USF Libraries
USF Digital Collections

Enhancing virus surveillance through metagenomics :

MISSING IMAGE

Material Information

Title:
Enhancing virus surveillance through metagenomics : water quality and public health applications
Physical Description:
Book
Language:
English
Creator:
Rosario, Karyna
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Enteric Viruses
Bioindicators
Wastewater
Reclaimed Water
Fecal Pollution
Single-stranded DNA Viruses
Dissertations, Academic -- Marine Science -- Masters -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: Monitoring viruses circulating in the human population and the environment is critical for protecting public and ecosystem health. The goal of this dissertation was to incorporate a viral metagenomic approach into virus surveillance efforts (both clinical and water quality control programs) to enhance traditional virus detection methods. Clinical surveillance programs are designed to identify and monitor etiological agents that cause disease. However, the ability to identify viruses may be compromised when novel or unsuspected viruses are causing infection since traditional virus detection methods target specific known pathogens. Here we describe the successful application of viral metagenomics in a clinical setting using samples from symptomatic patients collected through the Enterovirus Surveillance (EVS) program in the Netherlands (Appendix A). Despite extensive PCR-based testing, the viruses in a small percentage of these samples (n = 7) remained unidentified for more than 10 years after collection. Viral metagenomics allowed the identification of viruses in all seven samples within a week using minimal sequencing, thus rapidly filling the diagnostic gap. The unexplained samples contained BK polyomavirus, Herpes simplex virus, Newcastle disease virus and the recently discovered Saffold viruses (SAFV) which dominated the unexplained samples (n = 4). This study demonstrated that metagenomic analyses can be added as a routine tool to investigate unidentified viruses in clinical samples in a public-health setting. In addition, metagenomic data gathered for SAFV was used to complete four genotype 3 SAFV (SAFV-3) genomes through primer walking, doubling the number of SAFV-3 full genomic sequences in public databases. In addition to monitoring viruses in symptomatic patients, it is also important to monitor viruses in wastewater (raw and treated) to protect the environment from biological contamination and prevent further spread of pathogens. To gain a comprehensive understanding of viruses that endure wastewater treatment, viral metagenomics was used to survey the total DNA and RNA viral community in reclaimed water (the reusable end-product of wastewater treatment) (Appendix B). Phages (viruses that infect bacteria) dominated the DNA viral community while eukaryotic viruses similar to known plant and insect viruses dominated RNA metagenomic libraries suggesting that highly stable viruses may be disseminated through this alternative water supply. A plant virus, the Pepper mild mottle virus (PMMoV), was identified as a potential indicator of wastewater contamination based on metagenomic data and quantitative PCR assays (Appendix C). The metagenomic analysis also revealed a wealth of novel single-stranded DNA (ssDNA) viruses in reclaimed water. Further investigation of sequences with low-level similarities to known ssDNA viruses led to the completion of ten novel ssDNA genomes from reclaimed water and marine environments (Appendix D). Unique genome architectures and phylogenetic analysis suggest that these ssDNA viruses belong to new viral genera and/or families. To further explore the ecology of the novel ssDNA viruses, a strategy was developed to take metagenomic analysis to the next level by combining expression analysis and immunotechnology (Appendix E). This dissertation made a significant contribution to current microbiological data regarding wastewater by uncovering viruses that endure the wastewater treatment and identifying a new viral bioindicator.
Thesis:
Dissertation (PHD)--University of South Florida, 2010.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Karyna Rosario.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains X pages.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
usfldc doi - E14-SFE0004772
usfldc handle - e14.4772
System ID:
SFS0028062:00001


This item is only available as the following downloads:


Full Text

PAGE 1

Enhancing Virus Surveillance through Metagenomics: Water Quality and Public Health Applications by Karyna Rosario Cora A dissertation submitted in partial fulfillment o f the requirements for the degree of Doctor of Philosophy College of Mari ne Science University of South Florida Major Professor: Mya Breitbart, Ph.D. John Cannon, Ph.D John Paul, Ph.D. Kathleen Scott, Ph.D Ted Van Vleet, Ph.D. Date of Approval: October 28, 2010 Keywords: Enteric Viruses, Bioindicators, Wastewater, Rec laimed Water, Fecal Pollution, Single stranded DNA Viruses Copyright 2010, Karyna Rosario Cora

PAGE 2

DEDICATION Este logro est dedicado a mi familia. A mi esposo, Luke A. LeMond, por entender el sacrificio que implica completar un doctorado y por su apoyo incondicional durante todos estos aos. A mis padres, Myrna L. Cora y Rafael Rosario, por hace rme entender lo importante que es ir tras tus metas sin importar que tan incansables sean, aunque eso conlleve alejarme fsicamente de la familia. A mis hermanas, Shakyra Rosario Cora y Yahayra Rosario Cora, por siempre creer en mi y por su amistad porque ms que hermanas somos amigas Gracias a todos por siempre estar ah para escucharme,

PAGE 3

ACKNOWLEDGEMENTS This dissertation would not be possible without the guidance of my major professor, Dr. Mya Breitbart. There are no words that can express my gratitude to Dr. Breitbart, an advisor like no other. Her commitment to students, good scie nce, flexibility, and sense of humor have made my Ph.D. journey a fun and unforgettable experience. I would also like to thank my committee members, Dr. Kathleen Scott, Dr. John Cannon, Dr. John Paul and Dr. Ted Van Vleet for all their advice and support t hroughout my graduate work. I am really grateful for all the help and friendship that my labmates (Camille Daniels, Terry Ng, Erin Symonds, Dawn Goldsmith, Kim Pause, Darren Dunlap, and Bhakti Dwivedi) offered throughout the years. Their support and advice contributed to the completion and quality of this work.

PAGE 4

i TABLE OF CONTENTS ABSTRACT ................................ ................................ ................................ ..................... i i CHAPTER 1: INTRODUCTION ................................ ................................ ....................... 1 Background ................................ ................................ ................................ ............. 2 Virus S urveillance ................................ ................................ ........................ 2 Limitations of Current Methods Used for Virus S urveillance .................... 5 Metagenomics fo r Discovery and Community A naly sis ............................ 6 Overall Research O bjectives ................................ ................................ .................... 7 Research O verview ................................ ................................ ................................ 8 References ................................ ................................ ................................ ............. 12 CHAPTER 2: RESEARCH I MPACTS AND C ONCLUSIONS ................................ ...... 20 Research I mpacts ................................ ................................ ................................ ... 21 Viral M etagenomics and Clinical S urveillance ................................ ..................... 21 Viral Metagenomics and Water Q uality ................................ ................................ 24 References ................................ ................................ ................................ ............. 29 APPENDIX A: METAGENOMIC SEQUENCING FOR VIRUS I DEN TIFICATION IN A PUBLIC H EALTH SETTING ................................ ................................ ..... 31 APPENDIX B: METAGENOMIC A NALYSIS OF VIRUSES IN RECLAIMED W ATER ................................ ................................ ................................ ................ 32 APPENDIX C: PEPPER MILD MOTTLE VIRUS AS AN INDICATOR OF FECAL P OLLUTION ................................ ................................ ................................ ......... 33 APPENDIX D: DIVERSE CIRCOVIRUS LIKE GENOME ARCHITECTURES R EVEALED BY ENVIRONMENTAL M ETAGENOMICS .............................. 34 APPENDIX E: METHOD DEVELOPMENT FOR THE C HARACTERIZATION OF S INGLE STRANDED DNA V IRUSES ................................ .............................. 35 APPE NDIX F: AUTHOR CONTRIBUTIONS AND COPYRIGHT CLEARANCES .... 36

PAGE 5

ii ABSTRACT Monitoring viruses circulating in the human population and the environment is critical for protecting public and ecosystem health. T he goal of this dissertation was to incorporate a viral met a g e nomic approach into virus su rveillance efforts (both clinical and water quality control programs) to enhance traditional virus detection methods. Clinical surveillance programs are designed to identify and monitor etiological agents that cause disease. However, the ability to identify viruses may be c ompromised when novel or unsuspected viruses are causing infection since traditional virus detection methods target specific known pathogens Here we describe the successful application of viral metagenomics in a clinical setting using samples from sympto matic patients collected through the Enterovirus Surveillance (EVS) pro gram in the Netherlands (Appendix A ). Despite extensive PCR based testing, the viruses in a small percentage of these samples (n = 7) remained unidentified for more than 10 years after collection. Viral metagenomics allowed the identification of viruses in all seven samples within a week using minimal sequencing thus rapidly filling the diagnostic gap. The unexplained samples contained BK polyomavirus, H erpes simplex virus, Newcastle di sease virus and the recently discovered Saffold viruses (SAFV) which dominated the unexplained samples ( n = 4) This study demonstrated that metagenomic analyse s can be added as a routine tool to investigate unidentifie d viruses in clinical samples in a pu blic health setting In addition, metagenomic data gathered for SAFV was used to complete four

PAGE 6

iii genotype 3 SAFV (SAFV 3) genomes through primer walking, doubling the number of SAFV 3 full genomic sequences in public databases. In addition to monitoring viru ses in symptomatic patients, it is also important to monitor viruses in wastewater (raw and treated) to protect the environment from biological contamination and prevent further spread of pathogens. T o gain a comprehensive understanding of viruses that end ure wastewater treatment, viral metagenomics was used to survey the total DNA and RNA viral community in reclaimed water ( the reusable end product of wastewater treatment) (Appendix B ). Phages (viruses that infect bacteria) dominated the DNA viral communit y while eukaryotic viruses similar to known plant and insect viruses dominated RNA metagenomic libraries suggesting that highly stable viruses may be disseminated through this alternative water supply A plant virus, the Pepper mild mottle virus (PMMoV), w as identified as a potential indicator of wastewater contamination based on metagenomic data and qu antitative PCR assays (Appendix C ). The metagenomic analysis also revealed a wealth of novel single stranded DNA (ssDNA) viruses in reclaimed water Further investigation of sequences with low level similarities to known ssDNA viruses led to the completion of ten novel ssDNA genomes from reclaimed water an d marine environments (Appendix D ). Unique genome architectures and phylogenetic analysis suggest that the se ssDNA viruses belong to new viral genera and/or families. To further explore the ecology of the novel ssDNA viruses, a strategy was developed to take met agenomic analysis to the next level by combining expression analysis and immunotechnology (Appendix E ). This dissertation made a significant contribution to current microbiological data regarding

PAGE 7

iv wastewater by uncovering viruses that endure the wastewater treatment and identifying a new viral bioindicator

PAGE 8

1 CHAPTER 1 : INTRODUCTION

PAGE 9

2 Background Virus S urveillance The detect ion of pathogenic viruses circulating in the human population is a fundamental component of public health monitoring schemes to minimize risks associated with pathogen transmission In clinical settings it is crit ical to monitor viral pathogens for early detection and inter vention (1, 2) For this purpose, p athogens are usually monitored by collecting samples from patients expressing disease symptoms. However the emergence of epizootic diseases has necessitated t he ecological surveillance of viral pathogens in order to identify conditions that may lead to human infection (e.g. (3 5) ) Ecological surveillance involves the detectio n and identification of epizoo tic viruses in animal hosts and environmental reservoirs includ ing vectors responsible for transmitting the viruses (e g. (6 8) ). Since pathogenic viruses can be shed in high numbers in human feces (9 12) wastewater is considered a n important source of pathogen s to the environment (13, 14) Therefore it is important to monitor viruses in wastewater (raw and treated) to protect environments exposed to wastewater discharges from biological contamination and prevent further spread of pathogen s This type of surveillance is accomplished through water quality control programs. Although surveillance efforts in both cl inical and water quality control programs aim to limit pathogen dissemination their overall objective is different and thus the appro aches used for monitoring viruses differ. Clinical surveillance programs provide vital information for improving disease management strategies such as vaccine implementation and vector control (e.g. (15 17) ). Therefore it is of utmost importance to identify and monitor etiologic al agents that cause

PAGE 10

3 disease The detection and identification of viruses in clinical samples relies on a range of traditional and modern techniques including cell culture, electron microscopy, serology and molecular assays designed to screen for specific viral species or closely related viruses (18) The c ombination of these molecular techniques is often successful but fails to produce conclusive results when novel viruses or divergent variants of a known viral family are involved. This may result in a high percentage (up to 5 0 %) of cases with unidentified etiological agents (19 22) Moreover, new viruses are frequently discovered creating the need to constantly update PCR assays (23 26) Microarrays have been proposed as a more sensitive tool to moni tor viruses with high mutability and have been shown to provide significant advan tages over isolation in culture, immunoassays, and PCR based methods (27 29) Notably microarrays can be used to simultaneously test for multiple species of viruses offering an opportunity for massive ly parallel virus surveillance (30) However, microarrays often fail to detect etiological agents in clinical samples from patients suspected to ha ve viral infections (28) New approaches are needed to identify divergent and novel viruses that standard clinical surveillance methods fail to detect. In contrast to clinical scenarios w ater quality control programs that monitor the microbiological quality of wastewater are not designed to detect specific pathogens. The main goal of w ater quality programs is to limit the dissemination of fecal associated pathogens through wastewater discharges into the enviro nment consequently minimizing public exposure to these pathogens Due to the wide variety of possible pathogens and the large number of samples that must be tested on a frequent basis current quality control methods do not test the presence of pathogens directly (31) Instead standard detection

PAGE 11

4 methods focus on detecting indicator organisms that serve as surrogates for pathogenic organisms (32) It has been shown that bacterial indicators currently used for microbiological monitoring of wastewater, such as fecal coliforms and Enterococci, are easily inactivated compared to viruses and often do not correlate with the occurrence of viral pathogens in wastewater (33 39) These findings have led seve ral scientists to propose a suit e of viral bioindicator s including coliphage, human adenoviruses and polyomaviruses as a more sensitive tool to detect viral pathogen s (37, 39 41) Due to the historical dependence on indicator organisms to monitor water quality the virological content of was tew ater is still largely unknown. M ost microbiological and risk assessment studies regarding wastewater ha ve examined either indicator organisms or specific human pathogens (42) However, w astewater may also be a reservoir for non human pathogens that are present in human waste. For example, it has b een shown that plant viruses dominate the RNA viral community in human feces (43) Other studies have identified animal rotavirus strains of unknown origin co circulating with human strains in sewage and treated wastewater (44, 45) Furthermore stud ies investigating the viral community in stool from South Asian children have identified an abundance of novel picornaviruses related to animal and insect pathogens (46, 47) Therefore in addition to human pathogens, the diverse viral flora in human feces may contain pl ant, insect, and animal viruses Since wastewater is ultimately discharged i nto the environment, it is relevant for ecosystem health to evaluate if these non human pathogens are also present in wastewater. I f current treatments fail to remove plant and insect pathogens from wastewater this may have implications for the use of treated effl uent (i.e. reclaimed water) for agricultural irrigation In order to protect public and environmental health,

PAGE 12

5 there is a need to assess the total viral community in wastewater instead of focusing exclusively on human viruses. Limitations of Current M etho ds U sed for V irus S urveillance The methods conventionally used for v irus surveillance are limited as these methods heavily depend on a priori knowledge of the viruses that are being targeted In clinical settings if novel or unsuspected viruses are causing infection then current methods that target a specific virus or group of viruses will fail to identify the etiological agent Although water quality control programs aim to detect bioindicator s rather than specific pathogens the scarce knowledge regardin g the viral content in wastewater demonstrates the need to survey the viral community in wastewater Information from these surveys can later be used to identify new and improved viral bioindicators test the efficacy of different wastewater treatment tech niques, and evaluate potential impacts on ecosystem health However, current methods in water qua lity programs do not allow for total viral community analyse s since no single monitoring assay can target all viruses. In view of the limitations of methods th at target specific viruses, new approaches are in surveillance schemes One promising approach for viral identification and community analysis is the use of virus particle purification and m etagenomic sequencing (viral metagenomics).

PAGE 13

6 Metagenomics for V irus D iscovery and V iral C ommunit y A nalysis T raditional approach es used to identify viruses in surveillance programs are problematic because they require prior knowledge of the viruses that a re being targeted. For example, culture based methods depend on the availability and selection of appropriate susceptible host cells to propagate viruses. Molecular approaches, such as PCR assays, require knowledge regarding genomic information for primer design. Moreover, viruses do not have ubiquitously conserved genetic elements such as ribosomal DNA that can be used to amplify and identify all viruses (48) T hus there is no universal PCR assay that can target all the viruses in a sample Although microarrays can be used for massive parallel detection of multiple viral species, the assay still depends on oligoprobes based on known viruses and, thus, may fai l to detect divergent viral species Furthermore each microarray will only detect viruses that can bind to the oligoprobes included in the assay (30) The s e limitation s make traditional methods insufficient for virus surveilla nce strategies that need to characteriz e novel viruses in clinical samples or investigate the total viral community found in wastewater Metagenomic (whole community) analyses offer an opportunity to circumvent limitations found in current assays used for virus surveillance and directly describe the composition and structure of uncultured viral communities. In contrast to s pecific assays that are designed to recover a single virus or a group of closely related viruses, viral metagenomics allows t he identif ication of viruses in a sample without a priori knowledge of the viral types present (49, 50) It is important to distingui sh viral metagenomics, where viruses are purified before shotgun sequencing and yield of viral sequences is high (51) from a direct metagenomics approach, where total homogenates are sequenced and

PAGE 14

7 viruses only account for a small proportion of the sequences (52) V iral metagenomics has been used to describe viruses in mammal ian feces (43, 47, 53 57) cell culture s (46, 58) respirat ory tract aspirates (25, 59) blood (58, 60) and animal tissues (61, 62) as well as to characterize viral communities present in different environment s (63 67) A pplying a viral metagenomic app roach into virus surveillance efforts will allow the description of unidentified viruses in clinical samples and characterization of the entire viral community in wastewater as opposed to using specific assays for a limited number of viruses. This novel a pproach will enhance and complement current methods used for virus surveillance. Overall Research O bjectives The overarching goal of this research project was to apply viral metagenomics in virus surveillance efforts including clinical and water quality control programs. The project objectives included : 1) Characterization of unidentified viruses in samples collected through an established clinical surveillance program 2) Description of the complete DNA and RNA viral community in treated wastewater 3) Identificat ion of a potential new viral bioindicator for water quality assessments 4) Characterization of newly described single stranded DNA (ssDNA) viruses identified in wastewater

PAGE 15

8 Research O verview Viral metagenomics was used to enhance current methods for vir us surveillance in clinical and water quality control programs. The information gathered during the project was used to make recommendations for clinical surveillance programs and add to the current microbiological data regarding viruses in wastewater. The objectives of the project were accomplished through the following studies: Appendix A : Metagenomic Sequencing for Virus Identification in a Public Health S etting o This study describes systematic analysis of 1834 clinical specimens cultured from symp tomatic patients as part of the Enterovirus Surveillance program in the Netherlands through a combination of PCR based assays and viral metagenomics. During the investigated 13 year period (1994 2007), a total of seven samples exhibited reproducible cytopa thogenic effects in cell culture and tested negative for standard PCR assays and, thus, remained unexplained. In order to fill the diagnostic gap, metagenomic sequencing was applied to virus particles purified from the unexplained cell culture samples. Vir al metagenomics resulted in the rapid identification of viruses in all the samples with minimal sequencing. This study demonstrated that viral metagenomics is a powerful tool that can be integrated into public health monitoring efforts to investigate unexp lained infections that standard PCR assays fail to detect. In addition, four

PAGE 16

9 genomes of the recently discovered Saffold virus were completed and reported as part of this work. Appendix B : Metagenomic A nalysis of Viruses in Reclaimed W ater o The use of r eclai med water (i.e., the reusable end product of wastewater treatment) is an important component of sustainable water resource management. The primary goal of this study was to characterize the DNA and RNA viral community found in reclaimed water in an effort to detect viruses that endure the wastewater treatment process. The data suggested that reclaimed water may play a role in the dissemination of highly stable plant viruses and other novel viruses that have not been previously described. Stable viruses foun d in reclaimed water may share the same resistance to wastewater treatment processes as some pathogens of concern to public health. Therefore reclaimed water represents an untapped source for discovering new bioindicators that can serve as surrogates for p athogen detection in water supplies. Appendix C : Pepper Mild Mottle V irus as an Indicator of Fecal P ollution o Accurate indicators of fecal pollution are needed to minimize public health risks associated with wastewater contamination in recreational waters A plant virus, Pepper mild mottle virus (PMMoV), was identified as a potential novel indicator of wastewater contamination metagenomic sequencing of reclaimed water. Quantitative PCR assays showed that PMMoV is widespread and abundant in wastewater throu ghout the United

PAGE 17

10 States including both raw sewage and treated effluent. Further testing revealed the presence of PMMoV in seawater samples collected near point sources of secondary treated wastewater where it co occurred with several human pathogens and o ther proposed indicators of fecal pollution. The data collected during this study demonstrated that PMMoV is a promising indicator of fecal pollution in coastal environments. Appendix D : Diverse Circovirus like Genome Architectures Revealed by E nviro nment al M etagenomics o One of the biggest advantages of metagenomics is the potential to uncover new viruses directly from environmental communities without having prior knowledge of their existence. The reclaimed water DNA viral metagenome contained a wea lth of sequences with low levels of similarities to single stranded DNA ( ssDNA ) viruses This study focused on further investigating these sequences through the complete sequencing of five novel genomes. Data mining of environmental datasets resulted in th e completion of an additional five genomes with similar characteristics from metagenomic libraries of three different marine environments (Chesapeake Bay, British Columbia coastal waters, and Sargasso Sea). The ten novel genomes shared similarities with ss DNA circoviruses; however, only half exhibited genomic features consistent with known circoviruses. Unique genome architectures and phylogenetic analysis suggest that these viruses belong to new viral genera and/or families. This

PAGE 18

11 study revealed an unpreced ented diversity of ssDNA viruses with unique features in the environment Appendix E : Method Development for the C haracterization of N ovel S ingle stranded DNA V iruses o Metagenomic analyses have led to the discovery of a diversity of unknown ssDNA virus es in the environment. Since the novel ssDNA viruses have been identified directly from environmental sequence datasets and the hosts are unknown we are extremely limited in our ability to characterize these viruses. This study aimed to take metagenomic an alysis to the next level by combin in g expression analysis and immunotechnology to describe novel ssDNA viruses in reclaimed water. Recombinant expression of structural proteins would allow us to isolate unknown viruses from environmental samples by virtue of the antigenic properties of these proteins. For this purpose, t he potential structural genes of novel viruses were identified from assembled genomes based on conserved genome organizations However, the expression of the environmental ssDNA viruses prov ed to be difficult in the selected bacterial expression system and future studies should evaluate eukaryotic expression systems. This research will provide a method f or isolation and characterization of unknown ssDNA viruses in the environment based on str uctural genes found in metagenomic libraries

PAGE 19

12 References 1. Lee, K. S., Y. L. Lai, S. Lo, T. Barkham, P. Aw, P. L. Ooi, J. C. Tai, M. Hibberd, P. Johansson, S. P. Khoo, and L. C. Ng. 2010. Dengue virus surveillance for early warnin g, Singapore. Emerging Infectious Diseases [online serial: http://www.cdc.gov/EID/content/16/5/847.htm] 2. Noda, I., M. Kitamoto, H. Nakahara, R. Hayashi, T. Okimoto, Y. Monzen, H. Yamada, M. I magawa, N. Hiraga, J. Tanaka, and K. Chayama. Regular surveillance by imaging for early detection and better prognosis of hepatocellular carcinoma in patients infected with hepatitis C virus. Journal of Gastroenterology 45: 105 112. 3. Iglesias, I., M. J. M unoz, M. Martinez, and A. de la Torre. Environmental risk factors associated with H5N1 HPAI in Ramsar Wetlands of Europe. Avian Diseases 54: 814 820. 4. Ginsberg, H. S., I. Rochlin, and S. R. Campbell. The use of early summer mosquito surveillance to predic t late summer West Nile virus activity. Journal of Vector Ecology 35: 35 42. 5. Munster, V. J., J. Veen, B. Olsen, R. Vogel, A. Osterhaus, and R. A. M. Fouchier. 2006. Towards improved influenza A virus surveillance in migrating birds. Vaccine 24: 6729 6733. 6. Marfin, A. A., L. R. Petersen, M. Eidson, J. Miller, J. Hadler, C. Farello, B. Werner, G. L. Campbell, M. Layton, P. Smith, E. Bresnitz, M. Cartter, J. Scaletta, G. Obiri, M. Bunning, R. C. Craven, J. T. Roehrig, K. G. Julian, S. R. Hinten, D. J. Guble r, and N. E. T. C. S. G. Arbo. 2001. Widespread West Nile virus activity, Eastern United States, 2000. Emerging Infectious Diseases 7: 730 735. 7. Matsui, S. 2005. Protecting human and ecological health under viral threats in Asia. Water Science and Technol ogy 51: 91 97. 8. Krauss, S., D. E. Stallknecht, N. J. Negovetich, L. J. Niles, R. J. Webby, and R. G. Webster. Coincident ruddy turnstone migration and horseshoe crab spawning creates an ecological 'hot spot' for influenza viruses. Proceedings of the Royal Society B Biological Sciences : [doi:10.1098/rspb.2010.1090].

PAGE 20

13 9. Atmar, R. L., A. R. Opekun, M. A. Gilger, M. K. Estes, S. E. Crawford, F. H. Neill, and D. Y. Graham. 2008. Norwalk virus shedding after experimental human infection. Emerging Infectious Dis eases 14: 1553 1557. 10. Orru, G., G. Masia, G. Orru, L. Romano, V. Piras, and R. C. Coppola. 2004. Detection and quantitation of hepatitis E virus in human faeces by real time quantitative PCR. Journal of Virological Methods 118: 77 82. 11. Poon, L. L. M., K. H. Chan, O. K. Wong, T. K. W. Cheung, I. Ng, B. J. Zheng, W. H. Seto, K. Y. Yuen, Y. Guan, and J. S. M. Peiris. 2004. Detection of SARS coronavirus in patients with severe acute respiratory syndrome by conventional and real time quantitative reverse tra nscription PCR assays. Clinical Chemistry 50: 67 72. 12. Iwakiri, A., H. Ganmyo, S. Yamamoto, K. Otao, M. Mikasa, S. Kizoe, K. Katayama, T. Wakita, N. Takeda, and T. Oka. 2009. Quantitative analysis of fecal sapovirus shedding: identification of nucleotide substitutions in the capsid protein during prolonged excretion. Archives of Virology 154: 689 693. 13. Okoh, A. I., E. E. Odjadjare, E. O. Igbinosa, and A. N. Osode. 2007. Wastewater treatment plants as a source of microbial pathogens in receiving watershed s. African Journal of Biotechnology 6: 2932 2944. 14. Crockett, C. S. 2007. The role of wastewater treatment in protecting water supplies against emerging pathogens. Water Environment Research 79: 221 232. 15. Iwane, M. K., K. M. Edwards, P. G. Szilagyi, F. J. Walker, M. R. Griffin, G. A. Weinberg, C. Coulen, K. A. Poehling, L. P. Shone, S. Balter, C. B. Hall, D. D. Erdman, K. Wooten, B. Schwartz, and N. for the New Vaccine Surveillance. 2004. Population based surveillance for hospitalizations associated with respiratory syncytial virus, influenza virus, and parainfluenza viruses among young children. Pediatrics 113: 1758 1764. 16. Halloran, M. E., I. M. Longini, M. J. Gaglani, P. A. Piedra, H. Chu, G. B. Herschler, and W. P. Glezen. 2003. Estimating efficacy o f trivalent, cold adapted, influenza virus vaccine (CAIV T) against influenza A (H1N1) and B using surveillance cultures. American Journal of Epidemiology 158: 305 311.

PAGE 21

14 17. Guedes, D. R. D., M. T. Cordeiro, M. A. V. Melo Santos, T. Magalhaes, E. Marques, L Regis, A. F. Furtado, and C. F. J. Ayres. Patient based dengue virus surveillance in Aedes aegypti from Recife, Brazil. Journal of Vector Borne Diseases 47: 67 75. 18. Leland, D. S., and C. C. Ginocchio. 2007. Role of cell culture for virus detection in t he age of technology. Clinical Microbiology Reviews 20: 49 78. 19. Attili, S. V. S., A. K. Gulati, V. P. Singh, D. V. Varma, M. Rai, and S. Sundar. 2006. Diarrhea, CD4 counts and enteric infections in a hospital based cohort of HIV infected patients around Varanasi, India. BMC Infectious Diseases 6: 8. 20. Thomazelli, L. M., S. Vieira, A. L. Leal, T. S. Sousa, D. B. L. Oliveira, M. A. Golono, A. E. Gillio, K. E. Stwienr, D. D. Erdman, and E. L. Durigon. 2007. Surveillance of eight respiratory viruses in clini cal samples of pediatric patients in southeast Brazil. Jornal De Pediatria 83: 422 428. 21. Gruteke, P., A. S. Glas, M. Dierdorp, W. B. Vreede, J. W. Pilon, and S. M. Bruisten. 2004. Practical implementation of a multiplex PCR for acute respiratory tract in fections in children. Journal of Clinical Microbiology 42: 5596 5603. 22. van Gageldonk Lafeber, A. B., M. L. A. Heijnen, A. I. M. Bartelds, M. F. Peters, S. M. van der Plas, and B. Wilbrink. 2005. A case control study of acute respiratory tract infection i n general practice patients in the Netherlands. Clinical Infectious Diseases 41: 490 497. 23. Kang, X. P., T. Jiang, Y. Q. Li, F. Lin, H. Liu, G. H. Chang, Q. Y. Zhu, E. D. Qin, C. F. Qin, and Y. H. Yang. A duplex real time RT PCR assay for detecting H5N1 a vian influenza virus and pandemic H1N1 influenza virus. Virology Journal 7: 4. 24. Abed, Y., and G. Boivin. 2008. New saffold cardioviruses in 3 children, Canada. Emerging Infectious Diseases 14: 834 836. 25. Allander, T., M. T. Tammi, M. Eriksson, A. Bjerkn er, A. Tiveljung Lindell, and B. Andersson. 2005. Cloning of a human parvovirus by molecular screening of respiratory tract samples. Proceedings of the National Academy of Sciences of the United States of America 102: 12891 12896.

PAGE 22

15 26. van der Hoek, L., K. P yrc, M. F. Jebbink, W. Vermeulen Oost, R. J. M. Berkhout, K. C. Wolthers, P. M. E. Wertheim van Dillen, J. Kaandorp, J. Spaargaren, and B. Berkhout. 2004. Identification of a new human coronavirus. Nature Medicine 10: 368 373. 27. Kistler, A., P. C. Avila, S. Rouskin, D. Wang, T. Ward, S. Yagi, D. Schnurr, D. Ganem, J. L. DeRisi, and H. A. Boushey. 2007. Pan viral screening of respiratory tract infections in adults with and without asthma reveals unexpected human coronavirus and human rhinovirus diversity. J ournal of Infectious Diseases 196: 817 825. 28. Chiu, C. Y., A. Urisman, T. L. Greenhow, S. Rouskin, S. Yagi, D. Schnurr, C. Wright, L. Drew, D. Wang, P. S. Weintrub, J. L. DeRisi, and D. Ganem. 2008. Utility of DNA microarrays for detection of viruses in a cute respiratory tract infections in children. Journal of Pediatrics 153: 76 83. 29. Townsend, M. B., E. D. Dawson, M. Mehlmann, J. A. Smagala, D. M. Dankbar, C. L. Moore, C. B. Smith, N. J. Cox, R. D. Kuchta, and K. L. Rowlen. 2006. Experimental evaluation of the FluChip Diagnostic Microarray for influenza virus surveillance. Journal of Clinical Microbiology 44: 2863 2871. 30. Wang, D., A. Urisman, Y. T. Liu, M. Springer, T. G. Ksiazek, D. D. Erdman, E. R. Mardis, M. Hickenbotham, V. Magrini, J. Eldred, J. P Latreille, R. K. Wilson, D. Ganem, and J. L. DeRisi. 2003. Viral discovery and sequence recovery using DNA microarrays. Plos Biology 1: 257 260. 31. Salgot, M., C. Campos, B. Galofre, and J. C. Tapias. 2001. Biological control tools for wastewater reclama tion and reuse. A critical review. Water Science and Technology 43: 195 201. 32. Yates, M. V. 2007. Classical indicators in the 21st century Far and beyond the coliform. Water Environment Research 79: 279 286. 33. Sidhu, J. P. S., J. Hanna, and S. G. Toze. 2008. Survival of enteric microorganisms on grass surfaces irrigated with treated effluent. Journal of Water and Health 6: 255 262. 34. Blatchley, E. R., W. L. Gong, J. E. Alleman, J. B. Rose, D. E. Huffman, M. Otaki, and J. T Lisle. 2007. Effects of waste water disinfection on waterborne bacteria and viruses. Water Environment Research 79: 81 92.

PAGE 23

16 35. Nasser, A. M., and S. D. Oman. 1999. Quantitative assessment of the inactivation of pathogenic and indicator viruses in natural water sources. Water Research 33 : 1748 1752. 36. Savichtcheva, O., and S. Okabe. 2006. Alternative indicators of fecal pollution: Relations with pathogens and conventional indicators, current methodologies for direct pathogen monitoring and future application perspectives. Water Research 40: 2463 2476. 37. Harwood, V. J., A. D. Levine, T. M. Scott, V. Chivukula, J. Lukasik, S. R. Farrah, and J. B. Rose. 2005. Validity of the indicator organism paradigm for pathogen reduction in reclaimed water and public health protection. Applied and Envir onmental Microbiology 71: 3163 3170. 38. Haramoto, E., H. Katayama, K. Oguma, H. Yamashita, A. Tajima, H. Nakajima, and S. Ohgaki. 2006. Seasonal profiles of human noroviruses and indicator bacteria in a wastewater treatment plant in Tokyo, Japan. Water Sci ence and Technology 54: 301 308. 39. Carducci, A., P. Morici, F. Pizzi, R. Battistini, E. Rovini, and M. Verani. 2008. Study of the viral removal efficiency in an urban wastewater treatment plant. Water Science and Technology 58: 893 897. 40. Bofill Mas, S., N. Albinana Gimenez, P. Clemente Casares, A. Hundesa, J. Rodriguez Manzano, A. Allard, M. Calvo, and R. Girones. 2006. Quantification and stability of human adenoviruses and polyomavirus JCPyV in wastewater matrices. Applied and Environmental Microbiology 72: 7894 7896. 41. McQuaig, S. M., T. M. Scott, V. J. Harwood, S. R. Farrah, and J. O. Lukasik. 2006. Detection of human derived fecal pollution in environmental waters by use of a PCR based human polyomavirus assay. Applied and Environmental Microbiology 72: 7567 7574. 42. Westrell, T., C. Schonning, T. A. Stenstrom, and N. J. Ashbolt. 2004. QMRA (quantitative microbial risk assessment) and HACCP (hazard analysis and critical control points) for management of pathogens in wastewater and sewage sludge treatm ent and reuse. Water Science and Technology 50: 23 30.

PAGE 24

17 43. Zhang, T., M. Breitbart, W. H. Lee, J. Q. Run, C. L. Wei, S. W. L. Soh, M. L. Hibberd, E. T. Liu, F. Rohwer, and Y. J. Ruan. 2006. RNA viral community in human feces: prevalence of plant pathogenic viruses. PLoS Biology 4: 108 118. 44. Villena, C., W. M. El Senousy, F. X. Abad, R. M. Pinto, and A. Bosch. 2003. Group A rotavirus in sewage samples from Barcelona and Cairo: emergence of unusual genotypes. Applied and Environmental Microbiology 69: 3919 39 23. 45. Meleg, E., K. Banyai, V. Martella, B. Jiang, B. Kocsis, P. Kisfali, B. Melegh, and G. Szucs. 2008. Detection and quantification of group C rotaviruses in communal sewage. Applied and Environmental Microbiology 74: 3394 3399. 46. Kapoor, A., J. Victo ria, P. Simmonds, E. Slikas, T. Chieochansin, A. Naeem, S. Shaukat, S. Sharif, M. M. Alam, M. Angez, C. L. Wang, R. W. Shafer, S. Zaidi, and E. Delwart. 2008. A highly prevalent and genetically diversified Picornaviridae genus in South Asian children. Proc eedings of the National Academy of Sciences of the United States of America 105: 20482 20487. 47. Victoria, J. G., A. Kapoor, L. Li, O. Blinkova, B. Slikas, C. Wang, A. Naeem, S. Zaidi, and E. Delwart. 2009. Metagenomic analyses of viruses in the stool of c hildren with acute flaccid paralysis. Journal of Virology : 4642 4651. 48. Rohwer, F., and R. Edwards. 2002. The Phage Proteomic Tree: a genome based taxonomy for phage. Journal of Bacteriology 184: 4529 4535. 49. Delwart, E. L. 2007. Viral metagenomics. Revi ews in Medical Virology 17: 115 131. 50. Edwards, R. A., and F. Rohwer. 2005. Viral metagenomics. Nature Reviews Microbiology 3: 504 510. 51. Thurber, R. V., M. Haynes, M. Breitbart, L. Wegley, and F. Rohwer. 2009. Laboratory procedures to generate viral met agenomes. Nature Protocols 4: 470 483. 52. Cox Foster, D. L., S. Conlan, E. C. Holmes, G. Palacios, J. D. Evans, N. A. Moran, P. L. Quan, T. Briese, M. Hornig, D. M. Geiser, V. Martinson, D. vanEngelsdorp, A. L. Kalkstein, A. Drysdale, J. Hui, J. H. Zhai, L W. Cui, S. K. Hutchison, J. F. Simons, M. Egholm, J. S. Pettis, and W. I. Lipkin. 2007. A

PAGE 25

18 metagenomic survey of microbes in honey bee colony collapse disorder. Science 318: 283 287. 53. Blinkova, O., J. Victoria, Y. Li, B. F. Keele, C. Sanz, J. B. N. Ndja ngo, M. Peeters, D. Travis, E. V. Lonsdorf, M. L. Wilson, A. E. Pusey, B. H. Hahn, and E. L. Delwart. 2010. Novel circular DNA viruses in stool samples of wild living chimpanzees. Journal of General Virology 91: 74 86. 54. Breitbart, M., I. Hewson, B. Felts J. M. Mahaffy, J. Nulton, P. Salamon, and F. Rohwer. 2003. Metagenomic analyses of an uncultured viral community from human feces. Journal of Bacteriology 185: 6220 6223. 55. Breitbart, M., M. Haynes, S. Kelley, F. Angly, R. A. Edwards, B. Felts, J. M. Ma haffy, J. Mueller, J. Nulton, S. Rayhawk, B. Rodriguez Brito, P. Salamon, and F. Rohwer. 2008. Viral diversity and dynamics in an infant gut. Research in Microbiology 159: 367 373. 56. Cann, A. J., S. E. Fandrich, and S. Heaphy. 2005. Analysis of the virus population present in equine faeces indicates the presence of hundreds of uncharacterized virus genomes. Virus Genes 30: 151 156. 57. Li, L., J. G. Victoria, C. Wang, M. Jones, G. M. Fellers, T. H. Kunz, and E. Delwart. Bat guano virome: predominance of die tary viruses from insects and plants plus novel mammalian viruses. The Journal of Virology 84: 6955 6965. 58. Jones, M. S., A. Kapoor, V. V. Lukashov, P. Simmonds, F. Hecht, and E. Delwart. 2005. New DNA Viruses Identified in Patients with Acute Viral Infec tion Syndrome. The Journal of Virology 79: 8230 8236. 59. Willner, D., M. Furlan, M. Haynes, R. Schmieder, F. E. Angly, J. Silva, S. Tammadoni, B. Nosrat, D. Conrad, and F. Rohwer. 2009. Metagenomic analysis of respiratory tract DNA viral communities in cys tic fibrosis and non cystic fibrosis individuals. Plos One 4 60. Breitbart, M., and F. Rohwer. 2005. Method for discovering novel DNA viruses in blood using viral particle selection and shotgun sequencing. Biotechniques 39: 729 736.

PAGE 26

19 61. Ng, T. F. F., C. Ma nire, K. Borrowman, T. Langer, L. Ehrhart, and M. Breitbart. 2009. Discovery of a novel single stranded DNA virus from a sea turtle fibropapilloma by using viral metagenomics. Journal of Virology 83: 2500 2509. 62. Ng, T. F. F., W. K. Suedmeyer, E. Wheeler, F. Gulland, and M. Breitbart. 2009. Novel anellovirus discovered from a mortality event of captive California sea lions. Journal of General Virology 90: 1256 1261. 63. Angly, F. E., B. Felts, M. Breitbart, P. Salamon, R. A. Edwards, C. Carlson, A. M. Chan, M. Haynes, S. Kelley, H. Liu, J. M. Mahaffy, J. E. Mueller, J. Nulton, R. Olson, R. Parsons, S. Rayhawk, C. A. Suttle, and F. Rohwer. 2006. The marine viromes of four oceanic regions. PLoS Biology 4: e368. 64. Breitbart, M., B. Felts, S. Kelley, J. M. Maha ffy, J. Nulton, P. Salamon, and F. Rohwer. 2004. Diversity and population structure of a near shore marine sediment viral community. Proceedings of the Royal Society of London Series B Biological Sciences 271: 565 574. 65. Dinsdale, E. A., R. A. Edwards, D. Hall, F. Angly, M. Breitbart, J. M. Brulc, M. Furlan, C. Desnues, M. Haynes, L. L. Li, L. McDaniel, M. A. Moran, K. E. Nelson, C. Nilsson, R. Olson, J. Paul, B. R. Brito, Y. J. Ruan, B. K. Swan, R. Stevens, D. L. Valentine, R. V. Thurber, L. Wegley, B. A. White, and F. Rohwer. 2008. Functional metagenomic profiling of nine biomes. Nature 452: 629 U8. 66. Djikeng, A., R. Kuzmickas, N. G. Anderson, and D. J. Spiro. 2009. Metagenomic analysis of RNA viruses in a fresh water lake. Plos One 4 67. Culley, A. I., A. S. Lang, and C. A. Suttle. 2006. Metagenomic analysis of coastal RNA virus communities. Science 312: 1795 1798.

PAGE 27

20 CHAPTER 2 : RESEARCH IMPACTS AND CONCLUSIONS

PAGE 28

21 Research I mpacts Virus surveillance programs are an integral component of publi c health monitoring efforts designed to minimize public exposure to pathogens. However, monitoring efforts are limited in their ability t o detect pathogens since current methods specifically test for a limited number of pathogens, thus relying on prior knowledge of the targeted viruses. The goal of this project was to incorporate a virus metagenomic approach into virus surveillance schemes, including clinical and water quality co ntrol programs, to circumvent methodological limitations traditionally associated with virus detection. Metagenomics enhanced viral surveillance in a clinical setting by enabling the characterization of infectious viral agents in unidentified cl inical spe cimens. In addition, sequencing of the viral metagenome from reclaimed water (the reusable end product of wastewater treatment) described viruses that endure wastewater treatment identifying new viral bioindicators that can be used to improve water qualit y monitoring and uncovering viruses that are not commonly thought to be associated with wastewater Viral Metagenomics and Clinical S urveillance The application of viral metagenomics in a clinical setting was tested using samples collected through the Ent erovirus Surveillance (EVS) program in the Netherlands. In its current form, t he EVS program monitors the circulation of enteroviruses to ensure the eradication of poliovirus from the Netherlands (1, 2) Although routine virological laboratories across the country perform a range of tests for enteroviruses, all cell culture samples exhibiting cytopathogenic effects (CPE) that cannot be identified are submitted to the Center for Infectious Disease Control, National

PAGE 29

22 Institute for Publi c Health and the Environment ( RIVM ) in the Netherlands for virus identification and typing by PCR. Between 1994 and 2007, a total of 1742 unidentified cell culture isolates exhibiting consistent CPE were submitted to RIVM. PCR assays for enteroviruses and parechoviruses performed at RIVM successfully identi fied viruses in approximately 98 % of these isolates. The remaining 2 % of the samples were subjected to extensive PCR testing for a wide range of viruses, including noroviruses, rotaviruses A, B and C, ad enoviruses, astroviruses, sapoviruses, vesiviruses, reoviruses, a generic PCR that detects both enteroviruses and rhinoviruses, hepatitis A and E viruses, influenza A and B viruses, Aichi virus, coronaviruses 229E, NL63 and OC43, human respiratory syncytia l viruses A and B and human metapneumovirus In addition, s amples that remained negative had to be retrospectively analyzed every time PCR assays were updated to include a broader diversity of viruses The process of successive PCR testing for each of thes e viruses was extremely time consuming and labor intensive, with diminishing returns as some of these virus groups were not detected in any of the samples. The EVS program needs to identify all viral agents associated with clinical specimens collected t hro ughout the Netherlands to ensure that infections are not associated with poliovirus and track enteric viruses circulating in the population However, extensive PCR testing fail ed to identify viruses in seven cell culture samples that exhibited consistent C PE Some of the samples from the EVS program remained unidentified for more than 10 years after collection, despite frequent updat es to improve the PCR assays over t ime As presented in this dissertation v iral metagenomics allowed the identification of vi ruses in all seven s amples within a week using minimal sequencing

PAGE 30

23 (< 50 clones per sample). The unexplained samples contained BK polyomavirus, H erpes simplex virus, Newcastle disease virus and the recently discovered Saffold viruses (SAFV) which dominated the unexplained samples ( n = 4) Although all of these viruses had been previously described they were not inc luded in assays performed at RIVM because they were not suspected to cause an infe ction in the samples collected. This assumption precluded the i dentification of viruses in all the samples keeping the EVS program from meeting its goal. Metagenomic analysis does not require prior knowledge of the viruses in a sample fo r identification and, thus, this approach was successful in identifying infecti ous agents in all the samples. Although viral metagenomics was originally developed to describe total viral communities in environmental samples (3) this dissertation proved the effectiveness of viral metagenomics as a strategy for clinical surveillance. Viral metagenomics was a more efficient and cost e ffective alternative than individual PCR assays for different viruses other than enterovir uses and parechoviruses in the EVS program In addition, the discovery of genotype 3 SAFV (SAFV 3) in the EVS samples contributed to genomic data regarding these newly discovered RNA viruses. Prior to the co mpletion of the SAFV 3 found in the EVS sample s there were only three SAFV 3 genomes in public databases. T he metagenomic data gathered for SAFV was used to complete four SAFV 3 genomes through primer walking thus doubling the number of SAFV 3 full genomic sequences in the database This study demons trated that metagenomic analyse s can be added as a routine tool to investigate unidentified viruses in cell cultures from clinical samples in a public health setting Therefore, we recommend the use of viral

PAGE 31

24 metagenomics on cell culture samples that test n egative for established PCR assays in virus surveillance programs. Viral Metagenomics and Water Q uality Viral metagenomics was used to describe the total DNA and RNA viral community in reclaimed water Reclaimed water is an important component of water re use programs that aim to reduce the discharge of wastewater effluent into surface waters and conserve water by supplying water for activities that do not require d rinking water quality standards However this means that the public will be exposed to treat ed wastewater effluent through the use of reclaimed water for non potable public water supply, agricultural irriga tion, environmental enhancement and industri al uses. A s water reuse applications increase and reclaimed water distribution expands, there are some concerns that need to be addressed to ensure protection of public health and the health of the environment including the potential for pathogen dissemination through this alternative water supply Since the virological content of wastewater is still largely unknown, viral metagenomics was used to survey the total viral community in an effort to gain a comprehensive understanding of viruses that endure wastewater treatment. The information gathered during this study was used to identify potential new b ioindicators of fecal pollution and bring attention to non human viruses that have been overlooked when considering water quality. The DNA viral community in reclaimed water was dominated by phages (viruses that infect bacteria) After comparing t his viral community with a potable water viral meta genome, reclaimed water had a distinct phage community based on phage family

PAGE 32

25 distributions and host representation within each family Therefore, although phages dominate both conventional and alternative water sup plies, the types of phages in each water supply differ. From a water quality standpoint, it is useful to evaluate which types of phages endure wastewater treatment processes but are not present in potable water in order to identify potential viral bioindic ators. Finding strong bioindicators that correlate with the presence of human viruses is not an easy task as different viruses exhibit varying levels of resistance to wastewater treatment (4) Natural phage populations found in wastewater offer a range of resistance to disinfection (chlorination) that may represent most of the viruses that can be found in sewage (5) Therefore, phage populations in reclaimed water offer an untapped sourc e of potential bioindicators. Alternatively, eukaryotic viruses such as plant pathogens, may also be explored as potential viral bioindicators. Since plant pathogens found in human waste are suspected to be dietary in origin (6, 7) these viruses may be more abundant in the healthy human population than v iru ses that cause human disease. Data from this dissertation suggest that plant viruses may be good indicators of human fecal pol lution. The plant pathogen Pepper mild mottle virus (PMMoV) was identified as a potential bioindicato r due to its abundance in the reclaimed water RNA libraries and previous findings indicating that this virus dominates the RNA viral community in human fec es (6) Quantitative PCR assays showed that PMMoV is widespread and abundant (> 10 4 copies/ml) in wastewater (both raw and treated) across the United States. In addition, PMMoV was detected in seawater samples collected near point sources of secondary treated was tewater where it co occurred with several other pathogens and indicators of fecal pollution PMMoV was not found in non polluted seawater samples and could be

PAGE 33

26 dete cted in surface seawater for approximately 1 week after its initial introduction, indicating that the presence of PMMoV in the marine environment reflects a recent contamination event These findings suggest PMMoV is a promising indicator of fecal pollutio n in marine environments However, the abundance of PMMoV in both raw sewage and treated wastewater demonstrated that this viral indicator cannot be used to distinguish between thes e two sources of wastewater Instead, PMMoV serves as a conservative viral tracer of fecal pollution that can be used to represent microconstituents and pathogens that may not be removed effectively through wastewater treatment processes. The extremely high concentrations of PMMoV detected in human sewage (up to 10 7 copies/ml) co mpared to the concentration of any human pathogen reported to date (< 10 5 copies/ml) (8 11) suggest that this virus would be a good indicator of human fecal pollution. As a plant path ogen, PMMoV is different from other proposed viral indicators of fecal contamination since its presence in sewage is dietary in origin and is not dependent on active human infection In addition to potential bioindicators, t he reclaime d water metagenome un covered a wealth of novel eukaryotic viruses related to viruses that are not commonly associated with wastewater. Notably, DNA metagenomic libraries revealed the presence of viruses similar to single stranded DNA ( ssDNA ) animal viruses from the Circovirida e famil y which are known avian and porcine pathogens Further investigation of sequences related to circoviruses resulted in the completion of five novel circovirus like genomes. The unprecedented abundance of these viral sequences in reclaimed water prom pted a search for related viruses in other environmental samples. Data mining of environmental datasets resulted in the completion of an additional five circovirus like genomes from

PAGE 34

27 metagenomic libraries of three different marine environments (Chesapeake B ay, British Columbia coastal waters, and Sargasso Sea). The ten novel genomes shared similarities with ssDNA circoviruses; however, only half exhibited genomic features consistent with known circoviruses. Some of the genomes exhibit ed a mixture of genomic features associated with different families of ssDNA viruses (i.e. circoviruses, geminiviruses and parvoviruses). The abundance of circovirus like sequences in environmental metagenomic studies and the presence of unique genome sequences and architectures suggest that there is a complex and largely unexplored community of ssDNA viruses in the environment. T he identification of circovirus like sequences in reclaimed water led to the discovery of novel circovirus genom es in wastewater and the marine environme nt for the first time. However, we are extremely limited in our ability to further characterize these novel viruses since they were identified directly from metagenomic data and the hosts are unknown. I solation of novel ssDNA viral particles from the envir onment will allow further biological and phys icochemical characterization of these unknown viruses This task may be possible through recombinant expression of viral structural proteins and development of immunoassays, such as immunoprecipitation, to isola te native viruses from environmental samples by virtue of the antigenic properties of these proteins. However, in this dissertation, efforts to express and purify recombinant circovirus proteins in a bacterial system were unsuccessful Refinement of recomb inant expression strategies, such as using a eukaryotic expression system, will allow expression of divergent structural proteins and future isol ation of unknown viruses from the environment. T he combination of metagenomic sequencing, protein expression, a nd

PAGE 35

28 imm uno technology is a promis ing strategy that will help overcome the biggest current limitation in metagenomic analyses namely, the connection be tween new genes, viral particles and biological properties Other than data on specific human pathogens, i nformation regarding viruses in wastewater is extremely sparse. Since pathogen transport through wastewater is an important co ncern for public and environmental health, there wa s a need to survey the total viral community in wast ewater to identify viral ty pes that endure wastewater treatment. The metagenomic analysis of viruses in reclaimed water performed in this dissertation significantly contribute d to current microbiological data regarding treated wastewater. The genetic information gathered during this study can be used to design molecular assays to detect viral types of interest and assess their abundance in wastewater and ecosystems exposed to wastewater discharge. The diversity of both phage s an d eukaryotic viruses suspected to be dietary in origin, such as PMMoV, may be examined to find new and improved viral bioindicators of fecal pollution. Since reclaimed water contained a wealth of novel single stranded DNA and RNA viruses related to plant, animal and insect viruses, this alternative water supply may play a role in the dissemination of highly stable viruses Future research needs to evaluate the host range, infectivity and ecological impacts of novel viruses identified in reclaimed water to ensure the appropriate use of this important alternative water supply.

PAGE 36

29 References 1. van Spaendonck, M. A. E. C., P. M. Oostvogel, A. M. van Loon, J. K. van Wijngaarden, and D. Kromhout. 1996. Circulation of poliovirus during the poliomyelitis outbreak in the Netherlands in 1992 1993. Ame rican Journal of Epidemiology 143: 929 935. 2. Oostvogel, P. M., H. G. A. M. van der Avoort, M. N. Mulders, A. M. van Loon, M. A. E. Conyn van Spaendonck, H. C. Rmke, G. van Steenis, and J. K. van Wijngaarden. 1994. Poliomyelitis outbreak in an unvaccinate d community in the Netherlands, 1992 93. The Lancet 344: 665 670. 3. Breitbart, M., P. Salamon, B. Andresen, J. M. Mahaffy, A. M. Segall, D. Mead, F. Azam, and F. Rohwer. 2002. Genomic analysis of uncultured marine viral communities. Proceedings of the Nati onal Academy of Sciences of the United States of America 99: 14250 14255. 4. Nwachcuku, N., and C. P. Gerba. 2004. Emerging waterborne pathogens: can we kill them all? Current Opinion in Biotechnology 15: 175 180. 5. Duran, A. E., M. Muniesa, L. Moce Llivina C. Campos, J. Jofre, and F. Lucena. 2003. Usefulness of different groups of bacteriophages as model micro organisms for evaluating chlorination. Journal of Applied Microbiology 95: 29 37. 6. Zhang, T., M. Breitbart, W. H. Lee, J. Q. Run, C. L. Wei, S. W. L. Soh, M. L. Hibberd, E. T. Liu, F. Rohwer, and Y. J. Ruan. 2006. RNA viral community in human feces: prevalence of plant pathogenic viruses. PLoS Biology 4: 108 118. 7. Tomlinson, J. A., and E. Faithfull. 1982. Isolation of infective Tomato bushy stunt vi rus after passage through the human alimentary tract. Nature 300: 637 638. 8. Bofill Mas, S., N. Albinana Gimenez, P. Clemente Casares, A. Hundesa, J. Rodriguez Manzano, A. Allard, M. Calvo, and R. Girones. 2006. Quantification and stability of human aden oviruses and polyomavirus JCPyV in wastewater matrices. Applied and Environmental Microbiology 72: 7894 7896. 9. Carducci, A., P. Morici, F. Pizzi, R. Battistini, E. Rovini, and M. Verani. 2008. Study of the viral removal efficiency in an urban wastewater t reatment plant. Water Science and Technology 58: 893 897.

PAGE 37

30 10. He, J. W., and S. Jiang. 2005. Quantification of enterococci and human adenoviruses in environmental samples by real time PCR. Applied and Environmental Microbiology 71: 2250 2255. 11. Laverick, M ., A. Wyn Jones, and M. Carter. 2004. Quantitative RT PCR for the enumeration of noroviruses (Norwalk like viruses) in water and sewage. Letters in Applied Microbiology 39: 127 136.

PAGE 38

31 APPENDIX A : METAGENOMIC SEQUENCING FOR VIRUS IDENTIFICATION IN A PUBLIC HEALTH SETTING

PAGE 39

Appendix A

PAGE 40

Appendix A (Continued)

PAGE 41

Appendix A (Continued)

PAGE 42

Appendix A (Continued)

PAGE 43

Appendix A (Continued)

PAGE 44

Appendix A (Continued)

PAGE 45

Appendix A (Continued)

PAGE 46

Appendix A (Continued)

PAGE 47

Appendix A (Continued)

PAGE 48

Appendix A (Continued)

PAGE 49

Appendix A (Continued)

PAGE 50

32 APPENDIX B : METAGENOMIC ANALYSIS OF VIRUSES IN RECLAIMED WATER

PAGE 51

Appendix B

PAGE 52

Appendix B (Continued)

PAGE 53

Appendix B (Continued)

PAGE 54

Appendix B (Continued)

PAGE 55

Appendix B (Continued)

PAGE 56

Appendix B (Continued)

PAGE 57

Appendix B (Continued)

PAGE 58

Appendix B (Continued)

PAGE 59

Appendix B (Continued)

PAGE 60

Appendix B (Continued)

PAGE 61

Appendix B (Continued)

PAGE 62

Appendix B (Continued)

PAGE 63

Appendix B (Continued)

PAGE 64

Appendix B (Continued)

PAGE 65

Appendix B (Continued)

PAGE 66

33 APPENDIX C : PEPPER MILD MOTTLE VIRUS AS AN INDICATOR OF FECAL POLLUTION

PAGE 67

Appendix C

PAGE 68

Appendix C (Continued)

PAGE 69

Appendix C (Continued)

PAGE 70

Appendix C (Continued)

PAGE 71

Appendix C (Continued)

PAGE 72

Appendix C (Continued)

PAGE 73

34 APPENDIX D: DIVERSE CIRCOVIRUS LIKE GENOME ARCHITECTURES REVEALED BY ENVIRONMENTAL METAGENOMICS

PAGE 74

Appendix D

PAGE 75

Appendix D (Continued)

PAGE 76

Appendix D (Continued)

PAGE 77

Appendix D (Continued)

PAGE 78

Appendix D (Continued)

PAGE 79

Appendix D (Continued)

PAGE 80

Appendix D (Continued)

PAGE 81

Appendix D (Continued)

PAGE 82

Appendix D (Continued)

PAGE 83

Appendix D (Continued)

PAGE 84

Appendix D (Continued)

PAGE 85

35 APPENDIX E : METHOD DEVELOPMENT FOR THE CHARACTERIZATION OF NOVEL SINGLE STRANDED DNA VIRUSES

PAGE 86

Appendix E Introduction Metagenomic analyses of environmental samples have led to the discovery of a diversity of novel s ingle s tranded DNA (ssDNA) circo viruses in reclaimed water, marine habitats, lake water, and soil indicating that these viruses are more widesprea d than previously recognized (1 3) G eneric PCR assays have also revealed a wealth of novel circoviruses in sewage and stool from humans and animals in different continents including Africa, South Asia, and North America (4, 5) However nothing is known about the ecology of these novel ssDNA viruses. Further characterization of the novel ssDNA viruses is extremely di fficult since these viruses have been identified directly from environmental metagenomes and their hosts are unknown Therefore t here is a need to develop strategies to bridge genomic data gathered from metagenomic datasets to actual biological properties of novel viruses. We propose that the i solation of novel ssDNA viral particles from the environment will allow further biological and phys icochemical characterization of these unknown viruses Isolation of novel viruses may be possible through recombinant expression of divergent structural proteins and development of immunoassays, such as immunoprecipitation, to isolate native viruses from environmental samples by virtue of the antigenic properties of structural proteins. Here we describe efforts to express a putative structural protein from a novel ssDNA circo virus identified in reclaimed water. The environmental ssDNA virus chosen for this study has ch aracteristics similar to members of the Circovir u s genus within the Circoviridae family. Known c ircoviruse s include pathogens of agricultural and veterinary concern as they can cause fatal diseases in swine and birds (6) However, t o date it has not been possible to culture most

PAGE 87

Appendix E (Continued) circoviruses with the exception of porcine circoviruses making their study difficult The lack of current culturing techniques for most circoviruses is a big limitation and, thus, many studies have taken advantage of recombinant expression technologies in hopes of better understanding virus life cycles and deve loping subunit vaccines for avian and porcine circoviruses (7 15) Furthermore, r ecombinant ly expressed circovirus capsid (Cap) prot eins sometimes spontaneously self assemble into virus like particles (VLPs) that are morphologically similar to wild type circoviruses and have immunogenic activity (8, 9, 13) These studies have established the immunogenicity of recombinant circovirus structural proteins. Therefore s uccessful expression of the cap gene of environmental circovirus genomes may allow us to design immunological ass ays to detect and select for the s e virus es in the environment. Methods Plasmid C onstruction The coding sequence of an u nknown open reading frame ( ORF ) suspected to encode the capsid protein (designated UCap for unknown capsid) of the RW A circovirus (Genbank accession no. FJ959077 ) was used for recombinant expression. Total viral DNA used to produce the reclaimed water metagenome was used to amplify the entire uc ap ORF from RW A using PCR (see Table 1 for primers) The PCR product was ligated into the pETBlue 1 vector (Novagen Gibbstown, New Jersey ) This pETBlue U Cap plasmid was digested with BglII and EcoRI to excise the ucap ORF which was then ligated directionally into the pGEX 6P 2 vector (GE Healthcare Piscataway, New Jersey ) This vector is designed t o express proteins fused to g lutathione S transferase

PAGE 88

Appendix E (Continued) (GST) which is advantageous for affinity purification of recombinant proteins. In addition to full length UCap several truncated versions of this ORF were expressed. PCR primers containing SfiI sites were designed to obtain these UCap truncated versions from the pETBlue1 UCap vector (see Table 1 for primers). Truncated UCap versions were also ligated directionally into the pGEX 6P 2 vector. All pGEX U Cap construct s were propagated in Escherichia coli DH10 cells and plasmids were purified from cells using the QIAprep Spin Miniprep Kit (Qiagen, Valencia, California) The f inal plasmid s were sequenced to confirm the GST U Cap fusion and proper phasing. Protein E xpression and P urification The pGEX U C ap pl asmid s were expressed in E. coli Tuner cells (Novagen Gibbstown, New Jersey ) Briefly, t ransformed cells carrying the recombinant plasmid were grown to a desired optical density in LB medium containing carbenicillin (50 chloramphenicol and glucose C. The expression of recombinant protein in Tuner cells was induced by adding isopropyl thiogalactopyranos C. To optimize the expression and cell culture condi concentrations (0, 0.25, 0.50, 1, a nd 2 mM) and incubation times (3 5 hrs) were tested. C ells were centrifuged at 1,500 xg for 5 min after induction to retrieve expressed proteins Th e pellet ed cells were lysed chemically by resuspending the cells in a mixture of 1X BugBuster Protein Extraction Reagent (Novagen, Gibbstown, New Jersey) (50 Protease Inhibitor Cocktail III EDTA free (Calbiochem, Gibbstown, New Jersey) and Lysonase Bioprocessing Reagent (Novagen,

PAGE 89

Appendix E (Continued) Gibbstown, New Jersey) followed by 30 min incubation at room temperature Th e lysates were centrifuged at 10 2 00 xg separate soluble and insoluble protein fractions. Recombinant proteins in the soluble fraction were purified using a 50% slurry of Glutathione Sepharose 4B (GE Healthcare, Piscataway, New Jersey) following the All slurry washes were performed with a phosphate buffered saline (PBS) solution containing 0.1% Tween. Once the recombinant protein was purified the GST tag fused to the ucap ORF was removed by cleaving with the PreScission Protease TM (GE Healthcare, Piscataway, Ne w Jersey) Expression and purification of recombinant GST U Cap were verified by SDS PAGE and western blot using an anti GST antibody. N uclear L ocalization S ignal A possible nuclear localization signal (NLS) sequence was identified on the U Cap of RW A. To test if this ORF is involved in nuclear localization, human embryonic kidney cells (293T cells) were transfected with a pcDNA3 vector (Invitrogen) containing the putative cap gene. The plasmid was constructed by amplifying the U Cap ORF from the pETBlue U C ap vector through P CR using primers containing Sfi I restriction sites (Sense ATGGGA AAGTACACA AAG ; Antisense GT GG ). The PCR products were digested with Sfi I and ligated directionally into the pcDNA3 ve ctor. This pcDNA3 U Cap plasmid allowed the expression of the putative Cap fused to an Avi tag (biotin acceptor peptide tag) at the C terminus The plasmid was propagated in E. coli DH10 cells and plasmids were purified from cells using a commercial kit. T he final plasmid was sequenced to confirm the ucap

PAGE 90

Appendix E (Continued) insert and proper phasing. Human 293T cells were transfected using Lipofectamine 2000 (Invitrogen Carlsbad, California In order to evaluate where the expressed U Cap Avi tag localized, the cytosol and nuclei of harvested cells we re lysed separately. To separate nuclei from cytosol, cells were centrifuged at 500 x g for 1 min The pelleted cells were resuspended with PBS containing 0.1% Triton X and t he resuspension was the n centrifuged at 10, 2 00 x g for 10 min to pellet nuclei. The supernatant (cytosol fraction) was collected and the pelleted nuclei were resuspended wit h dithiothreitol (50 mM) and incubated at 100 Expression and localization of the U Cap Avi tag fused protein was verified by western blotting and immunofluorescent assays based on anti Avi monoclonal antibodies. Human 293T cells expressing the green fluorescent protein (GFP) were used as a control. Results and Discussion This study explored a method for the recombinant expression of an unknown gene suspected to encode the structural protein of the novel ssDNA virus RW A. The RW A circovirus was identified from a reclaimed water viral met agenome (1, 16) The RW A genome was confirmed by PCR and the virus was detected in raw sewage and treated effluent samples collected in two different years (2007 and 2009) suggesting that the virus is consistently pre sent in wastewater. RW A genomic features are consistent with known circoviruses including a small genome (2,162 nt) that encodes two major open reading frames (ORFs) in an ambisense organization and a conserved nonanucleotide motif located at the apex of a potential stem loop structure (Fig. 1). However, RW A only shares 36% amino acid identity within the replication associated (Rep) protein of an

PAGE 91

Appendix E (Continued) avian circovirus and there are no matches in the database for the second ORF. We hypothesized that t he unknown ORF (i.e. ucap ) encode s for the Cap protein due to its orientation with respect to the rep size, and N terminus amino acid composition. The goal of this study was to obtain a purified recombinant protein that could be used to develop immunoassays to det ect and isolate RW A from environmental samples in the future. For this purpose, the RW A UCap ORF was expressed using a bacterial expression system The E coli system was chosen because bacterial expression techniques are relatively simple and produce re sults in a short amount of time. The biggest concerns with this system are related to the possible outcomes of expressing eukaryotic proteins in a prokaryotic cell environment. It is possible that expressed proteins are not properly modified and expression of insoluble proteins or overproduction may result in the precipitation of the foreign protein into inclusion bodies. Nevertheless various studies have successfully expressed recombinant circovirus proteins in E. coli and retained their antigenic properti es causing an immune response and reacting with antibodies for wild type viruses (10, 12, 14, 17) Unfortunately, efforts to express and purify the RW A U Cap protein using a bacterial system were unsuccessful in this study Although the GST U Cap fused protein was expressed in Tuner cells low protein yield s were obtained and degradation products were more concentrated th an full length products This outcome may be due to an arginine rich region at the N terminus of the predicted U Cap amino acid sequence. This is characteristic of known circoviruses which contain a region high in basic residues at the N terminus of the Cap, most notably arginine (6, 18) It has been confirmed that this sequence high in basic amino acids interferes with the cap gene expression in E. coli

PAGE 92

Appendix E (Continued) resulting in low yi elds (12, 14) probably because of rare codon usage in E. coli (17) A few studies have successfully expressed the Cap protein by removing the arginine rich region from the amino acid sequence (10, 14) Another recent strategy was to use an engineered E. coli strain that contains extra copies of genes that encode rare tRNAs (17) However, the expression of truncated versions of the GST U Cap and the use of an E. coli strain ( Rossetta gami TM ) with extra copies of rare tRNAs were also unsuccessful in this study Truncated products were expressed but precipitated in to inclusion bodies and could not be purified. The E .coli system was chosen due to its simplicity compared to othe r expression systems. Since the recombinant expression of RW A U Cap in E. coli resulted in typical problems encountered when expressing eukaryotic proteins in a prokaryotic environment, we suggest future studies express this protein in an eukaryotic expres sion system such as baculovirus. The baculovirus expression system is the most widely used expression system for the preparation of VLPs (19) In this system the gene of interest is inserted into an insect virus (vector) and the desi red foreign protein is produced by growing the recombinant virus in cultured insect cells. This system has many advantages for the expression of eukaryotic viral proteins, most notably the expressed proteins are usually properly folded and transported to t he proper cellular compartment (i.e. membrane proteins are localized to the insect cell membrane, nuclear proteins to the nucleus, and secreted proteins are secreted into the medium) (19) The arginine rich amino acid sequence at th e N terminus of circoviurs Cap proteins is believed to be a nuclear localization signal (NLS) involved in viral DNA translocation across the host nucleus ( 7, 15, 20) This potential NLS was identified at the

PAGE 93

Appendix E (Continued) N terminus of RW A U Cap ORF and, thus, we hypothesized this protein localize s to the nucleus. In order to test this hypothesis, the RW A U Cap ORF was expressed in human 293T cells Transfected 293T cell s successfully expressed the recombinant protein. Western blotting (Fig. 1 ) and immunofluorescent assays (Fig. 2 ) suggest that the putative Cap protein does localize to the nucleus. The karyophilic nature of the capsid protein has been shown for both porci ne and avian circoviruses (7, 15, 20) The concentration of the RW A UCap in the nucleus further supports that this unknown ORF encodes a capsid protein. It is important to obtain recombinant structural proteins in order to develop strategies to study novel ssDNA viruses. In general, t he combination of metagenomic sequencing, protein expression, and imm uno technology will allow us to make a connection betwee n genes and viral particles. Purified capsid proteins and/or VLPs can be used to obtain polyclonal antibodies that could be used to isolate wild type viruses from the environment. Immun omagnetic separation assays can then be developed to concentrate and is olate wild type viruses corresponding to the sequences of interest Once wild type viruses are isolated we can study the physicochemical properties of the particles such as morphology and virion stability. T his information will be beneficial for taxonomic classification since the International Committee on Taxonomy of Viruses requires visualization of the viral particles in order to classify novel viruses (21) In addition the isolation of viral particles will allow us to corre ctly annotate structural proteins expanding our knowledge regarding viral capsid proteins. This information will contribute correctly annotated viral sequences to the database, which will in turn allow for the identification of more divergent structural ge nes in the future. Finally, one of the

PAGE 94

Appendix E (Continued) biggest challenges in viral metagenomics is finding potential hosts for unknown viral sequences. I mmunoassays can also be used to determine potential hosts of u nknown viruses Western blot assays can be developed to s creen a panel of sera from potential hosts including humans and animals These Western blot assays can allow us to determine whether a reaction will occur between the sera and the recombinant protein (a positive reaction suggests that the host has been exp osed to the protein in the past) In addition, i f immunomagnetic sep aration assays are successful, it will be possible to perform infectivity studies with novel viruses on different hosts All these efforts will add valuable information regarding unknown s sDNA viruses which is critical as these viruses continue to be discovered through environmental metagenomics

PAGE 95

Appendix E (Continued) Table 1 Primers used to obtain the full length coding region for the RW A unknown protein (UCap) and truncated versions of the protein Pri UCap product Sense : TTTGCATATGGAATGGGAAA Antisense : CAATCATAAACCCTGTGCTTCC Full length Sense : GTGGCCATTATGGCCCCGCAAAGAATCCCTTC Antisense : GTGGCCACCGCGGCCTCATAAACCCTGTGCTTCC No arginine rich region at N terminus Sense : GTGGCCATTATG GCCCCGCAAAGAATCCCTTC Antisense: GTGGCCACCGCGGCCTCAAAACTCCCCGCTTCCGGT N terminus half of the protein (excluding arginine rich region) Sense : GTGGCCATTATGGCCCAAGCCTTGCATGGATC Antisense : GTGGCCACCGCGGCCTCATAAACCCTGTGCTTCC C terminus half of the protein

PAGE 96

Appendix E (Continued) Figure 1 Schematic genome organizati on of known circoviruses (left) and the novel RW A circovirus (right) showing major open reading frames (ORFs) and a potential stem loop structure (green feature) RW A con tains two major ORFs, the replication associated ( rep ) gene (36% amino acid level identity to known Rep proteins from circoviruses) and an unknown ORF (no significant homologs in the database). This genome organization is consistent with known circovirus genomes including swine (e.g. Porcine circovirus, NC001792) and bird (e.g. Gull circovirus, NC008521) pathogens. T he unknown ORF is believed to encode for the capsid protein due to its orientation with respect to the rep ORF, size, and N terminus amino aci d composition. 1758 nt 2035 nt RW A 2162 nt Poly A signal Poly A signal Poly A signal

PAGE 97

Appendix E (Continued) Figure 2 Western blot autoradiograph of 293T cells expressing the green fluorescent protein (GFP) and the putative capsid protein from the circo virus RW A. The nuclear and cytosol fractions were separated. GFP (lanes G) is a cytoplasm ic protein while the putative capsid (lanes CP) is expected to localize to the nucleus due to a nuclear localization signal at the N terminus. The GFP signal is concentrated in the cytosol fraction (left) while the putative capsid protein is concentrated i n the nuclear fraction (right) confirming that this protein localizes to the nucleus Figure 3 I mmunofluorescence microscopy of 293T cells expressing the putative capsid protein from circo virus RW A The signal of the expressed capsid protein is concentrated in the nucleus of the cells suggesting the capsid proteins localize to the nucleus. Light field Dark field (fluorescence) Capsid GFP

PAGE 98

Appendix E (Continued) References: 1. Rosario, K., and S. B. Duffy, M. 2009. Diverse circovirus like genome architectures revealed by environmental metagenomics. Journal of General Virology 90: 2418 2424. 2. Kim, K. H., H. W. Chang, Y. D. Nam, S. W. Roh, M. S. Kim, Y. Sung, C. O. Jeon, H. M. Oh, and J. W. Bae. 2008. Amplification of uncultured single stranded DNA viruses from rice paddy soil. Applied and Environmental Microbiology 74: 5975 5985. 3. Lopez Bueno, A., J. Tamames, D. Velazquez, A. Moya, A. Quesada, and A. Alcami. 2009. High diversity of the viral community from an Antarctic lake. Science 326: 858 861. 4. Li, L., A. Kapoor, B. Slikas, O. S. B amidele, C. Wang, S. Shaukat, M. A. Masroor, M. L. Wilson, J. B. N. Ndjango, M. Peeters, N. D. Gross Camp, M. N. Muller, B. H. Hahn, N. D. Wolfe, H. Triki, J. Bartkus, S. Z. Zaidi, and E. Delwart. Multiple diverse circoviruses infect farm animals and are c ommonly found in human and chimpanzee feces. The Journal of Virology 84: 1674 1682. 5. Blinkova, O., K. Rosario, L. Li, A. Kapoor, B. Slikas, F. Bernardin, M. Breitbart, and E. Delwart. 2009. Frequent detection of highly diverse variants of Cardiovirus Cos avirus Bocavirus and Circovirus in sewage samples collected in the United States. Journal of Clinical Microbiology 47: 3507 3513. 6. Todd, D. 2000. Circoviruses: immunosuppressive threats to avian species: a review. Avian Pathology 29: 373 394. 7. Heath, L ., A. L. Williamson, and E. P. Rybicki. 2006. The capsid protein of beak and feather disease virus binds to the viral DNA and is responsible for transporting the replication associated protein into the nucleus. Journal of Virology 80: 7219 7225. 8. Stewart, M. E., N. Bonne, P. Shearer, B. Khalesi, M. Sharp, and S. Raidal. 2007. Baculovirus expression of beak and feather disease virus (BFDV) capsid protein capable of self assembly and haemagglutination. Journal of Virological Methods 141: 181 187.

PAGE 99

Appendix E (Continued) 9. Fan, H., C. Ju, T. Tong, H. Huang, J. Lv, and H. Chen. 2007. Immunogenicity of empty capsids of porcine circovius type 2 produced in insect cells. Veterinary Research Communications 31: 487 496. 10. Johne, R., R. Raue, C. Grund, E. F. Kaleta, and H. Muller. 2004. Re combinant expression of a truncated capsid protein of beak and feather disease virus and its application in serological tests. Avian Pathology 33: 328 336. 11. Lekcharoensuk, P., I. Morozov, P. S. Paul, N. Thangthumniyom, W. Wajjawalku, and X. J. Meng. 2004 Epitope mapping of the major capsid protein of type 2 porcine circovirus (PCV2) by using chimeric PCV1 and PCV2. Journal of Virology 78: 8135 8145. 12. Liu, Q., P. Willson, S. Attoh Poku, and L. A. Babiuk. 2001. Bacterial expression of an immunologically reactive PCV2ORF2 fusion protein. Protein Expr. Purif. 21: 115 120. 13. Nawagitgul, P., I. Morozov, S. R. Bolin, F. A. Harms, S. D. Sorden, and P. S. Paul. 2000. Open reading frame 2 of porcine circovirus type 2 encodes a major capsid protein. Journal of Ge neral Virology 81: 2281 2287. 14. Zhou, J. Y., S. B. Shang, H. Gong, Q. X. Chen, J. X. Wu, H. G. Shen, T. F. Chen, and J. Q. Guo. 2005. In vitro expression, monoclonal antibody and bioactivity for capsid protein of porcine circovirus type II without nuclear localization signal. Journal of Biotechnology 118: 201 211. 15. Liu, Q. G., S. K. Tikoo, and L. A. Babiuk. 2001. Nuclear localization of the ORF2 protein encoded by porcine circovirus type 2. Virology 285: 91 99. 16. Rosario, K., C. Nilsson, Y. W. Lim, R. Yijun, and M. Breitbart. 2009. Metagenomic analysis of viruses in reclaimed water. Environmental Microbiology 11: 2806 2820. 17. Trundova, M., and V. Celer. 2007. Expression of porcine circovirus 2 ORF2 gene requires c odon optimized E. coli cells. Virus Genes 34: 199 204. 18. Niagro, F. D., A. N. Forsthoefel, R. P. Lawther, L. Kamalanathan, B. W. Ritchie, K. S. Latimer, and P. D. Lukert. 1998. Beak and feather disease virus and porcine circovirus genomes: intermediates b etween the geminiviruses and plant circoviruses. Archives of Virology 143: 1723 1744.

PAGE 100

Appendix E (Continued) 19. Noad, R., and P. Roy. 2003. Virus like particles as immunogens. Trends Microbiol. 11: 438 444. 20. Meerts, P., G. Misinzo, F. McNeilly, and H. J. Nauwynck. 2005. Replic ation kinetics of different porcine circovirus 2 strains in PK 15 cells, fetal cardiomyocytes and macrophages. Archives of Virology 150: 427 441. 21. Fauquet, C. M., M. A. Mayo, J. Maniloff, U. Desselberger, and L. A. Ball. 2005. Virus Taxonomy: VIIIth Repo rt of the International Committee on Taxonomy of Viruses. Academic Press, San Diego, CA.

PAGE 101

36 APPENDIX F : AUTHOR CONTRIBUTIONS AND COPYRIGHT CLEARANCES

PAGE 102

Appendix F Author Contributions Appendix A : Metagenomic Sequencing for Virus Identification in a Public Health S etting S Svraka and K. Rosario designed and carried out experiments, analyzed data, and wrote manuscript E. Duizer and H. van der Avoort assisted wit h research M. Breitbart and M. Koopmans designed experiment and wrote manuscript Appendix B : Metagenomic Analysis of Viruses in Reclaimed W ater K. Rosario designed and carried out experiments, analyzed data, and wrote manuscript C. Nilsson and Y. W. L im performed sequencing Y. Ruan and M. Breitbart designed experiment and wrote manuscript Appendix C : Pepper mild mottle virus as an Indicator of Fecal P ollution K. Rosario and E. Sy monds designed and carried out experiments, analyzed data, and wrote ma nuscript C. Sinigalliano and J. Stewart carried out research M. Breitbart designed experiment and wrote manuscript Appendix D : Diverse Circovirus like Genome Architectures Revealed by E nvironmental M etagenomics K. Rosario designed and carri ed out experiments, analyzed data, and wrote manuscript S Duffy and M. Breitbart analyzed data and wrote paper Note : All the publications included in this dissertation were included with the approval of each journal and necessary copyright clearances ( see below).

PAGE 103

Appendix F (Continued) Copyright Clearances Appendices A and D: Dear Ms Rosario Cora Thank you for your email. SGM Copyright Permission is not required for a PhD thesis when the person requesting the permission is an author on the papers concerned. However, you are required to acknowledge the General Virology as the original source. Paper No. 012955 (84143): Diverse circovirus like genome architectures revealed by environmental metagenomics, Rosario et al. Your paper was published by the Journal of General Viro logy in volume 90, part 10, pages 2418 2424. Paper No. 024612 (84524): Metagenomic sequencing for virus identification in a public health setting, Svraka et al. Your paper will be published by the Journal of General Virology in volume 90, part 11, pages 2 846 2856. Good luck with your PhD. Yours sincerely Marianne K. Asbury Editorial Assistant Journal of General Virology Editorial Office Direct Tel. No. +44 (0)118 988 1825 Fax No. +44 (0)118 988 1834 Web: http://www.sgm.ac.uk On line journals: http://www.sgmjournals.org Society for General Microbiology Marlborough House Basingstoke Road Spencers Wood Reading RG7 1AG, UK Company Limited by Guarantee. Registered in England No. 1039582. Registered Office as above. Registered as a Charity in England and Wales, No. 264017 A charity registered in Scotland, No SC039250

PAGE 104

Appendix F (Continued) Appendix B:

PAGE 105

Appendix F (Continued) Appendix C:


xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim
leader nam 22 Ka 4500
controlfield tag 007 cr-bnu---uuuuu
008 s2010 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0004772
035
(OCoLC)
040
FHM
c FHM
049
FHMM
090
XX9999 (Online)
1 100
Rosario, Karyna.
0 245
Enhancing virus surveillance through metagenomics :
b water quality and public health applications
h [electronic resource] /
by Karyna Rosario.
260
[Tampa, Fla] :
University of South Florida,
2010.
500
Title from PDF of title page.
Document formatted into pages; contains X pages.
502
Dissertation (PHD)--University of South Florida, 2010.
504
Includes bibliographical references.
516
Text (Electronic thesis) in PDF format.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
3 520
ABSTRACT: Monitoring viruses circulating in the human population and the environment is critical for protecting public and ecosystem health. The goal of this dissertation was to incorporate a viral metagenomic approach into virus surveillance efforts (both clinical and water quality control programs) to enhance traditional virus detection methods. Clinical surveillance programs are designed to identify and monitor etiological agents that cause disease. However, the ability to identify viruses may be compromised when novel or unsuspected viruses are causing infection since traditional virus detection methods target specific known pathogens. Here we describe the successful application of viral metagenomics in a clinical setting using samples from symptomatic patients collected through the Enterovirus Surveillance (EVS) program in the Netherlands (Appendix A). Despite extensive PCR-based testing, the viruses in a small percentage of these samples (n = 7) remained unidentified for more than 10 years after collection. Viral metagenomics allowed the identification of viruses in all seven samples within a week using minimal sequencing, thus rapidly filling the diagnostic gap. The unexplained samples contained BK polyomavirus, Herpes simplex virus, Newcastle disease virus and the recently discovered Saffold viruses (SAFV) which dominated the unexplained samples (n = 4). This study demonstrated that metagenomic analyses can be added as a routine tool to investigate unidentified viruses in clinical samples in a public-health setting. In addition, metagenomic data gathered for SAFV was used to complete four genotype 3 SAFV (SAFV-3) genomes through primer walking, doubling the number of SAFV-3 full genomic sequences in public databases. In addition to monitoring viruses in symptomatic patients, it is also important to monitor viruses in wastewater (raw and treated) to protect the environment from biological contamination and prevent further spread of pathogens. To gain a comprehensive understanding of viruses that endure wastewater treatment, viral metagenomics was used to survey the total DNA and RNA viral community in reclaimed water (the reusable end-product of wastewater treatment) (Appendix B). Phages (viruses that infect bacteria) dominated the DNA viral community while eukaryotic viruses similar to known plant and insect viruses dominated RNA metagenomic libraries suggesting that highly stable viruses may be disseminated through this alternative water supply. A plant virus, the Pepper mild mottle virus (PMMoV), was identified as a potential indicator of wastewater contamination based on metagenomic data and quantitative PCR assays (Appendix C). The metagenomic analysis also revealed a wealth of novel single-stranded DNA (ssDNA) viruses in reclaimed water. Further investigation of sequences with low-level similarities to known ssDNA viruses led to the completion of ten novel ssDNA genomes from reclaimed water and marine environments (Appendix D). Unique genome architectures and phylogenetic analysis suggest that these ssDNA viruses belong to new viral genera and/or families. To further explore the ecology of the novel ssDNA viruses, a strategy was developed to take metagenomic analysis to the next level by combining expression analysis and immunotechnology (Appendix E). This dissertation made a significant contribution to current microbiological data regarding wastewater by uncovering viruses that endure the wastewater treatment and identifying a new viral bioindicator.
590
Advisor: Mya Breitbart, Ph.D.
653
Enteric Viruses
Bioindicators
Wastewater
Reclaimed Water
Fecal Pollution
Single-stranded DNA Viruses
690
Dissertations, Academic
z USF
x Marine Science
Masters.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.4772