studied tumor suppressor transcriptional factor and resides in the nucleus to transcribe pro-apoptotic genes such as Bim, or p27 in the active state. During conditions when cells are signaled to grow and divide, it is phosphorylated by oncogenes such as AKT or IKK-beta, becomes inactivated and translocates into the cytoplasm. We have shown for the first time that FOXO3a activity is also regulated by miRNAs, specifically miR-155. Western and Northern analysis revealed a correlation between FOXO3a protein and mature miR-155 RNA levels in breast cancer cell lines along with breast tumor and normal tissues. Specifically, miR-155 expression is low in BT474 and high in HS578T, and inversely correlates with endogenous FOXO3a protein levels. Overexpression of miR-155 decreased endogenous FOXO3a protein and knockdown of miR-155 HS578T rescued its expression. Reporter assay experiments validated the interaction between miR-155 and FOXO3a 3'UTR. More importantly, overexpression of miR-155 in BT474 protected the cells from apoptosis induced by drugs while knockdown of miR-155 in HS578T initiated cell death even in the absence of drugs. In summary, we have shown the importance of miR-155 in chemosensitivity by targeting FOXO3a in breast cancer. MiR-155 has been previously shown up-regulated in multiple types of malignancies, including breast cancer. In addition, miR-155 expression was reported to correlate very strongly to survival in lung and pancreatic cancer. We validated by qRT-PCR and Northern analysis that miR-155 expression is detected only in breast tumors and not normal breast tissue. In situ hybridization of breast cancer tissue microarrays revealed similar results. In light of previous studies that showed a correlation between miR-155 and survival in lung and pancreatic cancers, we performed an X-tile analysis to determine an optimal cut point for miR-155 level in our breast cancer sample population that would correlate to ten years overall survival. Verification using Kaplan-Meier validated a cut point at 90.14 to significantly correlate to overall survival (P=0.007). In addition, Chi-square analysis revealed miR-155 expression to correlate with high tumor stage, grade and lymph node metastasis. However, miR-155 expression did not correspond to ER, PR, or HER2/neu status, but this is hardly surprising since computational analysis does not predict miR-155 to target these genes. In summary, we have shown deviant expression of miR-155 in breast cancer. Due to its correlation with overall survival; higher grade and stage; lymph node metastasis, and triple negative subtype, miR-155 may prove to be a valuable prognostic marker and therapeutic target for breast cancer intervention.
590
Advisor: Jin Q. Cheng, Ph.D., M.D.
653
MicroRNA
EMT
Apoptosis
TGF-beta
Post-transcriptional Regulation
690
Dissertations, Academic
z USF
x Medical Sciences
Masters.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.4737



PAGE 1

The Role of MicroRNA-155 in Human Breast Cancer by William Kong A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Pathology and Cell Biology College of Medicine University of South Florida Major Professor: Jin Q. Cheng, M.D., Ph.D. Santo V. Nicosia, M.D. Patricia Kruk, Ph.D. Domenico Coppola, M.D. Jerry Wu, Ph.D. Date of Approval: July 20, 2010 Keywords: MicroRNA, EMT, Apoptosis, TGF, Post-transcriptional Regulation Copyright 2010, William Kong

PAGE 2

DEDICATION I dedicate this dissertation to my pare nts, Peter and Irene, who have always supported me through the good times and bad. You have, on more occasions than I would like to admit, always pi cked me up and put me back on track whenever I stumbled. My training wheels are off because I have learned from you to believe in myself, and always face every challenge confidently. My reaching this point and beyond are from the lessons you have taught me since childhood. I could not have done it without you! I would like to thank my sister, Linda, who I could always count on to look up to whenever I needed a role model; Braden W. fo r my rare excuse to get away from the lab on those “happiest days!”; and of course Kyle and Kierra W. for being there. Special thanks are also given to Myelin D., and Franjesca J. who believed in me from the start. X. H. who persuaded me to realize my dreams, L. H. who often stood by me, and M. Y. who made me laugh in the most unexpected ways – I just think of cows “mooo” and smile. You all are wonderful and I coul d not have done it without you!

PAGE 3

ACKNOWLEDGEMENT I would like to acknowledge my mentor, Dr. Cheng, for his firm confidence in me as a graduate student. His guidance and leadership directed me towards the path of accomplishments. I will always remember the i nvaluable lessons I learned from him. I thank him for everything.

PAGE 4

i TABLE OF CONTENTS LIST OF TABLES ............................................................................................................. iv LIST OF FIGURES ............................................................................................................v ABSTRACT ................................................................................................................... vi i CHAPTER I. INTRODUCTION TO MICRORNA AND BREAST CANCER ................1 Breast Cancer ...........................................................................................................1 Early Beginnings of RNA Interference and microRNAS ........................................4 MicroRNA Profiling ................................................................................................5 Evolution of miRNA High Throughput Analysis ........................................6 Array Platform .............................................................................................9 Probe Design ................................................................................................9 MiRNA Q-RT-PCR ...................................................................................10 Bead Based Method ...................................................................................11 Mirage ........................................................................................................14 Rake ...........................................................................................................14 Nanotechnology .........................................................................................15 MicroRNA Biogenesis ...........................................................................................16 MicroRNA Nomenclature ......................................................................................20 MicroRNA and Cancer ..........................................................................................20 MicroRNA-155 ......................................................................................................21 Central Hypothesis .................................................................................................23 Objectives ..............................................................................................................23 References ..............................................................................................................23 CHAPTER II. MICRORNA-155 IS REGULATED BY TGF /SMAD PATHWAY AND CONTRIBUTES TO EPITHELIAL CELL PLASTICITY BY TARGETING RHOA. ...........................................................................................36 Abstract ..................................................................................................................36 Introduction ............................................................................................................37 Materials and Methods ...........................................................................................39 Cell Line, Treatment and Tumor Specimens .............................................39 MicroRNA Microarray, Noth ern, and qRT-PCR Analysis .......................40 Immunofluorescence and Immunoblotting ................................................41 Isolation and Anaysis of miR-155 Promoter .............................................41 Chromatin Immunoprecipitation (ChIP) Assay .........................................42

PAGE 5

ii Knockdown of miR-155 ............................................................................42 Expression Plasmid and Esta blishment of Stable miR-155 Expression Cell Line ............................................................................43 RhoA 3’UTR Luciferase Reporter Assay ..................................................43 Results ....................................................................................................................44 miRNA Expression Profiles in TFG -Induced EMT in NMuMG, and Smad4 Knockdown NMuMG Cells ..............................................44 miR-155 is a Direct Target of TGF /Smad Pathway.................................48 miR-155 Facilitates TGF -Induced EMT and Tight Junction Dissolution as Well as Cell Migration and Invasion ...........................51 RhoA is Negatively Regulated by miR-155 ..............................................56 miR-155 Expression in Inva sive Breast Cancer ........................................61 Disscussion ............................................................................................................64 References ..............................................................................................................68 CHAPTER III. MICRORNA-155 REGUL ATES CELL SURVIVAL, GROWTH AND CHEMOSENSITIVITY BY TA RGETING FOXO3A IN BREAST CANCER ....................................................................................................................74 Abstract ..................................................................................................................74 Introduction ............................................................................................................75 Materials and Methods ...........................................................................................76 Cell Lines and Breast Tumor Specimens ...................................................76 Plasmids .....................................................................................................76 Northern Blot, Locked Nucleic Acid In Situ Hybridization (LNAISH) and Immunohistochemical Staining ............................................77 MiRNA RT-qPCR Detection and Quantification ......................................77 Cell Viability and Apoptosis Assay ...........................................................78 Western Blot Analys is and Antibodies ......................................................78 Target In-Vitro Luciferase Report Assay ..................................................78 Statistical Analysis .....................................................................................79 Results ..............................................................................................................79 MiR-155 is a Determinant in Chemosensitivity of Breast Cancer ............79 FOXO3a is Negatively Regulated by miR-155 .........................................84 3’UTR of FOXO3a Interacts with miR-155 ..............................................84 Downstream Targets of FOXO 3a were Inhibited by miR-155 ..................88 Introduction of FOXO3a cDNA Lacking 3’UTR Largely Abrogates miR-155 Cellular Functions ...............................................90 Inverse Correlation of Expression of miR-155 and FOXO3a in Breast Cancer .......................................................................................93 Discussion ..............................................................................................................96 References ..............................................................................................................99 CHAPTER IV. ELEVATED MICRORNA155 IS ASSOCIATED WITH POOR PROGNOSIS IN BREAST CANCER.......................................................................106 Abstract ................................................................................................................106 Introduction ..........................................................................................................107

PAGE 6

iii Materials and Methods .........................................................................................108 Tumor Specimens ....................................................................................108 RNA Isolation ..........................................................................................108 QRT-PCR and Northe rn Blot Analysis....................................................108 Locked Nucleic Acid in S itu Hybridization (LNA-ISH) .........................109 Statistical Analysis ...................................................................................110 Results ..................................................................................................................110 Frequent Overexpression of miR-155 in Breast Cancer ..........................110 MiR-155 Overexpression is Associ ated with Clini cal Features ..............117 MiR-155 Overexpression is Associ ated with Poor Overall 10-year Survival ..............................................................................................117 Discussion ............................................................................................................122 References ............................................................................................................123 CHAPTER V. DISCUSSI ON AND CONCLUSION ....................................................128 References ............................................................................................................133 APPENDICES ............................................................................................................139 Appendix I. Publications .....................................................................................139 List of First Au thor Publications ..............................................................139 List of Co-Author Publications ................................................................139 ABOUT THE AUTHOR. ..................................................................................... End Page

PAGE 7

iv LIST OF TABLES TABLE 1: Quantification of MiR-155 Expr ession in Breast Cancer Cell Lines. ..........83 TABLE 2: Clinical and Pathological Data for Breast Tumors in the Independent Validation Cohort........................................................................................115 TABLE 3: MiR-155 Expression in Histologic Subtype. ..............................................116 TABLE 4: MiR-155 Expression and Clinic al Pathological Characteristics. ................116 TABLE 5: Multivariate Analysis. .................................................................................121

PAGE 8

v LIST OF FIGURES FIGURE 1. Classification of MiRNA Profiling Methods ..................................................8 FIGURE 2. Diagram Representation of the Bead Based Method for High Throughput MiRNA Profiling ......................................................................13 FIGURE 3. Structures of MiRNA During Biogenesis .....................................................17 FIGURE 4. Canonical Pathway of MicroRNA Biogenesis .............................................19 FIGURE 5. Expression Profile of TGF /Smad Transcriptionally Regulates MiR155.................................................................................................................46 FIGURE 6. TGF /Smad Transcriptionally Regulates MiR-155 ......................................50 FIGURE 7. MiR-155 Mediates the Effect of TGF on EMT ..........................................52 FIGURE 8. MiR-155 Plays a Significant Ro le in Cell Migra tion and Invasion ..............55 FIGURE 9. RhoA is a Target of MiR-155 .......................................................................59 FIGURE 10. Elevated Levels of MiR-155 ar e Associated with Invasive Breast Cancer ...........................................................................................................62 FIGURE 11. MiR-155 Induces Breast Cancer Cell Growth and Survival and Chemoresistance ...........................................................................................81 FIGURE 12. MiR-155 Targets FOXO3a through Interaction with FOXO3a3’UTR ...........................................................................................................86 FIGURE 13. MiR-155 Inhibits FOXO3a Down stream Targets, Bim and p27, and Modulates Doxorubicin Effects on FOXO3a/Bim/p27 and Apoptosis ........89 FIGURE 14. Transfection of FOXO3a c DNA Lacking 3’UTR Overrides MiR-155 Effects on Bim and p27 Expression and Cell Survival .................................91 FIGURE 15. MiR-155 Inversely Correlate s with FOXO3a Expression in Breast Cancer Tissue and Cell Lines .......................................................................95

PAGE 9

vi FIGURE 16. MiR-155 Expressi on in Breast Cancer .......................................................112 FIGURE 17. MiR-155 Expressi on Correlates to 10-year Overall Survival in Breast Cancer ..............................................................................................119

PAGE 10

vii ABSTRACT Recent statistics reveal breast cancer as the most common cancer among women and accounts for approximately 41,000 mortalities per year. In diagnosis, features such as stage, grade, lymph node metastasis are im portant prognostic indica tors that help guide physicians and oncologist towards optimal pa tient care. Presence of established pathological markers such as ER, PR, and Her2/neu status w ould indicate ideal adjuvant therapy situation. Although trea tment of these types of breast cancer is well established, cancer that lack all three receptors, “triple ne gatives” or “basal like” do not respond to adjuvant therapy and are consid ered more aggressive in that patients tend to recur early and experience visceral metastasis. A lthough scientists have uncovered numerous molecular biology mechanisms in search of an understanding in cancer, leading to development of fields such as apoptosis or growth pathways; cell cycle; angiogenesis; metastasis; and more recently cancer stem cells much work remains as cancer is still not eradicated. MicroRNAs (miRNAs) are post transcriptio nal regulators of gene expression. Their discovery and functional understanding have only been uncovere d in the past ten years. Long pri-miRNAs ar e transcribed from the genom e and processed into premiRNAs by Dicer; and then into short singl e stranded mature miRNAs complexed with Argonaute proteins to inhibit pr otein translation. The first link of miRNAs to cancer was made only relatively recently, but the field has expanded exponentially since.

PAGE 11

viii TGFinduced Epithelial to Mesenchymal Transition model in Normal Mouse Mammary Gland Epithelia Cells (NMuMG) is a commonly used model to dissect the molecular processes of breast cancer meta stasis. Using miRNA microarray, we demonstrated miR-155 was upregulated along w ith alterations of other miRNAs. This observation was validated with Northern a nd qRT-PCR analysis. Promoter and ChIP analysis revealed TGFactivated the Smad4 transcriptional complex to induce the expression of miR-155. The re duction of RhoA protein leve ls by ubiquitination has been described to be a critical step during EMT, and we showed miR-155 down regulates RhoA proteins without degrading its mRNA levels; therefore, preventing de novo synthesis of RhoA proteins in the course of EMT. The interaction between miR-155 and RhoA’s 3’UTR was confirmed by reporter assays. In summary, we reported the importance of miR-155 during TGF induced EMT in NMuMG cells. FOXO3a is a well studied tumor suppressor transcriptional factor and resides in the nucleus to transcribe proapoptotic genes such as Bim, or p27 in the active state. During conditions when cells are signaled to grow and divide, it is phosphorylated by oncogenes such as AKT or IKK becomes inactivated and translocates into the cytoplasm. We have shown for the first time that FOXO3a activity is also regulated by miRNAs, specifically miR-155. Western and Northern analys is revealed a correlation between FOXO3a protein and mature miR-155 RNA levels in breas t cancer cell lines along with breast tumor and normal tissues. Specifically, miR-155 expression is low in BT474 and high in HS578T, and inversely corr elates with endogenous FOXO3a protein

PAGE 12

ix levels. Overexpression of miR-155 d ecreased endogenous FOXO3a protein and knockdown of miR-155 HS578T resc ued its expression. Re porter assay experiments validated the interaction between miR-155 and FOXO3a 3’UTR. More importantly, overexpression of miR-155 in BT474 protected the cells from apoptos is induced by drugs while knockdown of miR-155 in HS 578T initiated cell death even in the absence of drugs. In summary, we have shown the importance of miR-155 in chemosensitivity by targeting FOXO3a in breast cancer. MiR-155 has been previously shown up-regulated in multiple types of malignancies, including breast cancer. In addition, miR-155 expression was reported to correlate very strongly to su rvival in lung and pancreatic cancer. We validated by qRTPCR and Northern analysis that miR-155 expression is detected only in breast tumors and not normal breast tissue. In situ hybridiz ation of breast cancer tissue microarrays revealed similar results. In light of previ ous studies that showed a correlation between miR-155 and survival in lung an d pancreatic cancers, we perfo rmed an X-tile analysis to determine an optimal cut point for miR-155 le vel in our breast cancer sample population that would correlate to ten years overall survival. Veri fication using Kaplan-Meier validated a cut point at 90.14 to significantly correlate to overall su rvival (P=0.007). In addition, Chi-square analysis revealed miR-155 expression to correlate with high tumor stage, grade and lymph node metastasis. However, miR-155 expression did not correspond to ER, PR, or HER2/neu status but this is hardly surprising since computational analysis does not predict miR155 to target these genes. In summary, we have shown deviant expression of miR-155 in breast cancer. Due to its correlation with

PAGE 13

x overall survival; higher grade and stage; lymph node metastasis, and triple negative subtype, miR-155 may prove to be a valuable prognostic marker and therapeutic target for breast cancer intervention.

PAGE 14

1 CHAPTER I INTRODUCTION TO MICRORNA AND BREAST CANCER Breast Cancer: According to Breast Cancer Facts and Figures 2009-2010 (The American Cancer Society), breast cancer is the most common cancer among women in the United States. In 2009, over 190,000 women were diagnosed with breast cancer, and close to 41,000 died from this disease. Although much progress has been made since American Joint Committee on Cancer (AJCC) and Internatio nal Union for Cancer Control (UICC) established initiatives of standardizing can cer screening, diagnosis and prognosis leading to proper management and choice of therap eutic methods, much work remains in the eradication of breast and a ll other types of cancer. In diagnosis, standard clinical features such as the tumor si ze, extent of lymph node involvement, and distant metastasis at di agnosis have all been integrated into the AJCC TNM classification standard and still play a central role in determining prognosis and treatment course by the physician ( 49, 73, 100, 104). Similarly, Estrogen Receptor (ER) and Progesterone Receptor (PR) status ha ve been defined as important markers of breast cancer pathology decades ago, but now are gold standard in prescribing adjuvant therapy today (6, 25, 47, 59, 85-87, 125, 132, 141). Another feature of breast cancer tested for is amplification of Human Epiderma l growth factor Recepto r 2 (Her2/neu). It is a cell membrane surface-bound receptor tyro sine kinase belonging to the epidermal

PAGE 15

2 growth factor receptor family (ErbB) involved in signal transduction pathways promoting cell growth and differentia tion (24, 103, 111, 112). Alth ough its presence indicates aggressive tumor, trastuzumab, a specific antibo dy that targets the cell surface receptor, is supplemented, so that the receptor can be bloc ked from receiving growth signals (1, 9, 42, 84). A subtype of aggressive breast cancer, ca lled “triple negative” or “basal like”, lacks ER/PR/Her2 expression and grows withou t the need for external growth hormones (3, 7, 13, 16, 54). It is more prevalent in younger women and characterized by early recurrence and visceral metastasis to the brain (4, 45, 126). Fo rtunately, it is still sensitive to conventional chemotherapy and ofte n prescribed concurrently with surgery (4, 7, 13, 15, 16). Although the molecular biology of this breast cancer subtype is not yet fully understood, it has been associat ed with BRCA mutations (123, 138). Extensive research that spanned decades has resulted in the gold standard diagnostic algorithm that physicians and oncol ogists depend on to determine treatment strategy for the patient diagnosed with breas t cancer. As research continues, this algorithm can develop into a more sophisticat ed system better suited to the dynamic and unique characteristics of each individual patient. One example where change has occurred is breast cancer nodal involvement. Classifica tion were initially based on mainly location and extent of macro spread but has been modified to number of nodes involved instead. Modern cla ssification now groups patients into 1-3, 4-9 and finally 10 or more positive nodes and provides strong corr elation to overall survival (8, 65, 118, 133). To reiterate the growing need for indi vidualized therapy, r oughly a quarter of node negative breast cancer patients will experi ence atypical recurrence correlating to poor

PAGE 16

3 overall survival without much molecular understanding. Howe ver, work has shown that other features such as late stage and high grade can override the positive effects of negative node involvement feature (38, 102) Although tremendous progress has been made in breast cancer diagnosis and treatmen t, more work remains to be done to provide better patient care At molecular levels, significant progress has been made through the identification of a number of molecules involved in brea st cancer leading to targeted therapy. Targeting the oestrogen receptor (ER) is a we ll-established molecu lar targeted therapy approach, and widespread use of the selectiv e ER modulator tamoxifen in breast cancer is responsible for major improvements in cure ra tes, quality of life and disease prevention during the past over 2 decades. Targeting both HER2/neu with trastuzumab and the vascular endothelial growth factor (VEGF) with bevacizumab in combination with chemotherapy has become a further milestone in molecular targeted therapy (48, 91, 116). However, intrinsic and acquired resistance to endocri ne and/or cytosta tic treatments is still a common feature that limits the bene fits of these novel th erapeutic strategies. Therefore, clinical tria ls of endocrine or cytotoxic therap ies combined with growth factor pathway inhibitors or their downstream signalling elements are warranted; such approaches may allow us to improve upon the cu rrent standard of care for breast cancer patients (83). Unfortunately, despite enco uraging preclinical data, some of these combinations have yielded disappoi nting results in the clinical setting (68) Thus, there is an urgent need to identify new molecules whic h may play critical ro le in breast cancer development, metastasis and chemoresistance.

PAGE 17

4 Early Beginnings of RNA Interference and MicroRNAs: The discovery of RNA interference (RNAi) began slowly as laboratory observations, but developed into a specialized fi eld with widespread implications in basic science and clinical medicine. Two pioneers in this field, Andrew Z. Fire and Craig C. Mello, garnered extremely pr estigious career achievement recognition by winning the Nobel Prize. History of RNAi traces back to 1971, when a work named “DoubleStranded Poliovirus RNA Inhibits Initiatio n of Protein Synthe sis by Reticulocyte Lysates” (30) provided the first publishe d evidence that shor t double stranded RNA fragments can inhibit protein sy nthesis. The next breakthrou gh occurred in the early 80s, when Chalfie et al. described that mutati on of the lin-4 gene, now known as a miRNA, causes aberrant repetitive regeneration of larv al stage specific cuticle in Caenorhabditis elegans (20). This was followed by the desc ription of the elegant orchestration that occurs between lin-4, lin-14, lin-28, and lin-29 genes during Caenorhabditis elegans development. Specifically lin-14 and lin-2 8 were found to suppre ss lin-29 expression, but once development reached th e adult stage, lin-4 was generated to suppress lin-14 and lin-28, therefore liberating lin-29 to “regulate genes that control cell division, differentiation, and stage-specif ic gene expression” (69). Furthermore, cloning, mutation, and computation analysis of the lin-4 gene did not reveal a coded gene, but instead a small RNA transcripts containi ng 7 consecutive nucleotides in perfect complementation to repeat elements found within the 3’ un translated region (3’UTR ) of lin-14. This observation led to the key hypothe sis that lin-4 regulates lin -14 expression via antisense RNA-RNA interaction in the 3’UTR of messenger RNAs (70, 131). During this time, these molecules were called small temporal RNA (stRNA) as their expression occurred

PAGE 18

5 transiently during Caenorhabditis elegans development (67, 69, 70, 131). Shortly after the breakthrough discovery of lin-4, let-7 was also found to also regulate Caenorhabditis elegans development by targeting the hetero chronic genes lin-14, lin-28, lin-41, and daf12 (99). Similar to Ambros work, let-7 was also found to regulate lin-41 which in turn regulates lin-29 (115). The similarities betw een the lin-14 and let7 led researchers to consider the possibility that a previously undiscovered leve l of gene regulation existed. This became more evident as scientists almost immediately began identifying other stRNAs, and the term microRNA was subseque ntly coined (66, 67, 69). Although the observation of double stranded RNA fragments blocking prot ein translation was first noted in the early 70’s, it wasn’t until the 90’s that scientists began to unravel the mechanism of RNA interference. Around the same time, the discove ry of miRNAs lin14 and let-7 probably provided a symbiotic feed forward grow th towards better understanding of RNA interference. Since then the field has br anched into sub categories such as utilization of RNAi as a simple tool to knockdown gene expression in order to determine function. In other areas, diseas e signatures revealed by microRNA expression profiling studies have expanded the field of oncogenes or tumor suppressors and opened up new possibilities in medicine using RNAi to lower unwanted gene expression and vice versa. MicroRNA Profiling: Since the discovery of RNA interferen ce and miRNAs, accumulated studies have shown that miRNAs control ce ll proliferation, differentiati on, and apoptosis (22, 88, 134, 136). These broad functions suggest that mi RNAs may also contribute to a range of

PAGE 19

6 diseases. In fact, miRNA expression prof ile studies have demonstrated aberrant expression of miRNA in human cancer, hear t disease, diabetes, and neurological disorders (5, 34, 37, 52, 53, 63, 80, 105, 109, 122). Beyond pathological a ssociation, labs have branched into areas of specialty in cluding: (1) new miRNA discovery by sequence analysis and cloning; (2) f unctionality by target identificat ion, classification as tumor suppressor or oncogene, developmental regul ation, signaling pathways and biological circuits; (3) biogenesis and maturation by studying transcri ptional regulation, Dicer and Drosha processing, and RISC integration; (4) clinical utilization by identifying biomarker signature or therapeutic agents Although the range is wide in these different areas of specialty, many of them will have one techni que in common, initial profiling studies to determine a signature. 1) Evolution Of Mirna High Throughput Analysis : MiRNA high throughput analysis has grown to become a field of its own. Array technology that was created for cDNA expre ssion profiling was applied to expression profiling of miRNAs (76). Krichevsky and others were one of the first in this field to describe a dot blot method that can be easily replicated with standard lab equipments and reagents (63). Croce’s lab described an optimized method, which detects both mature miRNAs and their precursor forms (75). Due to sensitivity issues, the size of oligo arrays have been scaled down considerably from hand held spotti ng devices to robotics that can print microscopic oligo dots ont o a glass platform and later by direct synthesis through a photochemical process onto a quartz platform (76). However, re trotranscription and subsequent amplification through polymer ase chain reaction (PCR) addressed the

PAGE 20

7 sensitivity issue and took it to the next level by being able to profile using only nanograms of total RNA (21, 107, 108, 113). Si nce then, new techniques have been developed by innovating new approaches that ultimately stem from these foundational methods. In general, all existing methods can be separated into two categories—one that utilizes direct oligo hybrid ization without sample RNA amplification and the other requiring sample amplification ( Figure 1 ). A caveat to keep in mind is that there are inherent advantages and disadvantages to bot h approaches. Protocol s that do not utilize sample amplification will re quire a relatively larger starting amount of total RNA. However, protocols that require sample amplification c ould be more prone to external variation as handling imperfec tion can also be amplified.

PAGE 21

8 FIGURE 1. Classification of MiRNA Profiling Methods. All high throughput miRNA expression analysis methods can be categor ized into two groups based on the need forRNAsample amplification. The left part is a direct hybridizati on approach. The right part requires RNA sample amplification. (Kong, W., et al. 2008. Strategies for Profiling MicroRNA Expression. J. Cell. Physiol. 218:22–25, 2009.)

PAGE 22

9 2) Array Platform : Oligo microarray technology is based si mply on the Watson– Crick base pairing nature of nucleic acids. Synthesized antisense probes are spotted and immobilized onto a nylon support platform using a hand held s potting device (63). This method is relatively low cost and readily available to labs w ithout specialized robotics and equipments dedicated to array fabricati on. A disadvantage to this meth od is its scale. Oligo spots from a hand held device are macroscopic in nature, so the resulting array will be relatively large. About 30 mg of total RNA is commonly used to hybridize an array of this size (63). To address this issue, au tomated robots have been employed to spot microscopic oligo dots onto a glass slide ( 75). Another advantage to microscopic oligo dots is an increased probe density per give n area. Probes designed to differentiate between mature miRNA and pre-miRNAs an d probes that detect hypothetical miRNAs can all be spotted onto the same array. An evolution to this process is the direct photochemical synthesis of probe s onto a quartz platform (76). 3) Probe Design : The design of capture probes has been reported to affect the nature of hybridization. Annealing temperature for miR NA is determined by its length and GC content, so each miRNA has a signature Tm. An array that contains a library of probes can have a Tm that is distributed by a wide range of temperatures. Fortunately, most miRNAs are predicted to have a Tm of 55OC (62, 129), and this is often designated as the Tm of most miRNA microarray. However, se quence truncation or el ongation of problem probe has been shown as a way to normalize their Tm to 55OC. For example, probe can

PAGE 23

10 be truncated to lower their Tm, and flanking premiRNA sequences can be added to raise Tm (10, 40). Another approach is chemical modification of capture probes. Locked nucleic acid (LNA) and 2’-O-(2-methoxyethyl)-(MOE) are such examples. Since chemically modified probes can elevate Tm and stabilize hybridization, this approach allows an entire library of probes de signed to have a normalized Tm of 55OC (12, 17, 18). Unfortunately, synthesis and chemical modifi cation of RNA probes can be costly. To address this issue, simple concatamerizati on of DNA probes have been found to be a cost effective alternative (62). 4) MiRNA Q-RT-PCR : Profiling Direct hybridizati on of miRNA samples onto an oligo array may require a large amount of total RNA; however, some research protocols might have access to a small and limited amount of RNA—such as needle biopsies. A PCR based approach was developed to address this issue. In this met hod, total RNA is isolated as usual. However, a reverse transcriptase (RT) reaction follows. The RT reaction first consists of small RNA fractionation, followed by polyadenylation. Then a standard RT protocol is applied where poly(T)s are added to prime the synthesized th e poly(A) tail so reve rse transcriptase can produce cDNAs from the small RNA. Finally, miRNA specific primers will probe for a specific miRNA through PCR amplification ( 107, 113). Due to specificity issues and inability to differentiate between mature and pre-miRNA, changes have been made to the RT step. Instead of a general poly(A) react ion in combination with universal priming through poly(T) adapter molecules, a miRNA specific stem-loop reverse primer is used. This specially designed primer contains seque nce that is antisense to a portion of the 30

PAGE 24

11 sequence of the miRNA that is to be amplif ied. To increase the specificity of the PCR amplification step, the forward primer cont ains antisense sequenc e derived from the mature miRNA, and the reverse primer consis ts of sequences taken from the stem-loop of the reverse primer. Sensitivity and specificity was found to be dramatically improved. In addition, the nature of specific priming allows this protocol to differentiate between the longer pre-miRNA and shorter mature active fo rm of the miRNA. Finally, it is claimed that this protocol can discriminate between isoforms of related miRNAs that differs by only one or two base pairs (21, 108). A multiple xed kit that applies this technology into a high-throughput format is now commercially available. 5) Bead Based Method : Bead based profiling method involves bot h amplification and hybridization, and requires flow cytometry for analysis. Capture probes for a specific miRNA are synthesized and attached to a bead that is uniquely coded by a mixture of two fluorescent dyes for identification. Total RNA are enriched for short RNAs. As indicated in Figure 2 adapter oligos are then ligated to both th e 30 and 50 ends of en riched RNAs. Primers with sequence specific to adap ters are used to create a li brary of cDNAs through reverse transcription. Finally, a PCR reaction using primers antisense to the adaptors is performed to amplify the population of cDNAs. An important feature of this step is the use of biotinlyated PCR forward primers to tag each PCR duplex with a biotin molecule, which can enzymatically react with streptav idin–phycoerythrin to em it a colored reaction that can be registered by a flow cytometer. The resulting PCR product is hybridized to a mix of fluorescent beads that make up a miR NA library. This mixture is then run through

PAGE 25

12 a flow cytometer to analyze both fluoresce nt and streptavidin–phycoerythrin intensity. The fluorescent bead will indicate the sp ecific miRNA probe, whereas the streptavidin– phycoerythrin intensity will indicate quantity of a specific miRNA (78). This procedure can be relatively labor inte nsive since it requires both PCR and hybridization steps during sample analysis. In addition, a flow cytome ter will likely have to be optimized and dedicated to scanning th is bead based library.

PAGE 26

13 FIGURE 2. Diagram Representation of the Bead Based Method for High Throughput MiRNA Profiling. Short RNAs are enriched and then processed with a ligation reaction that adds adapter oligos to bot h 3' and 5' ends of short RNA. A reverse transcription step is carried out using primers that contains sequence to the adaptor oligos and followed by PCR using biotinlyated forwar d primers. The resulting PCR products are hybridized to a fluorescent beadmixture containing miRNA speci fic probes and then analyzed with a flow cytometer. (Kong, W., et al. 2008. Strategies for Profiling MicroRNA Expression. J. Cell. Physiol. 218:22–25, 2009.)

PAGE 27

14 6) Mirage : The methods described above can only profile known miRNAs. MiRAGE— miRNA serial analysis of gene expression—us es an amplification based method not only profile but also potentially iden tify new miRNAs. The first half of this protocol resembles the bead based method in that linkers are ligat ed to both 50 and 30 e nds of enriched small RNAs for reverse transcription. A PCR react ion is carried out on the resulting cDNA mix, also with the help of biotinlyated primers. This met hod deviates from the bead based method here. The linkers which now contain biotins are cleaved from the PCR products. The mixture containing amplified small RNA sequence and biotinlyated linkers are run through a column of streptavidin-coated b eads for purification. Streptavidin acts as magnets to bind the biotin tagged linkers. Th e eluted product, at least in theory, is purified small RNAs. The small RNAs are concatenated, cloned, and sequenced for analysis (27). 7) Rake : RAKE, which is short for RNA primed–a rray-based Klenow enzyme assay, is another strategy that involves both hybridi zation and amplificati on. However, the PCR reaction in this protocol does not amplify th e sample, but amplifies the signal. An oligo with a 50 spacer is covalently linked onto a glass platform. The spacer sequence is followed by a miRNA antisense capture probe with three thymidine residues in between. RNA samples are hybridized to this array. Mi RNAs in the sample would bind to their specific probe and form a double stranded structure. The addition of exonuclease I will only degrade unbound single stranded oligos. The miRNA that have latched onto its

PAGE 28

15 probe will act as a primer. Subsequent P CR will result in the addition of biotinconjugated dATPs onto the spacer template, which emits an augmented signal without PCR amplification of the original RNA sample (92). 8) Nanotechnology : Though not yet mainstream in the area of biotechnology, nanotechnology is finding its way into the miRNA profiling realm. Two methods have been described, and both still require the base pa iring nature of nucleic acid s but do not require sample amplification. The first example is a biosensor that has the capability to detect and quantitate miRNAs in the femt omolar range. The core of th is biosensor consists of a microscopic platform made with interlocki ng gold and titanium microelectrodes with wells in between. Capture probes are chemically fixed into these wells. As samples are hybridized onto this platform, miRNAs are bound to their probe in specific wells. The anionic nature of the miRNA phosphate ba ckbone then catalyzes the formation of polyaniline nanowires from a so lution of cationic aniline particles, forming a complete electrical circui t between the gapped elec trodes, and resulting in an immediate digital readout (35). Another nanotechnology based method ut ilizes surface plasmon resonance imaging (SPRI) in combination with tradi tional molecular biology enzymatic reactions. This multiplexed platform uniquely consists of a single stranded LNA capture probe per miRNA. A RNA sample is hybridized to this microarray, followed by poly(A) tailing of bound miRNA. Instead of using cy3 or cy5 la beled poly(T)s to base pair with the

PAGE 29

16 synthesized poly(A)s, gold na noparticles attached to po ly(T) oligos are used. The microarray image is then obtained from a s canner that detects gol d nanoparticles (36). MicroRNA Biogenesis : The study of miRNA biogenesi s from genomic transcription to the functional mature miRNA is an important area of resear ch. It is now evident that miRNAs appear individually or cluste red within introns of protein codi ng genes or ncRNA transcripts; while others are found within exons ( Figure 3A ; 101). The PolII transcribed primary RNA transcript, also known as “pri-miRNA,” is often longer than 1kb and capped at the 5’ end (56, 57, 74). A unique feat ure of this single stranded transcript is the formation of stable stem-loop hairpin structures ap proximately 70 nucleotides in length ( Figure 3B ).

PAGE 30

17 FIGURE 3. Structures of MiRNA During Biogenesis. ( A ) Schematic structure of 5 pri-miRNAs. Red depicts miRNA stems, gr een non coding, blue introns, beige coding exons, (PA) alternate polyA site. ( B ) Typical miRNA stem-loop structure. (Adapted Cullen, B.R. 2004. Transcriptionand Processi ng of Human microRNA Precursors. Mol Cell 16:861-865.)

PAGE 31

18 Drosha and DCGR8, components of the Mi croprocessor complex, locate and bind to the base of each hairpin a nd cleave approximately 11 nucleot ides from the base of the stem to free the hairpin from the primary transcript. This freed particle is called “premiRNA” and consists of an imperfectly co mplementary double stranded stem at the base of the single stranded loop (72, 140). The st ructure also contains a 5’ phosphate and a distinctive 3’ 2 nucleotide overhang which si gnals to Exportin-5 for nuclear export (11, 71, 79, 137). The transported pre-miRN A then undergoes loop cleavage by Dicer resulting in a double stranded RNA with pr otruding small bulges of non complementary nucleotides (44, 50, 58). Argona ut proteins determine and incorporate the guide strand while removing the opposing strand to form the functional mature miRNA complex known as RNA induced silencing complex (R ISC) (32, 33, 46, 82, 93, 110). This mature miRNA, loaded onto RISC, interact with 3’UTR of targeted mRNAs to induce gene silencing by either inhi biting protein translation or mRNA degradation ( Figure 4 ; 28, 51, 139, 140).

PAGE 32

19 FIGURE 4. Canonical Path way of MicroRNA Biogenesis. The production of the primary miRNA transcript (pri-miRNA) occurs by RNA polymerase II or III. Cleavage of the pri-miRNA by the Drosha-DGCR8 (Pas ha) complex takes place in the nucleus. The released precursor stem-loop (pre-miRNA) is exporte d to the cytoplasm by Exportin5-Ran-GTP. Dicer cuts the loop from the pre-miRNA structur e, leaving a double stranded RNA with bulges along the stem. The “diced” RNA double strand is them processed by Argonaute proteins into the RNA-induced silencing complex (RISC) where it becomes a mature miRNA that inhibits protei n translation. (Adapted from Winter, J., et al. 2009. Many roads to maturity: microRNA biogenesis pathways and their regulation. Nat Cell Bio 11.3:228-234.

PAGE 33

20 MicroRNA Nomenclature: As mentioned before, the discovery of mi RNAs as post transcriptional regulators lead to a rapid discovery of other members by techniques such as sequencing analysis of small total RNAs and small RNAs derived cDNA clones; or by computational analysis (66, 67, 69, 96). MicroRNAs are believed to have evolved ve ry early on; and therefore are often conserved between species. Homo logus orthologs are named with the same numerical identifier, bu t with a different species prefi x, i.e. hsa-miR-155 in human vs mmu-miR-155 in mouse. Paralogs that differ in one or two nucleotides in the mature sequence are given a lettered suffix after the nu merical identifier, such as members of let7 family. Distinct hairpin stru ctures from different loci in the genome giving rise to the same mature miRNA are given a numbered suffix, i.e. miR-199a-1 and miR-199a-2. Some hairpins will give rise to two equally stable mature miRNAs, and these are given the suffix -5p from the 5’ arm or -3p from th e 3’ arm, otherwise th e unstable strand will receive a notation after th e numerical identifier (2). MicroRNA and Cancer: The miRNA paradigm shifted from worm development to cancer when Calin et al. identified miR-15 and miR-16 as tumor suppressors at 13q14 in chronic lymphocytic leukemia in 2002 (14). It has been shown that hemizygous or homozygous loss of 13q14 occurs in more than 50% in B-CLL, man tle cell lymphoma, and prostate cancers, and only slightly lower in multiple myeloma; howev er, detailed genetic analysis of traditional genes located in this region yielded inc onclusive evidence. The discovery miRNA prompted Calin et al. to revisit informati on coded within this re gion. They discovered

PAGE 34

21 the genetic code for two miRNAs, miR-15 and miR-16, are indeed located in this area and hypothesized that deletion of 13q14 resu lts in loss of miR-15 and miR-16 expressions. This was confirmed when anal ysis showed 68% of the B-CLL patient RNA do not express these two miRNAs (14). Shortly after, Michael et al. showed a similar reduced expression of mature miR-143 and miR-145 in colorectal cancer (90); and Metzler et al. showed an accumulation of miR-155 in Burkitt Lymphoma (89), a trend repeated in other types of B cell lymphoma including diffuse large B cell lymphoma (31). In 2004, Takamizawa et al. showed that let-7 lost in lung cancer, in additio n to a direct correlation to postoperative survival. They also found that overexpression of exogenous let-7 in lung cancer cell lines leads to growth inhibition (119). Then Johnson et al. published “RAS is regulated by the let7 microRNA family,” to complement Takamizawa’s findings by demonstrating that let-7 is indeed a pr obable tumor suppressor by targeting oncogenic RAS (55). These landmark studies have established the importance of miRNAs in cancer, leading to an exponential growth in miRNA cancer research. MicroRNA-155: Accumulated evidence strongly sugge sts that miR-155 is oncogenic and frequently up regulated in various types of human malignancy, incl uding different forms of B cell lymphoma and carcinoma of breast, lung, colon, head/neck, and kidney (23, 31, 53, 60, 77, 128, 130). Furthermore, several studie s associate elevated miR-155 with late stage and poor overall surviv al in several types of cancer (43, 98, 135). Further, a possible link between miR-155 and inflamma tion in cancer has been reported (117).

PAGE 35

22 Moreover, miR-155 transgenic mice develop B-cell lymphoma (26), and miR-155-knockout mice exhibit impaired immune function (121 ). To date, the majority of validated miR-155 functional biology and pr otein targets define the importance of miR-155 in immunology (19, 29, 81, 95, 120, 121) and variou s forms of lymphoma (31, 60, 94, 97) and breast cancer (53, 61, 128). Beyond cancer, miR-155 is an essentia l regulator of cellular physiology, particularly important in the mammalian im mune system (19, 95, 121). For instance, miR-155 is detected during an immune respons e in activated mature B and T lymphocyte (124), germinal centers B cells (121), a nd monocytes (117). BIC/miR-155 knock-out mice results in impaired immune response a nd cytokine production (121), an observation that further support the vita l role of miR-155 in im munology. In addition, Down syndrome or trisomy 21 is linked with miR155 up regulation and thus provides possible cause of the resulting cognitive impairment a nd congenital heart defects seen in patients (64), indicating much work remains to better understand the role miR-155 play in human development and physiology. Finally, a number of miR-155 protein targets involved in processes ranging from immune response, inflammation, and cell grow th/survival have been identified. The transcription factors Pu1 and inositol phosphata se SHIP1 have been validated previously as direct targets of the miR-155-mediated immunoresponse (94, 127). BACH1 and ZIC3 are targeted by miR-155 and mediate miR-155 function in viral infection (41, 114). Moreover, miR-155 represses tumor protein 53-induced nuclear protein 1 (TP53NP1), leading to pancreatic tumor development (39). In addition, two studies using gene expression microarray analyses have show n that miR-155 and its viral orthologue

PAGE 36

23 Kaposi’s sarcoma-associated herpesvirus mi RK12– 11 negatively regulate more than 180 mRNAs, some of which encode proteins i nvolved in cell growth and survival, including PCSK5 and Rho GTPase-activ ating protein 21 (41, 106, 114). Central Hypothesis: MicroRNA plays a critical role in breast cancer metastasis and chemoresistance. Objectives: 1) Determine the role of TGF -regulated microRNA, especially miR-155, in EMT and breast cancer cell migration, invasion and metastasis. 2) Characterize miR-155 regula tion of cell survival, growth and chemosensitivity in breast cancer. 3) Ascertain miR-155 as a valu able marker in breast cancer. References: 1. 1998. Herceptin : new treatment and new questions. Tecnologica:15-6. 2. Ambros, V., B. Bartel, D. P. Bartel, C. B. Burge, J. C. Carrington, X. Chen, G. Dreyfuss, S. R. Eddy, S. Griffiths-Jone s, M. Marshall, M. Matzke, G. Ruvkun, and T. Tuschl. 2003. A uniform system for microRNA annotation. RNA 9:277-9. 3. Anders, C., and L. A. Carey. 2008. Unde rstanding and treati ng triple-negative breast cancer. Oncology (Williston Park) 22:1233-9; discussion 1239-40, 1243. 4. Anders, C. K., and L. A. Carey. 2009. Bi ology, metastatic patterns, and treatment of patients with trip le-negative breast can cer. Clin Breast Cancer 9 Suppl 2:S7381. 5. Asangani, I. A., S. A. Rasheed, D. A. Nikolova, J. H. Leupold, N. H. Colburn, S. Post, and H. Allgayer. 2008. MicroRNA21 (miR-21) post-transcriptionally downregulates tumor suppressor Pdcd4 a nd stimulates invasion, intravasation and metastasis in colorectal cancer. Oncogene 27:2128-36.

PAGE 37

24 6. Barna, B. P., and S. D. Deodhar. 19 78. Immunology, tumor markers, and breast cancer. Surg Clin North Am 58:693-704. 7. Bartsch, R., R. Ziebermayr, C. C. Zie linski, and G. G. Steger. 2010. Triplenegative breast cancer. Wien Med Wochenschr 160:174-81. 8. Basaran, G., C. Devrim, H. B. Caglar, B. Gulluoglu, H. Kaya, S. Seber, T. Korkmaz, F. Telli, M. Kocak, F. Dane, F. P. Yumuk, and S. N. Turhal. 2010. Clinical outcome of breast cancer patie nts with N3a (>/=10 positive lymph nodes) disease: has it changed ov er years? Med Oncol. 9. Baselga, J., L. Norton, J. Albane ll, Y. M. Kim, and J. Mendelsohn. 1998. Recombinant humanized anti-HER2 anti body (Herceptin) enhances the antitumor activity of paclitaxel and doxorubicin against HER2/neu overexpressing human breast cancer xenografts. Cancer Res 58:2825-31. 10. Baskerville, S., and D. P. Bartel. 2005. Microarray profiling of microRNAs reveals frequent coexpression with ne ighboring miRNAs and host genes. RNA 11:241-7. 11. Basyuk, E., F. Suavet, A. Doglio, R. Bordonne, and E. Bertrand. 2003. Human let-7 stem-loop precursors harbor feat ures of RNase III cleavage products. Nucleic Acids Res 31:6593-7. 12. Beuvink, I., F. A. Kolb, W. Budach, A. Ga rnier, J. Lange, F. Natt, U. Dengler, J. Hall, W. Filipowicz, and J. Weiler. 2007. A novel microarray approach reveals new tissue-specific signatures of know n and predicted mammalian microRNAs. Nucleic Acids Res 35:e52. 13. Bosch, A., P. Eroles, R. Zaragoza, J. R. Vina, and A. Lluch. 2010. Triple-negative breast cancer: molecular features, pathoge nesis, treatment and current lines of research. Cancer Treat Rev 36:206-15. 14. Calin, G. A., C. D. Dumitru, M. Shimizu, R. Bichi, S. Zupo, E. Noch, H. Aldler, S. Rattan, M. Keating, K. Rai, L. Rassenti, T. Kipps, M. Negrini, F. Bullrich, and C. M. Croce. 2002. Frequent deletions and down-regulation of microRNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc Natl Acad Sci U S A 99:15524-9. 15. Carey, L. A., E. C. Dees, L. Sawyer, L. Gatti, D. T. Moore, F. Collichio, D. W. Ollila, C. I. Sartor, M. L. Graham, and C. M. Perou. 2007. The triple negative paradox: primary tumor chemosensitivity of breast cancer subtypes. Clin Cancer Res 13:2329-34.

PAGE 38

25 16. Carotenuto, P., C. Roma, A. M. Rach iglio, G. Botti, A. D'Alessio, and N. Normanno. 2010. Triple negative breast cancer: from molecular portrait to therapeutic intervention. Crit Re v Eukaryot Gene Expr 20:17-34. 17. Castoldi, M., S. Schmidt, V. Benes, M. W. Hentze, and M. U. Muckenthaler. 2008. miChip: an array-based method for microRNA expression profiling using locked nucleic acid capture probes. Nat Protoc 3:321-9. 18. Castoldi, M., S. Schmidt, V. Benes, M. Noerholm, A. E. Kulozik, M. W. Hentze, and M. U. Muckenthaler. 2006. A sens itive array for microRNA expression profiling (miChip) based on locked nucleic acids (LNA). RNA 12:913-20. 19. Ceppi, M., P. M. Pereira, I. Dunand-Saut hier, E. Barras, W. Reith, M. A. Santos, and P. Pierre. 2009. MicroRNA-155 modul ates the interleukin-1 signaling pathway in activated human monocyte-derived dendritic ce lls. Proc Natl Acad Sci U S A 106:2735-40. 20. Chalfie, M., H. R. Horvitz, and J. E. Sulston. 1981. Mutations that lead to reiterations in the cell lineages of C. elegans. Cell 24:59-69. 21. Chen, C., D. A. Ridzon, A. J. Broomer, Z. Zhou, D. H. Lee, J. T. Nguyen, M. Barbisin, N. L. Xu, V. R. Mahuvakar, M. R. Andersen, K. Q. Lao, K. J. Livak, and K. J. Guegler. 2005. Real-time qua ntification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res 33:e179. 22. Chen, C. Z., L. Li, H. F. Lodish, and D. P. Bartel. 2004. MicroRNAs modulate hematopoietic lineage differentiation. Science 303:83-6. 23. Chen, H. C., G. H. Chen, Y. H. Chen, W. L. Liao, C. Y. Liu, K. P. Chang, Y. S. Chang, and S. J. Chen. 2009. MicroRNA dere gulation and pathway alterations in nasopharyngeal carcinoma. Br J Cancer 100:1002-11. 24. Clark, G. M., and W. L. McGuir e. 1991. Follow-up study of HER-2/neu amplification in primary breas t cancer. Cancer Res 51:944-8. 25. Clark, G. M., and W. L. McGuire. 1983. Progesterone receptors and human breast cancer. Breast Cancer Res Treat 3:157-63. 26. Costinean, S., N. Zanesi, Y. Pekarsky, E. Tili, S. Volinia, N. Heerema, and C. M. Croce. 2006. Pre-B cell proliferation and lymphoblastic leukemia/high-grade lymphoma in E(mu)-miR155 transgenic mice. Proc Natl Acad Sci U S A 103:7024-9.

PAGE 39

26 27. Cummins, J. M., Y. He, R. J. Leary, R. Pagliarini, L. A. Diaz, Jr., T. Sjoblom, O. Barad, Z. Bentwich, A. E. Szafranska, E. Labourier, C. K. Raymond, B. S. Roberts, H. Juhl, K. W. Kinzler, B. Vogelstein, and V. E. Velculescu. 2006. The colorectal microRNAome. Proc Natl Acad Sci U S A 103:3687-92. 28. Doench, J. G., C. P. Petersen, and P. A. Sharp. 2003. siRNAs can function as miRNAs. Genes Dev 17:438-42. 29. Dorsett, Y., K. M. McBride, M. Jankovi c, A. Gazumyan, T. H. Thai, D. F. Robbiani, M. Di Virgilio, B. R. San-Mar tin, G. Heidkamp, T. A. Schwickert, T. Eisenreich, K. Rajewsky, and M. C. Nussenzweig. 2008. MicroRNA-155 suppresses activation-induced cytid ine deaminase-mediated Myc-Igh translocation. Immunity 28:630-8. 30. Ehrenfeld, E., and T. Hunt. 1971. Doubl e-stranded poliovirus RNA inhibits initiation of protein synthesis by reticulo cyte lysates. Proc Natl Acad Sci U S A 68:1075-8. 31. Eis, P. S., W. Tam, L. Sun, A. Chadburn, Z. Li, M. F. Gomez, E. Lund, and J. E. Dahlberg. 2005. Accumulation of mi R-155 and BIC RNA in human B cell lymphomas. Proc Natl Acad Sci U S A 102:3627-32. 32. Elbashir, S. M., W. Lendeckel, and T. Tuschl. 2001. RNA interference is mediated by 21and 22-nucleotide RNAs. Genes Dev 15:188-200. 33. Elbashir, S. M., J. Martinez, A. Patkan iowska, W. Lendeckel, and T. Tuschl. 2001. Functional anatomy of siRNAs for medi ating efficient RNAi in Drosophila melanogaster embryo lysate. EMBO J 20:6877-88. 34. Fabbri, M., R. Garzon, A. Cimmino, Z. Liu, N. Zanesi, E. Callegari, S. Liu, H. Alder, S. Costinean, C. Fernandez-Cy mering, S. Volinia, G. Guler, C. D. Morrison, K. K. Chan, G. Marcucci, G. A. Calin, K. Huebner, and C. M. Croce. 2007. MicroRNA-29 family reverts aberra nt methylation in lung cancer by targeting DNA methyltransferases 3A and 3B. Proc Natl Acad Sci U S A 104:15805-10. 35. Fan, Y., X. Chen, A. D. Trigg, C. H. Tung, J. Kong, and Z. Gao. 2007. Detection of MicroRNAs using target-guided forma tion of conducting polymer nanowires in nanogaps. J Am Chem Soc 129:5437-43. 36. Fang, S., H. J. Lee, A. W. Wark, a nd R. M. Corn. 2006. Attomole microarray detection of microRNAs by nanoparticleamplified SPR imaging measurements of surface polyadenylation reactions. J Am Chem Soc 128:14044-6.

PAGE 40

27 37. Frankel, L. B., N. R. Christoffersen, A. Jacobsen, M. Lindow, A. Krogh, and A. H. Lund. 2008. Programmed cell death 4 (PDCD4) is an important functional target of the microRNA miR-21 in breast can cer cells. J Biol Chem 283:1026-33. 38. Galea, M. H., and R. W. Blamey. 1993. Comment on 'Predicting recurrence in axillary node negative breast cancer patient s', by Rosner and Lane. Breast Cancer Res Treat 28:299-300. 39. Gironella, M., M. Seux, M. J. Xie, C. Cano, R. Tomasini J. Gommeaux, S. Garcia, J. Nowak, M. L. Yeung, K. T. Jea ng, A. Chaix, L. Fazli, Y. Motoo, Q. Wang, P. Rocchi, A. Russo, M. Gleave, J. C. Dagorn, J. L. Iovanna, A. Carrier, M. J. Pebusque, and N. J. Dusetti. 2007. Tumo r protein 53-induced nuclear protein 1 expression is repressed by miR-155, and its restoration inhibits pancreatic tumor development. Proc Natl Acad Sci U S A 104:16170-5. 40. Goff, L. A., M. Yang, J. Bowers, R. C. Getts, R. W. Padgett, and R. P. Hart. 2005. Rational probe optimization and enhan ced detection strategy for microRNAs using microarrays. RNA Biol 2:93-100. 41. Gottwein, E., N. Mukherjee, C. Sachse, C. Frenzel, W. H. Majoros, J. T. Chi, R. Braich, M. Manoharan, J. Soutschek, U. Ohler, and B. R. Cullen. 2007. A viral microRNA functions as an orthologue of cellular miR-155. Nature 450:1096-9. 42. Graziano, C. 1998. HER-2 breast assay, linked to Herceptin, wins FDA's okay. CAP Today 12:1, 14-6. 43. Greither, T., L. F. Grochola, A. Udel now, C. Lautenschlager, P. Wurl, and H. Taubert. 2010. Elevated expression of microRNAs 155, 203, 210 and 222 in pancreatic tumors is associated with poorer survival. In t J Cancer 126:73-80. 44. Grishok, A., A. E. Pasquinelli, D. Conte, N. Li, S. Parrish, I. Ha D. L. Baillie, A. Fire, G. Ruvkun, and C. C. Mello. 2001. Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell 106:23-34. 45. Haffty, B. G., Q. Yang, M. Reiss, T. Kearney, S. A. Higgins, J. Weidhaas, L. Harris, W. Hait, and D. Toppmeyer. 2006. Locoregional re lapse and distant metastasis in conservatively managed triple negative early-stage breast cancer. J Clin Oncol 24:5652-7. 46. Hammond, S. M., E. Bernstein, D. Beach, and G. J. Hannon. 2000. An RNAdirected nuclease mediates pos t-transcriptional ge ne silencing in Drosophila cells. Nature 404:293-6. 47. Hawkins, R. A., M. M. Roberts, and A. P. Forrest. 1980. Oestrogen receptors and breast cancer: current stat us. Br J Surg 67:153-69.

PAGE 41

28 48. Hutter, R. V. 1984. Pathological paramete rs useful in predicting prognosis for patients with breast cancer Monogr Pathol:175-85. 49. Hutvagner, G., J. McLachlan, A. E. Pas quinelli, E. Balint, T. Tuschl, and P. D. Zamore. 2001. A cellular function for the RNA-interference enzy me Dicer in the maturation of the let-7 small temporal RNA. Science 293:834-8. 50. Hutvagner, G., and P. D. Zamore. 2002. A microRNA in a multiple-turnover RNAi enzyme complex. Science 297:2056-60. 51. Ikeda, S., S. W. Kong, J. Lu, E. Bispi ng, H. Zhang, P. D. A llen, T. R. Golub, B. Pieske, and W. T. Pu. 2007. Altered microRNA expression in human heart disease. Physiol Genomics 31:367-73. 52. Iorio, M. V., M. Ferracin, C. G. Liu, A. Veronese, R. Spizzo, S. Sabbioni, E. Magri, M. Pedriali, M. Fabbri, M. Ca mpiglio, S. Menard, J. P. Palazzo, A. Rosenberg, P. Musiani, S. Volinia, I. Nenci, G. A. Calin, P. Querzoli, M. Negrini, and C. M. Croce. 2005. MicroRNA gene e xpression deregulation in human breast cancer. Cancer Res 65:7065-70. 53. Irvin, W. J., Jr., and L. A. Carey. 2008. Wh at is triple-negat ive breast cancer? Eur J Cancer 44:2799-805. 54. Johnson, S. M., H. Grosshans, J. Shinga ra, M. Byrom, R. Jarvis, A. Cheng, E. Labourier, K. L. Reinert, D. Brown, and F. J. Slack. 2005. RAS is regulated by the let-7 microRNA family. Cell 120:635-47. 55. Johnson, S. M., S. Y. Lin, and F. J. Sl ack. 2003. The time of appearance of the C. elegans let-7 microRNA is transcripti onally controlled utilizing a temporal regulatory element in its promoter. Dev Biol 259:364-79. 56. Johnston, R. J., and O. Hobert. 2003. A microRNA controlling left/right neuronal asymmetry in Caenorhabditis elegans. Nature 426:845-9. 57. Ketting, R. F., S. E. Fischer, E. Bern stein, T. Sijen, G. J. Hannon, and R. H. Plasterk. 2001. Dicer functi ons in RNA interference a nd in synthesis of small RNA involved in developmental timing in C. elegans. Genes Dev 15:2654-9. 58. Klijn, J. G., P. M. Berns, P. I. Schmitz, and J. A. Foekens. 1992. The clinical significance of epidermal growth factor receptor (EGF-R) in human breast cancer: a review on 5232 patients. Endocr Rev 13:3-17.

PAGE 42

29 59. Kluiver, J., S. Poppema, D. de Jong, T. Blokzijl, G. Harms, S. Jacobs, B. J. Kroesen, and A. van den Berg. 2005. BIC and miR-155 are highly expressed in Hodgkin, primary mediastinal and diffuse large B cell lym phomas. J Pathol 207:243-9. 60. Kong, W., H. Yang, L. He, J. J. Zhao, D. Coppola, W. S. Dalton, and J. Q. Cheng. 2008. MicroRNA-155 is regulated by the tr ansforming growth factor beta/Smad pathway and contributes to epithelial cell plasticity by targe ting RhoA. Mol Cell Biol 28:6773-84. 61. Krichevsky, A. M. 2007. MicroRNA profili ng: from dark matter to white matter, or identifying new players in neur obiology. ScientificWorldJournal 7:155-66. 62. Krichevsky, A. M., K. S. King, C. P. Donahue, K. Khrapko, and K. S. Kosik. 2003. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA 9:1274-81. 63. Kuhn, D. E., G. J. Nuovo, M. M. Martin, G. E. Malana, A. P. Plei ster, J. Jiang, T. D. Schmittgen, A. V. Terry, Jr., K. Gardiner, E. Head, D. S. Feldman, and T. S. Elton. 2008. Human chromosome 21-derived miRNAs are overexpressed in down syndrome brains and hearts. Bioc hem Biophys Res Co mmun 370:473-7. 64. Kuru, B. 2006. Prognostic significance of total number of nodes removed, negative nodes removed, and ratio of positive nodes to re moved nodes in node positive breast carcinoma. Eur J Surg Oncol 32:1082-8. 65. Lagos-Quintana, M., R. Rauhut, W. Lendeckel, and T. Tuschl. 2001. Identification of novel genes coding fo r small expressed RNAs. Science 294:8538. 66. Lau, N. C., L. P. Lim, E. G. Weinstei n, and D. P. Bartel. 2001. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294:858-62. 67. Lee, R. C., and V. Ambros. 2001. An extensive class of small RNAs in Caenorhabditis elegans. Science 294:862-4. 68. Lee, R. C., R. L. Feinbaum, and V. Ambros. 1993. The C. elegans heterochronic gene lin-4 encodes small RNAs with an tisense complementar ity to lin-14. Cell 75:843-54. 69. Lee, Y., C. Ahn, J. Han, H. Choi, J. Kim, J. Yim, J. Lee, P. Provost, O. Radmark, S. Kim, and V. N. Kim. 2003. The nuclear RNase III Drosha initiates microRNA processing. Nature 425:415-9.

PAGE 43

30 70. Lee, Y., K. Jeon, J. T. Lee, S. Kim, and V. N. Kim. 2002. MicroRNA maturation: stepwise processing and subcellu lar localization. EMBO J 21:4663-70. 71. Leong, A. S., and W. A. Raymond. 1989. Prognos tic parameters in breast cancer. Pathology 21:169-75. 72. Lim, C. Y., B. Santoso, T. Boulay, E. Dong, U. Ohler, and J. T. Kadonaga. 2004. The MTE, a new core promoter element for transcription by RNA polymerase II. Genes Dev 18:1606-17. 73. Liu, C. G., G. A. Calin, B. Meloon, N. Ga mliel, C. Sevignani, M. Ferracin, C. D. Dumitru, M. Shimizu, S. Zupo, M. Dono, H. Alder, F. Bullrich, M. Negrini, and C. M. Croce. 2004. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc Natl Acad Sci U S A 101:9740-4. 74. Liu, C. G., R. Spizzo, G. A. Calin, and C. M. Croce. 2008. Expression profiling of microRNA using oligo DNA a rrays. Methods 44:22-30. 75. Liu, X., Z. Chen, J. Yu, J. Xia, a nd X. Zhou. 2009. MicroR NA Profiling and Head and Neck Cancer. Comp Funct Genomics:837514. 76. Lu, J., G. Getz, E. A. Miska, E. Alva rez-Saavedra, J. Lamb, D. Peck, A. SweetCordero, B. L. Ebert, R. H. Mak, A. A. Ferrando, J. R. Downing, T. Jacks, H. R. Horvitz, and T. R. Golub. 2005. MicroRNA expression profiles classify human cancers. Nature 435:834-8. 77. Lund, E., S. Guttinger, A. Calado, J. E. Dahlberg, and U. Kutay. 2004. Nuclear export of microRNA precursors. Science 303:95-8. 78. Makeyev, E. V., J. Zhang, M. A. Carrasco, and T. Maniatis. 2007. The MicroRNA miR-124 promotes neuronal di fferentiation by triggering brainspecific alternative pre-mRNA splicing. Mol Cell 27:435-48. 79. Martin, M. M., E. J. Lee, J. A. Buckenbe rger, T. D. Schmittgen, and T. S. Elton. 2006. MicroRNA-155 regulates human angiot ensin II type 1 receptor expression in fibroblasts. J Biol Chem 281:18277-84. 80. Martinez, J., A. Patkaniowska, H. Urlaub, R. Luhrmann, and T. Tuschl. 2002. Single-stranded antisense siRNAs guide target RNA cleavage in RNAi. Cell 110:563-74. 81. McGahan, L. 1998. Herceptin (R): monoc lonal antibody therapy for metastatic breast cancer. Issues Em erg Health Technol:1-4.

PAGE 44

31 82. McGuire, W. L., and G. M. Clark. 1983. Progesterone receptors and human breast cancer; 'Wassink lecture' presented at the 3rd EORTC Breast Cancer Working Conference. Eur J Cancer Clin Oncol 19:1681-5. 83. McGuire, W. L., and G. M. Clark. 1983. The prognostic role of progesterone receptors in human breast can cer. Semin Oncol 10:2-6. 84. McGuire, W. L., K. B. Horwitz, D. T. Zava, R. E. Garola, and G. C. Chamness. 1978. Hormones in breast cancer: update 1978. Metabolism 27:487-501. 85. Medina, R., S. K. Zaidi, C. G. Liu, J. L. Stein, A. J. van Wijnen, C. M. Croce, and G. S. Stein. 2008. MicroRNAs 221 and 222 bypass quiescence and compromise cell survival. Cancer Res 68:2773-80. 86. Metzler, M., M. Wilda, K. Busch, S. Viehmann, and A. Borkhardt. 2004. High expression of precursor microRNA-155/ BIC RNA in children with Burkitt lymphoma. Genes Chromosomes Cancer 39:167-9. 87. Michael, M. Z., O. C. SM, N. G. van Holst Pellekaan, G. P. Young, and R. J. James. 2003. Reduced accumulation of specific microRNAs in colorectal neoplasia. Mol Cancer Res 1:882-91. 88. Nelson, P. T., D. A. Baldwin, L. M. Scear ce, J. C. Oberholtzer, J. W. Tobias, and Z. Mourelatos. 2004. Microarray-bas ed, high-throughput gene expression profiling of microRNAs. Nat Methods 1:155-61. 89. Nykanen, A., B. Haley, and P. D. Za more. 2001. ATP requirements and small interfering RNA structure in the R NA interference pathway. Cell 107:309-21. 90. O'Connell, R. M., A. A. Chaudhuri, D. S. Rao, and D. Baltimore. 2009. Inositol phosphatase SHIP1 is a primary target of miR-155. Proc Natl Acad Sci U S A 106:7113-8. 91. O'Connell, R. M., K. D. Taganov, M. P. Boldin, G. Cheng, and D. Baltimore. 2007. MicroRNA-155 is induced during the macrophage inflammatory response. Proc Natl Acad Sci U S A 104:1604-9. 92. Pasquinelli, A. E., B. J. Reinhart, F. Slack, M. Q. Martindale, M. I. Kuroda, B. Maller, D. C. Hayward, E. E. Ball, B. Degnan, P. Muller, J. Spring, A. Srinivasan, M. Fishman, J. Finnerty, J. Corbo, M. Levine, P. Leahy, E. Davidson, and G. Ruvkun. 2000. Conservation of the sequence a nd temporal expression of let-7 heterochronic regulatory RNA. Nature 408:86-9.

PAGE 45

32 93. Pedersen, I. M., D. Otero, E. Kao, A. V. Miletic, C. Hother, E. Ralfkiaer, R. C. Rickert, K. Gronbaek, and M. David. 2009. Onco-miR-155 targets SHIP1 to promote TNFalpha-dependent growth of B cell lymphomas. EMBO Mol Med 1:288-95. 94. Raponi, M., L. Dossey, T. Jatkoe, X. Wu, G. Chen, H. Fan, and D. G. Beer. 2009. MicroRNA classifiers for predicting prognos is of squamous cell lung cancer. Cancer Res 69:5776-83. 95. Reinhart, B. J., F. J. Slack, M. Basson, A. E. Pasquinelli, J. C. Bettinger, A. E. Rougvie, H. R. Horvitz, and G. Ruvkun. 2000. The 21-nucleotide let-7 RNA regulates developmental timing in Cae norhabditis elegans. Nature 403:901-6. 96. Reiss, M. 1989. Prognostic factors in pr imary breast cancer Conn Med 53:565-71. 97. Rodriguez, A., S. Griffiths-Jones, J. L. Ashurst, and A. Bradley. 2004. Identification of mammalian microRNA host genes and transcription units. Genome Res 14:1902-10. 98. Rosner, D., and W. W. Lane. 1993. Pr edicting recurrence in axillary-node negative breast cancer patients. Br east Cancer Res Treat 25:127-39. 99. Roux-Dosseto, M., S. Romain, N. Dussau lt, and P. M. Martin. 1989. Correlation of erbB-2 gene amplification with low levels of estrogen and/or progesterone receptors in primary breast cancer: do erbB-2 products delineate hormoneindependent tumors? Biomed Pharmacother 43:641-9. 100. Saez, R. A., W. L. McGuire, and G. M. Clark. 1989. Prognostic factors in breast cancer. Semin Surg Oncol 5:102-10. 101. Saito, Y., G. Liang, G. Egger, J. M. Frie dman, J. C. Chuang, G. A. Coetzee, and P. A. Jones. 2006. Specific activation of microRNA-127 with downregulation of the proto-oncogene BCL6 by chromatin-modifying drugs in human cancer cells. Cancer Cell 9:435-43. 102. Samols, M. A., R. L. Skalsky, A. M. Maldonado, A. Riva, M. C. Lopez, H. V. Baker, and R. Renne. 2007. Identification of cellular genes targeted by KSHVencoded microRNAs. PLoS Pathog 3:e65. 103. Schmittgen, T. D., J. Jiang, Q. Liu, and L. Yang. 2004. A high-throughput method to monitor the expression of microRNA precursors. Nucleic Acids Res 32:e43. 104. Schmittgen, T. D., E. J. Lee, J. Jiang, A. Sarkar, L. Yang, T. S. Elton, and C. Chen. 2008. Real-time PCR quantification of precursor and mature microRNA. Methods 44:31-8.

PAGE 46

33 105. Schratt, G. M., F. Tuebing, E. A. Nigh, C. G. Kane, M. E. Sa batini, M. Kiebler, and M. E. Greenberg. 2006. A brain-speci fic microRNA regulates dendritic spine development. Nature 439:283-9. 106. Schwarz, D. S., G. Hutvagner, B. Haley, and P. D. Zamore. 2002. Evidence that siRNAs function as guides, not primers, in the Drosophila and human RNAi pathways. Mol Cell 10:537-48. 107. Seshadri, R., F. A. Firgaira, D. J. Horsfa ll, K. McCaul, V. Setlur, and P. Kitchen. 1993. Clinical significance of HER-2/ne u oncogene amplification in primary breast cancer. The South Australian Breast Cancer Study Group. J Clin Oncol 11:1936-42. 108. Seshadri, R., C. Matthews, A. D obrovic, and D. J. Horsfall. 1989. The significance of oncogene amplification in primary breast cancer. Int J Cancer 43:270-2. 109. Shi, R., and V. L. Chiang. 2005. F acile means for quantifying microRNA expression by real-time PCR. Biotechniques 39:519-25. 110. Skalsky, R. L., M. A. Samols, K. B. Plaisa nce, I. W. Boss, A. Riva, M. C. Lopez, H. V. Baker, and R. Renne. 2007. Kaposi's sarcoma-associated herpesvirus encodes an ortholog of miR-155. J Virol 81:12836-45. 111. Slack, F. J., M. Basson, Z. Liu, V. Am bros, H. R. Horvitz, and G. Ruvkun. 2000. The lin-41 RBCC gene acts in the C. eleg ans heterochronic pathway between the let-7 regulatory RNA and the LIN-29 transcription factor. Mol Cell 5:659-69. 112. Taganov, K. D., M. P. Boldin, K. J. Chang, and D. Baltimore. 2006. NF-kappaBdependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune respons es. Proc Natl Acad Sci U S A 103:12481-6. 113. Tai, P., E. Yu, and K. Joseph. 2010. Prognos tic significance of number of positive nodes: a long-term study of one to two node s versus three nodes in breast cancer patients. Int J Radiat On col Biol Phys 77:180-7. 114. Takamizawa, J., H. Konishi, K. Yanagisawa, S. Tomida, H. Osada, H. Endoh, T. Harano, Y. Yatabe, M. Nagino, Y. Nimura T. Mitsudomi, and T. Takahashi. 2004. Reduced expression of the let-7 microRNAs in human lung cancers in association with shortened postopera tive survival. Cancer Res 64:3753-6. 115. Teng, G., P. Hakimpour, P. Landgraf, A. Ri ce, T. Tuschl, R. Casellas, and F. N. Papavasiliou. 2008. MicroRNA-155 is a nega tive regulator of activation-induced cytidine deaminase. Immunity 28:621-9.

PAGE 47

34 116. Thai, T. H., D. P. Calado, S. Casola, K. M. Ansel, C. Xiao, Y. Xue, A. Murphy, D. Frendewey, D. Valenzuela, J. L. Kut ok, M. Schmidt-Supprian, N. Rajewsky, G. Yancopoulos, A. Rao, and K. Rajewsky. 2007. Regulation of the germinal center response by microRNA-155. Science 316:604-8. 117. To, K. K., Z. Zhan, T. Litman, and S. E. Bates. 2008. Regulation of ABCG2 expression at the 3' untranslated re gion of its mRNA through modulation of transcript stability and protein translation by a putative microRNA in the S1 colon cancer cell line. Mol Cell Biol 28:5147-61. 118. Toyama, T., H. Yamashita, N. Kondo, K. Okuda, S. Takahashi, H. Sasaki, H. Sugiura, H. Iwase, and Y. Fujii. 2008. Frequently increased epidermal growth factor receptor (EGFR) copy numbers and decreased BRCA1 mRNA expression in Japanese triple-negative br east cancers. BMC Cancer 8:309. 119. Turner, M., and E. Vigorito. 2008. Regulati on of Band T-cell differentiation by a single microRNA. Biochem Soc Trans 36:531-3. 120. Valavaara, R., J. Tuominen, and R. Johansson. 1990. Predictive value of tumor estrogen and progesterone receptor levels in postmenopausal women with advanced breast cancer treated w ith toremifene. Cancer 66:2264-9. 121. Venkitaraman, R., T. Joseph, A. Dhadda A. Chaturvedi, and S. Upadhyay. 2009. Prognosis of patients with triple-negative breast cancer and brai n metastasis. Clin Oncol (R Coll Radiol) 21:729-30. 122. Vigorito, E., K. L. Perks, C. Abreu-G oodger, S. Bunting, Z. Xiang, S. Kohlhaas, P. P. Das, E. A. Miska, A. Rodriguez, A. Bradley, K. G. Smith, C. Rada, A. J. Enright, K. M. Toellner, I. C. Macl ennan, and M. Turner. 2007. microRNA-155 regulates the generation of immunoglobul in class-switched plasma cells. Immunity 27:847-59. 123. Volinia, S., G. A. Calin, C. G. Liu, S. Ambs, A. Cimmino, F. Petrocca, R. Visone, M. Iorio, C. Roldo, M. Ferracin, R. L. Prueit t, N. Yanaihara, G. Lanza, A. Scarpa, A. Vecchione, M. Negrini, C. C. Harris, and C. M. Croce. 2006. A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A 103:2257-61. 124. Wang, H., R. A. Ach, and B. Curry. 2007. Direct and sensitive miRNA profiling from low-input total RNA. RNA 13:151-9. 125. Wang, X., S. Tang, S. Y. Le, R. Lu, J. S. Rader, C. Meyers, and Z. M. Zheng. 2008. Aberrant expression of oncogenic and tumor-suppressive microRNAs in cervical cancer is requ ired for cancer cell grow th. PLoS One 3:e2557.

PAGE 48

35 126. Wightman, B., I. Ha, and G. Ruvkun. 1993. Po sttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell 75:855-62. 127. Wolff, A. C. 2005. Current status of taxa nes as adjuvant therapy for early-stage breast cancer. Int J Fert il Womens Med 50:227-9. 128. Woodward, W. A., V. Vinh-Hung, N. T. Ueno, Y. C. Cheng, M. Royce, P. Tai, G. Vlastos, A. M. Wallace, G. N. Hort obagyi, and Y. Nieto. 2006. Prognostic value of nodal ratios in node-positive breast cancer. J Clin Oncol 24:2910-6. 129. Xu, P., S. Y. Vernooy, M. Guo, and B. A. Hay. 2003. The Drosophila microRNA Mir-14 suppresses cell death and is require d for normal fat metabolism. Curr Biol 13:790-5. 130. Yanaihara, N., N. Caplen, E. Bowman, M. Seike, K. Kumamoto, M. Yi, R. M. Stephens, A. Okamoto, J. Yokota, T. Tanaka G. A. Calin, C. G. Liu, C. M. Croce, and C. C. Harris. 2006. Unique microR NA molecular profiles in lung cancer diagnosis and prognosis. Cancer Cell 9:189-98. 131. Yang, H., W. Kong, L. He, J. J. Zhao, J. D. O'Donnell, J. Wang, R. M. Wenham, D. Coppola, P. A. Kruk, S. V. Ni cosia, and J. Q. Cheng. 2008. MicroRNA expression profiling in human ovarian can cer: miR-214 induces cell survival and cisplatin resistance by targeti ng PTEN. Cancer Res 68:425-33. 132. Yi, R., Y. Qin, I. G. Macara, and B. R. Cullen. 2003. Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes Dev 17:3011-6. 133. Young, S. R., R. T. Pilarski, T. Donenbe rg, C. Shapiro, L. S. Hammond, J. Miller, K. A. Brooks, S. Cohen, B. Tenenholz, D. Desai, I. Zandvakili, R. Royer, S. Li, and S. A. Narod. 2009. The preval ence of BRCA1 mutations among young women with triple-negative br east cancer. BMC Cancer 9:86. 134. Zeng, Y., E. J. Wagner, and B. R. Cu llen. 2002. Both natural and designed micro RNAs can inhibit the expression of c ognate mRNAs when expressed in human cells. Mol Cell 9:1327-33. 135. Zeng, Y., R. Yi, and B. R. Cullen. 2003. MicroRNAs and small interfering RNAs can inhibit mRNA expression by similar mechanisms. Proc Natl Acad Sci U S A 100:9779-84. 136. Ziegler, L. D., and A. U. Buzdar. 1991. Curre nt status of adjuvant therapy of early breast cancer. Am J Clin Oncol 14:101-10.

PAGE 49

36 CHAPTER II MICRORNA-155 IS RE GULATED BY TGF /SMAD PATHWAY AND CONTRIBUTES TO EPITHELIAL CELL PLASTICITY BY TARGETING RHOA Abstract: TGF signaling facilitates metastasis in advanced malignancy. While a number of protein-coding genes are known to be involved in this process, the role of miRNAs in TGF -induced cell migration and invasion is still limited. By hybr idizing a 515 miRNA oligo based microarray library a total of 28 miRNAs were found to be significantly deregulated in TGF -treated NMuMG but not Sm ad4-knockdown-NMuMG cells. Among upregulated miRNAs, miR-155 is the most significantly elevated miRNA. TGF induces miR-155 expression and promot er activity through Smad4. Knockdown of miR-155 suppressed TGF -induced EMT and tight-junction dissolution as well as cell migration and invasion. Further, ectopic expression of miR-155 reduced RhoA protein and disrupted tight junction formation. Reintroducing RhoA cDNA without 3’UTR largely rescued the phenotype induced by miR-155 and TGF In addition, elevated levels of miR-155 were frequen tly detected in invasive breas t cancer. These data suggest that miR-155 could play an important role in TGF -induced EMT, cell migration and invasion by targeting RhoA and serves as pot ential therapeutic target for breast cancer intervention.

PAGE 50

37 Introduction: Metastasis accounts for the majority of death in cancer patients, and thus it is crucial to understand the molecular and cellular mechanism that cause primary tumor to metastasize. The most critical step in c onversion of primary tumors to metastases is attributed to the process known as epithelia l-mesenchymal transition (EMT). EMT is a remarkable example of cellular plasticity that invol ves the dissolution of epithelial tight junctions, intonation of adhere n junctions, remodeling of th e cytoskeleton and loss of apical-basal polarity (49, 55). In cells undergoing EMT, the loss of epithelial cell adhesion and cytoskeletal components is coordinated with a gain of mesenchymal components and initiation of a migratory phenotype. Transforming growth factor (TGF ) has emerged as a key regulator of EMT in late-stage carcinomas, where it promotes invasion and metastasis (54). TGF binds to a heteromeric complex of transmembrane serine-threoni ne kinases, the type I and II TGF receptors (T RI and T RII). Following ligand binding to T RII, the type I receptor is recruited to the ligand-receptor complex, where the constitutively active T RII transactivates T RI. Activated T RI phosphorylates the receptor-specific Smad2 and Smad3. Phosphorylated Smad2/3 associates with Smad4 as a heteromeric complex and translocates to the nucleus. This complex binds directly to Smad -binding elements and associate with a plethora of transcription f actors, co-activators or co-repressors, thus leading to transcriptional i nduction or repression of a dive rse array of genes (54). A number of genes that are asso ciated with tumor growth and metastasis have been shown to be directly regulated by this pathway, which include induction of COX2, Slug, Snail and Twist and repression of Id2 and Id3 (54) Recent reports have shown the importance

PAGE 51

38 of microRNA (miR)-200 family down re gulation during EMT (2, 12, 21, 36), however, functions of up-regulat ed miRNAs during TGF induced EMT remain uncharacterized. MiRNAs are a class of 22-nt noncodi ng RNAs, which are evolutionarily conserved and function as negative regulators of gene expression. Like conventional protein-coding mRNA, miRNAs are transcri bed by RNA polymerase II and controlled by transcription factors (1, 9, 16, 38). The primary transcript (pri-miRNA) is capped and polyadenylated. The pri-miRNA is processe d by the nuclear RNaseIII Drosha and its cofactor DGCR8/Pasha to generate a precu rsor miRNA (pre-miRNA), a 60-70-nucleotide RNA that has a stem loop structure (3, 13, 15) The pre-miRNA is rapidly exported to the cytoplasm by exportin-5 in a Ran-GTPdependent manner, wh ere it is further processed by a second RNaseIII, Dicer, to release a mature ~22-nucleotide miRNA. Subsequently, the mature miRNA enters a RNA-induced silencing complex (RISC), guides RISC to regions of complementarity in the 3’untranslated region (UTR) of target mRNAs and triggers either th eir degradation or inhibition of translation, depending on degree of complementarity between miRNA and its target mRNA (24, 44). Based on prediction by publicly available algorithms each miRNA may have several hundreds to potentially thousands of target mRNA s (25, 32). miRNA profiling has shown deregulation of miRNAs in different type s of human malignancy, some of which are associated with late stage and high grade tu mors as well as poor prognosis (29, 34, 35), implying that miRNA could play a pivotal role in tumorigenesis and in tumor progression to metastasis. In the present study, we profiled the miRNA signature of EMT induced by TGF /Smad pathway in normal mouse mammary gl and epithelial cells (NMuMG). We

PAGE 52

39 further demonstrate that miR-155 is a dir ect transcriptional target of the TGF /Smad4 pathway and mediates TGF -induced EMT. Ectopic ex pression of miR-155 disrupts proper tight junction formation and promotes cell migration a nd invasion. Knockdown of mir-155 reduces TGF -induced EMT, cell migration and invasion. Moreover, RhoA is negatively regulated by miR155. Restoration of RhoA us ing an expression vector cloned without the 3’UTR rescued the effects of miR-155-induced phenotypes. Thus, we demonstrated for the first time that miR-155 is regulated by TGF /Smad pathway and plays a role in mammary epithelial ce ll plasticity through targeting RhoA. Materials and Methods: 1) Cell Line, Treatment and Tumor Specimens : Mouse mammary epithelial cell line NMuMG, cells were purchased from American Type Culture Collection (Manassas, VA). Stable Smad4-knockdown (pRetroSuper-Smad4shRNA) and pRetroSuper (pRS) vectortransfected (parental) NMuMG cells we re kindly provided by Peter ten Dijke (Leiden University Medical Center, the Netherlands (5). The cells were maintained in DMEM supplemented with 10% fetal bovine serum (FBS). Cells were treated with TGF at concentration 5 ng/ml for time points indica ted in the figure le gend. Cell transfection experiments were performed with Lipof ectamine 2000 (Invitrogen). Frozen human primary breast tumor and normal breast tissues were procured anonymously from patients who underwent surgery at H. Lee Moffitt Cancer Center, and each sample contains at least 70% tumor cells as confirmed by microscopi c examination of sections. The tissues were snap frozen, within 15 mi n. of accrual to prevent RNA de gradation, and stored at – 70C.

PAGE 53

40 2) MicroRNA Microarray, Nort hern, and qRT-PCR Analysis : Total RNA from cell lines, breast tumor and normal tissue was isolated using Trizol reag ent (Invitrogen). MicroRNA array profiling was performed as previously described (52). Briefly, oligonucleotide arrays were pr inted with tri-mer oligonucl eotide probes antisense to 515 miRNAs specific to human and mouse miRNAs on GeneScreen Plus (NEN) membranes. The miRNA expression profiling was performe d by hybridization of the array with [ -32P]ATP labeled small RNA probes prepared from TGF -treated and untreated NMuMG cells. To ensure accuracy of the hybridi zations, each experimental group was hybridized onto three separate membra nes. In addition, eight oligonucleotides wi th nonmatching any known miRNA were used as hybridization controls. Hybr idization signal s for each spot of the array and background values at 15 empty spots were measured. Raw data were further automatically pro cessed in Microsoft Excel. Hybridization signals that failed to exceed the average background value by more than three SDs were excluded from analysis. The data were normalized and uns upervised hierarchical clustering analysis with average linkage algorithms was performed with GeneCl uster. The results were visualized with TreeView. Differentially expressed miRNAs were identified by using the t test procedure within significance analysis of microarray. For Northern blot analysis, 20 g of RNA were separated on 15% denaturing polyacrylamide gel and then electroblotted onto a Zeta-Probe GT Blotting Membrane (Bio-Rad). Following transfer, the memb rane was dried and UV-cross linked. The probes were prepared using the Starfire O ligonucleotide Labeling System (Integrated DNA Technologies) according to the manufacturer’s protocol. The blots were hybridized overnight at 420C in a buffer containing 5 x SSC, 20 mM Na2HPO4 (pH 7.2), 7% SDS, 1

PAGE 54

41 x Denhardt’s, 0.2 mg/ml salmon sperm DNA, and then washed with 1X SSC/1 % SDS buffer at 420C (25). mirVana qRT-PCR was performed according to manufacturer’s instruction (Ambion) 3) Immunofluorescen ce and Immunoblotting For immunofluorescence, cells grown to 60-80% confluence were washed with PBS a nd fixed with 4% para formaldehyde. Cells were permeabilized with 0.5% Triton X-100 in PBS prior to the addition of primary and secondary antibodies. Visual ization of E-cadherin was pe rformed by staining with mouse-anti-E-cadherin (BD Transduction La bs) and then with TRITC conjugated goat secondary anti-mouse IgG (Sigma). Visua lization of ZO-1 was performed by staining with rabbit-anti-ZO-1 (34) a nd then with FITC conjugated go at secondary anti-rabbit IgG (Sigma). Fluorescence imaging was taken by confocal microscopy (Leica), and phase contrast imaging was taken by an inverted mi croscope (Nikon). I mmunoblotting analysis was carried out as prev iously described (52). 4) Isolation and Analys is of MiR-155 Promoter miR-155 is found within the BIC gene on chromosome 21 in human and chromosome 16 in mouse. The genomic structure of human BIC consists of three exons where exon 3 encodes miR-155 (8, 43). Based on transcription start s ite identified by other groups (33, 53), a 1.0-kb putative promoter was amplified by nest PCR using NMuMG genomi c DNA as template. The PCR products were cloned to pGL3-basic vector (Promega) utilizing the Hind IIIMlu I sites and resulting construct was confirmed by DNA se quencing. All-in-one-seq-analyzer software was used to identify putative Smad4 binding sites within the miR-155/BIC promoter.

PAGE 55

42 5) Chromatin Immunoprecipitation (ChIP) Assay NMuMG cells were cultured to 7080% confluence and treated with TGF at 5ng/ml for 24 hours. Cells were harvested for ChIP analysis as previously described (35). Briefly, solubilized chromatin was prepared from a total of 2 x 107 cells. The chromatin solution was diluted 10-f old with ChIP dilution buffer, and precleared with protein-A bead s and preimmune serum. The precleared chromatin solution was divided and utili zed in immunoprecipitation assays with either an anti-Smad4 antibody or an anti-IgG antibody. Following wash, the antibody-protein-DNA complex was eluted from the beads. After cross-link, protein and RNA were removed and the purified DNA was subjected to P CR with primers specific for 2 putative Smad4-binding sites within th e BIC/pri-miR-155 promoter. The sequences of the PCR primers used are as follows: 5’-CCAAA GGAATCACTGGAGGA3’ and ‘5-CCCACAGGTCACTAGGCAA T-3’. Amplified PCR products were resolved by 1.5% agarose gel electr ophoresis and visualized by BioImage. 6) Knockdown of MiR-155 Knockdown of miR-155 in NMuMG cells were obtained by transfection with antisense 2'-O-methyl o ligoribonucleotides (ASO) against miR-155 using Lipofectamine 2000 (Invitrogen). Tr ansfection complexes were prepared according to the manufacturer’s instructions and added directly to the cells at a final oligonucleotide concentrati on of 10 nmol/L. Following 36 h incubation, cells were treated with or without hTGF 2ng/ml; RD Systems) for different times and evaluated for tight junctions and EMT phe notype. ASO’s were composed entirely of 2’-O methyl bases and chemically synthesized by Integr ated DNA Technologies (C oralville, IA) with

PAGE 56

43 the following sequences: 2’O -Me-155: 5’-CCCCTATCAC AATTAGCATTAA-3’, and 2’O -Me-scrambled: 5’AAGGCA AGCUGACCCUGAAGU-3’. 7) Expression Plasmid and Establishment of Stable MiR-155 Expression Cell Lines miR-155 expression plasmid was created ac cording to BLOCK-iT™ Pol II miR RNAi Expression Vector Kit’s protocol. Briefly, the following oligos were cloned into the pcDNA™6.2-GW/miR (Invitrogen) vector a nd designated as pcDNA™6.2-GW/miR-155: 5’-TGCTGTTAATGCTAATTGTGAT AGGGGGTTTTGGCCACTGACTGACCC CCTATCAATTAGCATTA-3’and 5’CCT GTAATGCTAATTGATAGGGGGTCAGTC AGTGGCCAAAACCCCCTATCACAATTAGCATTAAC-3’. To generate stable miR155 expressing cells, NMuMG cells were tr ansfected with pcDNA™6.2-GW/miR-155 or pcDNA™6.2-GW/miR-control vector using Li pofectamine 2000 (Invitrogen). Following selection with blasticidin, stable clonal cell lines were established and examined for expression of miR-155 by Northern analysis. 8) RhoA 3’UTR Luciferase Reporter Assay To create individual RhoA 3’UTR luciferase reporter constructs, 60 bp sequen ces from putative miR-155 binding sites were synthesized and ligated into pMIR-REPORT vect or (Ambion) at SpeI and HindIII sites. To create full length RhoA 3’UTR reporter, the following primers were used to amplify RhoA’s 3’UTR region from mouse c DNA library: 5’ACTAGTGCAGCCTCATGCGGT TAAT-3’, and 5’-AAGCTTTTTTTTTAGAAA ACTGCCTTTATTCT-3’, digested and cloned into pMIR-REPORT vector (Ambion) at SpeI and HindIII sites. To create mutant 3’UTR, point mutations were created at first two matching nucleotide within selected

PAGE 57

44 putative seeding regions with the following ru les: A to T and vice versa; and G to C and vice versa. NMuMG cells were tran sfected in 24-well plates with 0.10 g of the pMIRREPORT-3’UTR/RhoA lu ciferase report, 0.05 g of the normalization plasmid pCMVgalactosidase, and 0.6 ug of miR-155 or c ontrol non GFP vector or 5ng/ml of TGF Luciferase assays were performed using th e Luciferase Assay System (Promega), and activities were normalized to -galactosidase activity (52). Results: 1) MiRNA Expression Profiles in TGF -Induced EMT in NMuMG, and Smad4 Knockdown NMuMG Cells : TGF /Smad pathway plays a critical role in promoting cancer metastasis. Previous studies have id entified a number of protein-coding genes that are regulated by TGF /Smad and mediate TGF function (54). Since TGF induced EMT in NMuMG cells is a frequently used cellular model to study the molecular mechanism of cancer metastasis (5, 34), a nd its miRNA expression signature is not completely understood, we proceeded to prof ile changes using a mi RNA microarray in an attempt to identify possibl e miRNAs involved in TGF /Smad-induced EMT, cell migration and invasion. Previous studies ha s shown that stable knockdown of Smad4 in different cell lines, including NMuMG, fails to undergo EMT in response to TGF treatment (5). As shown in Figure 5A Smad4 level was decreased by 80% after stable transfection of NMuMG with Smad4-shRNA. As expected, a parental but not Smad4knockdown NMuMG cells underwent EMT after TGF treatment. Thus, we treated both cell lines with TGF for 0, 24 and 36 h to obtain a miRN A signature using three separate hybridizations. Hybrid ization to a custom microarr ay, which contains 515 miRNAs,

PAGE 58

45 revealed 28 differentially re gulated miRNAs in the parental but not in the Smad4knockdown NMuMG cells between 0 h and 24 h or 36 h of TGF treatment with a P value of < 0.05 ( Figures 5B and 5C ). Of the 28 listed miRNAs, 9 were up-regulated and 19 were down-regulated during TGF -treatment at both time points ( Figure 5C ). Our array revealed that the members of th e let-7 and miR-30 family miRNAs were consistently down-regulated and clustered mi RNAs were often regulated simultaneously ( Figure 5D ). In agreement with previous findings, our array data also show significant down-regulation of miR-200c and miR-205 during a mesenchymal phenotype (12). MiR155, miR-214, miR-21 and miR-323 were all found to be significantly upregulated. We selected 5 significantly deregulated miRNAs for validation by Northern blot and qRTPCR to determine the accuracy of the array data ( Figure 6A and data not shown).

PAGE 59

46

PAGE 60

47 FIGURE 5. MiRNA Expre ssion Profile of TGF /Smad-Induced EMT in NMuMG Cells. ( A ) TGF induces cell morphological change of EMT in control (pRS vectortransfected) but not Smad4-knockdown NM uMG cells. Western bl ot analysis was performed with anti-Smad4 and –actin an tibodies in contro l and Smad4-knockdown NMuMG cells (upper panels). Indicated cells were treated w ith or without TGF for 24 h and photographed (bottom panel). ( B ) Heatmap representation of miRNAs dysregulated during TGF treatment in control and Sm ad4-knockdown NMuMG cells. ( C ) The list of deregulated miRNAs induced by TGF in control but not Smad4-knockdown NMuMG cells. ( D ) Chromosomal representation of the deregulated miRNA location within mouse genomic DNA. Clustered miRNAs are simultaneously down-regulated or upregulated during TGF treatment.

PAGE 61

48 We next examined if the promoters of TGF -regulated miRNAs may contain Smad4 binding element. Sequence analys is using MATCH and TRANSFAC (22, 29) was conducted in a 6-kb DNA region (5 kb upstr eam and 1 kb downstream from the ends of the pri-miRNA), designated as the put ative miRNA promoter. As indicated in Figure 5C both mouse and human promoters of TGF -deregulated miRNAs contain 1 or more Smad4 binding sites, further suggesting th at these miRNAs c ould be regulated by TGF /Smad pathway and play important roles in TGF -induced EMT. 2) MiR-155 is a Direct Target of TGF /Smad Pathway : Since miR-155 is a highly upregulated miRNA in TGF -treated NMuMG cells ( Figures 5C and 6A ) and its function in metastasis is currently unknown, we investig ated if miR-155 is directly regulated by the TGF /Smad4 pathway We cloned a mouse promot er 1.0-kb upstream from the transcriptional start site of the BIC (pri-miR-155) gene into th e pGL3-basic vector (33, 53). Sequence analysis revealed two Smad response elements (CAGAC and CTGTCTGT; 23) located at -542bp a nd -454bp from the transcription start site, which are conserved in human miR-155 promoter. A luciferase reporter assay revealed that miR-155 promoter activ ity is induced by TGF in parental but not Smad4-knockdown NMuMG cells ( Figure 6B ). Deletion mapping showed that the first Smad4 binding site (e.g. -454bp) is responsible for TGF -induced miR-155 promoter activity ( Figure 6C ). To determine whether Smad4 could directly bind to the Smad-binding site within the promoter in vivo we carried out a ChIP assay. NMuMG cells were treated with or without TGF for 24 hours and immunoprecipitated with anti-Smad4 antibody. Figure 6D shows that Smad4 specifically bound to the promoter following TGF treatment.

PAGE 62

49 These findings indicate that miR-155 is a transcriptional ta rget of the TGF /Smad pathway.

PAGE 63

50 FIGURE 6. TGF /Smad Transcriptionally Regulates MiR-155. ( A ) Verification of TGF -regulated miRNAs. Parental NM uMG cells were treated with TGF for indicated time points and subjected to Northern blot analysis with i ndicated probes. ( B ) TGF induces miR-155 promoter activ ity in parental but not Smad4-knockdown NMuMG cells. Diagram shows that a putative mouse miR155 promoter containing two Smad4-binding sites and individual Smad4-bind ing site deletion mutants were cloned to pGL3 plasmid (top panel). Parent al and Smad4-knockdown cells were transfected with pGL3-miR155-Luc and treated wi th or without TGF Following 36 h incubation, the cells were subjected to luciferase reporter assay. The experiments we re done thrice in triplicate for each treatment. ( C ) The first Smad4 binding s ite is required for TGF -induced miR-155 promoter activity. NMuMG cells were transfec ted with indicated plasmids, treated with TGF and assayed for luci ferase activity. ( D ) TGF induces Smad4 binding to miR-155 promoter. ChIP assay was done in NMuMG cells treated with/without TGF PCR was done with the eluted DNA fragments from an ti-Smad4 immunoprecipitates using a set of primers that detect the first Smad4-binding site determined im portant from reporter assay. IgG and anti-actin antibody were us ed as negative controls.

PAGE 64

51 3) MiR-155 Facilitates TGF -Induced EMT and Tight-Junction Dissolution as Well as Cell Migration and Invasion : We next assessed whether miR-155 plays a role during TGF -induced EMT. First, NMuMG cells were transfected with an tisense 2'-O-methyl oligonucleotides (ASO) against miR-155 and control ASO and then treated with or without TGF Figure 7A shows that miR-155 ASO effectively knocked down miR-155 induced by TGF Accordingly, TGF -driven morphological changes were reduced by knockdown of miR-155 up to 24 hours ( Figure 7B ). Immunofluorescent staining against E-cadherin and ZO-1 at the sa me timepoint revealed that tight junction assembly was disrupted by TGF in control ASO-NMuMG cells but still intact in miR-155-knockdown cells ( Figure 7C ). In addition, TGF -downregulated E-ca dherin was rescued by knockdown miR-155 ( Figure 7D ). To further demonstrate the effect of miR-155 on TGF function, we established miR-155 stably-t ransfected cell line by transfection of NMuMG cells with pcDNA™6.2-GW/miR-155 fo llowing selection with blasticidin ( Figure 7A ). Ectopic expression of miR-155 alone was not su fficient to induce EMT but did cause disruption in cell polarity and tight junction formations ( Figures 7E and 7F ). Moreover, cells overexpressing miR-155 underwent a complete TGF -induced EMT by 12 hours compared to the 24-36 hours it normally takes in the parent al control cells in response to TGF ( Figures 7E and 7F ). In addition, E-cadherin level was much lower in miR-155 transfected cells than vector -treated cells by 12 hours of TGF treatment ( Figure 7G ).

PAGE 65

52

PAGE 66

53 FIGURE 7. miR-155 Media tes the Effect of TGF on EMT. ( A ) Ectopic expression and knockdown of miR-155. NMuMG cells were transfected with indicated plasmids and oligos. Following tr eatment with/without TGF cells were subjected into Northern blot analysis with [ 32P]-dATP labeled miR-155 (top) and U6 (bottom) probes. ( B and C ) Knockdown of miR-155 inhibited TGF -induced EMT and tight junction dissolution. NMuMG cells were transfected with miR-155 ASO and control ASO followed by treatment with/without TGF for 24 hours. Cell morphol ogy were documented using a phase contrast microscope (B) and stained with anti-ZO-1 and -E-cadherin antibodies conjugated to FITC and TRITC, respectively. Arrows indicate the restoration of TGF disrupted tight junction by knockdown of miR-155 (C). ( D ) Knockdown of miR-155 inhibits TGF -downregulated E-cadherin. NMuMG cel ls were transfected with control and miR-155 ASO, treated with TGF treatment for 24 h and then immunoblotted with indicated antibodies. ( E and F ) Overexpression of miR155 disrupted proper tight junction formations and accelerated TGF -induced EMT. Stable miR-155-transfected and control NMuMG cells were treated with/without TGF for 12 h and photographed (E) and immunofluorescence-stained with indicated antibodies (F). Ec topic expression of miR-155-promoted tight junction dissolu tion is indicated with arrows. ( G ) Western blot analysis of E-cadherin in NM uMG cells that were transfected with miR-155 and then treated with TGF for 12 h.

PAGE 67

54 Furthermore, we assessed the role of mi R-155 in cell mobility and invasion. Cell migration was examined using Boyden chambers and "Wound healing" assays. Cell invasion was measured using matrigel coated Boyden chambers as de scribed in Material and Methods. Triplicate experiments show ed that stable expression of miR-155 increased cell migration by n early double, as illustrate d by Boyden chamber and wound healing assays ( Figures 8A, 8B and 8D ). Further, cell invasion was also significantly enhanced by stable over expression of miR-155 ( Figures 8A and 8D ). In contrast, knockdown of miR-155 considerably re duced cell migration and invasion ( Figures 8C and 8D ). Taken collectively, these results indica te that miR-155 plays an important role in TGF -induced EMT as well as in ce ll migration and invasion.

PAGE 68

55 FIGURE 8. miR-155 Plays a Significan t Role in Cell migration and Invasion. ( A and B ) Ectopic expression of miR-155 indu ces cell migration and invasion. pcDNA™6.2-miR-control and pcDNA™6.2-miR155 stably transfected NMuMG cells were examined for cell migration and i nvasion using Boyden chamber and "Wound healing" assays as described in “Materials and Methods”. ( C ) Knockdown of miR-155 reduces cell migration and invasion. NMuMG cells were transfect ed with miR-155 ASO and control ASO. Following 36 h of incubati on, cells were subjected to chamber cell migration and invasion assays using Boyden chambers with or without insertion of coating matrigel. ( D ) Statistic analysis. The experi ments in panel A-C were repeated thrice. P values for comparisons are indicated.

PAGE 69

56 4) RhoA is Negatively Regulated by MiR-155 : Since miR-155 was significantly upregulated after treatment with TGF in NMuMG cells ( Figures 5C and 6A ) and mediates TGF function in EMT ( Figure 7 ), cell mobility and invasion ( Figure 8 ), we proceeded to identify potential targets know n to play a role in EMT using RNA22 microRNA Target Detection and miRBase da tabases. Among candidates surveyed, we found that the 3’UTR of RhoA, which plays an important role in cell junction formation and stabilization (34, 37, 46, 49), contains th ree highly conserved regions that may serve as a binding site for miR-155 as determined by the RNA22 algorithm ( Figure 9A ). To examine whether RhoA is indeed a target of miR-155, NMuMG cells were transfected with pcDNA ™6.2-GW/miR-155 and pcDNA™6.2-GW/miR-control and selected with blasticidin. Immunoblotting and RT-PCR anal yses revealed that RhoA protein but not mRNA was considerably decreased in miR-155-transfected cells ( Figure 9B ). As expected, TGF treatment reduces expression level of RhoA in NMuMG cells ( Figure 9C ). However, knockdown of miR-155 largel y rescues the inhib itory effects of TGF on RhoA protein level ( Figure 9C ). Since miR-155 downregulates RhoA to drive EMT progression, it is reasoned that ectopic expression of RhoA can rescue this phenomenon. Indeed transition towards EMT was hindered when pcDNA3RhoA that lacks a 3’UTR was introduced into a st ably miR-155-transfected NMuMG and subsequently treated with TGF for 24 hours. As shown in Figure 9D ectopic expression of RhoA decreased tight-junc tion dissolution induced by miR-155. These results further indicate that RhoA is a target of miR-155 and mediates miR-155’s contribution to the control of epithelial cell plasticity.

PAGE 70

57 Previous studies have shown that TGF induces the RhoA protein degradation through the ubiquitin-proteasome pathway (34, 49). Thus, we further examined the significance of the protein degradation and miR-155 in regulation of RhoA by TGF NMuMG cells were transfect ed with control or miR155 antisense 2-O-methyl oligonucleotides (ASO) and then treated with or without TGF and proteasome inhibitor MG132. Figure 9E shows that neither MG132 nor knockdown of miR-155 alone fully rescues TGF -downregulated RhoA. However, th e combined treatment of MG132 and miR-155/ASO abrogated TGF -repressed RhoA expression. These results indicate that both unbiquitination-proteasome pa thway and miR-155 mediate TGF -regulated RhoA. To further demonstrate that RhoA is negatively regulated by miR-155, we constructed luciferase reporters that contains each of the three highly conserved seeding sites along with their mutants and a construct that contains the full length RhoA 3’UTR. To determine if any of the three seeding s ites responds to miR-155, the reporter plasmids were introduced into NMuMG cells to gether with pcDNA™6.2-GW/miR-155 or pcDNA™6.2-GW/miR vector. Following 36 hours of incubation, cells were subjected to luciferase assay. Triplicate experiments s how that reporter activity for each site is reduced by ectopic expression of miR-155 with site one exhibiting a more significant response than the two other sites. When thes e sites are mutated, the luciferase reporter is no longer inhibited by miR-155 ( Figures 9F and G ). We then examined if full length RhoA 3’UTRis regulated by TGF through miR-155. Triplicate experiments show the full length reporter responds to TGF and this response is largely abrogated when antisense 2'-O-me oligonucleot ides of miR-155 is simultane ously introduced into the cells ( Figure 9H ). When the same experiments were carried out in the Smad4

PAGE 71

58 knockdown NMuMG cell line, the full leng th reporter does not respond to TGF Figure 9I ). Furthermore, antise nse full length 3’UTR of RhoA fails to respond to miR-155 and TGF ( Figure 9I ).

PAGE 72

59

PAGE 73

60 FIGURE 9. RhoA is a Target of MiR-155. ( A ) Sequence alignment of miR-155 with 3'-UTR of RhoA The seed sequence of miR-155 matc hes to three regi ons of RhoA’s 3’UTR, which are highly conserved between human, mouse and rat. ( B ) miR-155 reduces RhoA protein but not mRNA expressi on. NMuMG cells were transfected with pcDNA™6.2-miR-155 and control v ector. After selection with blasticidin, expression level of RhoA was determined using Western blot analysis (top panel). The same blot was reprobed with anti-actin antibody (panel 2). Expression of miR-155 from the same set of cells was examined by Northern blot an alysis (panel 3). RT-PCR was performed to determine RhoA mRNA levels (p anel 5). U6 and actin were used for loading control (panels 4 and 6). ( C ) Knockdown of miR-155 rescues TGF down-regulation of RhoA. NMuMG cells were transfected miR-155 ASO or control ASO. After 36 h of incubation, cells were treated w ith or without TGF for 24 h and immunoblotted with indicated antibodies (panels 1 and 2). A Northern blot was hybrid ized with indicated probes (panels 3 and 4). ( D ) Ectopic expression of RhoA-c DNA lacking 3’UTR overrides the effects of miR-155 on cell tight -junction dissolution. MiR-155 stable clonal cells were transfected with pcDNA3-RhoA or vector. Following treatment w ith or without TGF cells were immunostained with anti-ZO-1 antibody. ( E ) Inhibition of ubiquitinproteasome pathway and miR-155 hinders TGF down-regulation of RhoA. NMuMG cells were transfected with control or miR-155 ASO. Following 48 h incubation, cells were treated with or without MG132 and/or TGF for 12 h and then subjected to immunoblotting (panels 1 and 2) and qRTPCR (panels 3 and 4) analyses. ( F and G ) MiR-155 inhibits RhoA 3’UTR luciferase activity. Cells were transfected with individual site of pGL3-Luc3’UTR/RhoA (F) and their mutants (G) together with pCMVgalactosidase, pcDNA™6.2-miR-155 or pcDNA ™6.2-miR-control vector. Luciferase activities were normalized to -galactosidase activity. ( H and I ) TGF and miR155 repress full length RhoA 3’UT R but not its antisense in parental NMuMG cells. Cells were transfected with indicated pl asmids and treated with or without TGF for 24 h. Luciferase activities were normalized to -galactosidase activity. Full length RhoA 3’UTR responds to TGF and miR-155 in parental (H) but not Smad4-knockdown NmuMG cells (I). TGF -inhibited reporter activity wa s abrogated by knockdown of miR-155. MiR-214 was used as a control. Experiments were done in triplicates for standard deviation calculations.

PAGE 74

61 5) MiR-155 Expression in Invasive Breast Cancer : Having observed that miR-155 mediates TGF -induced EMT, cell migration and inva sion, we asked if expression of miR-155 is associated with cancer invasivene ss in human primary breast carcinoma. A total of 62 breast ca ncer specimens (e.g. 17 non-inva sive and 45 invasive breast carcinomas) and 5 normal breast tissue were examined for expression of miR-155. qRTPCR ( Figure 10A ) and miRNA locked nucleic acid in situ hybridization ( Figure 10B ) analyses revealed high levels of miR-155 in 41 of 45 invasive tumors but only in 2 of 17 non-invasive cancers ( Figure 10C ). Expression of miR-155 was very low in normal breast tissue ( Figures 10A and 10B ). These data further support the findings of miR155 ’s involvement in EMT and invasion as obse rved in NMuMG cells, and suggest that miR-155 could play a pivotal role in breast cancer metastasis.

PAGE 75

62

PAGE 76

63 FIGURE 10. Elevated Levels of MiR-155 are Associated with Invasive Breast Cancer. ( A ) qRT-PCR analysis of miR-155 expre ssion in human normal, non-invasive and invasive breast carcinoma. U6 was used as control. The numbers represent the band density ratio of miR-155 divided by U6. ( B ) LNA-ISH. miR-155 was labeled with digoxigenin-ddUTP using the Dig-3’-end labelin g kit (Roche) and hybridized to paraffin sections of breast cancer. Representative photomicrographs of sections of a ductal carcinoma in situ (DCIS; left) and invasive (right) breast tumor tissues. ( C ) Summary of qRT-PCR and LNA-ISH analysis. miR-155 was f ound to be more frequently detected in invasive breast carcinoma th an non-invasive tumour. ( D ) Schematic illustration of the transcriptional induction of miR-155 by TGF /Smad pathway and TGF down-regulation of RhoA through ubiquitination-proteasome and miR-155 cascades.

PAGE 77

64 Discussion: Many studies have demonstr ated previously that TGF pathway plays a critical role in breast cancer metastasis (18, 31, 39, 50). Several TGF /Smad-regulated genes have been shown to mediate TGF signaling in control of ce llular processes associated with breast cancer metastasis (18, 31, 39, 50). In this study, we report a miRNA expression signature of TGF -induced EMT in mouse mammary gland epithelial (NMuMG) cells. Twenty eight miRNAs were found to be significantly deregulated by TGF in parental but not Smad4-knockdown NM uMG cells. Further, we showed miR155, the most significantly upregulated miR NA, plays an importa nt role in TGF -induce EMT, cell migration and invasion. In addition, RhoA was negatively regulated by miR155 and reconstitution of RhoA in miR155 overexpressing cells decreases TGF /miR155-induced tight-junction dissolution. Moreov er, high expression levels of miR-155 correlate with invasive breas t carcinomas. These findings are important for several reasons. First, they provide a miRNAs expression signature of TGF /Smad pathway in mammary gland epithelial cells. Second, this study established a direct link between TGF /Smad4 and miR-155 during EMT. Finally, th is is the first study to describe RhoA as a direct target of miR-155. MiR-155, a product of the BIC gene, is over-expresse d in a number of human malignancies which include B-cell lymphoma and carcinomas of breast, colon, lung and ovary (8, 17, 48, 51, 52). E(mu)-mmu-miR155 transgenic mice cause B-cell malignancies (4) whereas its knockout mice e xhibit impaired immune function (40, 45). The transcription factor Pu 1 is validated as a direct target of miR-155-mediated immunoresponse (47). Moreover, miR-155 repr essed tumor protein 53-induced nuclear

PAGE 78

65 protein 1 (TP53NP1) leading to pancreatic tumor development (10). In addition, NF B and AP-1 transcription factors have been shown to regulate miR155 expression (20, 33, 53). However, functions of miR-155 in cel l migration and invasi on have not been investigated. Thus, our study provides the fi rst evidence that miR155 is up-regulated by TGF /Smad4 pathway and mediates TGF -induced EMT and cell invasion. Previous computational and experimental studies have focused on the quality of sequence match between miRNA and the targ et (6, 7, 14, 26, 42). miRNAs negatively regulate their target mRNAs through base-pai ring interactions, which leads to either mRNA degradation or transla tional inhibition depending on th e degree of match between the ‘seed sequence’ (positions 2 – 7 at the 5’ side) of miRNA and 3’UTR of mRNA, e.g. miRNA targets mRNA degradation, when th e seed sequence perfectly matches with target 3’ UTR, or inhibits translation, when they are partially iden tical (6, 7, 14, 26, 42). In addition, recent reports indicated mRNA seco ndary structures may also contribute to target recognition due to the fact that th ere is an energy cost associated with unbasepairing of the messenger required to ma ke the target site accessible for miRNA binding (27, 30). Kertesz et al. showed that site accessibility is as important as base pairing within the seeding re gion. Effective miRNA func tion requires nucleic acids flanking the target site, as we ll as the target itself, to be unpaired in a thermodynamically stable fashion (19). Through the RNA22 algorithm, we found the ‘seed sequence’ of miR-155 have potential to bind in multiple regi ons within the 3’UTR of RhoA. Of these sites, we selected three sites that fit the above mentioned criteria and are highly conserved among species. Further, RhoA 3’ UTR reporter assays experiments showed miR-155 significantly diminished luciferase activity at all three sites. To mimic

PAGE 79

66 endogenous conditions more closely, we clone d full length RhoA 3’UTR and performed experiments using TGF instead of ectopic expression of miR-155. As expected, the full length 3’UTR responds to TGF which is inhibited by knockdown of miR-155 in the parental NMuMG line but not in the Smad4 knockdown line. RhoA is the prototypical member of the R ho GTPase family, which regulates many cellular processes, includi ng cellular adhesion, motility, and polarity, and is an important modulator of cell junction formation and stability (34, 37, 46, 49). Previous studies showed that TGF induces the disruption of tight -junction, cell polarity and EMT through ubiquitination and degradation of RhoA by Smurf1 E3 ligase that is activated by Par6 (34). Our study demonstrated that TGF downregulates RhoA protein expression through up-regulation of miR-155, and thus pr ovided an additional molecular mechanism of TGF regulation of RhoA (Fig. 10D). Re gulation by miRNAs provide a means for cell to prevent protein translation – a m echanism to quickly prevent accumulation of proteins by translational inhi bition; our findings go hand in hand with earlier findings that TGF ubiquitinates RhoA for degradation. In this scenario, induction of miR-155 halts the translation of RhoA while ubiquitination de grades translated RhoA proteins. Based on computational program prediction, each miRNA could negatively regulate hundreds of protein-coding mRNAs (6, 7, 14, 26, 42). Two recent studies, using gene expression microarray analysis, showed that miR-155 and its viral orthologue KSHV-miR-K12-11 negatively regulate more than 180 mRNAs, some of which are involved in cell migration and invasion, including GSK 3, PCSK5 and Rho GTPase activ ating protein 21 (11, 41). Thus, RhoA is a major but not only target that mediates miR-155 function in control of cell polarity, EMT and cell invasion contributing to cancer metastasis.

PAGE 80

67 In addition, a previous st udy reported a miRNA profile in human keratinocytes treated with TGF Four miRNAs were up-regulate d and other 4 were down-regulated by TGF (55). Of the 8 deregulated miR NAs only 1 miRNA (e .g. miR-21) showed consistent change with our resu lts. This discrepancy could be due to different cell types and duration of TGF treatment. Recent reports have indicated the importance of downregulation in miR-200 family of miRNAs during TGF induced EMT (2, 12, 22, 36). In congruence to previous findings, our a rray also shows the down-regulation of miR-200c and miR-205 during a mesenchyma l transition ( Figure 6C ). However, the remaining members of the miR-200 family were not detected in our array. This could be due to different cell lines us ed for the miRNA array analysis between our study and previous reports (2, 12, 36). In addition, we showed frequent up-regulation of miR-155 in primary invasive breast cancer. Consistent with this finding, a previously study reported that miR-155 is elevated in a meta static breast cancer cell li ne MDA-MB-231, but not in a non-metastatic line MCF-7 (28) We also observed that knockdown of miR-155 inhibits TGF -downregulated E-cadherin whereas ectopi c expression of miR-155 enhances the TGF effects on E-cadherin expression ( Figures 7D and 7G ). Sequence analysis shows no match between seed sequence of miR-155 an d 3’UTRs of E-cadherin, ZEB1 and SIP1 (12). Further investigation is required to determine the mechanism of miR-155 downregulation of E-cadherin, although it is likely that the effects ar e indirect but serves as an useful EMT indicator. In summary, we demonstrated miRNA expression signature of TGF /Smad-induced EMT in mammary epithelial cells. All 28 de regulated miRNAs contain at least one Smad4 binding site within their putative promoters. MiR-155 mediated TGF /Smad

PAGE 81

68 pathway-induced EMT, cell migration and i nvasion through targetin g RhoA. Further, expression of miR-155 is associ ated with invasive phenotype of breast cancer. Thus, miR-155 could be potential metast atic/prognostic marker and th erapeutic target for breast cancer metastasis intervention. References: 1. Ambros, V. 2004. The functions of animal microRNAs. Nature 431:350-355. 2. Burk, U., J. Schubert, U. Wellner, O. Sc hmalhofer, E. Vincan, S. Spaderna, and T. Brabletz. 2008. A reciproc al repression between ZEB1 and members of the miR-200 family promotes EMT and inva sion in cancer cells. EMBO Rep 9:582589. 3. Cai, X., C. H. Hagedorn, and B. R. Cullen. 2004. Human microRNAs are processed from capped, polyadenylated tr anscripts that can also function as mRNAs. Rna 10:1957-1966. 4. Costinean, S., N. Zanesi, Y. Pekarsky, E. Tili, S. Volinia, N. Heerema, and C. M. Croce. 2006. Pre-B cell proliferation and lymphoblastic leukemia/high-grade lymphoma in E(mu)-miR155 transgenic mice. Proc Natl Acad Sci U S A 103:7024-7029. 5. Deckers, M., M. van Dinther, J. Buijs, I. Que, C. Lowi k, G. van der Pluijm, and P. ten Dijke. 2006. The tumor s uppressor Smad4 is required for transforming growth factor beta-induced epithelia l to mesenchymal transitio n and bone metastasis of breast cancer cells. Ca ncer Res 66:2202-2209. 6. Didiano, D., and O. Hobert 2006. Perfect seed pairing is not a generally reliable predictor for miRNA-target interac tions. Nat Struct Mol Biol 13:849-51. 7. Doench, J. G., and P. A. Sharp. 2004. Speci ficity of microRNA target selection in translational repressi on. Genes Dev 18:504-511. 8. Eis, P. S., W. Tam, L. Sun, A. Chadburn, Z. Li, M. F. Gomez, E. Lund, and J. E. Dahlberg. 2005. Accumulation of mi R-155 and BIC RNA in human B cell lymphomas. Proc Natl Acad Sci U S A 102:3627-3632. 9. Farh, K. K., A. Grimson, C. Jan, B. P. Le wis, W. K. Johnston, L. P. Lim, C. B. Burge, and D. P. Bartel. 2005. The wide spread impact of mammalian MicroRNAs on mRNA repression and evol ution. Science 310:1817-1821.

PAGE 82

69 10. Gironella, M., M. Seux, M. J. Xie, C. Cano, R. Tomasini J. Gommeaux, S. Garcia, J. Nowak, M. L. Yeung, K. T. Jea ng, A. Chaix, L. Fazli, Y. Motoo, Q. Wang, P. Rocchi, A. Russo, M. Gleave, J. C. Dagorn, J. L. Iovanna, A. Carrier, M. J. Pebusque, and N. J. Dusetti. 2007. Tumor protein 53-induced nuclear protein 1 expression is repressed by miR-155, and its restoration inhibits pancreatic tumor development. Pr oc Natl Acad Sci U S A 104:16170-16175. 11. Gottwein, E., N. Mukherjee, C. Sachse, C. Frenzel, W. H. Majoros, J. T. Chi, R. Braich, M. Manoharan, J. Soutschek, U. Ohler, and B. R. Cullen. 2007. A viral microRNA functions as an ortholo gue of cellular miR-155. Nature 450:10961099. 12. Gregory, P. A., A. G. Bert, E. L. Pate rson, S. C. Barry, A. Tsykin, G. Farshid, M. A. Vadas, Y. Khew-Goodall, and G. J. Goodall. 2008. The miR-200 family and miR-205 regulate epithelial to mesenchym al transition by targeting ZEB1 and SIP1. Nat Cell Biol 10:593-601. 13. Griffiths-Jones, S., R. J. Grocock, S. van Dongen, A. Bateman, and A. J. Enright. 2006. miRBase: microRNA sequences, target s and gene nomenclature. Nucleic Acids Res 34:D140-144. 14. Grun, D., Y. L. Wang, D. Langenberger, K. C. Gunsalus, and N. Rajewsky. 2005. microRNA target predictions across seve n Drosophila species and comparison to mammalian targets. PLoS Comput Biol 1:e13. 15. Han, J., Y. Lee, K. H. Yeom, Y. K. Kim, H. Jin, and V. N. Kim. 2004. The Drosha-DGCR8 complex in primary microRNA processing. Genes Dev 18:30163027. 16. Houbaviy, H. B., M. F. Murray, a nd P. A. Sharp. 2003. Embryonic stem cellspecific MicroRNAs. Dev Cell 5:351-358. 17. Iorio, M. V., M. Ferracin, C. G. Liu, A. Veronese, R. Spizzo, S. Sabbioni, E. Magri, M. Pedriali, M. Fabbri, M. Ca mpiglio, S. Menard, J. P. Palazzo, A. Rosenberg, P. Musiani, S. Volinia, I. Nenci, G. A. Calin, P. Querzoli, M. Negrini, and C. M. Croce. 2005. MicroRNA gene e xpression deregulation in human breast cancer. Cancer Res 65:7065-7070. 18. Kang, Y., W. He, S. Tulley, G. P. Gupta, I. Serganova, C. R. Chen, K. ManovaTodorova, R. Blasberg, W. L. Gerald, and J. Massague. 2005. Breast cancer bone metastasis mediated by the Smad tumor suppressor pathway. Proc Natl Acad Sci U S A 102:13909-13914. 19. Kertesz, M., N. Iovino, U. Unnerstall, U. Gaul, and E. Segal. 2007. The role of site accessibility in microRNA target recognition. Nat Genet 39:1278-1284.

PAGE 83

70 20. Kluiver, J., A. van den Be rg, D. de Jong, T. Blokzijl, G. Harms, E. Bouwman, S. Jacobs, S. Poppema, and B. J. Kroe sen. 2007. Regulation of pri-microRNA BIC transcription and processing in Bu rkitt lymphoma. Oncogene 26:3769-3776. 21. Korpal, M., E. S. Lee, G. Hu, and Y. Kang. 2008. The miR-200 Family Inhibits Epithelial-Mesenchymal Transition and Cancer Cell Migration by Direct Targeting of E-cadherin Transcripti onal Repressors ZEB1 and ZEB2. J Biol Chem 283:14910-14914. 22. Kulshreshtha, R., M. Ferraci n, S. E. Wojcik, R. Garzon, H. Alder, F. J. AgostoPerez, R. Davuluri, C. G. Liu, C. M. Cro ce, M. Negrini, G. A. Calin, and M. Ivan. 2007. A microRNA signature of hyp oxia. Mol Cell Biol 27:1859-1867. 23. Kusanagi, K., H. Inoue, Y. Ishidou, H. K. Mishima, M. Kawabata, and K. Miyazono. 2000. Characterization of a bone morphogenetic protein-responsive Smad-binding element. Mo l Biol Cell 11:555-565. 24. Lee, Y., C. Ahn, J. Han, H. Choi, J. Kim, J. Yim, J. Lee, P. Provost, O. Radmark, S. Kim, and V. N. Kim. 2003. The nuclear RNase III Drosha initiates microRNA processing. Nature 425:415-419. 25. Lewis, B. P., C. B. Burge, and D. P. Bartel. 2005. Conserve d seed pairing, often flanked by adenosines, indicates that t housands of human genes are microRNA targets. Cell 120:15-20. 26. Lewis, B. P., I. H. Shih, M. W. JonesRhoades, D. P. Bartel, and C. B. Burge. 2003. Prediction of mammalian mi croRNA targets. Cell 115:787-798. 27. Long, D., R. Lee, P. Williams, C. Y. Chan, V. Ambros, and Y. Ding. 2007. Potent effect of target structure on microRNA function. Nat Struct Mol Biol 14:287-294. 28. Ma, L., J. Teruya-Feldstein, and R. A. Weinberg. 2007. Tumour invasion and metastasis initiated by microRNA-10b in breast cancer. Nature 449:682-688. 29. Matys, V., E. Fricke, R. Geffers, E. Gossling, M. Haubrock, R. Hehl, K. Hornischer, D. Karas, A. E. Kel, O. V. Kel-Margoulis, D. U. Kloos, S. Land, B. Lewicki-Potapov, H. Michael, R. Munch, I. Reuter, S. Rotert, H. Saxel, M. Scheer, S. Thiele, and E. Wingende r. 2003. TRANSFAC: transcriptional regulation, from patterns to prof iles. Nucleic Acids Res 31:374-378. 30. Muckstein, U., H. Tafer, J. Hackermuller, S. H. Bernhart, P. F. Stadler, and I. L. Hofacker. 2006. Thermodynamics of RNA-RNA binding. Bioinformatics 22:1177-1182.

PAGE 84

71 31. Nam, J. S., A. M. Suchar, M. J. Kang, C. H. Stuelten, B. Tang, A. M. Michalowska, L. W. Fisher, N. S. Fedar ko, A. Jain, J. Pinkas, S. Lonning, and L. M. Wakefield. 2006. Bone sialoprotein mediates the tumor cell-targeted prometastatic activity of transforming grow th factor beta in a mouse model of breast cancer. Cancer Res 66:6327-6335. 32. Negrini, M., M. Ferracin, S. Sabbioni, and C. M. Croce. 2007. MicroRNAs in human cancer: from research to therapy. J Cell Sci 120:1833-40. 33. O'Connell, R. M., K. D. Taganov, M. P. Boldin, G. Cheng, and D. Baltimore. 2007. MicroRNA-155 is induced during the macrophage inflammatory response. Proc Natl Acad Sci U S A 104:1604-1609. 34. Ozdamar, B., R. Bose, M. Barrios-Rod iles, H. R. Wang, Y. Zhang, and J. L. Wrana. 2005. Regulation of the polarity protein Par6 by TGF receptors controls epithelial cell plastici ty. Science 307:1603-1609. 35. Park, S., D. Kim, S. Kaneko, K. M. Szew czyk, S. V. Nicosia, H. Yu, R. Jove, and J. Q. Cheng. 2005. Molecular cloning a nd characterization of the human AKT1 promoter uncovers its up-regulation by the Src/Stat3 pathway. J Biol Chem 280:38932-38941. 36. Park, S. M., A. B. Gaur, E. Lengyel, and M. E. Peter. 2008. The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. Genes Dev 22:894-907. 37. Perez-Moreno, M., C. Jamora, and E. Fuchs. 2003. Sticky business: orchestrating cellular signals at adhere ns junctions. Cell 112:535-548. 38. Reinhart, B. J., F. J. Slack, M. Basson, A. E. Pasquinelli, J. C. Bettinger, A. E. Rougvie, H. R. Horvitz, and G. Ruvkun. 2000. The 21-nucleotide let-7 RNA regulates developmental timing in Cae norhabditis elegans. Nature 403:901-906. 39. Roberts, A. B., and L. M. Wakefield. 2003. The two faces of transforming growth factor beta in carcinogenesis. Pr oc Natl Acad Sci U S A 100:8621-8623. 40. Rodriguez, A., E. Vigorito, S. Clare, M. V. Warren, P. Couttet, D. R. Soond, S. van Dongen, R. J. Grocock, P. P. Das, E. A. Miska, D. Vetrie, K. Okkenhaug, A. J. Enright, G. Dougan, M. Turner, a nd A. Bradley. 2007. Requirement of bic/microRNA-155 for normal immune function. Science 316:608-611. 41. Skalsky, R. L., M. A. Samols, K. B. Plaisa nce, I. W. Boss, A. Riva, M. C. Lopez, H. V. Baker, and R. Renne. 2007. Kaposi's sarcoma-associated herpesvirus encodes an ortholog of miR-155. J Virol 81:12836-12845.

PAGE 85

72 42. Stark, A., J. Brennecke, N. Bushati, R. B. Russell, and S. M. Cohen. 2005. Animal MicroRNAs confer robustness to ge ne expression and have a significant impact on 3'UTR evolution. Cell 123:1133-1146. 43. Tam, W. 2001. Identification and char acterization of human BIC, a gene on chromosome 21 that encodes a noncoding RNA. Gene 274:157-167. 44. Tang, G. 2005. siRNA and miRNA: an insi ght into RISCs. Trends Biochem Sci 30:106-114. 45. Thai, T. H., D. P. Calado, S. Casola, K. M. Ansel, C. Xiao, Y. Xue, A. Murphy, D. Frendewey, D. Valenzuela, J. L. Kutok, M. Schmidt-Supprian, N. Rajewsky, G. Yancopoulos, A. Rao, and K. Rajewsky. 2007. Regulation of the germinal center response by microR NA-155. Science 316:604-608. 46. Vaezi, A., C. Bauer, V. Vasioukhin, and E. Fuchs. 2002. Actin cable dynamics and Rho/Rock orchestrate a polarized cyto skeletal architecture in the early steps of assembling a stratified ep ithelium. Dev Cell 3:367-381. 47. Vigorito, E., K. L. Perks, C. Abreu-G oodger, S. Bunting, Z. Xiang, S. Kohlhaas, P. P. Das, E. A. Miska, A. Rodriguez, A. Bradley, K. G. Smith, C. Rada, A. J. Enright, K. M. Toellner, I. C. Macl ennan, and M. Turner. 2007. microRNA-155 Regulates the Generation of Immunoglobu lin Class-Switched Plasma Cells. Immunity 27:847-859. 48. Volinia, S., G. A. Calin, C. G. Liu, S. Ambs, A. Cimmino, F. Petrocca, R. Visone, M. Iorio, C. Roldo, M. Ferracin, R. L. Prueit t, N. Yanaihara, G. Lanza, A. Scarpa, A. Vecchione, M. Negrini, C. C. Harris, and C. M. Croce. 2006. A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A 103:2257-2261. 49. Wang, H. R., Y. Zhang, B. Ozdamar, A. A. Ogunjimi, E. Alexandrova, G. H. Thomsen, and J. L. Wrana. 2003. Regul ation of cell polar ity and protrusion formation by targeting RhoA fo r degradation. Science 302:1775-1779. 50. Xie, W., J. C. Mertens, D. J. Reiss, D. L. Rimm, R. L. Camp, B. G. Haffty, and M. Reiss. 2002. Alterations of Smad si gnaling in human breast carcinoma are associated with poor outcome: a tissu e microarray study. Cancer Res 62:497-505. 51. Yanaihara, N., N. Caplen, E. Bowman, M. Seike, K. Kumamoto, M. Yi, R. M. Stephens, A. Okamoto, J. Yokota, T. Ta naka, G. A. Calin, C. G. Liu, C. M. Croce, and C. C. Harris. 2006. Unique microRNA molecular profiles in lung cancer diagnosis and prognosis. Cancer Cell 9:189-198.

PAGE 86

73 52. Yang, H., W. Kong, L. He, J. J. Zhao, J. D. O'Donnell, J. Wang, R. M. Wenham, D. Coppola, P. A. Kruk, S. V. Ni cosia, and J. Q. Cheng. 2008. MicroRNA expression profiling in human ovarian can cer: miR-214 induces cell survival and cisplatin resistance by targeti ng PTEN. Cancer Res 68:425-433. 53. Yin, Q., X. Wang, J. McBride, C. Fe well, and E. K. Flemington. 2008. B-cell receptor activation induces BIC/MIR-155 expression through a conserved AP-1 element. J Biol Chem 283:2654-2662. 54. Zavadil, J., and E. P. Bottinger. 2005. TGF and epithelial-to-mesenchymal transitions. Oncogene 24:5764-5774. 55. Zavadil, J., M. Narasimhan, M. Blumenberg, and R. J. Schneider. 2007. Transforming growth factorand microRNA:mRNA regulatory networks in epithelial plasticity. Cell s Tissues Organs 185:157-161.

PAGE 87

74 CHAPTER III MICRORNA-155 REGULATES C ELL SURVIVAL, GROWTH AND CHEMOSENSITIVITY BY TARGETING FOXO3A IN BREAST CANCER Abstract: Breast cancer is the second leading cause of cancer de ath in women. Despite improvements in treatment over the past fe w decades, there is the urgent need for development of targeted therapies. MicroRNA-155 (miR-155) is frequently upregulated in breast cancer. In this study, we demonstrat e the critical role of miR-155 in regulation of cell survival and chemosensitivity th rough downregulation of FOXO3a in breast cancer. Ectopic expression of miR-155 induce s cell survival and chemoresistance to multiple agents, whereas knockdown of miR-155 renders cells to apoptosis and enhances chemosensitivity. Further, we identified FOXO3a as a direct target of miR-155. Sustained overexpression of miR-155 resulted in repr ession of endogenous FOXO3a without changing mRNA levels, and knockdown of miR-155 increases endogenous FOXO3a. Introduction of FOXO3a lack ing 3’UTR abrogates miR-155-induced cell survival and chemoresistance. Finall y, reverse correlation between miR-155 and FOXO3a levels were observed in a panel of breast cancer cell lines and primary tumors. In conclusion, our study reveals a mol ecular link between miR-155 and FOXO3a and presents evidence that miR-155 is a critic al therapeutic target in breast cancer.

PAGE 88

75 Introduction: MicroRNAs (miRs) are short single stra nded RNAs that have become known as important regulators of various cellular pro cesses by controlling gene expression at the post-transcriptional level (1-4). Deregulated miRNAs in can cer function as either tumor suppressors (5-7) or oncogenes (8-11) and play a central role in carcinogenesis. Accumulated evidence shows that miR-155 is an oncogenic miRNA. First, miRNA profiling studies indicated frequent increa se of miR-155 in vari ous types of human malignancies including different forms of B cel l lymphoma and carcinoma of breast, lung, colon, head/neck, and kidney (9, 11-16). Recen t studies have demonstrated association of elevated miR155 with late stage and poo r overall survival in several types of malignancy (17-19). We have previously shown that miR-155 is induced by TGF and plays an important role in epithelial-to -mesenchymal transition and demonstrated frequent overexpression of mi R-155 in invasive breast cance r (20). Further, a possible link between miR-155 and inflammation in cancer has been reported (21). Moreover, miR-155 transgenic mice develop B cell ly mphomas (22) and mi R-155-knockout mice exhibit impaired immune function (23). FKHRL1 (FOXO3a) is a major member of the Forkhead transcriptional factor family (24). Members of this family are characterized by a distinctive fork head DNA binding domain which is negatively regu lated by protein kinases Akt, SGK and IKK The phosphorylation of FOXO3a by these kinases leads to its translocation from the nucleus to the cytoplas m and loss of the pro-apoptotic function. In the unphosphorylated active form, FOXO3a reside s in the nucleus and induces cell death

PAGE 89

76 by upregulation of apoptotic proteins such as BIM, p27, BNIP3, and 24p3 (29-32) and repression of anti-apoptotic molecule FLIP and BCL-XL (33,34). To date, the majority of validated miR155 functional biology and protein targets define the importance of miR-155 in immunology (23,3539) and various forms of lymphoma (9,11,40,41); however, the in depth role miR-155 play in the context of human breast cancer is still limited. Here, we report that miR-155 induces cell survival and plays an important role in chemoresistance in breast cancer. Its anti-apoptotic function is mediated by direct translational inhibition of FOXO3a. Thus, our findings not only demonstrate regulation of FOXO3a at posttranscriptional levels but also identify miR-155 as a critical therapeu tic target in breast cancer. Materials and Methods: 1) Cell Lines and Breast Tumor Specimens : Breast cancer cell lines were obtained from ATCC and grown according ATCC recomm ended culture conditions. All primary/recurrent human breast cancer and normal breast specimens were obtained from patients who underwent surgery at H. Lee Moff itt Cancer Center and approved by IRB. Each cancer specimen contained at least 80% tumor cells as confirmed by microscopic examination. Tissues were preserved by snap-freeze and stored at -80OC for subsequent RNA and Protein extraction. 2) Plasmids : Lenti-miR-155 and control was purcha sed from System Biosciences and packaged according to protocol. Hsa-mi R-155 and control mimic precursor molecules were purchased from Ambion. miR-155 and c ontrol 2-O’-methyl antisense oligos were

PAGE 90

77 custom synthesized from IDT-DNA with se quence as previously described (20). FOXO3a expression vector was kindly provided by Dr. B. M. T. Burgering. 3) Northern Blot, Locked Nucleic Acid In-Situ Hybridizat ion (LNA-ISH) and Immunohistochemical Staining : Total RNA from cell lines and breast cancer and normal tissue was isolated using TRIZOL reagent (Invitrogen) according to manufacture’s protocol. LNA-ISH and immunohi stochemistry were performed as previously described (20). Briefly, LNA probes were synthesized complementary to human mature miR-155 (5 -CCCCTATCACGATTAGCATTAA-3 ) and scrambled negative control (5 TTCACAATGCGTTATCGGATGT-3 ) and digoxigenin-labeled at the 5 end (Exiqon). Northern analysis on breast cancer cell lin es and tissue RNA were performed using StarfireTM oligo labeling kit (IDT-DNA). 4) MiRNA RT-qPCR Detection and Quantification : Hsa-miR-155 and U6 microRNA levels were detected using TaqMan microRNA Reverse Transcription kit (Applied Biosystem). Briefly, 200ng of total RNA from each cell lines and tumor RNA were used for primer specific reverse transcriptase for both hsa-miR-155 and U6, and then 2ul of the RT product was used for subsequent qP CR. The qPCR was performed on ABI HT9600 and data was collected and analyzed using ABI SDS version 2.3. To calculate relative concentration, miR-155 and U6 CT values for all samples were obtained. A normalized expression for each sample was obtained by dividing CT of miR-155 by the same sample’s U6 CT and designated as CT. This value is then tran sformed by performing 2^( CT). Furthermore, the ( CT) method was used in comparing miR-155 expression in

PAGE 91

78 immortalized cells to cancer cell lines or normal tissue to cancer tissue according to ABI’s protocol. 5) Cell Viability and Apoptosis Assays : Optimal drug concentration for induction of apoptosis in BT-474 and Hs578T cell lines we re titrated by measuring cleaved caspase activity with Caspase-Glo 3/7 assay (Promega). Titration results determined the following concentrations for all subsequent experiments: doxorubi cin 5uM, paclitaxel 5nM, and VP-16 400uM. After transfecti on of miR-155 mimic (BT-474) or 2’-O-me anti-miR-155 (Hs578T) and tr eatment with individual drug, cell viability was examined with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay as previously described (42) Apoptotic detection assay were performed using Cell Death Detection ELISAPLUS kit according manufactur e’s protocol (Roche), and Caspase-Glo 3/7 Assay (Promega). Each experiment was re peated at least three times in triplicate. The results are expressed as the enrichment factor relative to th e untreated controls. 6) Western Blot Analysis and Antibodies : Western analysis was pe rformed as previously described (20). The followi ng antibodies were used: rabbit-anti-FOXO3a (Abcam), rabbit-anti-cleaved PARP (Cell Signaling), rabbit-anti-total PA RP (Cell Signaling), mouse-anti-actin (Santa-Cruz), rabbit-anti-p27 (Cell Signaling), and rabbit-anti-Bim (Cell Signaling). 7) Target In-Vitro Luciferase Report Assay : The pMIR-Report plasmids for the miR-155 target FOXO3a 3’UTR were c onstructed as wild type (WT) pmiR-FOXO3a containing

PAGE 92

79 two tandem repeats of miR-155 response elem ent from FOXO3a 3’UTR and as mutant (MUT) pmiR-FOXO3a by replacing 2 nucleotides within the “seed sequence” ( Figure 2A ). The sequences used to create the pmiR-FOXO3a are as follow: forward, 5'-ctagATGAACTTACAGGTGAGCATTAAA TGAACTTACAGGTGAGCATTAA-3' and reverse, 5’-agctTTAATGCTCACCTGTAAGTTCATTTAATGCTCACCTGTAAGTTCAT-3’. The oligos were annealed and inserted in to the pMIR-Report vector (Ambion). The empty vector (pMIR-REPORT) was used as a negative control. Cells were transfected with 0.2 g of the reporter plasmids, 0.1 g of pCMV-gal, and where applicable 5nM of miR-155 precursor or control, or 50nM of miR-155 ASO or control per well on 96-well plates. Following 24 h incubation, cells were su bjected to luciferase reporter assay using the Luciferase Assay System (Promega). Luciferase activities were normalized by -gal activities. Each experiment was repeated at least three times in triplicate. 8) Statistic Analysis : Statistic significance was an alyzed by unpaired Student’s t test, and P 0.05 was considered to be statistically significant. Results: 1) MiR-155 Is a Determinant in Chemosensitivity of Breast Cancer : In light of several studies, including ours, showing frequent upr egulation of miR-155 in breast cancer (13, 15, 20), we examined the role of miR-155 in breast cancer cell growth, survival and response to chemotherapeutic agents. Ini tially, we evaluated mi R-155 expression in 12 breast cancer cell lines by quantitative RT -PCR. Three cell lines, MDA-MB-157, MDA-

PAGE 93

80 MB-435, and HS578T, had significantly elev ated levels of miR-155 whereas the remaining cell lines had lo wer expression of miR-155 ( Figure 11A and Table 1 ). To examine the effect of miR-155 on chemosensitiv ity, we ectopically expressed miR-155 in BT-474 (e.g., low miR-155) and knocked dow n miR-155 in HS578T (e.g., high miR-155) cells. The cells infected with lentiviral vector and transfected with scrambled RNA oligonucleotides were used as controls ( Figures 11B and 11C ). Notably, modulation of miR-155 alone is sufficient to significantly affect cell growth and the programmed cell death, i.e., ectopic expression of miR-155 in BT-474 promotes cell pr oliferation and cell survival ( Figures 11 D-F ; P <0.05) whereas depletion of miR-155 in HS578T induces cell growth arrest and apoptosis ( Figures 11G-I ; P <0.01). Moreover, expression of miR155 renders BT-474 cells resistance to doxorubicin, VP16 and paclitaxel ( Figures 11E and 11F ). On the other hand, knockdown of miR-155 sensitizes HS578T cells to apoptosis induced by doxorubici n, VP16 and/or paclitaxel ( Figures 11H and 11I ). These data indicate that miR-155 is a determinant of chemosensitivity in breast cancer cells.

PAGE 94

81

PAGE 95

82 FIGURE 11. MiR-155 Induces Breast Cancer Ce ll Growth and Survival and Chemoresistance. ( A ) miR-155 and U6 expression in 12 breast cancer cell lines was determined by real-time PCR. Relative expression was calcul ated by obtaining CT, where the CT value of miR-155 was divided by the U6 CT from the same sample, the resulting value was then transformed by applying 2^-( CT). ( B and C ) Northern blot. BT-474, expressing low endogenous miR-155, wa s stably infected with lentivirus expressing miR-155 and vector (B). HS578T cells, presenting high endogenous miR-155, were transfected with anti-miR-155 (ASO) and c ontrol oligo (C). Af ter incubation of 24 h, total RNAs were isolated and subjected to No rthern blot analysis w ith indicated probes. ( D F ) Expression of miR-155 induces cell growt h, survival and chem oresistance. miR155and vector-infected or oligo mimics tran sfected BT-474 cells were treated with and without doxorubicin for indicate d times (D) or indicated chem otherapeutic agents for 24 h (E and F). The growth curve was determin ed by counting cell numbe r at different time points (D). Apoptosis was assayed with Cell Death Detection ELISAPLUS kit (E) and caspase 3/7 activity (F). ( G I ) Knockdown of miR-155 inhi bits cell growth/survival and sensitizes cells to chemotherapeutic dr ug-induced cell growth arrest and apoptosis. Anti-miR-155 and scramble oligonucleotide-tr eated HS578T cells were treated with the same agents and assayed with the same meth ods as described in panels D-F. Data represent three independent experime nts with four replicates each. Asterisks indicate p < 0.05.

PAGE 96

83

PAGE 97

84 2) FOXO3a is Negatively Regulated by MiR-155 : Since miR-155 plays a significant role in cell growth and the programme d cell death, we performed in silico search for miR-155 targets using MicroRNA.org, TargetScan, MicroCosm, and RNA 22. The 3'UTR of FOXO3a, a key transcriptiona l factor in regulation of cell growth and apoptosis (32,43,44), was found to contain a motif (3370 – 3392 bp NM_001455) that matches with the “seed” sequence of miR-155 ( Figure 12A ). Since BT-474 and MDA-MB-468 cells norma lly express low levels of miR-155 and high FOXO3a ( Figures 12B and 14A ), we transfected the cells with pre-miR-155. This resulted in about 50-60% reducti on of endogenous total FOXO3a proteins ( Figure 12B and data not shown). In contrast, HS 578T and MDA-MB-157 normally expresses low FOXO3a proteins and high miR-155 ( Figures 12C and 14A ), so we proceeded to suppress miR-155 expression with miR-155 ASO. This resulted in an increase of endogenous FOXO3a protein ( Figure 12C and data not shown). However, RT-PCR analysis revealed that FOXO3a mRNA levels remained unchanged ( Figures 12B and 12C ), indicating miR-155 targets FOXO3a by translational inhibition, not mRNA degradation. 3) 3’UTR of FOXO3a Interacts with MiR-155 : To investigate whether miR-155 repression of FOXO3a is mediated by dire ct interaction of miR-155 with FOXO3a3’UTR, we cloned two tandem repeats of wild type (WT) miR-155-FOXO3a miR-155 response element (MRE), or mutant (MUT) into pMIR-REPORT plasmid downstream of luciferase ( Figures 12A and 12D ). Basal levels of pMIR-FOXO3a reporter activity were examined in 2 miR-155 low (MDA-MB-468 a nd BT-474) and 2 mi R-155 high (HS578T

PAGE 98

85 and MDA-MB-157) cell lines. As shown in Figure 12E the reporter activities are reversely correlated with miR-155 expression le vels, i.e., the activity is high in miR-155 low cells (e.g., MDA-MB-468 and BT-474) and low in miR-155 high cells (e.g., (HS578T and MDA-MB-157). Further, e xpression of miR-155 represses pMIRFOXO3a-WT but not pMIR-FOXO3a-MUT reporter activity in BT-474 ( Figure 12F ). In contrast, co-transfection of mi R-155 ASO and pMIR-FOXO3a-WT in HS578T resulted in an increase of luciferase activity, but the same experiment carried out with the MUT construct resulted in little change ( Figure 12G ). These data indicate that miR-155 directly targets FOXO3a 3’UTR at MRE ( Figures 12A and 12D ) to repress FOXO3a protein expression.

PAGE 99

86

PAGE 100

87 FIGURE 12. MiR-155 Targets FOXO3a through Interaction with FOXO3a-3’UTR. ( A ) Sequence alignment of the human miR155 sequences with a region of the FOXO3a 3 -UTR (top). Bottom panel shows mutant of FOXO3a-3’UTR (seed sequence mutation) for pMIR-REPORTER, and th e mutant nucleotid es are bolded. ( B ) Expression of miR-155 reduces FOXO3a protei n but not mRNA levels. BT-474 cells were transfected with pre-mi R-155 or control oligo and then subjected to Western (top 2 panels), RT-PCR (panels 3 and 4) and Northern blot (panels 5 and 6) analyses. Bottom panels are quantification of levels of FOXO3a and miR-155. ( C ) Knockdown of miR155 induces FOXO3a protein level. Hs578T cells were transfected with miR-155 ASO and control oligo for 24 hours then examin ed for FOXO3a and miR-155 levels as described in panel B. Actin was used as loading control for Western and RT-PCR analysis. miR-155 was normalized by U6. ( D ) Tandem repeats of depicted sequences of WT and MUT FOXO3a 3’UTR was used for cloning into pMIR-REPORT vector downstream of luciferase gene. Cloning strate gy detailed in Experimental Procedure. ( E G ) Luciferase reporter assay. Indicated cells were transfected with indicated plasmids and oligo as well as -galactosidase. After 24 h incubati on, cells subjected to luciferase assay. Luciferase activity was normalized with -galactosidase. Relative luciferase activities are presented. Data represent th ree independent experiments in triplicate. Asterisks indicate p < 0.05.

PAGE 101

88 4) Downstream Targets of FOXO3a were Inhibited by MiR-155 : Since FOXO3a is an important transcriptional factor that regulates proapoptotic and growth inhibition genes, we next examined if expression of Bi m and p27, two major downstream targets of FOXO3a, is affected by modulation of mi R-155 in breast cancer. Immunoblotting analysis with anti-Bim and -p27 antibodies re vealed that basal le vels of Bim and p27 were reduced by stable expressi on of miR-155 in BT-474 cells ( lanes 1 and 4 of Figure 13A ) but increased by knockdown of miR-155 in HS578T ( lanes 1 and 4 of Figure 13C ). It has been demonstrated that doxorubi cin induces/activates FOXO3a to promote apoptosis (45) Thus, we further determined the effect of miR-155 on doxorubicininduced FOXO3a and apoptosis. Figures 13A and 13B shows that expr ession of miR155 considerably reduced th e effects of doxorubicin on FOXO3a, Bim and p27 expression and PARP cleavage and apoptosis In contrast, depletion of miR-155 enhances doxorubicin-stimulated FOXO3a, Bim and p27 expression as well as PARP cleavage and apoptosis ( Figures 13C and 13D ). These results fu rther support the finings of induction of cell survival and grow th by miR-155 through targeting FOXO3a.

PAGE 102

89 FIGURE 13. MiR-155 Inhibi ts FOXO3a Downstream Targ ets, Bim and p27, and Modulates Doxorubicin Effects on FOXO3a/Bim/p27 and Apoptosis. Lenti-miR155and vector-stably infected BT-474 cells were treated with doxorubicin at indicated time points and then subjected to immunoblotti ng analysis with indicated antibodies ( A ) and apoptosis assay ( B ). ( C and D ) Control and anti-miR-155 oligo-treated HS578T cells were treated and analyzed as described in panels A and B. Apoptosis experiments were repeated three times in triplicate.

PAGE 103

90 5) Introduction of FOXO3a cDNA Lacking 3'-UTR Largely Abrogates MiR-155 Cellular Function : Since miR-155 directly targets FOXO3a through interaction between FOXO3a 3’UTR and miR-155, we reasoned that ectopic expression of FOXO3a by transfection of the cDNA that only contains the coding region of FOXO3a should escape the regulation by miR-155 and thus attenuate or decrease miR-155 function. To this end, pcDNAFOXO3a lacking 3'-UTR was introduced into miR-155 -stably infected BT-474 cells and then treated with and without doxorubicin for 24 h. Immunoblotting analysis revealed that the expression of FOXO3 a largely attenuated miR-155-i nhibitory effect on Bim and p27 expression and PARP cleavage ( lanes 2 and 3 of Figure 14A ). Further, miR-155inhibited apoptosis induced by doxorubicin was also abrogate d by ectopic expression of FOXO3a ( Figure 14B ). Based on these findings, we conclude that the FOXO3a is a major target of miR-155 and largely mediates miR-155 anti-apoptotic function.

PAGE 104

91

PAGE 105

92 FIGURE 14 Transfection of FOXO3a cDNA Lacking 3'-UTR Overrides MiR-155 Effects on Bim and p27 Expression and Cell Survival. BT-474 cells were transfected with indicated constructs and then i mmunoblotted with indicated antibodies ( A ). After treatment with and without doxorubicin, cells were assayed for apoptosis ( B ), and caspase 3/7 activity ( C ). *, p < 0.05. Error bars, S.E.

PAGE 106

93 6) Inverse Correlation of Expression of MiR-155 and FOXO3a in Breast Cancer : Having demonstrated FOXO3a as a major target of miR-155, we next investigated the correlation of between miR-155 and FOXO3a expression in breast cancer cell lines and breast tumors. Of 12 cell lines examined, 3 e xpressing high levels of miR-155 exhibited undetectable or low level of FOXO3a. Of 9 cell lines with low levels of miR-155, 8 express high levels of FOXO3a ( Figure 15A ). Moreover, we examined 77 human breast cancer specimens and 11 normal breast ti ssues with Western, Northern blots, immunohistochemical st aining and miRNA-LNA in situ hybridization. Upregulation of miR-155 was detected in 55 breast ca ncers and 1 normal breast tissues ( Figures 15B-D ). Of the 55 tumors with elevated miR-155, 41 (75%) had low levels of FOXO3a ( P <0.001). However, 16 of 22 (73%) specimens with dow nregulated miR-155 present high levels of FOXO3a ( Figure 15E ). In addition, we examined miR-155 and FOXO3a levels in 38 recurrent breast cancers due to chemoor /and radio-resistance. Immunoblotting and qRT-PCR analyses show that 31 recurrent tumors express elevated miR-155 and low FOXO3a ( P <0.001; Figure 15D and data not shown). These findings indicate that miR155 regulation of FOXO3a in vivo and that elevated miR-155 is associated with chemoor/and radio-resi stance in breast cancer.

PAGE 107

94

PAGE 108

95 Figure 15. MiR-155 Inversely Correlates with FOXO3a Expression in Breast Cancer Tissue and Cell Lines. ( A ) Western (top 2 panels) a nd Northern (panels 3 and 4) analyses of 12 breast cell lines for expression of FOXO 3a and miR-155. Bottom panel shows the quantification of FOXO3a and miR-155. ( B and C ) Expression of FOXO3a and miR-155 was analyzed in representative of breast tumors with Western/Northern blot (B), miR-155 LNA-ISH and immunohi stochemical staining (C). ( D ) Representatives of recurrent tumors (RT) were analyzed w ith qRT-PCR (top; miR-155) and immunoblotting analysis (bottom). ( E ) Chi-square test analysis of miR-155 and FOXO3a expression in 77 breast cancer specimens examined. The i nverse correlation is significant (p<0.001).

PAGE 109

96 Discussion: MiR-155 has emerged as an essential regulat or of cellular physiology; particularly important in the mammalian immune system (23, 36, 37). For instance, miR-155 is detected during an immune response in ac tivated mature B and T lymphocytes (46), germinal centers B cells (23), and monoc ytes (21). BIC/miR-155 knock-out mice resulted in impaired immune response and cytokine production ( 23), further supporting the vital role of miR-155 in immunology. Beyond immuno logy and into the realm of development, Down syndrome or Trisomy 21 was recently linked with high levels of miR-155 and thus provide further insights to the resulting cognitive impairment and congenital heart defects seen in patients (4 7). In cancer, deregulation of miR-155 is implicated in a wide spectrum of maligna ncy including various forms of lymphoma, breast, lung, pancreatic head and neck, and kidney cance r (9, 11, 13-15). In immunology and lymphoma, miR-155 has been extensively investigated; however, it is only evident that miR-155 expression is el evated in breast cancer (13, 15) and detailed function remains elusive. We demonstrate in this study that miR-155 is a determinant of chemosensitivity by targeting FOXO3a in breas t cancer. We show that miR-155 directly interacts with 3’UTR of FOXO3a and blocks FOXO3a translation. As a result, Bim and p27, major downstream targets of FOXO3a, are inhibited by miR-155. Ectopic expression of FOXO3a largely abrogated miR155-induced chemoresistance. In addition, inverse correlation between miR-155 and FO XO3a expression was detected in breast cancer cell lines and tumors. These findi ngs demonstrate for the first time that deregulation of miR-155 in breast cancer is associated with chemosensitivity and that FOXO3a is a bona fide target of miR-155.

PAGE 110

97 FOXO3a is a well studied transcriptional factor that contains a fork head DNA binding domain, and plays a crucial role in apoptosis and cell grow th by transcriptional regulation of a number of apoptosis/ce ll growth-associated genes (24, 32, 43). Overexpression of FOXO3a has been shown to inhibit tumor growth in vitro and tumor size in vivo in breast cancer cells (28, 48). In addition, genetic deletion of all FOXOs (FOXO1, FOXO3 and FOXO4) alleles generate s progressive cancer ous phenotypes, such as thymic lymphomas and hemangiomas ( 49). These data elucidated FOXOs as bona fide tumor suppressor genes. Recent studies also reveal the importance of FOXOs in preserving the self-renewal capacity of hema topoietic stem cells (50,51). Moreover, FOXO3a has been reported to be deregulat ed in breast cancer and loss of FOXO3a is often linked to a decline in apoptotic activit y and increased chemor esistance in cancer cells (43, 52-58). In addition, post-translational regulation of FOXOs has been wildly studied. Our finding of miR-155 negative re gulation of FOXO3a not only provides an underlying mechanism for aberrant expression of FOXO3a in breast cancer but also reveals regulation of FOXO at post-transcriptional level. In an earlier work, we demonstrat ed that miR-155 is induced by TGF in mouse mammary epithelial cell, NMuMG. E xpression of miR-155 promotes whereas knockdown of miR-155 reduces TGF -induced tight junction di ssolution, cell migration and invasion by targeting RhoA (20). Pr evious studies have shown that miR-155 regulates a number of genes which are invol ved in immune response, inflammation and cell growth/survival. The transcription factors Pu1 and inositol phosphatase SHIP1 have been validated previously as direct ta rgets of the miR-155-mediated immuno-response (40, 59). BACH1 and ZIC3 are targeted by miR-155 and mediate miR-155 function in

PAGE 111

98 viral infection (60,61). Moreover, miR-155 represses tumor protein 53-induced nuclear protein 1 (TP53NP1), leading to pancrea tic tumor development (62). In addition, two studies using gene expression microarray analyses showed that miR-155 and its viral orthologue Kaposi's sarcoma-associated herpesvirus miR-K12-11 negatively regulate more than 180 mRNAs, some of which encode proteins involved in cell growth and survival, including CDKN1B/p27kip1, CDKN1C/p57kip2 and GSK3 (60, 61). Thus, FOXO3a is a major but not ne cessary the only target that mediates miR-155 function in the control of cell growth, survival and chemosensitivity. Finally, we noticed that miR155 is more frequently upregulated in breast tumors than cancer cell lines. A possible reason is that miR-155 in tumor cells could be induced by cytokines that are released from the tumor microenvironment. In agreement with this notion, miR-155 has been shown to be transcriptionally regulated by NF B, AP1, and Foxp3 in response to cytokines during immune cells maturation and development (36, 63-65). We also demonstrated transcri ptional regulation of miR-155 via TGF /Smad pathway (20). In addition, accumulated stud ies show that gene expression, biology and clinical outcome of cancer ar e significantly influenced by th e microenvironment (66, 67). Three-dimensional culture model has b een established to recapitulate the in vivo functions, interactions and ar chitecture of the mammary gland and breast tumor (66, 67) which more closely resembles tumor microenviro nment than traditional tissue culture. In order to address if miR-155 e xpression is influenced by microenvironment, further investigation is required using 3-D culture system and animal models. In summary, we demonstrated that miR-155 contributes to chemoresistance in breast cancer. FOXO3a is negatively re gulated by miR-155 and mediates miR-155

PAGE 112

99 function in the control of breast cancer cell su rvival and growth. In combination with our previous findings of miR-155 induction of EMT, cell migration and invasion in mammary epithelial cell, miR-155, therefore, is a critical therapeu tic target for breast cancer intervention. References: 1. Bartel, D. P. 2009. MicroRNAs: target r ecognition and regulatory functions. Cell 136:215-33. 2. Lagos-Quintana, M., R. Rauhut, W. Lendeckel, and T. Tuschl. 2001. Identification of novel genes coding fo r small expressed RNAs. Science 294:8538. 3. Lau, N. C., L. P. Lim, E. G. Weinstei n, and D. P. Bartel. 2001. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294:858-62. 4. Lee, R. C., R. L. Feinbaum, and V. Ambros. 1993. The C. elegans heterochronic gene lin-4 encodes small RNAs with an tisense complementar ity to lin-14. Cell 75:843-54. 5. Calin, G. A., C. D. Dumitru, M. Shimizu, R. Bichi, S. Zupo, E. Noch, H. Aldler, S. Rattan, M. Keating, K. Rai, L. Rassenti, T. Kipps, M. Negrini, F. Bullrich, and C. M. Croce. 2002. Frequent deletions and down-regulation of microRNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc Natl Acad Sci U S A 99:15524-9. 6. Calin, G. A., M. Ferracin, A. Cimmino, G. Di Leva, M. Shimizu, S. E. Wojcik, M. V. Iorio, R. Visone, N. I. Sever, M. Fabbr i, R. Iuliano, T. Palumbo, F. Pichiorri, C. Roldo, R. Garzon, C. Sevignani, L. Rassenti, H. Alder, S. Volinia, C. G. Liu, T. J. Kipps, M. Negrini, and C. M. Croce. 2005. A MicroRNA signature associated with prognosis and progression in chroni c lymphocytic leukemia. N Engl J Med 353:1793-801. 7. Johnson, S. M., H. Grosshans, J. Shinga ra, M. Byrom, R. Jarvis, A. Cheng, E. Labourier, K. L. Reinert, D. Brown, and F. J. Slack. 2005. RAS is regulated by the let-7 microRNA family. Cell 120:635-47. 8. Chan, J. A., A. M. Krichevsky, a nd K. S. Kosik. 2005. MicroRNA-21 is an antiapoptotic factor in human gliobl astoma cells. Cancer Res 65:6029-33.

PAGE 113

100 9. Eis, P. S., W. Tam, L. Sun, A. Chadburn, Z. Li, M. F. Gomez, E. Lund, and J. E. Dahlberg. 2005. Accumulation of mi R-155 and BIC RNA in human B cell lymphomas. Proc Natl Acad Sci U S A 102:3627-32. 10. He, L., J. M. Thomson, M. T. Hemann, E. Hernando-Monge, D. Mu, S. Goodson, S. Powers, C. Cordon-Cardo, S. W. Lo we, G. J. Hannon, and S. M. Hammond. 2005. A microRNA polycistron as a poten tial human oncogene. Nature 435:82833. 11. Kluiver, J., S. Poppema, D. de Jong, T. Blokzijl, G. Harms, S. Jacobs, B. J. Kroesen, and A. van den Berg. 2005. BIC and miR-155 are highly expressed in Hodgkin, primary mediastinal and diffuse large B cell lym phomas. J Pathol 207:243-9. 12. Chen, H. C., G. H. Chen, Y. H. Chen, W. L. Liao, C. Y. Liu, K. P. Chang, Y. S. Chang, and S. J. Chen. 2009. MicroRNA dere gulation and pathway alterations in nasopharyngeal carcinoma. Br J Cancer 100:1002-11. 13. Iorio, M. V., M. Ferracin, C. G. Liu, A. Veronese, R. Spizzo, S. Sabbioni, E. Magri, M. Pedriali, M. Fabbri, M. Ca mpiglio, S. Menard, J. P. Palazzo, A. Rosenberg, P. Musiani, S. Volinia, I. Nenci, G. A. Calin, P. Querzoli, M. Negrini, and C. M. Croce. 2005. MicroRNA gene e xpression deregulation in human breast cancer. Cancer Res 65:7065-70. 14. Liu, X., Z. Chen, J. Yu, J. Xia, a nd X. Zhou. 2009. MicroR NA Profiling and Head and Neck Cancer. Comp Funct Genomics:837514. 15. Volinia, S., G. A. Calin, C. G. Liu, S. Ambs, A. Cimmino, F. Petrocca, R. Visone, M. Iorio, C. Roldo, M. Ferracin, R. L. Prueit t, N. Yanaihara, G. Lanza, A. Scarpa, A. Vecchione, M. Negrini, C. C. Harris, and C. M. Croce. 2006. A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A 103:2257-61. 16. Wang, X., S. Tang, S. Y. Le, R. Lu, J. S. Rader, C. Meyers, and Z. M. Zheng. 2008. Aberrant expression of oncogenic and tumor-suppressive microRNAs in cervical cancer is requ ired for cancer cell grow th. PLoS One 3:e2557. 17. Yanaihara, N., N. Caplen, E. Bowman, M. Seike, K. Kumamoto, M. Yi, R. M. Stephens, A. Okamoto, J. Yokota, T. Tanaka G. A. Calin, C. G. Liu, C. M. Croce, and C. C. Harris. 2006. Unique microR NA molecular profiles in lung cancer diagnosis and prognosis. Cancer Cell 9:189-98. 18. Raponi, M., L. Dossey, T. Jatkoe, X. Wu, G. Chen, H. Fan, and D. G. Beer. 2009. MicroRNA classifiers for predicting prognos is of squamous cell lung cancer. Cancer Res 69:5776-83.

PAGE 114

101 19. Greither, T., L. F. Grochola, A. Udel now, C. Lautenschlager, P. Wurl, and H. Taubert. Elevated expression of micr oRNAs 155, 203, 210 and 222 in pancreatic tumors is associated with poorer survival. Int J Cancer 126:73-80. 20. Kong, W., H. Yang, L. He, J. J. Zhao, D. Coppola, W. S. Dalton, and J. Q. Cheng. 2008. MicroRNA-155 is regulated by the tr ansforming growth factor beta/Smad pathway and contributes to epithelial cell plasticity by targe ting RhoA. Mol Cell Biol 28:6773-84. 21. Taganov, K. D., M. P. Boldin, K. J. Chang, and D. Baltimore. 2006. NF-kappaBdependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune respons es. Proc Natl Acad Sci U S A 103:12481-6. 22. Costinean, S., N. Zanesi, Y. Pekarsky, E. Tili, S. Volinia, N. Heerema, and C. M. Croce. 2006. Pre-B cell proliferation and lymphoblastic leukemia/high-grade lymphoma in E(mu)-miR155 transgenic mice. Proc Natl Acad Sci U S A 103:7024-9. 23. Thai, T. H., D. P. Calado, S. Casola, K. M. Ansel, C. Xiao, Y. Xue, A. Murphy, D. Frendewey, D. Valenzuela, J. L. Kut ok, M. Schmidt-Supprian, N. Rajewsky, G. Yancopoulos, A. Rao, and K. Rajewsky. 2007. Regulation of the germinal center response by microRNA-155. Science 316:604-8. 24. Anderson, M. J., C. S. Viars, S. Czek ay, W. K. Cavenee, and K. C. Arden. 1998. Cloning and characterization of three human forkhead genes that comprise an FKHR-like gene subfamily. Genomics 47:187-99. 25. Brunet, A., J. Park, H. Tran, L. S. H u, B. A. Hemmings, a nd M. E. Greenberg. 2001. Protein kinase SGK mediates surv ival signals by phosphorylating the forkhead transcription factor FKHR L1 (FOXO3a). Mol Cell Biol 21:952-65. 26. Brunet, A., A. Bonni, M. J. Zigmond, M. Z. Lin, P. Juo, L. S. Hu, M. J. Anderson, K. C. Arden, J. Blenis, and M. E. Gree nberg. 1999. Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell 96:857-68. 27. Plas, D. R., and C. B. Thompson. 2003. Ak t activation promotes degradation of tuberin and FOXO3a via the pr oteasome. J Biol Chem 278:12361-6. 28. Hu, M. C., D. F. Lee, W. Xia, L. S. Go lfman, F. Ou-Yang, J. Y. Yang, Y. Zou, S. Bao, N. Hanada, H. Saso, R. Kobayash i, and M. C. Hung. 2004. IkappaB kinase promotes tumorigenesis through inhibition of forkhead FOXO3a. Cell 117:225-37. 29. Dijkers, P. F., R. H. Medema, J. W. La mmers, L. Koenderman, and P. J. Coffer. 2000. Expression of the pro-apoptotic Bcl-2 family member Bim is regulated by the forkhead transcription fact or FKHR-L1. Curr Biol 10:1201-4.

PAGE 115

102 30. Dijkers, P. F., R. H. Medema, C. Pals, L. Banerji, N. S. Thomas, E. W. Lam, B. M. Burgering, J. A. Raaijmakers, J. W. Lammers, L. Koenderman, and P. J. Coffer. 2000. Forkhead transcription f actor FKHR-L1 modulates cytokinedependent transcriptional regulation of p27(KIP1). Mol Cell Biol 20:9138-48. 31. Park, S., J. Guo, D. Kim, and J. Q. Ch eng. 2009. Identification of 24p3 as a direct target of Foxo3a regulated by interleukin-3 through the phosphoinositide 3kinase/Akt pathway. J Biol Chem 284:2187-93. 32. Tran, H., A. Brunet, J. M. Grenier, S. R. Datta, A. J. Fornace, Jr., P. S. DiStefano, L. W. Chiang, and M. E. Greenberg. 2002. DNA repair pathway stimulated by the forkhead transcription factor FOXO3 a through the Gadd45 protein. Science 296:530-4. 33. Skurk, C., H. Maatz, H. S. Kim, J. Ya ng, M. R. Abid, W. C. Aird, and K. Walsh. 2004. The Akt-regulated forkhead tran scription factor FOXO3a controls endothelial cell viability th rough modulation of the ca spase-8 inhibitor FLIP. J Biol Chem 279:1513-25. 34. Tang, T. T., D. Dowbenko, A. Jackson, L. Toney, D. A. Lewin, A. L. Dent, and L. A. Lasky. 2002. The forkhead transcrip tion factor AFX activates apoptosis by induction of the BCL-6 transcriptiona l repressor. J Biol Chem 277:14255-65. 35. Teng, G., P. Hakimpour, P. Landgraf, A. Ri ce, T. Tuschl, R. Casellas, and F. N. Papavasiliou. 2008. MicroRNA-155 is a nega tive regulator of activation-induced cytidine deaminase. Immunity 28:621-9. 36. O'Connell, R. M., K. D. Taganov, M. P. Boldin, G. Cheng, and D. Baltimore. 2007. MicroRNA-155 is induced during the macrophage inflammatory response. Proc Natl Acad Sci U S A 104:1604-9. 37. Ceppi, M., P. M. Pereira, I. Dunand-Saut hier, E. Barras, W. Reith, M. A. Santos, and P. Pierre. 2009. MicroRNA-155 modul ates the interleukin-1 signaling pathway in activated human monocyte-derived dendritic ce lls. Proc Natl Acad Sci U S A 106:2735-40. 38. Martin, M. M., E. J. Lee, J. A. Buckenbe rger, T. D. Schmittgen, and T. S. Elton. 2006. MicroRNA-155 regulates human angiot ensin II type 1 receptor expression in fibroblasts. J Biol Chem 281:18277-84. 39. Dorsett, Y., K. M. McBride, M. Jankovi c, A. Gazumyan, T. H. Thai, D. F. Robbiani, M. Di Virgilio, B. R. San-Mar tin, G. Heidkamp, T. A. Schwickert, T. Eisenreich, K. Rajewsky, and M. C. Nussenzweig. 2008. MicroRNA-155 suppresses activation-induced cytid ine deaminase-mediated Myc-Igh translocation. Immunity 28:630-8.

PAGE 116

103 40. O'Connell, R. M., A. A. Chaudhuri, D. S. Rao, and D. Baltimore. 2009. Inositol phosphatase SHIP1 is a primary target of miR-155. Proc Natl Acad Sci U S A 106:7113-8. 41. Pedersen, I. M., D. Otero, E. Kao, A. V. Miletic, C. Hother, E. Ralfkiaer, R. C. Rickert, K. Gronbaek, and M. David. 2009. Onco-miR-155 targets SHIP1 to promote TNFa-dependent growth of B cell lymphomas. EMBO Mol Med 1:288295. 42. Yang, H., W. Kong, L. He, J. J. Zhao, J. D. O'Donnell, J. Wang, R. M. Wenham, D. Coppola, P. A. Kruk, S. V. Ni cosia, and J. Q. Cheng. 2008. MicroRNA expression profiling in human ovarian can cer: miR-214 induces cell survival and cisplatin resistance by targeti ng PTEN. Cancer Res 68:425-33. 43. Sunters, A., S. Fernandez de Mattos, M. Stah l, J. J. Brosens, G. Zoumpoulidou, C. A. Saunders, P. J. Coffer, R. H. Medema, R. C. Coombes, and E. W. Lam. 2003. FoxO3a transcriptional regulat ion of Bim controls apoptos is in paclitaxel-treated breast cancer cell lines. J Biol Chem 278:49795-805. 44. Barthelemy, C., C. E. Henderson, and B. Pettmann. 2004. Foxo3a induces motoneuron death through the Fas pathway in cooperation with JNK. BMC Neurosci 5:48. 45. Hui, R. C., R. E. Francis, S. K. Guest, J. R. Costa, A. R. Gomes, S. S. Myatt, J. J. Brosens, and E. W. Lam. 2008. Doxor ubicin activates FOXO3a to induce the expression of multidrug resistance gene ABCB1 (MDR1) in K562 leukemic cells. Mol Cancer Ther 7:670-8. 46. Turner, M., and E. Vigorito. 2008. Regulati on of Band T-cell differentiation by a single microRNA. Biochem Soc Trans 36:531-3. 47. Kuhn, D. E., G. J. Nuovo, M. M. Martin, G. E. Malana, A. P. Plei ster, J. Jiang, T. D. Schmittgen, A. V. Terry, Jr., K. Gardiner, E. Head, D. S. Feldman, and T. S. Elton. 2008. Human chromosome 21-derived miRNAs are overexpressed in down syndrome brains and hearts. Bioc hem Biophys Res Co mmun 370:473-7. 48. Yang, J. Y., C. S. Zong, W. Xia, H. Yama guchi, Q. Ding, X. Xie, J. Y. Lang, C. C. Lai, C. J. Chang, W. C. Huang, H. Huang, H. P. Kuo, D. F. Lee, L. Y. Li, H. C. Lien, X. Cheng, K. J. Chang, C. D. Hsiao, F. J. Tsai, C. H. Tsai, A. A. Sahin, W. J. Muller, G. B. Mills, D. Yu, G. N. Hortobagyi, and M. C. Hung. 2008. ERK promotes tumorigenesis by inhibiting F OXO3a via MDM2-mediated degradation. Nat Cell Biol 10:138-48.

PAGE 117

104 49. Paik, J. H., R. Kollipara, G. Chu, H. Ji, Y. Xiao, Z. Ding, L. Miao, Z. Tothova, J. W. Horner, D. R. Carrasco, S. Jiang, D. G. Gilliland, L. Chin, W. H. Wong, D. H. Castrillon, and R. A. DePinho. 2007. FoxO s are lineage-restricted redundant tumor suppressors and regulate endothel ial cell homeostasis. Cell 128:309-23. 50. Miyamoto, K., K. Y. Araki, K. Naka F. Arai, K. Takubo, S. Yamazaki, S. Matsuoka, T. Miyamoto, K. Ito, M. Ohmura C. Chen, K. Hosokawa, H. Nakauchi, K. Nakayama, K. I. Nakayama, M. Harada N. Motoyama, T. Suda, and A. Hirao. 2007. Foxo3a is essential for maintenance of the hematopoietic stem cell pool. Cell Stem Cell 1:101-12. 51. Tothova, Z., R. Kollipara, B. J. Huntly, B. H. Lee, D. H. Castrillon, D. E. Cullen, E. P. McDowell, S. Lazo-Kallanian, I. R. Williams, C. Sears, S. A. Armstrong, E. Passegue, R. A. DePinho, and D. G. Gilli land. 2007. FoxOs are critical mediators of hematopoietic stem cell resistance to physiologic oxidative stress. Cell 128:325-39. 52. Belguise, K., S. Guo, and G. E. So nenshein. 2007. Activation of FOXO3a by the green tea polyphenol epigallocatechin-3-ga llate induces estrogen receptor alpha expression reversing invasive phenotype of breast cancer cells. Cancer Res 67:5763-70. 53. Radisavljevic, Z. 2003. Nitric oxide s uppression triggers apoptosis through the FKHRL1 (FOXO3A)/ROCK kinase pathway in human breast carcinoma cells. Cancer 97:1358-63. 54. Sunters, A., P. A. Madureira, K. M. Pomeranz, M. Aubert, J. J. Brosens, S. J. Cook, B. M. Burgering, R. C. Coombes, and E. W. Lam. 2006. Paclitaxel-induced nuclear translocation of FOXO3a in breas t cancer cells is mediated by c-Jun NH2terminal kinase and Akt. Cancer Res 66:212-20. 55. Krol, J., R. E. Francis, A. Albergaria, A. Sunters, A. Polychronis, R. C. Coombes, and E. W. Lam. 2007. The transcription fact or FOXO3a is a crucial cellular target of gefitinib (Iressa) in breast ca ncer cells. Mol Cancer Ther 6:3169-79. 56. Stan, S. D., E. R. Hahm, R. Warin, and S. V. Singh. 2008. Withaferin A causes FOXO3aand Bim-dependent apoptosis a nd inhibits growth of human breast cancer cells in vivo. Cancer Res 68:7661-9. 57. Zou Zou, Y., W. B. Tsai, C. J. Cheng, C. Hsu, Y. M. C hung, P. C. Li, S. H. Lin, and M. C. Hu. 2008. Forkhead box transc ription factor FO XO3a suppresses estrogen-dependent breast ca ncer cell proliferation a nd tumorigenesis. Breast Cancer Res 10:R21.

PAGE 118

105 58. Morelli, C., M. Lanzino, C. Garofalo, P. Maris, E. Brunelli, I. Casaburi, S. Catalano, R. Bruno, D. Sisci, and S. Ando. 2009. Akt2 inhibition enables the Forkhead transcription factor FoxO3a to a repressive role for ER{alpha} transcriptional activity in breast cancer cells. Mol Cell Biol. 59. Vigorito, E., K. L. Perks, C. Abreu-G oodger, S. Bunting, Z. Xiang, S. Kohlhaas, P. P. Das, E. A. Miska, A. Rodriguez, A. Bradley, K. G. Smith, C. Rada, A. J. Enright, K. M. Toellner, I. C. Macl ennan, and M. Turner. 2007. microRNA-155 regulates the generation of immunoglobul in class-switched plasma cells. Immunity 27:847-59. 60. Skalsky, R. L., M. A. Samols, K. B. Plaisa nce, I. W. Boss, A. Riva, M. C. Lopez, H. V. Baker, and R. Renne. 2007. Kaposi's sarcoma-associated herpesvirus encodes an ortholog of miR-155. J Virol 81:12836-45. 61. Gottwein, E., N. Mukherjee, C. Sachse, C. Frenzel, W. H. Majoros, J. T. Chi, R. Braich, M. Manoharan, J. Soutschek, U. Ohler, and B. R. Cullen. 2007. A viral microRNA functions as an orthologue of cellular miR-155. Nature 450:1096-9. 62. Gironella, M., M. Seux, M. J. Xie, C. Cano, R. Tomasini J. Gommeaux, S. Garcia, J. Nowak, M. L. Yeung, K. T. Jea ng, A. Chaix, L. Fazli, Y. Motoo, Q. Wang, P. Rocchi, A. Russo, M. Gleave, J. C. Dagorn, J. L. Iovanna, A. Carrier, M. J. Pebusque, and N. J. Dusetti. 2007. Tumo r protein 53-induced nuclear protein 1 expression is repressed by miR-155, and its restoration inhibits pancreatic tumor development. Proc Natl Acad Sci U S A 104:16170-5. 63. Kluiver, J., A. van den Be rg, D. de Jong, T. Blokzijl, G. Harms, E. Bouwman, S. Jacobs, S. Poppema, and B. J. Kroe sen. 2007. Regulation of pri-microRNA BIC transcription and processing in Bu rkitt lymphoma. Oncogene 26:3769-76. 64. Zheng, Y., S. Z. Josefowicz, A. Kas, T. T. Chu, M. A. Gavin, and A. Y. Rudensky. 2007. Genome-wide analysis of Foxp3 target genes in devel oping and mature regulatory T cells. Nature 445:936-40. 65. Yin, Q., X. Wang, J. McBride, C. Fewell, and E. Flemington. 2008. B-cell receptor activation induces BIC/miR-155 expression through a conserved AP-1 element. J Biol Chem 283:2654-62. 66. Weigelt, B., and M. J. Bissell. 2008. Unraveling the microenvironmental influences on the normal mammary gland and breast cancer. Semin Cancer Biol 18:311-21. 67. Lee, E. Y., W. H. Lee, C. S. Kaetzel, G. Parry, and M. J. Bissell. 1985. Interaction of mouse mammary epithelial cells with collagen substrata: regulation of casein gene expression and secretion. Pr oc Natl Acad Sci U S A 82:1419-23.

PAGE 119

106 CHAPTER IV ELEVATED MICRORNA-155 IS ASSOCIATED WITH POOR PROGNOSIS IN BREAST CANCER Abstract: MicroRNA-155 is often upregulated in various types of malignancy, including breast cancer. However, the clinical and pa thological significance of deregulation of miR-155 remain elusive in breast cancer. Here, we evaluated mi R-155 expression in 154 primary breast cancers and 69 normal mammry ti ssues. Increase levels of miR-155 were oberserved in 67 (43.5%) patien ts with breast can cer as compared to normal tissue controls. Elevated miR-155 is associated with high grade (49/76, 64.5% versus low grad 18/78, 23.1%) and late stage (37/70, 52.9% vers us early stage 30/84, 35.7%) of tumors as well as invasive (53/85, 62.4% versus noninvasive 14/69, 20.3%) breast carcinoma. More significantly, miR-155 is frequently ov erexpressed in lymph node-positive tumor (i.e., 10; 20/32, 62.5%) than node-negative (i.e ., < 10; 47/122, 38.2%). MiR-155 levels do not correlate to ER, PR, and Her2/neu expression. Furthermore, patients whose tumors express high levels of miR-155 have sh orter overall survival than those of tumors with low levels of miR-155. These findings indicate that miR-155 is unfavorable prognostic marker and could be a critical targ et for triple-negative breast cancer while the molecular mechanism needs to be further investigated.

PAGE 120

107 Introduction: Breast cancer is the most common cancer am ong women in the Un ited States. In 2009, over 192,370 women were diagnosed with br east cancer, and close to 40,170 died from this disease. Clinical features such as the tumor size, extent of lymph node involvement, and distant metastasis at dia gnosis have all been integrated into the American Joint Committee on Cancer (AJCC) TNM classification standard and still play a central role in determining prognosis and treatment course (9, 17, 26, 34, 36). Similarly, estrogen receptor (ER), progest erone receptor (PR), and huma n epidermal growth factor receptor 2 (Her2/neu) statuses have been de fined as important markers of breast cancer pathology decades ago, but are still gold standa rd in prescribing adjuvant therapy today (6, 15, 16, 29, 31, 45, 49). A number of proteincoding genes have be en identified to play important role in breas t cancer development, metastasis and chemoresistance (40); however, the importance of microRNAs (miRNAs) in these processes remains to be fully documented. MiRNAs are a class of small ( ~ 22 nucleotide) noncoding RNAs and negatively regulate protein-coding gene expression by targeting mRNA degradation or translation inhibition (1, 23-25, 38). MicroRNA-155 (miR -155) is often dere gulated in breast carcinoma revealed by several miRNA prof iling studies (18, 44). However, its clinicopathological significance in human breas t cancer is not yet fu lly understood. We have previously shown that miR-155 regulates cell survival, growth and chemosensitivity in breast cancer cells (20). In this study, we examin ed miR-155 levels in 154 primary breast cancer using quantitative Real-Tim e PCR (qRT-PCR), Northern, and Locked Nucleic Acid-miRNA (LNA-miRNA) in situ hybridization (ISH). Elevated levels of

PAGE 121

108 miR-155 are more frequently detected in hi gh grade, late stage and lymph node-positive tumors. Further, miR-155 expression decreas ed patient overall survival. These findings suggest that miR-155 could play a pivotal role in breast tumor progression and serves as a poor prognostic marker and critical therapeutic target in breast cancer. Materials and Methods: 1) Tumor Specimen : All primary human breast cancer (e.g., 154) and normal breast (e.g., 59) specimens were obtained from patients who underwent surgery at H. Lee Moffitt Cancer Center. Each cancer specimen cont ained at least 80% tumor cells as confirmed by microscopic examination. Tissues were pr eserved by snap-freeze and stored at -80OC and formalin fixed paraffin embedded (FFPE) blocks. The following information on the tumors was collected: histology, primary site and laterality, tumor markers ER PR, and Her2/neu, clinical and pathological stage and grade, as well as nodal status. In addition, the following information was collected: age, year first seen, performance status and survival days. All specimens (total 82) were chosen from patients who have at least 120 months (10 years) of follow up documentation as determined by year first seen at Moffitt. 2) RNA Isolation : Total RNA from breast cancer and normal tissues was isolated using TRIZOL reagent (Invitrogen) accord ing to protocol and as pr eviously described (20, 21, 47). 3) QRT-PCR and Northern Blot Analysis : Hsa-miR-155 and U6 microRNA levels were detected using the TaqMan microRNA reverse transcripti on kit (Applied Biosystems) as

PAGE 122

109 previously described (20). Briefly, 200 ng of total RNA from each cell line and tumor RNA were used for primer-specific reverse transcription (RT) in both Hsa-miR-155 and U6, and then 2 l of the RT product was used for subsequent quantitative PCR. The quantitative PCR was performed on an Applied Biosystems 7900HT fast real-time PCR system, and data were collected and analyzed using ABI SDS version 2.3. To calculate relative concentration, miR-155 and U6 CT values for all samples were obtained. A normalized expression for each sample was obtained by dividing the CT value of miR155 by the same sample's U6 CT and designated as CT. This value was then transformed by performing 2 ( C T ). Furthermore, the ( CT) method was used in comparing miR-155 expression in immortalized cells with cancer cells or comparing normal breast with cancer tissues according to the manufacturer's protocol. Northern analysis on breast cancer tissue RNAs were performed as previously described. MiR-155 probe was prepared using the StarfireTM oligonucleotide-labeling kit (IDT-DNA). The expression of miR-155 was determined by comparing the miR155 to U6 ratio between normal mammary and tumor tissues ( i.e. the ratio miR155/U6 of all tested normal mammary tissues were averaged to 1.0, and the cut-off value for overexpression of miR-155 is 2-fold in breast tumors. 4) Locked Nucleic Acid in Situ Hybridization (LNA-ISH) : LNA probes were synthesized complementary to human mature miR-155 (5 CCCCTATCACGATTAGCATTAA-3 ) and scrambled negative control (5 TTCACAATGCGTTATCGGATGT-3 ) and digoxigenin-labeled at the 5 -end (Exiqon).

PAGE 123

110 LNA-ISH on breast cancer Tissue Microarray (TMA) was performed as previously described (20, 21, 48). 5) Statistical Analysis : Correlations of miR155 with tumor grade, stage, and histology were analyzed by X2 testing. For survival analysis, opt imal cut-point wa s selected using X-tile program as described previously (5, 14 ). Monte Carlo simulations were used to adjust for multiple looks in optimal cut-po int selection. Hazard ratios were assessed using the univariate and multivariate Cox proportional hazards model (Log-rank test at = 0.05) based on the cut-point value determined by the X-tile. The regression analyses were adjusted for AJCC TNM staging (I, II, III, and IV), and histolog ical grade (high and low). Confidence intervals (95% CI) for th e corresponding parameters in the multivariate Cox regression model were tabulated in Table 5 Patients’ deaths of non-related breast cancer were censored in the survival analyses at the date of death. These analyses were performed using the SPSS 11.5 Statistical Software and P < 0.05 was considered statistically significant. Results: 1) Frequent Overexpression of MiR-155 in Breast Cancer : In light of a number miRNA profiling studies showing miR-155 up-regulated in breast cancer; we had set out to determine if miR-155 could be used as a tu mor marker in this malignancy. RNA was extracted from eighty-two snap frozen breast cancer specimen and twenty normal breast tissues. The tumor specimens consisted of ductal, lobular, mixe d ductal and lobular, mucinous, and comedeocarcinoma. QRT-PCR for miR-155 and U6 was performed using

PAGE 124

111 TaqMan MicroRNA Assay (Applied Biosystems) as de scribed in Materials and Methods ( Figure 16A ). Quantitation using the delta de lta CT method yi elded expression, including outlier, ranged from 2.3 to 737.7 in reference to normal breast RNA ( Figure 16B ). To validate specificity and accuracy of qRT-PCR, sa mples were randomly chosen for Northern analysis ( Figure 16C ). In agreement to our previous findings (20, 21), miR-155 expression was found lower in norma l breast RNA compared to cancer RNA ( Figure 16B ).

PAGE 125

112 CATEGORY 60 cases 22 cases 20 cases CATEGORY LOWHIGH NORMALmiR-155 q-RT-PCRA B hsa-miR-155 and U6

PAGE 126

113 Weak 5XModerate 5X Strong 5X T1 T2 T3 T4 T5 T6 T7 T8 3.6 6.3 5.8 3.2 1.8 2.9 2.7 4.7 D C T9 T10 T11 T12 N1 N2 N3 4.0 3.7 1.7 6.0 1.4 1.0 1.0 miR-155 U6 miR-155 U6 Figure 16. MiR-155 Expression in Breast Cancer. ( A ) Quantitative real-time PCR was performed in 82 human breast cancer ti ssues and 20 normal human mammary tissues to determine relative miR-155 and U6 expression. ( B ) Relative expre ssion levels were calculated using the CT method, where miR-155 expr ession in breast cancer was compared to that in normal breast tissue a nd U6 expression was used for normalizing RTqPCR samples; and • outlyers. ( C ) Northern analysis fo r verification of miR-155 expression in randomly selected tu mor and normal breast tissues. ( D ) In situ hybridization for miR-155 on breast cancer tis sue microarray: 7 hi gh miR-155 tumors, 65 low to moderate miR-155 tumors, 49 low to moderate or undetectable miR-155 normal tissues.

PAGE 127

114 We have previously used formalin fixed paraffin embedded (FFPE) tissue microarrays (TMA) to determine micr oRNA levels by LNA-ISH (20, 21, 47, 48); therefore, we performed ISH with LNA-miR155 probe (Exiqon) in the same series of breast tumors used for qRT-PCR and Nort hern analysis, as well as 72 additional carcinoma and 49 normal tissues not available in snap frozen tissue. We first evaluated the specificity of LNA-miR-155 probe by performing ISH in miR-155 precursortransfected BT-474 and miR-155-antisense tr ansfected HS578T, cell lines previously determined to be low and high in endogenous miR-155, respectively (2 0). Signals were high in miR-155 transfected BT-474 and pare ntal HS578T, but not detected in control oligo transfected BT-474 and miR-155 ASO transfected HS578T (data not shown), suggesting the LNA-miR-155 probe specifically hybridized to mature miR-155. ISH of primary breast tumors revealed a range of miR-155 staining intensity in tumor regions and were scored by 0, 1, 2, or 3 as determin ed by negative, weak, moderate, or strong respectively ( Figure 16D ). The BT-474 miR-155 transfect ed and endogenous high miR155 HS578T cell line ISH staining scored 3, so only tumor core s with a score of 3 were considered high for miR-155 expression. In c ontrast, normal breast tissue showed low or no detectable levels of miR-155. QRT-PCR, northern, and/or IS H analyses revealed elevat ed levels of miR-155 in 67 of 154 (43.5%) breast cancers examined. Tumor characteristics from all samples are listed in Table 2 Breakdown of miR-155 expression in these samples are summarized in Table 3

PAGE 128

115 Table 2. Clinical and Pathological Data for Breast Tumors in the Independent Validation Cohort Breast cancer clinicopathological charac teristics Number of patients (n=154) Age < 51 67 >51 87 Histologic subtype Ductal carcinoma 135 Lobular 10 Ductal/lobular mixed 7 Others 2 Normal tissue 69 Stage Stage 1 35 Stage 2 49 Stage 3 56 Stage 4 14 Grade 1 39 2 39 3 76 Nodal status Node-negative (<10) 122 Node-positive (> 10) 32 Intrinsic subtype (63 cases with complete data) ER positive 45 ER negative 18 PR positive 40 PR negative 23 HER-2/neu positive 11 HER-2/neu negative 52 Clinical and pathological charac terization of breast tumor tissue.

PAGE 129

116 Table 3. MiR-155 Expression in Histological Subtype Histology N High/Mod Low/No Ductal carcinoma in situ 135 53 82 Lobular carcinoma 10 6 4 Ductal & lobular carcinoma 7 6 1 Mucinous adenocarcinoma 1 1 0 Comedeocarcinoma 1 1 0 Normal tissue 69 3 66 Expression of miR-155 in 154 breast cancer specimens and 69 normal mammary tissues. Table 4. MiR-155 Expression in Clinic al and Pathological Characteristics Characteristics N Low/NoHigh/Mod P value Age 0.193 < 51 67 42 25 >51 87 45 42 Stage 0.035 I/II 84 54 30 III/IV 70 33 37 Grade <0.001 I/II 78 60 18 III 76 27 49 Node 0.017 Negative (<10) 12275 47 Positive (> 10) 32 12 20 ER Status (63 cases) 0.279 ER positive 45 18 27 ER negative 18 10 8 PR Status (63 cases) 0.118 PR positive 39 14 25 PR negative 24 14 10 Her2/Neu Status (63 cases) 0.257 Her2/neu positive 11 5 11 Her2/neu negative 52 23 24 Analysis with X 2 test.

PAGE 130

117 2) MiR-155 Overexpression Is Asso ciated with Clinical Features : The frequency of miR155 overexpression was significantly low in early stage (35. 7%) and low grade (23.1%) breast cancer when compared to late stage (52.9%) and high grade (64.5%) tumors ( P =0.035 and P <0.001 respectively; Table 4 ). Current understan ding in breast cancer indicates a higher number ( 10) of positive lymph node involvement is often correlated with poorer prognosis (3, 22, 42). We obs erved that miR-155 expression directly associated with lymph node metastasis evaluated at 10 positive nodes ( P =0.017; Table 4 ). Another important asp ect of breast cancer is ER PR, and Her2/neu receptor status; however, miR-155 levels did not correlate significantly with their expression ( Table 4 ). 3) MiR-155 Overexpression Is Associated with Poor Overall 10-year Survival : We next analyzed the association be tween miR-155 expression with 10-year survival in the 82 tumors in which 10 years follow-up data are available. The X-tile algorithm automatically determines whether an optimal cut-point exists for the range of miR-155 expression that results in a statistically signifi cant difference in 10 year overall survival. MiR-155 expression of the 82 tumor samples we re automatically divided into “training” and “validation” for cro ss-validation analysis ( Figures 17A and B ). The analysis determined 90.14 as the optimal cut-point in th is data set. Cross-validation analysis revealed that over-expression of miR-155 in validation set had poor overall survival ( P =0.0077; Figure 17B ). Further, Kaplan-Meier analysis of all 82 samples demonstrated a statistically significant inverse correla tion between overall survival and miR-155 expression level ( P = 0.008; Figure 17C ).

PAGE 131

118 To extend this observation, we separated the patients into tw o groups by stage [eg, early stages (I/II) and late st ages (III/IV)] and asked wh ether miR-155 expression could predict patient survival within each subgroup. In both groups, high miR-155 expression was still a prognostic factor ( Figures 17D and E ), although the result was not statistically significant in early stage tumors ( P = 0.326; Figure 17D ) likely due to the small sample size. In addition, we also ev aluated miR-155’s impact on overall survival in different grade; we found that patients with elevat ed miR-155 appear to have poor overall survival while P values did not reach significance (data not shown). These results suggest that high miR-155 expression to be an unfavorable prognostic feature that is independent of other factors.

PAGE 132

119 X-Tile miR-155 cut-point determination Cut-point: 90.1412 P -value = 0.0077 Validation Analyses 10 years 61 cases 21 cases 61 cases 21 cases A B miR-155 < 90.14 miR-155 > 90.14 P =0.008 Survival Time (Years)Cum Survivaln=21 n=61 All Stages Stage I/II miR-155 < 90.14 miR-155 > 90.14 Survival Time (Years) P =0.326 n=7 n=24 Survival Time (Years) Stage III/IV miR-155 < 90.14 miR-155 > 90.14 P =0.001 n=14 n=37C D E Figure 17. MiR-155 Expression Correlates to Ten-Year Overall Survival in Breast Cancer. ( A ) MiR-155 low and high expression cutpoint that best associates with patient 10 year survival within the cancer subpopulation was determined by using the XTile algorithm, where a division at 90.1412 will yield a statistically significant difference in 10 year overall survival in original data set, ( B ) and software randomly derived validation set. ( C ) Further statistical analysis on miR-155 expression and correlation to 10 year overall survival was performed us ing the Log Rank, Breslow, and Tarone-Ware methods on SPSS Statistics version 17.0 and the cut-off at 90.1412 as previously determined by X-Tile yields a statistical significance between mi R-155 expression and patient 10 year survival. ( D ) Overall 10-year survival was also analyzed in patients with early stage and ( E ) late stage breast tumors expressi ng high versus low levels of miR-155.

PAGE 133

120 Further univariate analysis revealed that grade, and mi R-155 were associated with poor clinical outcome ( P < 0.05), while stage approached statistical significance ( P =0.054; Table 5 ) likely due to sample size. Of them, miR-155 was a re lative strong predictor of poor clinical outcome with a hazard ratio of 2.619 (95% CI, 1.322-5.189, P =0.006; Table 5 ). A multivariate Cox proportional hazard anal ysis with the followi ng variables: age, histology, stage, grade, and miR-155 expression was used to analyze their simultaneous association with overall survival. As expecte d, the best multivariable model predictive of overall survival showed stage as the strongest predictor of outcome with a hazard ratio of 2.286 (1.330-3.930, P =0.003; Table 5 ). In addition, miR-155 expression also appeared to be a predictor with a hazard ratio of 2.857 (1.390-5.874, P =0.004; Table 5 ). Taken collectively, these results sugge st that elevated levels of miR-155 are asso ciated with poor prognosis in breast cancer.

PAGE 134

121 Table 5. Ten-Year Survival Analysis of Patients with Breast Tumor Univariate Analysis Multivariate Analysis Variable HR* (95% CI†) P value HR (95% CI) P value Age < 51 years vs. > 51 1.158 (0.671-1.997) 0.599 1.202 (0.692-2.086) 0.514 Histology Ductal vs. ot her types 1.577 (0.852-2.919) 0.147 1.379 (0.698-2.725) 0.356 Stage Early(I/II) vs. Late(III/IV) 1.662 (0.992-2.783) 0.054 2.286 (1.330-3.930) 0.003 Grade Early(I/II) vs. Late(III) 2.280 (1.266-4.105) 0.006 1.951 (1.072-3.553) 0.029 miR-155 < 90 vs. >90 2.619 (1.322-5.189) 0.006 2.857 (1.390 -5.874) 0.004 *HR: Hazard Ratio †CI: Confidence Ratio

PAGE 135

122 Disscussion: The TNM staging of breast cancer is a standardized guideline for determining stage, grade, and lymph node me tastasis to provide an overvi ew of tumor behavior based on past observed pattern s. In general, breast cancer di agnosis with high stage, grade and lymph node involvement correlates with poor ov erall survival and i ndicates the necessity for aggressive treatment (2, 27, 41). Interest ingly, we demonstrated in this study that miR-155 correlates to high grade, stage, a nd lymph node involvement. Furthermore, miR-155 expression levels are also associated with 10 year overall survival assessed using univariate and multivariate Cox proportional hazards model. The same observations have been published in lung and pancreatic cancers (13, 33, 46). In addition, we previously demonstrated that TGF induces miR-155 expression while promoting EMT by targeting RhoA, and contribute to chemo-resistance by targeting FOXO3a in breast cancer cell lines (20, 21). Both fi ndings associate miR-155 expression with features of aggressive tumors often ch aracterized by invasion, metastasis and chemoresistance. Collectively, these results suggest that miR-155 is involved in breast tumor progression. Over the years, as understanding in breas t cancer developed, markers such as ER PR, and Her2/neu have become vital for the clinician to determine proper treatment (8, 10, 11, 32). For instance, adjuvant therapy wher e growth hormone would be blocked from binding their receptor would prove fruitful only if the tumor expresses ER and PR (7, 19, 43, 45, 49). Similarly, Her2/neu is a cell membrane surface-bound receptor tyrosine kinase belonging to the epidermal growth fact or receptor family. It is involved in signal transduction pathways promoting cell grow th and differentiati on (6, 35, 37). Its

PAGE 136

123 presences indicates aggressive tumor, but can be treated with herceptin – an antibody specifically targeting Her2/neu (4, 12, 28, 39) Computational analysis using RNA22 (30) to determine if miR-155 may target ER PR, or Her2/neu yielded negative results, and so it was not surprising that miR-155 did not correlate to the expression of these markers. In summary, our findings indicat e that overexpression of miR-155 is a recurrent event in breast cancer and could serve as a prognostic marker, pathogenetic factor and a critical therapeutic target. Future investigations are required to determine the mechanism by which miR-155 is up-regulated in human breast carcinogenesis. References: 1. Banerjee, D., and F. Slack. 2002. Control of developmental timing by small temporal RNAs: a paradigm for RNA-me diated regulation of gene expression. Bioessays 24:119-29. 2. Bartelink, H., J. C. Horiot, P. Poortmans, H. Struikmans, W. Van den Bogaert, I. Barillot, A. Fourquet, J. Borger, J. Ja ger, W. Hoogenraad, L. Collette, and M. Pierart. 2001. Recurrence rates after trea tment of breast cancer with standard radiotherapy with or without additio nal radiation. N Engl J Med 345:1378-87. 3. Basaran, G., C. Devrim, H. B. Caglar, B. Gulluoglu, H. Kaya, S. Seber, T. Korkmaz, F. Telli, M. Kocak, F. Dane, F. P. Yumuk, and S. N. Turhal. 2010. Clinical outcome of breast cancer patie nts with N3a (>/=10 positive lymph nodes) disease: has it changed ov er years? Med Oncol. 4. Baselga, J., L. Norton, J. Albane ll, Y. M. Kim, and J. Mendelsohn. 1998. Recombinant humanized anti-HER2 anti body (Herceptin) enhances the antitumor activity of paclitaxel and doxorubicin against HER2/neu overexpressing human breast cancer xenografts. Cancer Res 58:2825-31. 5. Camp, R. L., M. Dolled-Filhart, a nd D. L. Rimm. 2004. X-tile: a new bioinformatics tool for biomarker assessment and outcome-based cut-point optimization. Clin Cancer Res 10:7252-9.

PAGE 137

124 6. Clark, G. M., and W. L. McGuir e. 1991. Follow-up study of HER-2/neu amplification in primary breas t cancer. Cancer Res 51:944-8. 7. Clark, G. M., and W. L. McGuire. 1983. Progesterone receptors and human breast cancer. Breast Cancer Res Treat 3:157-63. 8. Fan, C., D. S. Oh, L. Wessels, B. Weigelt, D. S. Nuyten, A. B. Nobel, L. J. van't Veer, and C. M. Perou. 2006. Concorda nce among gene-expression-based predictors for breast cance r. N Engl J Med 355:560-9. 9. Fisher, B., S. Anderson, J. Bryant, R. G. Margolese, M. Deutsch, E. R. Fisher, J. H. Jeong, and N. Wolmark. 2002. Twenty-year follow-up of a randomized trial comparing total mastectomy, lumpectomy, and lumpectomy plus irradiation for the treatment of invasive breas t cancer. N Engl J Med 347:1233-41. 10. Fisher, B., C. Redmond, A. Brown, N. Wo lmark, J. Wittliff, E. R. Fisher, D. Plotkin, D. Bowman, S. Sachs, J. Wolter, R. Frelick, R. Desser, N. LiCalzi, P. Geggie, T. Campbell, E. G. Elias, D. Pr ager, P. Koontz, H. Volk, N. Dimitrov, B. Gardner, H. Lerner, and H. Shibata. 1981. Treatment of primary breast cancer with chemotherapy and tamoxi fen. N Engl J Med 305:1-6. 11. Goetz, M. P., J. N. Ingle, and F. J. Couch. 2007. Gene-expression-based predictors for breast cancer. N Engl J Med 356:752; author reply 752-3. 12. Graziano, C. 1998. HER-2 breast assay, linked to Herceptin, wins FDA's okay. CAP Today 12:1, 14-6. 13. Greither, T., L. F. Grochola, A. Udel now, C. Lautenschlager, P. Wurl, and H. Taubert. 2010. Elevated expression of microRNAs 155, 203, 210 and 222 in pancreatic tumors is associated with poorer survival. In t J Cancer 126:73-80. 14. Guo, J. P., S. K. Shu, L. He, Y. C. Lee, P. A. Kruk, S. Grenman, S. V. Nicosia, G. Mor, M. J. Schell, D. Coppola, and J. Q. Cheng. 2009. Deregulation of IKBKE is associated with tumor progression, poor prognosis, and cisplatin resistance in ovarian cancer. Am J Pathol 175:324-33. 15. Hawkins, R. A., M. M. Roberts, and A. P. Forrest. 1980. Oestrogen receptors and breast cancer: current stat us. Br J Surg 67:153-69. 16. Hughes, K. S., L. A. Sc hnaper, D. Berry, C. Cirrincione, B. McCormick, B. Shank, J. Wheeler, L. A. Champion, T. J. Smith, B. L. Smith, C. Shapiro, H. B. Muss, E. Winer, C. Hudis, W. Wood, D. Sugarbaker, I. C. Henderson, and L. Norton. 2004. Lumpectomy plus tamoxifen with or without irradiation in women 70 years of age or older with early breast cancer. N Engl J Med 351:971-7.

PAGE 138

125 17. Hutter, R. V. 1984. Pathological paramete rs useful in predicting prognosis for patients with breast cancer Monogr Pathol:175-85. 18. Iorio, M. V., M. Ferracin, C. G. Liu, A. Veronese, R. Spizzo, S. Sabbioni, E. Magri, M. Pedriali, M. Fabbri, M. Ca mpiglio, S. Menard, J. P. Palazzo, A. Rosenberg, P. Musiani, S. Volinia, I. Nenci, G. A. Calin, P. Querzoli, M. Negrini, and C. M. Croce. 2005. MicroRNA gene e xpression deregulation in human breast cancer. Cancer Res 65:7065-70. 19. Klijn, J. G., P. M. Berns, P. I. Schmitz, and J. A. Foekens. 1992. The clinical significance of epidermal growth factor receptor (EGF-R) in human breast cancer: a review on 5232 patients. Endocr Rev 13:3-17. 20. Kong, W., L. He, M. Coppola, J. Guo, N. N. Esposito, D. Coppola, and J. Q. Cheng. 2010. MicroRNA-155 regulates cell survival, growth, and chemosensitivity by targeting FOXO3a in breast cancer. J Biol Chem 285:1786979. 21. Kong, W., H. Yang, L. He, J. J. Zhao, D. Coppola, W. S. Dalton, and J. Q. Cheng. 2008. MicroRNA-155 is regulated by the tr ansforming growth factor beta/Smad pathway and contributes to epithelial cell plasticity by targe ting RhoA. Mol Cell Biol 28:6773-84. 22. Kuru, B. 2006. Prognostic significance of total number of nodes removed, negative nodes removed, and ratio of positive nodes to re moved nodes in node positive breast carcinoma. Eur J Surg Oncol 32:1082-8. 23. Lagos-Quintana, M., R. Rauhut, W. Lendeckel, and T. Tuschl. 2001. Identification of novel genes coding fo r small expressed RNAs. Science 294:8538. 24. Lau, N. C., L. P. Lim, E. G. Weinstei n, and D. P. Bartel. 2001. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294:858-62. 25. Lee, R. C., and V. Ambros. 2001. An extensive class of small RNAs in Caenorhabditis elegans. Science 294:862-4. 26. Leong, A. S., and W. A. Raymond. 1989. Prognos tic parameters in breast cancer. Pathology 21:169-75. 27. Levine, M. N., and T. Whelan. 2006. Ad juvant chemotherapy for breast cancer-30 years later. N Engl J Med 355:1920-2. 28. McGahan, L. 1998. Herceptin (R): monoc lonal antibody therapy for metastatic breast cancer. Issues Em erg Health Technol:1-4.

PAGE 139

126 29. McGuire, W. L., and G. M. Clark. 1983. The prognostic role of progesterone receptors in human breast can cer. Semin Oncol 10:2-6. 30. Miranda, K. C., T. Huynh, Y. Tay, Y. S. Ang, W. L. Tam, A. M. Thomson, B. Lim, and I. Rigoutsos. 2006. A pattern-bas ed method for the identification of MicroRNA binding sites and their corre sponding heteroduplexes. Cell 126:120317. 31. Muss, H. B., D. A. Berry, C. T. Cirrincione, M. Theodoul ou, A. M. Mauer, A. B. Kornblith, A. H. Partridge, L. G. Dressl er, H. J. Cohen, H. P. Becker, P. A. Kartcheske, J. D. Wheeler, E. A. Perez, A. C. Wolff, J. R. Gralow, H. J. Burstein, A. A. Mahmood, G. Magrinat, B. A. Parker, R. D. Hart, D. Grenier, L. Norton, C. A. Hudis, and E. P. Winer. 2009. Adjuvant chemotherapy in older women with early-stage breast cancer. N Engl J Med 360:2055-65. 32. Piccart-Gebhart, M. J., M. Procter, B. Le yland-Jones, A. Goldhirsch, M. Untch, I. Smith, L. Gianni, J. Baselga, R. Bell, C. Jackisch, D. Cameron, M. Dowsett, C. H. Barrios, G. Steger, C. S. Hu ang, M. Andersson, M. Inbar, M. Lichinitser, I. Lang, U. Nitz, H. Iwata, C. Thomssen, C. Lohrisc h, T. M. Suter, J. Ruschoff, T. Suto, V. Greatorex, C. Ward, C. Str aehle, E. McFadden, M. S. Dolci, and R. D. Gelber. 2005. Trastuzumab after adjuvant chemotherapy in HER2-positive breast cancer. N Engl J Med 353:1659-72. 33. Raponi, M., L. Dossey, T. Jatkoe, X. Wu, G. Chen, H. Fan, and D. G. Beer. 2009. MicroRNA classifiers for predicting prognos is of squamous cell lung cancer. Cancer Res 69:5776-83. 34. Reiss, M. 1989. Prognostic factors in pr imary breast cancer Conn Med 53:565-71. 35. Roux-Dosseto, M., S. Romain, N. Dussau lt, and P. M. Martin. 1989. Correlation of erbB-2 gene amplification with low levels of estrogen and/or progesterone receptors in primary breast cancer: do erbB-2 products delineate hormoneindependent tumors? Biomed Pharmacother 43:641-9. 36. Saez, R. A., W. L. McGuire, and G. M. Clark. 1989. Prognostic factors in breast cancer. Semin Surg Oncol 5:102-10. 37. Seshadri, R., F. A. Firgaira, D. J. Horsfa ll, K. McCaul, V. Setlur, and P. Kitchen. 1993. Clinical significance of HER-2/ne u oncogene amplification in primary breast cancer. The South Australian Breast Cancer Study Group. J Clin Oncol 11:1936-42. 38. Slack, F. J., M. Basson, Z. Liu, V. Am bros, H. R. Horvitz, and G. Ruvkun. 2000. The lin-41 RBCC gene acts in the C. eleg ans heterochronic pathway between the let-7 regulatory RNA and the LIN-29 transcription factor. Mol Cell 5:659-69.

PAGE 140

127 39. Slamon, D. J., B. Leyland-Jones, S. Sha k, H. Fuchs, V. Paton, A. Bajamonde, T. Fleming, W. Eiermann, J. Wolter, M. Pe gram, J. Baselga, and L. Norton. 2001. Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. N Engl J Med 344:783-92. 40. Sotiriou, C., and L. Pusztai. 2009. Gene-e xpression signatures in breast cancer. N Engl J Med 360:790-800. 41. Sparano, J. A., M. Wang, S. Martino, V. J ones, E. A. Perez, T. Saphner, A. C. Wolff, G. W. Sledge, Jr., W. C. Wood, and N. E. Davidson. 2008. Weekly paclitaxel in the adjuvant treatment of breast cancer. N Engl J Med 358:1663-71. 42. Tai, P., E. Yu, and K. Joseph. 2010. Prognos tic significance of number of positive nodes: a long-term study of one to two nodes versus three nodes in breast cancer patients. Int J Radiat On col Biol Phys 77:180-7. 43. Valavaara, R., J. Tuominen, and R. Johansson. 1990. Predictive value of tumor estrogen and progesterone receptor levels in postmenopausal women with advanced breast cancer treated w ith toremifene. Cancer 66:2264-9. 44. Volinia, S., G. A. Calin, C. G. Liu, S. Ambs, A. Cimmino, F. Petrocca, R. Visone, M. Iorio, C. Roldo, M. Ferracin, R. L. Prueit t, N. Yanaihara, G. Lanza, A. Scarpa, A. Vecchione, M. Negrini, C. C. Harris, and C. M. Croce. 2006. A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A 103:2257-61. 45. Wolff, A. C. 2005. Current status of taxa nes as adjuvant therapy for early-stage breast cancer. Int J Fert il Womens Med 50:227-9. 46. Yanaihara, N., N. Caplen, E. Bowman, M. Seike, K. Kumamoto, M. Yi, R. M. Stephens, A. Okamoto, J. Yokota, T. Tanaka G. A. Calin, C. G. Liu, C. M. Croce, and C. C. Harris. 2006. Unique microR NA molecular profiles in lung cancer diagnosis and prognosis. Cancer Cell 9:189-98. 47. Yang, H., W. Kong, L. He, J. J. Zhao, J. D. O'Donnell, J. Wang, R. M. Wenham, D. Coppola, P. A. Kruk, S. V. Ni cosia, and J. Q. Cheng. 2008. MicroRNA expression profiling in human ovarian can cer: miR-214 induces cell survival and cisplatin resistance by targeti ng PTEN. Cancer Res 68:425-33. 48. Zhao, J. J., J. Lin, H. Yang, W. Kong, L. He, X. Ma, D. Coppola, and J. Q. Cheng. 2008. MicroRNA-221/222 negatively regulates estrogen receptor alpha and is associated with tamoxifen resistance in breast cancer. J Biol Chem 283:31079-86. 49. Ziegler, L. D., and A. U. Buzdar. 1991. Curre nt status of adjuvant therapy of early breast cancer. Am J Clin Oncol 14:101-10.

PAGE 141

128 CHAPTER V DISSCUSSION AND CONCLUSION: MicroRNAs (miRNAs) are short single st randed RNA that has been shown to play a significant role in oncogenesis (7, 16, 23, 39, 40, 50). To determine the cause for dysregulation of microRNAs in various cancers, the biogenesis or maturation of miRs is a very active field of research. Majority of mi RNAs are believed to be transcribed by PolII machinery into a long single stranded pri-RNA (24, 25, 31). Control of miRNA expression at the genomic level is similar to the regulation of protei n-coding genes, with regulation by various transcrip tional factors. We have s hown in normal mouse mammary gland epithelial cells (NMuMG), that TGF directs the transcription of miR-155 via Smad4 transcritional factor ( Figures 5 and 6 ; 29). NMuMG cells are commonly used to study TGF induced EMT (12, 43). EMT is a mech anism that cancer cells utilize to initiate metastasis (33, 55, 61). Specifically, the TGF ligand binds to a type II receptor which then recruits and phosphorylates a type I receptor. This is followed by the phosphorylation of receptor bound SMAD2/3; which in turn detaches into the cytoplasm and combine with SMAD4 to form an active tr anscriptional complex that transports into the nucleus to regulate the expression of specific genes (41, 49, 59). We have provided evidence that miR-155 is regulated in this ma nner by performing luciferase reporter and CHIP analyses ( FIGURE 6; 29).

PAGE 142

129 TGF is a ligand that induces EMT in NM uMG cells by modifying the expression of a subset of genes to i nduce an overall phenotype ch ange. Examples of such modification are lowered expre ssion of typical epithelial cell markers such as E-cadherin, and ZO-1; and appearance of mesenchymal ma rkers such as N-cadherin, and vimentin (10, 12, 43). One example on ho w this occurs is described by Ozdamar et al., who reported that Par6 interacts with the TGF receptor. In the presence of the ligand, Par6 becomes phosphorylated and inte racts with the E3 ubiquitin ligase Smurf1. The Smurf1, in turn, targets the guanosine triphosphata se RhoA for degradation, thereby leading to a loss of tight junctions (43). The suppression of RhoA is mandatory for dissolution of tight junctions during early st age of EMT. This work pr ovided strong evidence for the degradation of existing RhoA by ubiqui tination in the presence of TGF If RhoA mRNA exists in the cytoplas m, translation would still oc cur to produce new RhoA that may replace degraded levels and prevent tight junction dissolution. MiRNAs work by preventing de novo production of specific prot eins via binding to the 3’UTRs of its targeted mRNAs. Computational analysis using RNA22 indeed reveals multiple sites within the 3’UTR of RhoA where miR-155 can bind ( FIGURE 9 ; 29) and we provided evidence that miR-155 expression suppresses RhoA expression ( FIGURE 9 ) and contributes to tight junction disso lution, cell migration and invasion ( FIGURES 7 and 8 ; 29). FOXO3a is a well studied transcriptional factor that contains a forkhead DNA binding domain (2). In the unphosphorylated form, it induces apopto sis and cell growth arrest by transcriptional regula tion of pro-apoptotic and grow th inhibitory genes in the nucleus. BIM, p27, and BNIP3 are such iden tified downstream targets of FOXO3a (13,

PAGE 143

130 14, 44, 53). Upon growth factor stimulati on, FOXO3a is phosphorylated by oncogenes such as Akt, SGK, and IKK and subsequently translocates from the nucleus into the cytoplasm where it loses its transcriptional activity. Computational analysis reveals miR-155 target the 3’UTR of FOXO3a mRNA ( FIGURE 12 ). Baseline analysis for miR-155 levels in breast cancer cell lines shows high miR-155 expression in HS578t, MDA-MB-157 and MDA-MB-435, and co rrelates to lowered expression of FOXO3a in these cell lines ( FIGURE 15 and Table 1 ). On the other hand, the remaining tested breast cancer cell lines did not display detectable levels of miR-155, but generally expressed FOXO3a ( FIGURE 15 ). These observations sugge st that FOXO3a could be regulated by miR-155. We set out to prove this by performing ectopic expression and knockdown of miR-155 in cell lines. In BT-474 a breast cancer cel l line that normally expresses high FOXO3a and low miR-155, ex topic expression of miR-155 reduces endogenous FOXO3a expression whereas knoc kdown of miR-155 in HS578t, a breast cancer cell line that doesn’ t express FOXO3a but high miR-155, induces FOXO3a expression ( FIGURE 12 ; 28). MicroRNA-155 has been shown to play an important role in physiological processes, especially immunology (8, 15, 34, 4 2, 51, 52). In addition, early profiling studies have shown that miR-155 is frequen tly up-regulated in va rious types of human malignancy including B cell lymphoma, lung, colon, head/neck, kidney, pancreatic, and breast cancer (9, 16, 22, 27, 32, 56, 57). A lthough we have shown that miR-155 promotes tight junction dissolution during TGF induced EMT in a mouse cell line model, function of miR-155 in human breas t cancer remains largely unknown. Since we observed miR-155 targeting FOXO3a, we hypothe sized that miR-155 plays a key role in

PAGE 144

131 breast cancer chemosensitivity. To test th is, we overexpressed miR-155 in BT-474 and observed a decrease in apoptosis ( FIGURE 11 ), whereas knockdow n of miR-155 with antisense oligos (ASO) sensitizes the cells to programmed cell death ( FIGURE 11 ; 28). Another breakthrough occurred in 2006 when Yanaihara, N. et al., published a significant correlation between miR-155 expressi on and overall survival in lung cancer, but did not offer any molecular insights to explain the phenome non (60). In light of this and two similar reports that have published si milar observations in pancreatic cancer and squamous cell lung cancer (18, 46, 60); we set out to perform similar analysis on breast cancer. We determined miR-155 expressi on in 154 breast cancer specimen, and 20 normal breast tissues taken from patients who underwent surgery at H. Lee Moffitt Cancer center. A near half of breast cancers express high le vels of miR-155. Statistical analyses suggest that miR-155 is an excelle nt prognostic indicator of overall 10 year survival ( FIGURE 17 and TABLE 5 ). The AJCC TNM staging system provides a standard method for diagnosing breast cancer and provides the patien t with a prognostic outlook; while giving the physician guidelines for patient care (21, 30, 47, 48). Cancer stage, pathological grade, lymph node involvement are classic indicat ors for tumor behavior. Hi gh grade, late stage, and presence of lymph node involvement are typical of aggressive tumors and often results in poor survivability. We observed miR-155 also corresponds to high grade, late stage breast cancer and coincide s with lymph node involve ment greater than 10 ( TABLE 4 ). However, we have shown that prognostic valu e of miR-155 is independent of tumor stage and grade.

PAGE 145

132 ER PR and Her2/neu have been established as gold standard for diagnosis of breast cancer because they provide the basis fo r different therapeutic regiems (1, 3, 4, 11, 17, 19, 26, 35-38, 54, 58, 62). If the tumor expresses ER or PR, adjuvant therapy such as tamoxifen can be used to prevent the horm ones from reaching their receptor. Similarly, if the tumor expresses Her2/neu, herceptin can be used to block the cell surface receptor from activation. Tumors that lack all thre e markers are named “triple negatives” or “basal like,” and do not require the presence of growth sign al to grow. Triple negative breast cancers are often consid ered more aggressive since traditional chemotherapy and surgery are only treatment options. However, patients still experience early recurrence and visceral metastasis to the brain. Since our previous findings support the notion that miR-155 expression supports aggressive tumor behavior, we set out to determine if miR155 alters ER PR, or Her2/neu expression. Com putation analysis for potential miR155 sites in the 3’UTR of ER PR, or Her2/neu mRNA did not reveal ideal binding sites for miR-155. MiR-155 was identified early to be an oncogene, but not much was known on what role it played in cancer. Over the ye ars, researchers from different areas of specialization have s upported a critical role for miR-155 in immunology (8, 15, 34, 42, 51, 52) and leukemiagenesis (9, 16, 22, 27, 32, 56, 57). However, the role of miR-155 in breast cancer remains elusive. Our study has shown that miR-155 is induced by TGF during EMT, and targets RhoA to initiate phe notypic transition (29) In addition, miR155 targets FOXO3a and induces chemoresis tance in breast cancer (28). Finally, statistical analysis of miR-155 expression in br east cancer also reveals an association of elevated miR-155 with poor overall survival, la te stage and poorly differentiated tumor as

PAGE 146

133 well as tumors with lymph node metastasis. These findings indica te strongly that miR155 could serve as not only a prognostic marker and pathogenetic factor but also as a critical therapeutic target in breast cancer. References: 1. 1998. Herceptin : new treatment and new questions. Tecnologica:15-6. 2. Anderson, M. J., C. S. Viars, S. Czek ay, W. K. Cavenee, and K. C. Arden. 1998. Cloning and characterization of three human forkhead genes that comprise an FKHR-like gene subfamily. Genomics 47:187-99. 3. Barna, B. P., and S. D. Deodhar. 19 78. Immunology, tumor markers, and breast cancer. Surg Clin North Am 58:693-704. 4. Baselga, J., L. Norton, J. Albane ll, Y. M. Kim, and J. Mendelsohn. 1998. Recombinant humanized anti-HER2 anti body (Herceptin) enhances the antitumor activity of paclitaxel and doxorubicin against HER2/neu overexpressing human breast cancer xenografts. Cancer Res 58:2825-31. 5. Brunet, A., A. Bonni, M. J. Zigmond, M. Z. Lin, P. Juo, L. S. Hu, M. J. Anderson, K. C. Arden, J. Blenis, and M. E. Gree nberg. 1999. Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell 96:857-68. 6. Brunet, A., J. Park, H. Tran, L. S. H u, B. A. Hemmings, a nd M. E. Greenberg. 2001. Protein kinase SGK mediates surv ival signals by phosphorylating the forkhead transcription factor FKHR L1 (FOXO3a). Mol Cell Biol 21:952-65. 7. Calin, G. A., C. D. Dumitru, M. Shimizu, R. Bichi, S. Zupo, E. Noch, H. Aldler, S. Rattan, M. Keating, K. Rai, L. Rassenti, T. Kipps, M. Negrini, F. Bullrich, and C. M. Croce. 2002. Frequent deletions and down-regulation of microRNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc Natl Acad Sci U S A 99:15524-9. 8. Ceppi, M., P. M. Pereira, I. Dunand-Saut hier, E. Barras, W. Reith, M. A. Santos, and P. Pierre. 2009. MicroRNA-155 modul ates the interleukin-1 signaling pathway in activated human monocyte-derived dendritic ce lls. Proc Natl Acad Sci U S A 106:2735-40. 9. Chen, H. C., G. H. Chen, Y. H. Chen, W. L. Liao, C. Y. Liu, K. P. Chang, Y. S. Chang, and S. J. Chen. 2009. MicroRNA dere gulation and pathway alterations in nasopharyngeal carcinoma. Br J Cancer 100:1002-11.

PAGE 147

134 10. Cheng, G. Z., W. Z. Zhang, M. Sun, Q. Wang, D. Coppola, M. Mansour, L. M. Xu, C. Costanzo, J. Q. Cheng, and L. H. Wang. 2008. Twist is transcriptionally induced by activation of STAT3 and medi ates STAT3 oncogenic function. J Biol Chem 283:14665-73. 11. Clark, G. M., and W. L. McGuire. 1983. Progesterone receptors and human breast cancer. Breast Cancer Res Treat 3:157-63. 12. Deckers, M., M. van Dinther, J. Buijs, I. Que, C. Lowi k, G. van der Pluijm, and P. ten Dijke. 2006. The tumor s uppressor Smad4 is required for transforming growth factor beta-induced epithelia l to mesenchymal transitio n and bone metastasis of breast cancer cells. Ca ncer Res 66:2202-9. 13. Dijkers, P. F., R. H. Medema, J. W. La mmers, L. Koenderman, and P. J. Coffer. 2000. Expression of the pro-apoptotic Bcl-2 family member Bim is regulated by the forkhead transcription fact or FKHR-L1. Curr Biol 10:1201-4. 14. Dijkers, P. F., R. H. Medema, C. Pals, L. Banerji, N. S. Thomas, E. W. Lam, B. M. Burgering, J. A. Raaijmakers, J. W. Lammers, L. Koenderman, and P. J. Coffer. 2000. Forkhead transcription f actor FKHR-L1 modulates cytokinedependent transcriptional regulation of p27(KIP1). Mol Cell Biol 20:9138-48. 15. Dorsett, Y., K. M. McBride, M. Jankovi c, A. Gazumyan, T. H. Thai, D. F. Robbiani, M. Di Virgilio, B. R. San-Mar tin, G. Heidkamp, T. A. Schwickert, T. Eisenreich, K. Rajewsky, and M. C. Nussenzweig. 2008. MicroRNA-155 suppresses activation-induced cytid ine deaminase-mediated Myc-Igh translocation. Immunity 28:630-8. 16. Eis, P. S., W. Tam, L. Sun, A. Chadburn, Z. Li, M. F. Gomez, E. Lund, and J. E. Dahlberg. 2005. Accumulation of mi R-155 and BIC RNA in human B cell lymphomas. Proc Natl Acad Sci U S A 102:3627-32. 17. Graziano, C. 1998. HER-2 breast assay, linked to Herceptin, wins FDA's okay. CAP Today 12:1, 14-6. 18. Greither, T., L. F. Grochola, A. Udel now, C. Lautenschlager, P. Wurl, and H. Taubert. 2010. Elevated expression of microRNAs 155, 203, 210 and 222 in pancreatic tumors is associated with poorer survival. In t J Cancer 126:73-80. 19. Hawkins, R. A., M. M. Roberts, and A. P. Forrest. 1980. Oestrogen receptors and breast cancer: current stat us. Br J Surg 67:153-69. 20. Hu, M. C., D. F. Lee, W. Xia, L. S. Go lfman, F. Ou-Yang, J. Y. Yang, Y. Zou, S. Bao, N. Hanada, H. Saso, R. Kobayash i, and M. C. Hung. 2004. IkappaB kinase promotes tumorigenesis through inhibition of forkhead FOXO3a. Cell 117:225-37.

PAGE 148

135 21. Hutter, R. V. 1984. Pathological paramete rs useful in predicting prognosis for patients with breast cancer Monogr Pathol:175-85. 22. Iorio, M. V., M. Ferracin, C. G. Liu, A. Veronese, R. Spizzo, S. Sabbioni, E. Magri, M. Pedriali, M. Fabbri, M. Ca mpiglio, S. Menard, J. P. Palazzo, A. Rosenberg, P. Musiani, S. Volinia, I. Nenci, G. A. Calin, P. Querzoli, M. Negrini, and C. M. Croce. 2005. MicroRNA gene e xpression deregulation in human breast cancer. Cancer Res 65:7065-70. 23. Johnson, S. M., H. Grosshans, J. Shinga ra, M. Byrom, R. Jarvis, A. Cheng, E. Labourier, K. L. Reinert, D. Brown, and F. J. Slack. 2005. RAS is regulated by the let-7 microRNA family. Cell 120:635-47. 24. Johnson, S. M., S. Y. Lin, and F. J. Sl ack. 2003. The time of appearance of the C. elegans let-7 microRNA is transcripti onally controlled utilizing a temporal regulatory element in its promoter. Dev Biol 259:364-79. 25. Johnston, R. J., and O. Hobert. 2003. A microRNA controlling left/right neuronal asymmetry in Caenorhabditis elegans. Nature 426:845-9. 26. Klijn, J. G., P. M. Berns, P. I. Schmitz, and J. A. Foekens. 1992. The clinical significance of epidermal growth factor receptor (EGF-R) in human breast cancer: a review on 5232 patients. Endocr Rev 13:3-17. 27. Kluiver, J., S. Poppema, D. de Jong, T. Blokzijl, G. Harms, S. Jacobs, B. J. Kroesen, and A. van den Berg. 2005. BIC and miR-155 are highly expressed in Hodgkin, primary mediastinal and diffuse large B cell lym phomas. J Pathol 207:243-9. 28. Kong, W., L. He, M. Coppola, J. Guo, N. N. Esposito, D. Coppola, and J. Q. Cheng. 2010. MicroRNA-155 regulates cell survival, growth, and chemosensitivity by targeting FOXO3a in breast cancer. J Biol Chem 285:1786979. 29. Kong, W., H. Yang, L. He, J. J. Zhao, D. Coppola, W. S. Dalton, and J. Q. Cheng. 2008. MicroRNA-155 is regulated by the tr ansforming growth factor beta/Smad pathway and contributes to epithelial cell plasticity by targe ting RhoA. Mol Cell Biol 28:6773-84. 30. Leong, A. S., and W. A. Raymond. 1989. Prognos tic parameters in breast cancer. Pathology 21:169-75. 31. Lim, C. Y., B. Santoso, T. Boulay, E. Dong, U. Ohler, and J. T. Kadonaga. 2004. The MTE, a new core promoter element for transcription by RNA polymerase II. Genes Dev 18:1606-17.

PAGE 149

136 32. Liu, X., Z. Chen, J. Yu, J. Xia, a nd X. Zhou. 2009. MicroRNA profiling and head and neck cancer. Comp Funct Genomics:837514. 33. Mani, S. A., W. Guo, M. J. Liao, E. N. Eaton, A. Ayyanan, A. Y. Zhou, M. Brooks, F. Reinhard, C. C. Zhang, M. Ship itsin, L. L. Campbell, K. Polyak, C. Brisken, J. Yang, and R. A. Weinbe rg. 2008. The epithelial-mesenchymal transition generates cells with prope rties of stem cel ls. Cell 133:704-15. 34. Martin, M. M., E. J. Lee, J. A. Buckenbe rger, T. D. Schmittgen, and T. S. Elton. 2006. MicroRNA-155 regulates human angiot ensin II type 1 receptor expression in fibroblasts. J Biol Chem 281:18277-84. 35. McGahan, L. 1998. Herceptin (R): monoc lonal antibody therapy for metastatic breast cancer. Issues Em erg Health Technol:1-4. 36. McGuire, W. L., and G. M. Clark. 1983. Progesterone receptors and human breast cancer; 'Wassink lecture' presented at the 3rd EORTC Breast Cancer Working Conference. Eur J Cancer Clin Oncol 19:1681-5. 37. McGuire, W. L., and G. M. Clark. 1983. The prognostic role of progesterone receptors in human breast can cer. Semin Oncol 10:2-6. 38. McGuire, W. L., K. B. Horwitz, D. T. Zava, R. E. Garola, and G. C. Chamness. 1978. Hormones in breast cancer: update 1978. Metabolism 27:487-501. 39. Metzler, M., M. Wilda, K. Busch, S. Viehmann, and A. Borkhardt. 2004. High expression of precursor microRNA-155/ BIC RNA in children with Burkitt lymphoma. Genes Chromosomes Cancer 39:167-9. 40. Michael, M. Z., O. C. SM, N. G. van Holst Pellekaan, G. P. Young, and R. J. James. 2003. Reduced accumulation of specific microRNAs in colorectal neoplasia. Mol Cancer Res 1:882-91. 41. Moustakas, A. 2002. Smad signalling network. J Cell Sci 115:3355-6. 42. O'Connell, R. M., K. D. Taganov, M. P. Boldin, G. Cheng, and D. Baltimore. 2007. MicroRNA-155 is induced during the macrophage inflammatory response. Proc Natl Acad Sci U S A 104:1604-9. 43. Ozdamar, B., R. Bose, M. Barrios-Rod iles, H. R. Wang, Y. Zhang, and J. L. Wrana. 2005. Regulation of the polarity protein Par6 by TGFbeta receptors controls epithelial cell pl asticity. Science 307:1603-9.

PAGE 150

137 44. Park, S., J. Guo, D. Kim, and J. Q. Ch eng. 2009. Identification of 24p3 as a direct target of Foxo3a regulated by interleukin-3 through the phosphoinositide 3kinase/Akt pathway. J Biol Chem 284:2187-93. 45. Plas, D. R., and C. B. Thompson. 2003. Ak t activation promotes degradation of tuberin and FOXO3a via the pr oteasome. J Biol Chem 278:12361-6. 46. Raponi, M., L. Dossey, T. Jatkoe, X. Wu, G. Chen, H. Fan, and D. G. Beer. 2009. MicroRNA classifiers for predicting prognos is of squamous cell lung cancer. Cancer Res 69:5776-83. 47. Reiss, M. 1989. Prognostic factors in pr imary breast cancer. Conn Med 53:56571. 48. Saez, R. A., W. L. McGuire, and G. M. Clark. 1989. Prognostic factors in breast cancer. Semin Surg Oncol 5:102-10. 49. Souchelnytskyi, S., L. Ronnstrand, C. H. Heldin, and P. ten Dijke. 2001. Phosphorylation of Smad signaling proteins by receptor serine/threonine kinases. Methods Mol Biol 124:107-20. 50. Takamizawa, J., H. Konishi, K. Yanagisawa, S. Tomida, H. Osada, H. Endoh, T. Harano, Y. Yatabe, M. Nagino, Y. Nimura T. Mitsudomi, and T. Takahashi. 2004. Reduced expression of the let-7 microRNAs in human lung cancers in association with shortened postopera tive survival. Cancer Res 64:3753-6. 51. Teng, G., P. Hakimpour, P. Landgraf, A. Ri ce, T. Tuschl, R. Casellas, and F. N. Papavasiliou. 2008. MicroRNA-155 is a nega tive regulator of activation-induced cytidine deaminase. Immunity 28:621-9. 52. Thai, T. H., D. P. Calado, S. Casola, K. M. Ansel, C. Xiao, Y. Xue, A. Murphy, D. Frendewey, D. Valenzuela, J. L. Kut ok, M. Schmidt-Supprian, N. Rajewsky, G. Yancopoulos, A. Rao, and K. Rajewsky. 2007. Regulation of the germinal center response by microRNA-155. Science 316:604-8. 53. Tran, H., A. Brunet, J. M. Grenier, S. R. Datta, A. J. Fornace, Jr., P. S. DiStefano, L. W. Chiang, and M. E. Greenberg. 2002. DNA repair pathway stimulated by the forkhead transcription factor FOXO3 a through the Gadd45 protein. Science 296:530-4. 54. Valavaara, R., J. Tuominen, and R. Johansson. 1990. Predictive value of tumor estrogen and progesterone receptor levels in postmenopausal women with advanced breast cancer treated w ith toremifene. Cancer 66:2264-9. 55. Vernon, A. E., and C. LaBonne. 2004. Tumor metastasis: a new twist on epithelial-mesenchymal tran sitions. Curr Biol 14:R719-21.

PAGE 151

138 56. Volinia, S., G. A. Calin, C. G. Liu, S. Ambs, A. Cimmino, F. Petrocca, R. Visone, M. Iorio, C. Roldo, M. Ferracin, R. L. Prueit t, N. Yanaihara, G. Lanza, A. Scarpa, A. Vecchione, M. Negrini, C. C. Harris, and C. M. Croce. 2006. A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A 103:2257-61. 57. Wang, X., S. Tang, S. Y. Le, R. Lu, J. S. Rader, C. Meyers, and Z. M. Zheng. 2008. Aberrant expression of oncogenic and tumor-suppressive microRNAs in cervical cancer is requ ired for cancer cell grow th. PLoS One 3:e2557. 58. Wolff, A. C. 2005. Current status of taxa nes as adjuvant therapy for early-stage breast cancer. Int J Fert il Womens Med 50:227-9. 59. Wrana, J. L., L. Attisano, J. Carcamo, A. Zentella, J. Doody, M. Laiho, X. F. Wang, and J. Massague. 1992. TGF beta si gnals through a heteromeric protein kinase receptor complex. Cell 71:1003-14. 60. Yanaihara, N., N. Caplen, E. Bowman, M. Seike, K. Kumamoto, M. Yi, R. M. Stephens, A. Okamoto, J. Yokota, T. Tanaka G. A. Calin, C. G. Liu, C. M. Croce, and C. C. Harris. 2006. Unique microR NA molecular profiles in lung cancer diagnosis and prognosis. Cancer Cell 9:189-98. 61. Yang, J., S. A. Mani, J. L. Donaher, S. Ramaswamy, R. A. Itzykson, C. Come, P. Savagner, I. Gitelman, A. Richardson, a nd R. A. Weinberg. 2004. Twist, a master regulator of morphogenesis, plays an esse ntial role in tumor metastasis. Cell 117:927-39. 62. Ziegler, L. D., and A. U. Buzdar. 1991. Curre nt status of adjuvant therapy of early breast cancer. Am J Clin Oncol 14:101-10.

PAGE 152

139 APPENDICES Appendix I. Publications: 1) List of First Author Publications : Chapter II of this thesis has been published as: Kong, W., H. Yang, L. He, J. J. Zhao, D. C oppola, W. S. Dalton, a nd J. Q. Cheng. 2008. MicroRNA-155 is regulated by the transforming growth factor beta/Smad pathway and contributes to epithelial ce ll plasticity by targ eting RhoA. Mol Cell Biol 28:6773-84. Chapter III of this thesis has been published as: Kong, W., L. He, M. Coppola, J. Guo, N. N. Es posito, D. Coppola, and J. Q. Cheng. 2010. MicroRNA-155 regulates cell survival, grow th, and chemosensitivity by targeting FOXO3a in breast cancer. J Biol Chem 285:17869-79. Excerpts from the introductory Chapter I of this thesis have been published as: Kong, W., J. J. Zhao, L. He, and J. Q. Cheng. 2009. Strategies for profiling microRNA expression. J Cell Physiol 218:22-5. Chapter IV of this thesis is in the process of publication. 2) List of Co-Author Publications : Yang, H., W. Kong, L. He, J. J. Zhao, J. D. O'Donnell, J. Wang, R. M. Wenham, D. Coppola, P. A. Kruk, S. V. Nicosia, a nd J. Q. Cheng. 2008. MicroRNA expression profiling in human ovarian cance r: miR-214 induces cell survival and cisplatin resistance by targeting PTEN. Cancer Res 68:425-33. Zhao, J. J., J. Lin, H. Yang, W. Kong, L. He X. Ma, D. Coppola, and J. Q. Cheng. 2008. MicroRNA-221/222 negatively regulates estrogen r eceptor alpha and is associated with tamoxifen resistance in breast cancer. J Biol Chem 283:31079-86.

PAGE 153

140 Zhao, J. J., J. Lin, T. Lwin, H. Yang, J. G uo, W. Kong, S. Dessureault, L. C. Moscinski, D. Rezania, W. S. Dalton, E. Sotomayor, J. Tao, and J. Q. Cheng. 2010. microRNA expression profile and identif ication of miR-29 as a prognos tic marker and pathogenetic factor by targeting CDK6 in ma ntle cell lymphoma. Blood 115:2630-9. Cheng, G. Z., S. Park, S. Shu, L. He, W. K ong, W. Zhang, Z. Yuan, L. H. Wang, and J. Q. Cheng. 2008. Advances of AKT pathway in human oncogenesis and as a target for anticancer drug discovery. Curr Ca ncer Drug Targets 8:2-6. Scott, K. M., S. M. Sievert, F. N. Abril, L. A. Ball, C. J. Barrett, R. A. Blake, A. J. Boller, P. S. Chain, J. A. Clark, C. R. Davis, C. Detter, K. F. Do, K. P. Dobrinski, B. I. Faza, K. A. Fitzpatrick, S. K. Freyermuth, T. L. Harm er, L. J. Hauser, M. Hugler, C. A. Kerfeld, M. G. Klotz, W. W. Kong, M. Land, A. Lapidus F. W. Larimer, D. L. Longo, S. Lucas, S. A. Malfatti, S. E. Massey, D. D. Martin, Z. McCuddin, F. Me yer, J. L. Moore, L. H. Ocampo, Jr., J. H. Paul, I. T. Paulsen, D. K. Reep, Q. Ren, R. L. Ross, P. Y. Sato, P. Thomas, L. E. Tinkham, and G. T. Zeruth. 2006. The genome of deep-sea vent chemolithoautotroph Thiomicrospira crunogena XCL-2. PLoS Biol 4:e383.

PAGE 154

ABOUT THE AUTHOR William Kong earned a B.S. degree in Microb iology from the college of Arts and Sciences from University of South Florida on July 2000. He entered University of South Florida’s college of Medicine’s Medical Sciences Ph.D. program on August 2005. During his graduate study, William publishe d two first author peer-reviewed manuscripts, one invited review article, and multiple co-author peer-reviewed scientific journals. He was awarded Outstanding Presen tations in USF Health’s Research Day in 2008 and 2009; USF Resident Gr aduation and Research Day in 2009; and the prestigious USF College of Medicine Merit Scholarship in 2009. William is an associate member of American Association of Cancer Research and a member of Asso ciation of Medical Science Graduate Students (AMSGS) at USF. He was also involved in many research projects that resulted in fundi ng of grants applied to Nationa l Institute of Health, National Cancer Institute, and Department of Defense. Outside of science and academics, William is a PADI open water diver and have dove in the Gulf of Mexico, Atlantic Ocean, and the Caribbean. He hopes to dive the Great Barrier Reef some day. He is also an avid traveler and been to numerous states including Hawaii, California, Nevada, Ar izona, New York, Massachusetts, Georgia, Alabama, Texas, Arkansas, and Louisiana. He has also visited many international destinations including Australia, Baha mas, Canada, China, Hong Kong, Taiwan, Thailand and Malaysia.