USF Libraries
USF Digital Collections

Molecular detection of the toxic marine diatom _pseudo-nitzschia multiseries_

MISSING IMAGE

Material Information

Title:
Molecular detection of the toxic marine diatom _pseudo-nitzschia multiseries_
Physical Description:
Book
Language:
English
Creator:
Delaney, Jennifer
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Pseudo-nitzschia
NASBA
QRT-PCR
Harmful algae detection
RbcS
Dissertations, Academic -- Marine Science -- Masters -- USF   ( lcsh )
Genre:
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: The marine diatom genus Pseudo-nitzschia includes species that produce domoic acid, a neurotoxin responsible for illness and mortality in both humans and marine wildlife. Because of the expertise and time required for the microscopic discrimination of species, molecular methods that monitor environmental concentrations of Pseudo-nitzschia provide a rapid alternative for the early detection of blooms and prediction of toxin accumulation. We have developed a nucleic acid sequence-based amplification with internal control RNA (IC-NASBA) assay and a quantitative reverse transcription PCR (qRT-PCR) assay for the detection of the toxic species P. multiseries targeting the ribulose-1,5-biphosphate carboxylase/oxygenase small subunit (rbcS) gene. Both methods use RNA amplification and fluorescence-based real-time detection. Due to a limited rbcS sequence database, primers were designed and used to sequence this gene from 14 strains of Pseudo-nitzschia (including four P. multiseries) and 19 other marine diatoms. The IC-NASBA and qRT-PCR assays had a limit of detection of one cultured cell of P. multiseries and were linear over four and five orders of magnitude, respectively (r-squared ≥ 0.98). Neither of the assays detected closely related organisms outside the Pseudo-nitzschia genus, and the qRT-PCR assay was specific to P. multiseries. While cross-reactivity of primers with unknown species prevented reliable detection of P. multiseries in spiked environmental samples using IC-NASBA, the qRT-PCR assay had positive detection from 10,000,000 cells/L to 1,000 cells/L. Nearly a 1:1 relationship was observed between predicted and calculated cell concentrations using qRT-PCR. Based on a diel expression study, the rbcS transcript copy number per cell ranged from 21,600 to 53,500, with the highest expression during early to mid photoperiod. The rbcS qRT-PCR assay is useful for the detection and enumeration of low concentrations of P. multiseries in the environment.
Thesis:
Thesis (MS)--University of South Florida, 2010.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Jennifer Delaney.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains X pages.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
usfldc doi - E14-SFE0004812
usfldc handle - e14.4812
System ID:
SFS0028088:00001


This item is only available as the following downloads:


Full Text
xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim
leader nam 22 Ka 4500
controlfield tag 007 cr-bnu---uuuuu
008 s2010 flu s 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0004812
035
(OCoLC)
040
FHM
c FHM
049
FHMM
090
XX9999 (Online)
1 100
Delaney, Jennifer.
0 245
Molecular detection of the toxic marine diatom _pseudo-nitzschia multiseries_
h [electronic resource] /
by Jennifer Delaney.
260
[Tampa, Fla] :
b University of South Florida,
2010.
500
Title from PDF of title page.
Document formatted into pages; contains X pages.
502
Thesis (MS)--University of South Florida, 2010.
504
Includes bibliographical references.
516
Text (Electronic thesis) in PDF format.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
3 520
ABSTRACT: The marine diatom genus Pseudo-nitzschia includes species that produce domoic acid, a neurotoxin responsible for illness and mortality in both humans and marine wildlife. Because of the expertise and time required for the microscopic discrimination of species, molecular methods that monitor environmental concentrations of Pseudo-nitzschia provide a rapid alternative for the early detection of blooms and prediction of toxin accumulation. We have developed a nucleic acid sequence-based amplification with internal control RNA (IC-NASBA) assay and a quantitative reverse transcription PCR (qRT-PCR) assay for the detection of the toxic species P. multiseries targeting the ribulose-1,5-biphosphate carboxylase/oxygenase small subunit (rbcS) gene. Both methods use RNA amplification and fluorescence-based real-time detection. Due to a limited rbcS sequence database, primers were designed and used to sequence this gene from 14 strains of Pseudo-nitzschia (including four P. multiseries) and 19 other marine diatoms. The IC-NASBA and qRT-PCR assays had a limit of detection of one cultured cell of P. multiseries and were linear over four and five orders of magnitude, respectively (r-squared ≥ 0.98). Neither of the assays detected closely related organisms outside the Pseudo-nitzschia genus, and the qRT-PCR assay was specific to P. multiseries. While cross-reactivity of primers with unknown species prevented reliable detection of P. multiseries in spiked environmental samples using IC-NASBA, the qRT-PCR assay had positive detection from 10,000,000 cells/L to 1,000 cells/L. Nearly a 1:1 relationship was observed between predicted and calculated cell concentrations using qRT-PCR. Based on a diel expression study, the rbcS transcript copy number per cell ranged from 21,600 to 53,500, with the highest expression during early to mid photoperiod. The rbcS qRT-PCR assay is useful for the detection and enumeration of low concentrations of P. multiseries in the environment.
590
Advisor: John Paul, Ph.D.
653
Pseudo-nitzschia
NASBA
QRT-PCR
Harmful algae detection
RbcS
690
Dissertations, Academic
z USF
x Marine Science
Masters.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.4812



PAGE 1

M olecular Detection of the Toxic Marine Diatom Pseudo nitzschia multiseries by Jennifer A. Delaney A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science College of Marine Science University of South Florida Major Professor: John H. Paul, Ph.D. Mya Breitbart, Ph.D. Michael Parsons, Ph.D. Date of Approval: October 15, 2010 Keywords: Pseudo nitzschia NASBA, qRT PCR, harmful algae detection, rbcS Copyright 2010, Jennifer A. Delaney

PAGE 2

ACKNOWLEDGEMENTS First, I would like to thank my major advisor, Dr. John Paul, for his support and guidance throughout this project. I would also like to acknowledge my committee members Dr. Mya Breitbart and Dr. Michael Parsons for their time and encouragement. I am very grateful to Dr. Stephen Bates and Claude LŽger of Fisheries and Oceans Canada, Dr. Sibel Bargu of Louisiana State University, and Dr. Bill Richardson and Julie Brame of the Florida Fish a nd Wildlife Research Institute for providing me with phytoplankton cultures Thank you to Sheila O'Dea and all members/former members of the Paul lab for their scientific advice and their friendship: Dave John, Lauren McDaniel, Jen Mobberley, Bob Ul rich, Beth Young, and Brian Zielinski. Last I want to thank all of my frien ds and family for their support. A s pecial thanks goes out to my parents and Anthony You have always believed in me, and t his thesis could not have been completed without you Th is work was funded by the Office of Naval Research (ONR) under grant no. N00014 07 1 0794 a STAR Fellowship Agreement no. FP91699801 awarded by the U.S. Environme ntal Protection Agency (EPA), and a Gulf Oceanographic Trust Fellowship award ed through the USF College of Marine Science.

PAGE 3

! i TABLE OF CONTENTS LIST OF TABLES ................................ ................................ ................................ .. iii LIST OF FIGURES ................................ ................................ ............................... iv ABSTRACT ................................ ................................ ................................ ........ v i INTRODUCTION ................................ ................................ ................................ ... 1 Pseudo nitzschia : A cosmopolitan diatom and emerging HAB genus ................................ ................................ ................................ ..... 1 Global distribution ................................ ................................ ............ 2 Distribution in the United States and the Gulf of Mexico ................. 2 Domoic acid (DA) : A potent neu rotoxin to humans and wildlife .................. 3 Effects on humans and the marine food we b ................................ .. 5 Variability in toxin production and possible role(s) of DA ................. 7 Culture stud ies: Effect of growth phase and macro nutrients ................................ ................................ 7 Field studies: Effect of macronutrients and eutrophication ................................ ................................ .. 9 T race metals and DA production ................................ ........ 10 Bacteria and DA produ ction ................................ ................ 11 Possible role(s) of DA ................................ ......................... 11 Major toxic events in North A merica and around the world ...................... 12 Canada ................................ ................................ .......................... 12 The United States ................................ ................................ .......... 12 Mexico ................................ ................................ ............................ 15 Other global locations ................................ ................................ .... 16 Traditional monitoring strategies: T oxin detection and microscopy .......... 17 Molecular m onitoring strategies for Pseudo nitzschia .............................. 20 Commonly used genetic ta rget and methods ................................ 20 RuBisCO: A potenti al molecular detection target .......................... 24 Nucleic acid amplification based detect ion methods: qRT PCR and NASBA ................................ ................................ ...... 26 Research objectives ................................ ................................ ................. 29 MATERIALS AND METHODS ................................ ................................ ............. 30 Phytoplan kton cultures and cell counts ................................ .................... 30

PAGE 4

! ii DNA extraction, rbcS primer design, and PCR ................................ ......... 30 Cloning, sequencin g, and bioinformatic analysis ................................ ...... 34 Syn thesis of in vitro transcript ................................ ................................ ... 36 IC NASBA assay d esign and reaction conditions ................................ ..... 36 TaqMan¨ qR T PCR assay d esign and reaction conditions ..................... 37 RNA extraction ................................ ................................ .......................... 39 Standard protocol ................................ ................................ .......... 39 Efficiency experiment ................................ ................................ ..... 39 Specificity testing ................................ ................................ ...................... 40 Spiked environmental sam ples ................................ ................................ 40 Determinatio n of IC NASBA assay inhibitor(s) ................................ ......... 42 Size fractionation experiment ................................ ........................ 42 K. brevis spike experiment ................................ ............................. 42 Sequence spe cific capture with Dynabeads¨ ................................ .......... 42 Coupling of probe to beads ................................ ............................ 43 Hybridization of probe conjugated beads to target mRNA ............ 45 Expression patterns of the rbcS gene in P. multiseries ............................ 45 RESULTS ................................ ................................ ................................ ....... 47 Seque nce and phylogenetic analysis ................................ ....................... 47 Sensitivity and specificit y of IC NASBA and qRT PCR assays ................ 48 RNA ext raction efficiency experiment ................................ ....................... 53 Spiked environmental samples ................................ ................................ 54 Determination of the IC NASBA assay inhibitor ................................ ....... 56 Sequence spe cific capture with Dynabeads¨ ................................ .......... 58 Probe coupling ................................ ................................ ............... 58 Target hybridization in cult ure and environmental samples ........... 59 Expression patterns of the rbcS gene ................................ ...................... 62 DISCUSSION ................................ ................................ ................................ ...... 63 REFERENCES ................................ ................................ ................................ .... 70 APPENDICES ................................ ................................ ................................ ..... 93 Appendix 1: IC NASBA assays for P. delicatissima and LA2 StC6C ....... 94 Appendix 2: P. m ultiseries CCMP2708 growth curve and toxin data ....... 97 Appendix 3: rbcS phylogeny of marine diat oms and environmental clones ................................ ................................ ................................ .. 99

PAGE 5

! iii LIST OF TABLES Table 1 : Pseudo nitzschia species present in the Gulf of Mexico ......................... 4 Table 2: Phytoplankton culture growth conditions and GenBank accession numbers for the rbcS gene ................................ ................................ .... 31 Table 3: Sequences for primers, molecular beacons, TaqMan¨ probe and IC RNA oligonucleotides ................................ ................................ ....... 35 Table 4: Variability of rbcS nucleotide and amino acid sequences in Pseudo nitzschia and other marine diatoms ................................ ......... 47 Table 5: Specificit y of IC NASBA and qRT PCR assays ................................ .... 52 Table A1: P. delicatissima and LA2 StC6C beacon sequences .......................... 9 4 Table A2: Specificity of P. delicatissima and LA2 StC6C IC NASBA assays ................................ ................................ ................................ 95

PAGE 6

! iv LIST OF FIGURES Figure 1: Chemical structure of domoic acid ................................ ......................... 5 Figure 2: Chains of P. multiseries CCMP2708 ................................ .................... 19 Figure 3 : Nucleic Acid Sequence Based Amplification (NASBA) wi th molecular beacon detection ................................ ................................ 27 Figure 4 : TaqMan¨ qR T PCR assay process ................................ ..................... 28 Figure 5 : General detection process incorporating b ead based target mRNA capture ................................ ................................ ...................... 43 Figure 6 : Activation and coupling of oligonucleotides to Dyna beads¨ MyOne Carboxylic Acid ................................ ................................ .... 44 Figure 7 : Evolutionary relationship of marine diatoms based on the rbcS gene ................................ ................................ ................................ ..... 49 Figure 8 : SYBR ¨ Green dissociation curve ................................ ........................ 50 Figure 9 : Representative IC NASBA plots for P. multiseries ............................... 50 Figure 10 : Representative qRT PCR plot for P. multiseries ................................ 51 Figure 11 : Ty pical cell standard curves ................................ ............................... 51 Figure 12 : Comparison of three RNA extraction methods as determined by rbcS copy number ................................ ................................ .............. 54 Figure 13 : Inhibition of IC NASBA assay in spiked environmental samples ....... 55 Figure 14 : Calculated versus expected cells per liter for qRT PCR sp iked environmental experiment ................................ ................................ .. 56 Figure 15 : Results from size fractionation experiment ................................ ........ 57

PAGE 7

! v Figure 16 : Comparison of P. multiseries and K. brevis IC NASBA assay performance ................................ ................................ ....................... 58 Figure 17 : Relative percentages of probe detected in various steps of Dynabead¨ coupling procedure ................................ ......................... 59 Figure 18 : Comparison of IC NASBA plots for an environmental sample run without and with the Dynabe ad¨ target hybridization step .......... 60 Figure 19 : Detection of 10 6 cells/L using Dynabeads¨ and IC N ASBA .............. 61 Figure 20 : Diel e xpression pattern of rbcS gene in exponential phase P. multiseries CCMP2708 culture ................................ ........................... 62 Figure A1: Transcript standard curves for P. delicatissima and LA2 StC6C IC NASBA assays ................................ ................................ ............. 9 4 Figure A2: Growth curve for P. multiseries CCMP2708 based o n cell counts an d fluorescence ................................ ................................ .... 9 7 Figure A3: Fluorescence growth curve and domoic acid measurement in stationary phase P. multiseries CCMP2708 cells .............................. 9 8 Figure A4: Evolutionary relationship of marine diatoms and environmental rbcS clones ................................ ................................ ........................ 9 9

PAGE 8

! vi ABSTRACT The marine diatom genus Pseudo nitzschia includes species that produce domoic acid, a neurotoxin responsible for illness and mortality in both humans and marine wildlife. Because of the expertise and time required for the microscopic discriminati on of species, molecular methods that monitor environmental concentrations of Pseudo nitzschia provide a rapid alternative for the early detection of blooms and prediction of toxin accumulation. We have developed a nucleic acid sequence based amplification with internal control RNA ( IC NASBA) assay and a quantitative reverse transcription PCR (qRT PCR) assay for the detection of the toxic species P. multiseries targeting the ribulose 1,5 biphosphate carboxylase/oxygenase small subunit ( rbcS ) gene. Both meth ods use RNA amplification and fluorescence based real time detection. Due to a limited rbcS sequence database, primers were designed and used to sequence this gene from 14 strains of Pseudo nitzschia (including four P. multiseries ) and 19 other marine diat oms. The IC NASBA and qRT PCR assays had a limit of detection of one cultured cell of P. multiseries and were linear over four and five orders of magnitude, respectively (r 2 0.98). Neither of the assays detected closely related organisms outside the Pseu do nitzschia genus, and the qRT PCR assay was specific to P. multiseries While cross reactivity of primers

PAGE 9

! vii with unknown species prevented reliable detection of P. multiseries in spiked environmental samples using IC NASBA, the qRT PCR assay had positive d etection from 10 7 cells/L to 10 3 cells/L. Nearly a 1:1 relationship was observed between predicted and calculated cell concentrations using qRT PCR. Based on a diel expression study, the rbcS transcript copy number per cell ranged from 2.16 x 10 4 to 5.35 x 10 4 with the highest expression during early to mid photoperiod. The rbcS qRT PCR assay is useful for the detection and enumeration of low concentrations of P. multiseries in the environment.

PAGE 10

! 1 INTRODUCTION Pseudo nitzschia : A cosmopolitan diatom and emerging HAB genus Diatoms are a globally important group of phytoplankton, comprising approximately 40% of all primary production in the oceans (Mann, 1999; Sarthou et al., 2005) Because their frustules are composed of silica, they participate in the cycling of this critical nutrient, along with carbon, phosphorus, nitrogen, and iron (Sarthou et al., 2005) Diatoms require high nutrient concentrations for gr owth due to their relatively low surface to volume ratios, and they tend to dominate high nutrient regions in the ocean (Sarthou et al., 2005) They also respond rapidly to iron fertili zation experiments, becoming dominant members of the phytoplankton ass emblage (Coale et al., 1996; Marchetti et al., 2006) The sinking of diatom cells results in a n et downward flux of carbon, which has implications for carbon sequestration on a global scale (Bowler et al., 2010) Additionally, some diatoms of th e genus Pseudo nitzschia (Hasle, 1994) produce the neurotoxin domoic acid (DA). Members of this pennate diatom genus form colonies characterized by chains of overlapping cells (Skov et al., 1999) There are at least twelve toxic species of Pseudo nitzschia : P. australis, P. calliantha, P. cuspidata, P. delicatissima, P. fraudulenta, P. galaxiae, P.

PAGE 11

! 2 multiseries, P. multistriata, P. pseudodelicatissima, P. pungens, P. seriata, and P. turgidula (Bates and Trainer, 2006; Lefebvre and Robertson, 2010) Global distribution. Pseudo nitzschia species have been observed in the waters of all seven continents, spanning tropical, temperate, and polar environments (Hasle, 2002, and references therein) In fact, one of the most studied species, P. multiseries has been found under the ice in Prince Edward Island, Canada at temperatures of 1.5 ¡C (Bates et al. 1989) and during the summer in Galveston Bay, TX at temperatures up to 30 ¡C (Dickey et al., 1992; Reap, 1991) DA production by this genus also occurs globally and has been most documented in waters of the United States, Canada, Ireland, Scotland, France, Italy, Japan, Denmark, Portugal, Chile, Australia, and New Zealand (Couture et al., 200 1; Pan et al., 2001; Trainer et al., 2001; Villac et al., 1993) The list of countries reporting toxin production by Pseudo nitzschia is continually growing, but the species responsible vary with location. Distribution in the United States and the Gulf of Mexico. The most severely toxic Pseudo nitzschia blooms in the United States occur along the west coast (Trainer et al., 2001) Ne vertheless, Pseudo nitzschia species (and DA production ) are prevalent in other areas of the country, including the northeast, southeast, and the Gulf of Mexico (Fire et al., 2009; Liefer et al., 2009; Thessen and Stoec ker, 2008; Verity, 2010; Villareal et al., 1994) In the Gulf of Mexico (GOM) Pseudo nitzschia can reach up to >10 7 cells/L (Dort ch et al., 1997) and comprise a large portion of the diatom

PAGE 12

! 3 community (John et al., 2007) Their prevalence in the Gulf has increased during recent years, poss ibly due to an increase in eutro phication (Bates et al., 1998; Parsons et al., 2002) P. pseudodelicatissima found in Louisian a coastal waters has shown a high level of D A production (Pan et al., 2001; Parsons et al., 1999) and DA was found in P. multiseries isolated from the Texas coast (Dickey et al., 1992; Reap, 1 991) Pseudo nitzschia species have also been observed in Tampa Bay, Florida as a numerically dominant phytoplankton group (Badylak et al., 2007; Lundholm et al., 2003) Sixteen species of Pseudo nitzschia have been documented in the GOM nine of which fall on the list of potential domoic acid producers (Table 1). Domoic acid (DA) : A potent neurotoxin to humans and wildlife Domoic acid (DA) is a water soluble amino acid that affects neurotransmission (Figure 1). Based on isoto pic labeling studies, DA is derived from acetate via two separate precursor intermediates: 3 hydroxyglutamate, derived from the Krebs cycle, and an isoprenoid structure derived from gerany l pyrophosphate (Douglas et al., 1992; Ramsey et al., 1998; Smith et al., 2001) DA is structurally similar to kainic acid, which binds to a subgroup of the glutamate receptor family in the brain (reviewed by Jeffery et a l., 2004) Consequently, it has a high affinity for these receptors (known as the kainate receptors), which are heavily concentrated in the hippocampus. This interaction stimulates neuronal firing, leading to cell death and massive tissue degeneration (Jeffery et al., 2004)

PAGE 13

! 4 Table 1. Pseudo nitzschia species present in the Gulf of Mexico. Species Sampling Location References P. americana Apalache Bay, FL (Del Rio et al., 2010) (Lundholm et al., 2002b) P. brasiliana Northeast GOM ; LA TX coast (Lundholm et al., 2002b) (Thessen et al., 2005) P. caciantha Near Tuxpam, MX (Lundholm et al., 2003) P. calliantha Tampa Bay and Apalache Bay, FL (Del Rio et al., 2010) (Lundholm et al., 2003) P. cuspidata Near Tuxpam, MX (Lundholm et al., 2003) P. decipiens Near Tuxpam, MX (Lundholm et al., 2006) P. delicatis sima LA TX coast; Near Tuxpam, MX (Lundholm et al., 2006) (Parsons et al., 1999) (Thessen et al., 2005) P. galaxiae Near Tuxpam, MX (Lundholm and Moestrup, 2002) P. linea Tampa Bay and Apalache Bay, FL (Lundholm et al., 2002b) P. multiseries Galveston Bay, TX; LA TX coast (Dickey et al., 1992) 2 (Fryxell et al., 1990) (Hasle, 1972) (Parsons et al., 1999) (Reap, 1991) (Thessen et al., 2005) P. m ultistriata LA TX coast (Thessen et al., 2005) P. pseudodelicatissima LA TX coast; North and east coasts of Yucatan Peninsula (Del Rio et al., 2010) (Ghinaglia et al., 2004) 1 (Pan et al., 2001) 1,2 (Parsons et al., 1999) 1,2 (Thessen et al., 2005) 1 P. pungens LA TX coast; Near Tuxpam, MX (Del Rio et al., 2010) (Fryxell et al., 1990) (Hasle, 1972) (Lundholm et al., 2006) (Parsons et al., 1999) (Thessen et al., 2005) P. seriata North, west, and east coasts of Yucatan Peninsula (Ghinaglia et al., 2004) P. subcurvata National Park Sistema Arreci fal Veracruzano (southern GOM ) (AkŽ Castillo and Okolodkov, 2009) P. subfraudulenta LA TX coast (Hasle, 1972) (Thessen et al., 2005) 1 Study found a member of the P. pseudodelicatissima/P. cuspidata complex, but the exact species is undetermined. 2 Study detected domoic acid production by this species.

PAGE 14

! 5 Effects on humans and the marine food web When ingested by humans in hig h concentrations, DA can cause amnesic shellfish p oisoning, or ASP (Todd, 1993) The name of this condition stems from one of the most striking symptoms associated with DA poisoning, whi ch is permanent short term memory loss. Shortly after consumption of contaminated shellfish, both gastrointestinal (nausea, vomiting, diarrhea) and neurological (disorientation, memory loss) symptoms appear (Cˆmpas et al., 2007) In severe cases, the individual may experience seizures, autonomic dysfun ction, coma, or even death. Figure 1. Chemical structure of domoic acid. Domoic acid bioaccumulates in organisms that feed on Pseudo nitzschia namely benthic and filter feeding invertebrates, and this toxin is then transferred to higher predators (Bejarano et al., 2008) DA is found primarily in the digestive gland of shellfish and does not appear to negatively impact these organisms, due

PAGE 15

! 6 to their la ck of a complex central nervous system. Common invertebrate vectors include mussels ( Mytilus spp.; Bates et al., 1989; Horner et al., 1997) razor clams ( Siliqua patula ; Wekell et a l., 1994) various scallop species (Campbell et al., 2001; Couture et al., 2001) Dungeness crabs ( Cancer magister ; Horner and Postel, 1993 ) sand crabs ( Emerita analoga ; Ferdin et al., 2002; Powell et al., 2002) swimming crabs ( Polybius henslowii ; Costa et al., 2003) the common cuttlefish ( Sepia officinalis ; Costa et al., 2005) and Euphausiids (Bargu et al., 2002) In addition to invertebrates, planktivorous fish such as the northern anchovy ( Engraulis moordax ; Fritz et al., 1992; Lefebvre et al., 1999; Lefebvre et al., 2002b) and the Pacific sardine ( Sardinops sagax ; Lefebvre et al., 2002b; Tr ainer et al., 2001) as well as carnivorous fish such as mackerel ( Scomber japonicus ; Sierra Beltr‡n et al., 1997) have been implicated in transfer of DA up the food web. Although few studies evaluating sub acute toxicity to fish exist, it appears that oral administration of DA to fish does not cause toxicological symptoms, indicating low gastrointestinal absorption of the toxin (Lefebvre et al., 2001) Nevertheless, DA has been detected in a wide variety of marine organisms, indi cating widespread cycling of this toxin in the marine environment (Lefebv re et al., 20 02a) Domoic acid poisoning of wildlife is apparent at the higher trophic levels, such as birds and marine mammals, where it results in 7 many of t he same neurological symptoms that humans e xperience including disorientation and seizures (Fritz et al., 1992; Goldstein et al., 2008; Gulland, 2000)

PAGE 16

! 7 V ariability in toxin production and possible role(s) of DA. There has been significant variability observ ed in DA production, not only between different Pseudo nitzschia species, b ut also between different isolates of the same species (Bates et al., 1998) It is not completely understood why such variability in production of DA exists, nor does the toxin have any proven natural function in the physiology or life history of Pseudo nitzschia (Mos, 2001) However, many stud ies have established correlations between different environmental parameters/culture conditions and DA production, and there are also hypotheses as to the possible function of this toxin. Culture studies: Effect of growth phase and macro nutrients Most studies have shown that Pseudo nitzschia species produce the highest concentrations of DA in stationary phase (Bates, 1998; Bates et al., 1995b) A few exceptions, including P. pseudodelicatissima / cuspidata from the northern Gulf of Mexico (Pan et al., 2001) and isolates of P. australis and P. multiseries (Garrison et al., 1992; Pan et al., 1996b) have produced high DA concentrations in late exponential phase. An explanation for these results could be that some cells have stopped dividing and begin to produce DA, while others are still growing (Bates, 1998; Pan et al., 1 996b) Based on laboratory studies, nutrient conditions conducive to DA production include limitation by silicate or phosphate, and an excess of nitrogen (Bates et al., 1998) In P. multiseries cellular DA inversely correlates with both silicate and phosphate, in both batch and continuous cultures (Bates et al., 1991; Bates et al., 1996; Kudela et al., 2003; Pan et al., 1996a; Pan et al., 1996b; Pan

PAGE 17

! 8 et al., 1996c) The same is true for P. seriata ( Fehling et al. 2004) This pattern could be the result of a competition for free energy between primary and secondary metabolism, in which free energy is diverted to toxin production when growth slows as a result of nutrient limitation (Pan et al., 1996a; Pan et al., 1996c) The obs ervation that DA accumulation occurs predominantly in stationary phase, when growth slows and nutrients become limiting, also supports this idea. DA is an amino acid, so nitrogen is required for its synthesis (Bates et al., 1991) Several studies have shown the ability of Pseudo nitzschia to grow (and produce DA) using a variety of nitrogen sources, including nitrate, urea, and ammonium (Bates et al., 1993b; Howard et al., 2007; Thessen et al., 2009) Bates et al. (1993b) found that high concentrations of ammonium, when compared to nitrate, resulted in a two to fourfold increase in DA produced in stationary phase. Another study using P. australis found an increase in particulate and dissolved DA production when cells were grown with urea as the sole nitrogen source, compared with both nitrate and ammonium (Howard et al., 2007) Recently, Thessen et al. (2009) examined the effect of different nitrogen sources (nitrate, ammonium, and urea) on growth and DA production for multiple strains of P. multiseries, P. fraudulenta, and P. calliantha The authors found that toxin productio n is possible when cells are provided with any of the three sources and that this production can vary with source. However, most of the variation observed was between strains, not nitrogen sources, indicating that other mechanisms are also involved in esta blishing conditions conducive to DA production.

PAGE 18

! 9 Field studies: Effect of macronutrients and eut r ophication Field studies examining macronutrient concentrations and DA production have produced conflicting results, likely due to the complexity of the natural environment. Those conducted in southern California are consistent with laboratory studies, showing increa sed toxin production under phosphate and silicate limitation (Anderson et al., 2006; Schnetzer et al., 2007) Studies conducted in the Pacific Northwest have found no correlation between macronutrient concentrations and DA production (Marchetti et al., 2004; Trainer et al., 2009) Trainer et al. (200 9) concluded that there are no simple predictive relationships between concentration s of DA and macronutrients even in studies that establish correlations, it is not clear whether the nutrient concentrations play a direct role in toxin production or ar e simply a result of their drawdown during bloom formation. There has been speculation about the effect of eutrophication on development of toxic Pseudo nitzschia blooms. For example, in the northern Gulf of Mexico, the increase in nitrogen inputs relativ e to silicate have decreased the Si:N ratio by a factor of four over the last century (Turner and Rabalais, 1991) Simultaneously, an increase in Pseudo nitzschia has been observed since the 1950s (Dortch 1997). Previous studies have suggested the ability of Pseudo nitzschia to outcompete other phytoplankton at lo w Si:N ratios, thus suggesting that eutrophication may favor the formation of blooms (Sommer, 1994) I n an attempt to confirm the apparent correlation between nutrient input and Pseudo nitzschia abundance, Parsons et al. (2002) examined sediment cores from the

PAGE 19

! 10 northern Gulf of Mexico. The authors found higher abundances of Pseudo nitzschia when nitrate concentrations were elevated and Si:N was low, thus providing evidence for the link between eutrophication and Pseudo nitzschia blooms. However, some studies have found toxic Pseudo nitschia blooms during silicate replete conditions, indicati ng that this ratio is not necessarily predictive of bloom formation (Traine r et al., 200 0) Although nutrient loading from rivers is hypothesized to be the cause of a number of toxic Pseudo nitzschia blooms, it is not responsible for every event (Trainer et al., 2000) The form of nitrogen present may also play a role in bloom toxicity. Coastal environments are especially rich in ammonium and organic forms of nitrogen (Bates et al., 1998) Based on laboratory studies utilizing different nitrogen sources, organic forms of nitrogen like urea may enhance DA production (see above) ; however more studies are needed to confirm this (Bates, 1998; Howard et al., 2007; Thessen et al., 2009) Trace metals and DA production Pseudo nitzschia cells also increase DA production under low iron and copper conditions (Maldonado et al., 2002; Rue and Bruland, 2001; Wells et al., 2005) Maldonado et al. (2002) found that iron uptake rates in P. multiseries were enhanced threefold by adding DA to the culture medium, and that DA helped to decrease the toxicity of copper. Pseudo nitzschia spp. have an inducible high affinity iron uptake capability, requiring copper and domoic acid, that enables them to outcompete other diatoms in low iron conditions (Wells et al., 200 5) In the Juan de Fuca eddy region, Trainer et al. (2009) found the highest cellular DA

PAGE 20

! 11 concentrations and Pseudo nitz schia abundances in areas of iron limitation. Bacteria and DA production Several studies have examined the connection between bacteria associated with Pseudo nitzschia and the production of DA. Axenic cultures tend to accumulate less DA than non axenic c ultures (Douglas and Bates, 1992; Douglas et al., 1993; Kobayashi et al., 2009) and reintroducing the bacteria restores toxin production (Bat es et al., 19 95a) However, the bacteria themselves do not seem to be capable of DA production (Bat es et al., 200 4) It has been sugg ested that Pseudo nitzschia use a bacterially derived precursor to synthesize DA (Bates et al., 2004) Osada and Stewart (1997) fou nd that adding gluconic acid/glucolactone, a compound produced by the symbiont bacterium Altermonas sp., to axenic cultures increases DA production. The authors suggest that DA and gluconic acid/glucolactone are both nutrient scavengers, so Pseudo nitzschi a produces DA to counter the effects of the bacterially produced compound. Possible role(s) of DA The most widely accepted function of DA is to chelate extracellular iron and copper, copper being a necessary component of the high affinity iron transport ers present in Pseudo nitzschia (Bejarano et al., 2008; Wells et al., 2005) The presence of three carboxyl groups in the DA structure means it c ould chelate these trace metals (Bates et al 2001) Th is proposed function fits with observations of enhanced DA production in the presence of bacteria, due to a competition for micron utrients. DA may also simply serve as a way of dispensing

PAGE 21

! 12 excess photosynthetic energy when cells can no longer grow optimally, since most of the toxin is excreted (Bates, 1998; Bates et al., 1991) Due to the low nitrogen content (4.5% molecular weight) of DA, it is unlikely to be used as an N storage compound (Bates et al., 1991) and the toxin lacks any apparent allelopathic effects against other phytoplankton (Lundholm et al 2005b) Major toxic events in North America and aroun d the world Canada. The first reported DA poisoning event occurred in 1987 on Prince Edward Island (PEI), Canada, during which 107 people became ill and three died from eating blue mussels contaminated with high levels of toxin (Bates et al., 1989; Perl et al., 1990; Todd, 1993; Wright et al., 1989) Pseudo nitzschia multiseries was subsequently implicated as the toxin producer, and shellfish were not cleared for harvesting until the following April (Bates et al., 1989) Shortly thereafter, in the summer/fall of 1988, another toxic bloom resulted in shellfish harvesting closures in Cardigan Bay PEI and the Bay of Fundy (Bates et al., 1998; Gilgan et al., 1990; Martin et al., 1990) Since then, high DA concentrations and harvesting closures have been common along the east and west coasts of Canada (Bates et al., 1998; Couture et al., 2001) The United States. In the fall of 1991, a major DA poisoning event affected the entire U.S. west coast, specifically California, Oregon, and Washington. In Santa Cruz, California, 95 Brandt's cormorants and 43 brown pelicans died as a result of consuming anchovies with high levels of DA (Fritz et al., 1992; Work et al., 1993)

PAGE 22

! 13 Sick birds displayed central nervous system symptoms indicative of DA poisoning, and large numbers of P. australis frustules were found in the stomachs of birds and anchovies. Additionally, high levels of DA were found in Monterey Bay mussels (Wekell et al., 1994) In Oregon and Washington, razor clams and Dungeness crabs both contained high levels of DA, resulting in harvesting closures of almost one year in both of these states (Horner and Postel, 1993; Trainer, 2002; Villac et al., 1993) A study conducted later by the Washin gton Department of Health found that 21 people reported gastrointestinal symptoms after eating razor clams during the fall of 1991, and 13 of these exhibited mild neurological symptoms (Horner and Postel, 1993) The second significant DA poisoning event in the U.S. occurred in 1998 along the west coast. In May June in central California, there were over 400 sea lion mortalities due to the consumption of anchovies and sardines containing high levels of DA (Scholin et al. 2000) In addition, 70 sea lions and one northern fur seal stranded with neurological symptoms and were admitted to The Marine Mamma l Center; 48 of these sea lions later died (Gu lland, 2000) DA was detected in the serum, urine, and feces of several sea lions tested (Gulland, 2000; Lefebvre et al., 1999; Scholin et al., 2000) P. multiseries and P. australis were both discovered to be dominant Pseudo nitzschia species at the time of the strandings, and both were shown to produce DA (Scholin et al., 2000; Trainer et al., 2000) This event was the first to demonstrate trophic transfer of DA to marine mammals. In Oregon and Washington, DA rose to high levels in razor

PAGE 23

! 14 clams by fall of 1998, resulting in harvesting closures of most beaches for over one year (Trainer, 2002; Trainer et al., 2001; Trainer and Suddleson, 2005) In California, marine mammals (namely sea lions) exhibiting symptoms of DA poisoning have stranded every year since 1998. Between 1998 2006, for example, there were a total of 715 strandings with neurological symptoms brought to The Marine Mammal Center in Sausalito, CA, and 298 of these either died or were euthanized (Goldstein et al., 2008) Some of the marine mammal mortality events attributed to DA in California have also included sea otters, dolphins, and northern fur seals (Gulland, 2006; Kreuder et al., 2003; Schnetzer et al., 2007) DA was detected in stranded Risso's dolphins, Cuvier's beaked whale, gray whales, and humpback whales in 2002, but the susceptibility of these mammals to DA is unknown (Torres de la Riva et al., 2009) Between 1998 and 2006, high concentrations of DA have often been found in shellfish on the U.S. west coast, resulting in commercial and recreati onal closures in Washington and Oregon (Holtermann et al., 2010; Trainer, 2002; Trainer and Suddleson, 2005; Tweddle et al., 2010) Such closures have resulted in significant economic losses for these states. For exa mple, an estimated $4.8 million was lost during the 2003 closures of razor clam and mussel beds in Oregon (Tweddle et al., 2010) Most of these closures have occurred in coastal waters. However in September 2003, shellfish harvesting was closed for the first time in Puget Sound due to high concentrations of Pseudo nitzschia ( Trainer et al., 2007) This occurred again in 2005 due to elevated concentrations of DA in oysters and clams in Sequim Bay (Trainer et al., 2007)

PAGE 24

! 15 Elsewhere in the U.S., DA has been detected in shellfish and marine mammals but does not seem to accumulate in high concentrations and has not yet been definitively linked to DA poisoning in humans or animals. Interes tingly, DA was reported in shellfish in Nantucket as early as 1991, although at levels below the threshold for suspending harvesting (Nassif and Timperi, 1991) DA has been detected in stranded humpback whales in Maine (Gulland, 2006) as well as in stranded pygmy and dwarf sperm wh ales along the southeastern Atlantic coast from Virginia to Florida (Fire et al., 2009) In the Gulf of Mexico in 2004, a bottlenose dolphin mortality event occurred along the Florida panhandle; brevetoxin was determined to be the cause of death, but DA was also present in low amounts in some of these animals (NMFS, 2004) Mexico. In January 1996 in Cabo San Lucas, Baja California, over 150 pelicans died, and many more exhibited neurological symptoms that persisted for up to two months (Sierra Beltr‡n et al., 1997) These birds ate mackerel containing high levels of DA, and about 50% of the colony was lost. The next year, another mortality event involving 766 common loons and 182 marine mam mals occurred in the Gulf of California (Sierra Beltr‡n et al., 1998) P. australis frustules and DA were found in the stomachs of common dolphins and sardines. In January 2004, 112 dolphins, 195 sea lions 9 gray pelicans, and 20 tons of sardines died or were sickened in San Jorge Bay, Caborca, Sonora, presumably due to DA poisoning (Sierra Beltr‡n et al., 2005) DA was detected in the blood of stranded dol phins for three out of four samples tested. Later in the year, pelicans were

PAGE 25

! 16 also affected in Mazatlan Bay, Sinaloa. Although toxin analyses were not conducted on these animals, P. pseudodelicatissima was the dominant phytoplankton species, and the phytopl ankton toxin profile was similar to that of the dolphin blood in Carborca (Sierra Beltr‡n et al., 2005) Other global locations. DA contamination of shellfish and planktivorous fish is also common in other areas of the world. A major DA event occurred in Scotland in 1999, when high concentrations were found in king scallops, queen scallops, and mussels (Gal lacher et al., 2001) Most scallop fisheries were closed from June 1999 to May 2000 and about £15 million were lost from this industry. DA has been detected frequently in Scottish shellfish since then (Campbell and Kelly, 2001; Campbell et al., 2003) In French waters, high DA concentrations in shellfish in the Bay of Seine and Western Brittany have resulted in harvesting closures (Amzil et al., 2001; Nezan et al ., 2006) During summer fall 1992, a bloom of Pseudo nitzschia and high DA concentrations in mussels forced the closure of harvesting along the east coast of the Jutland peninsula in Denmark (Lundholm and Skov, 1993) More recently, in 2005, mussel closures occurred in the same region (Lundholm et al., 2005a) High concentrations of DA have also been detected in shellfish, cephalopods, and sardines from Portugal (Costa and Garrido, 2004; Costa et al., 2003) Mediterranean mussels in Spain (Miguez et al. 1996) blue mussels in Greece (Kaniou Grigoriadou et al., 2005) shellfish and tunicates from Chile (L—pez Rivera et al., 2009) and various shellfi sh

PAGE 26

! 17 species from New Zealand (Rhodes et al., 1998a; Rhodes et al., 2001; Rhodes, 1998; Rhodes et al., 2003) Traditional monitoring strategies: Toxin detection and microscopy Following the ASP events of 1987 on Pri nce Edward Island, the Canadian government imposed a 20 g domoic acid per gram of mussel flesh (20 ppm) limit for harvesting (Jeffery et al., 2004) This limit is still enforced today and has been adopted by other countries, including those belonging to the European Union, the United S tates, New Zealand, and Australia (Jeffery et al., 2004) A slightly higher limit of 30 ppm for Dungeness crab viscera was established after the discovery that proper cleaning of crabs greatly reduces the risk of DA poisoning (Trainer, 2002) The U.S. Food and Drug Administration, through the National Shellfish Safety Program (NSSP), requires domestic commercial shellfish harvesting operations to monitor for biotoxins, as well as countries that export to the U.S. (Anderson et al., 2001) Several state agencies in the U.S. regularly monitor shellfish for DA, including those in Oregon, Washington, California, Alaska (Trainer, 2002) Some of the other states focus on other biotoxins but may test for DA if Pseudo nitzschia cell concentrations re ach a trigger level which varies with species and location Other countries that experience frequent DA contamination of shellfish have their own toxin monitoring programs, such as Canada, New Zealand, Scotland, Ireland, France, Norway, Denmark, Portugal, and Chile (Couture et al., 2001) There are two AOAC (Association of Official Analytical Chemists) ce rtified methods for detecting DA. These include HPLC coupled with UV detection

PAGE 27

! 18 (AOAC, 2005a) and an Enzyme Linked ImmunoSorbent Assay (ELISA; AOAC, 20 05b) Although screening shellfish for DA is an important component of monitoring programs, the toxin is detected after it has already entered the food web, reducing warning time for regulatory agencies. There have also been questions about the reliabil ity of indicator species used, due to different toxin depuration rates and geographical distributions of these organisms (Ferdin et al., 2002) Most states within the U.S., as well as other countries, routinely monitor phytoplankton assemblages in order to de tect blooms of harmful algae such as Pseudo nitzschia before toxin accumulates. This method can serve as a type of "early warning" system, enabling better preventative strategies. There is no general consensus on the threshold cell concentration that shoul d be used, because toxin production/accumulation varies with Pseudo nitzschia species and geographic location (Anderson et al., 2001) In Washington State, research by the ORHAB partnership resulted in the establishment o f the following trigger cell concentrations for that region : P. multiseries / P. pungens : 1 x 10 5 cells/L P. heimii / P. fraudulenta / P. australis : 3 x 10 4 cells/L and P. delicatissima / P. pseudodelicatissima : 1 x 10 6 cells/L (Trainer and Suddleson, 2005) These concentrations initiate parti culate DA measurements of seawater to complement the shellfish monitoring and assist coastal managers with closure decisions. Around 5 x 10 4 cells/L of P. australis result in unsafe concentrations of DA in mussels and fish in California, which is similar t o the ORHAB data for this species (Busse et al., 2006) Some countries use phytoplankton monitoring as

PAGE 28

! 19 part of a two tiered system, in whi ch the phytoplankton cell counts (first tier) trigger shellfish toxin testing (second tier). For example, New Zealand established 5 x 10 4 cells/L (when Pseudo nitzschia is >50% total phytoplankton) and 1 x 10 5 cells/L (when Pseudo nitzschia is <50% total p hytoplankton) as the concentration(s) to initiate DA testing of shellfish (Anderson et al., 2001) An inherent difficulty associated with traditional monitoring programs is the requirement for microscopy based techniques to identify species of Pseudo nitzschia. Some species can be grouped into general morphotypes using light microscopy (LM; Parsons et al., 1999; Trainer and Suddleson, 2005) The genus itself is easily distinguishable due to the formation of stepped colonies, or chains of overlapping cells (Figure 2; Hasle, 1994) However it is common to have multispecies blooms comprised of both toxic and non toxic species, some of which cannot be distinguished by LM. Figure 2 Chains of P. multiseries CCMP2708. ( A = phase contrast, B = dif ferential interference contrast )

PAGE 29

! 20 For example, P. multiseries and P. pungens are nearly identical morphologically and often occur together, but the former is considerably more toxic (Bates et al., 1998; Miller and Scholin, 1996; Trainer et al., 1998) Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) can be used to examine the frustule patterns of these diatoms, which are unique for each species (e.g. Hasle and Lundholm, 2005; Lundholm et al., 2003; Lundholm et al., 2006) Because these techniques require a significant amount of time and expertise, as well as expensive equipment, they are not practical for most rout ine monitoring programs Several alternative identification techniques have been explored, including antibodies (Bates et al., 1993a) and lectins (Rhodes, 1998) However, most of the focus has been on the development of nucleic acid methods (utilizing DNA and RNA) for identification and enumeration of species within this harmful algal genus (i. e.: Diercks et al., 2008a; Miller and Scholin, 1998; Scholin et al., 1997) Molecular monitoring strategies for Pseudo nitzschia Commonly used genetic targets and methods Because the gene(s) involved in domoic acid production have not yet been elucid ated, molecular detection is typically based on the use of species specific sequences to detect potential toxin producers in the environment. Most previous studies utilizing molecular methods to detect Pseudo nitzschia have involved the use of ribosomal DNA or RNA (rDNA/rRNA; Anderson et al., 2001; Penna and Galluzzi, 2008) This includes the small subunit (18S), variable regions of the large subunit (28S), 5.8S, or the non coding internal and external

PAGE 30

! 21 transcribed spacer regions (ITS an d ETS, respectively). Because it is relatively conserved, the 18S is typically used for discrimination above the species level, while the 28S and ITS regions are used for discrimination between species, the ITS bein g most variable (Penna and Galluzzi, 2008) Probes targeting variable regions of the 28S rRNA have been developed for a variety of Pseudo nitzschia species and used in two formats: whole cell hybridization and sandwich hybridization (Miller and Scholin, 1996, 1998; Scholin et al., 1996; Scholin et al., 1999; Scholin et al., 1997) Whole cell hybridization, also known as "Fluorescent in situ Hybridization" (FISH), involves fixing and permeabilizing cells, incubating them with a specific fluorescent oligonucleotide probe, and then viewing them under an epifluorescence microscope for identification/quantification of the target cell type (DeLo ng et al., 1989 ) Sandwich hybridization assays (SHAs) require homogenization of cells to liberate their nucleic acids, followed by two subsequent hybridizations: the first c aptures the target sequence to an anchored oligonucleotide, and the second uses a signal probe that binds near the capture site (Ness and Chen, 1991; Ness et al., 1991) An enzyme driven colourimetric reaction enables viewin g of the end products, and the amount of color is proportional to target abundance (Scholin et al., 1996) The SHA has been integrated into a remote field monitoring platform called the Environmental Sample Processor (ESP), an electro magnetic/fluidic system that concentrates water samples and uses various probe arrays to detect species of interest, as well as preserves samples to be analyzed later with whole cell hybridization (Greenfield et al., 20 08; Greenfield et al., 2006) Recently, a cELISA

PAGE 31

! 22 was also added to the ESP for the detection of DA (Doucette et al., 2009; Scholin et al., 2009) Because the 28S probes were developed using Pseudo nitzschia strain s isolated from Monterey Bay, California, there have been mixed results when applying them to other geographical regions. In addition, the extensive cryptic diversity of this genus has caused difficulties for the discrimination of some species. Vrieling et al. (1996) and Bates et al. (1999) had success using the P. multiseries and P. pungens probes in Dutch and Canadian waters, respectively. The 28S probes also successfully detected six Pseudo nitzschia species in New Zealand (Rhodes et al., 2001) Other studies have shown the 28S probes to be variable in their discrimination of Pseudo nitzschia species (Lundholm et al., 2006; Orsini et al., 2002; Parsons et al., 1999; Rhodes et al., 1998b; Scholin et al., 1999; Turrell et al., 2008) For example, Lundholm et al. (2006) found that P. delica tissima like isolates from geographically diverse locations reacted with the probes fo r five different species When the 28S probes were applied to northern Gulf of Mexico waters, they agreed with the microscope on the presence or absence of four different Pseudo nitzschia species in 66% of the sample s analyzed (Parsons et al., 1999) However, a great deal of probe cross reactivity was observed with P. pseudodelicatissima and P. delicatissima indicating genetic variation in these species (Parsons et al., 1999) Another rR NA region that has been used for the development of Pseudo nitzschia detection a ssays is the 18S (Diercks et al., 2008a; Fitzpatrick et al., 2010) although it is generally more conserved than the 28S. Species specific

PAGE 32

! 23 SHA probes were used to discriminate cultures of P. multiseries P. australis P. pungens and P. seriata and a genus probe detected all strains tested except for P. pseudodelicatiss ima (Diercks et al., 2008a) However, more extensive testing of these probes is needed. Eventually, these SHAs are to be integrated into a portable semi automated device developed in the EU project ALGADEC that performs SHAs with electrochemi cal detection (Dier cks et al., 200 8b) Fitzpatrick et al. (2010) used the 18S to design a SYBR Green qPCR assay for the Pseudo nitzschia genus, but species specific detection was not obtained, which the authors attributed to low sequence diversity for this gene. The ITS regions seem to be the most variable o f the rRNA, and examination of these regions has begun to unravel the cryptic diversity of the Pseudo nitzschia genus. Sequence analysis of the ITS2 has resulted in the description of new species, most notably within the P. pseudodelicatissima and P. delic atissima complexes (Amato and Montresor, 2008; Lundholm et al., 2003; Lundholm et al., 2006; Quijano Scheggia et al., 2009) This cryptic diversity may help to explain some of the variation observed with 28S probes. Because ITS sequence length can vary between species, the potential for species discrimination using automated ribosomal intergenic spacer analysis (ARISA) has also been examined (Hubbard et al., 2008) However, sequence variation has also been observed among isolates of the same species, and even within the same genome, or monocl onal culture (Casteleyn et al., 2008; D'Alelio et al., 2009; Orsini et al., 2004) For this reason Evans et al. (2007) concluded that the ITS regions alone were not suitable for barcoding diatoms. Recently, Moniz and

PAGE 33

! 24 Kaczmarska (2010) proposed the use of the 5.8S + ITS2 region as a barcode, with the 5.8S gene acting as an "anchor" point and the ITS2 providing m ore resolution. Lastly, simple sequence repeats (SSRs), or microsatellites, and intersimple sequence repeats (ISSRs) have also been investigated as molecular tools for the discrimination of Pseudo nitzschia species (Bo rnet et al., 2004; Bornet et al., 2005; Evans et al., 2004; Evans and Hayes, 2004) SSRs are abundant polymorphic repeat motifs scattered throughout the genome, and ISSRs are the regions in between these motifs, which can be amplified with unique PCR pr imers (Bornet et al., 2004) These markers are highly variable, with the potential to discriminate discrete populations of the same species (Evans et al., 2004) RuBisCO: A potential molecular detection target. Ribu lose 1,5 biphosphate carboxylase/oxygenase (RuBisCO) catalyzes the first major step of carbon fixation: the carboxylation of ribulose 1,5 biphosphate (RuBP) using either carbon dioxide or molecular oxygen. In chromophytic and rhodophytic algae (non green a lgae), RuBisCO consists of eight large and eight small subunits encoded by the chloroplast (Hwang and Tabita, 1989) The genes encoding the large and small subunits ( rbcL and rbcS respectively) are cotranscribed and separated by a short, variable intergenic region (Hwang and Tabita, 1991) RuBisCO is one of the world's most abundant proteins; in fac t, it may comprise up to 50% of the total soluble proteins in a plant leaf or cell (Ellis, 1979)

PAGE 34

! 25 Relatively few studies have focused on RuBisCO genes in Pseudo nitzschia Amato et al. (2007) examined the rbcL gene, along with the 28S and ITS rDNA, to reveal the presence of cryptic, reproductively isolated groups within P. pseudodelicatissima and P. delicatissima The rbcL and ITS regions were considerably more variable than the 28S g ene. The rbcL gene has been suggested as a potential barcode gene for diatoms (Evans et al., 2007) The authors initially chose this gene because it has straightforward alignment, sufficient variability, and because it is plastid encoded, amplifying contaminant DNA is unlikely. The rbcL and the cytoc hrome c oxidase ( cox 1) genes were concluded to be better barcode regions than either the 18S or ITS rDNA (Evans et al., 2007) McDonald et al. (2007) has also suggested the rbcL gene as a possible candidate gene for Pseudo nitzschia identification because of its high resolution compared to the 28S. Although the rbcS gene has been examined in a few marine diatoms no studies have focused on this gene in Pseudo nitzschia Hwang and Tabita (1991) sequenced the rbcL gene rbcL rbcS spacer region, and rbcS gene in Cylindrotheca sp. s train N1. The authors found that the rbcS gene encodes for 139 amino acids in this marine diatom (corresponding to 417 bp) and has a relativ ely high AT content (Hwang and Tabita, 1991) The same length was obse rved for the rbcS gene in a diatom endosymbiont of Peridinium foliaceum (Che snick et al., 199 6) Phylogenetic analyses revealed that the rbcS gene may be less conserved than the rbcL indi cating its potential useful ness in the resolution of closely related species (Chesnick et al., 1996)

PAGE 35

! 26 Nucleic acid amplification based detection methods: qRT PCR and NASBA Real time nucleic acid amplification techniques have be en applied to the detection of several harmful algal species (reviewed by Humbert et al., 2010; Penna and Galluzzi, 2008) These methods enable higher sensitivity, which is necessary for the detection of pre bloom concentrations. Additionally, quantitative PCR (qPCR) allows for the semi quantificatio n or quantification of potentially toxic cells. Quantitative PCR assays have been designed for a variety of harmful phytoplankton, including dinoflagellates, raphidophytes, pelagophytes, diatoms, and cyanobacteria (Baxa et al., 2010; Bowers et al., 2000; Fitzpatrick et al., 2010; Galluzzi et al., 2004; Handy et al., 2005; Park et al., 2007; Popels et al., 2003) Although assay design is significantly more complex, multispecies detection is also possible with qPCR. Han dy et al. (2006) used multiplexing and multiprobing to detect several harmful raphidophyte species simultaneously. Furthermore, it has been demonstrated that morphotaxo nomy analyses and molecular methods such as qPCR and FISH all yield comparable cell concentrations (Touzet et al., 2009) Although most of these qPCR studies have targeted DNA, assay s using RNA (especially mRNA) amplification are advantageous because the rapid degradation of mRNA only permits the detection of viable cells, enabling a more relevant estimate of cell concentration. Additionally, the presence of high copy numbers of mRNA per cell combined with amplification provides the potential for a very low limit of detection in the environment. Two such RNA amplification methods are Nucleic Acid Sequence Based Amplification (NASBA; Figure 3;

PAGE 36

! 27 Compton, 1991) and quantitative reverse transcription PCR (qRT PCR ; Figure 4 ). NASBA has been used for the detection of the RuBisCO large subunit ( rbcL ) gene in Karenia brevis and Karenia mikimotoi with a detection limit of one cell per reaction (Casper et al., 2004; Ulrich et al., 2010) A qRT PCR assay targeting the rbcL gene of K. brevis has also been deve loped (Gray et al., 2003) Coyn e and Cary (2005) used qRT PCR as a proxy for Pfiesteria piscicida cyst viability in estuarine sediments. Figure 3 Nucleic Acid Sequence Based Amplification (NASBA) with molecular beacon detection A) Reaction pathway. A 3' primer containing the T7 RNA polymerase promoter sequence (Primer 1) hybridizes to the single stranded sense RNA. Following reverse transcription, the RNA template is digested by RNAse H, which is specific for DNA/RNA h ybrids. Ne xt, Primer 2 anne als to the 5' end, and a sense DNA stran d is synthesized. Once a double stranded DNA molecule exists that contains the T7 promoter sequence, antisense RNA is generated by action of the RNA polymerase. The antisense RNA functions as a templ ate for re verse transcriptase, and the cycle repeats, with Primer 2 annealing first. B) Molecular beacon hairpin loop structure. Upon binding of the beacon to the target antisense RNA seque nce, fluorescence is emitted ( R = reporter dye ; Q = quencher).

PAGE 37

! 28 Figure 4 TaqMan¨ qRT PCR assay process. Following reverse transcription PCR is conducted, with the TaqMan¨ probe binding to the antisense DNA strand during each cycle. The exonuclease activity of the DNA polymerase cleaves the probe, releasing the reporter dye into solution (R= reporter; Q= quencher) NASBA and qRT PCR can both incorporate fluorescent probe based detection of a specific genetic sequence, in the form of molecular beacons for NASBA (Leone et al., 1998) and TaqMan probes for qRT PCR (Livak et al.,

PAGE 38

! 29 1995) NASBA quantification is accomplished by comparing the time to positivity (TTP) value of a sample, which is analogous to threshold cycle (Ct) in qRT PCR, to that of a standard curve. Addition of an internal control RNA enables higher precision in quantification (IC NASBA; Patterson et al., 2005; Ulrich et al., 2010) One major differe nce between these two methods is that NASBA is isothermal (41 ¡C), while qRT PCR is conducted using traditional thermocycling conditions. Research objectives Molecular techniques are useful for the detection of Pseudo nitzschia due to the high morphologi cal similarity between species and the time required for microscopic identification. The ideal target gene should accurately delineate species, while the methodology employed should be sensitive and easily adaptable to high throughput screening and/or fiel d monitoring platforms. The major objectives of this research were to: 1. Evaluate the rbcS gene as a potential target for the detection of Pseudo nitzschia species by sequencing this gene from a variety of marine diatoms ; 2. Design an RNA amplification assay based on the rbcS gene for the detection of the domoic acid producer P. multiseries ; 3. Test the sensitivity and specificity of the assay(s) using cultures and RNA transcripts, as well as spiked environmental samples ; 4. Provide an estimate of rbcS trans cript copy number per cell and diel variability in expression

PAGE 39

! 30 MATERIALS AND METHODS Phytoplankton cultures and cell counts Unialgal cultures were maintained in growth medias and conditions specified in Table 2. For cell enumeration, cultures were swirled gently to ensure a homogenous distribution of cells, and a subsample was fixed with Lugol's iodine at a final concentration of 2%. A 1 mL Sedgwick Rafter counting chamber (Wildlife Supply Company, Yulee, DL) with 1 L grids was used to count cells Counts were based on 50 fields of view, and at least 2 mL were enumerated per sample, which were then averaged to estimate cell concentration. DNA extraction, rbcS primer design, and PCR The DNA extraction protocol was adapted from Paul and Pichard (1995) as follows: A 50 mL aliquot of diatom culture underw ent centrifugation at 10,000 x g for 20 min or longer, depending on pellet stability. The super natant was decanted and the pellet was resuspended in 1 mL STE buffer. This volume was then transferred to a 1.5 mL microcentrifuge tube and the Paul and Pichard (1995) protocol was followed without further deviation. Total DNA w as quantified and purity was assessed with a NanoDrop spectrophotometer (ND 1000, NanoDrop Technologies, Wilmington, DE). Degenerate primers were designed by examining a ClustalW alignment (OMIGA 2.0, Accelrys, San Diego, CA) of the

PAGE 40

! 31 Ta ble 2 Phytoplankton culture growth conditions and GenBank accession numbers for the rbcS gene. PSEUDO NITZSCHIA ISOLATES Species Strain designation Source 1 Media 2 Temperature Light regime ( mol photons m 2 s 1 ; light:dark) GenBank Accession Number for rbcS 3 P. cf. calliantha NWFSC 186 S. Bates, DFO L1 + Si 17 ¡C 46 50; 13:11 HQ263183 P. cuspidata NWFSC 189 S. Bates, DFO L1 + Si 17 ¡C 46 50; 13:11 HQ263184 P. delicatissima CL 252 S. Bates, DFO L1 + Si 17 ¡C 46 50; 13:11 HQ263180 P. delicatissima CL 253 S. Bates, DFO L1 + Si 17 ¡C 46 50; 13:11 HQ263181 P. delicatissima CL 260 S. Bates, DFO L1 + Si 17 ¡C 46 50; 13:11 HQ263182 P. multiseries CCMP2708 CCMP L1 + Si 17 ¡C 46 50; 13:11 HQ263174 P. multiseries CLNN 20 S. Bates, DFO L1 + Si 17 ¡C 46 50; 13:11 HQ263175 P. multiseries CLNN 21 S. Bates, DFO L1 + Si 17 ¡C 46 50; 13:11 HQ263176 P. multiseries PM O2 S. Bates, DFO L1 + Si 17 ¡C 46 50; 13:11 HQ263177 P. pungens CL 249 S. Bates, DFO L1 + Si 17 ¡C 46 50; 13:11 HQ263178 P. pungens CL 259 S. Bates, DFO L1 + Si 17 ¡C 46 50; 13:11 HQ263179 P. sp. AL 2 5 AL 2 S. Bargu, LSU L1 + Si 22 ¡C 40 45; 12:12 HQ263185 P. sp. LA1 St3 5 LA1 St3 S. Bargu, LSU L1 + Si 22 ¡C 40 45; 12:12 HQ263186 P. sp. LA2 StC6C 6 LA2 StC6C S. Bargu, LSU L1 + Si 22 ¡C 40 45; 12:12 HQ263187 OTHER PHYTOPLANKTON Species Strain designation Source 1 Media 2 Temperature Light regime ( mol photons m 2 s 1 ; light:dark) GenBank Accession Number for rbcS 3 DIATOMS Chaetoceros compressum CCMP168 CCMP f/2 17 ¡C 35 40; 13:11 HQ263188 Cylindrotheca closterium CCMP1855 CCMP f/2 22 ¡C 45 50; 12:12 HQ263189 Cylindrotheca fusiformis CCMP343 CCMP f/2 17 ¡C 35 40; 13:11 HQ263190 Detonula confervacea CCMP353 CCMP f/2 4 ¡C 8 12; 12:12 HQ263191

PAGE 41

! 32 Table 2, Continued. DIATOMS Fragilaria pinnata CCMP395 CCMP f/2 17 ¡C 35 40; 13:11 HQ263192 Leptocylindrus danicus CCMP1856 CCMP f/2 22 ¡C 45 50; 12:12 HQ263194 Navicula incerta CCMP542 CCMP f/2 17 ¡C 35 40; 13:11 HQ263195 Nitzschia curvilineata CCMP555 CCMP f/2 17 ¡C 35 40; 13:11 HQ263196 Nitzschia frustulum CCMP558 CCMP f/2 17 ¡C 35 40; 13:11 HQ263197 Nitzschia laevis CCMP559 CCMP f/2 17 ¡C 35 40; 13:11 HQ263198 Nitzschia cf. ovalis CCMP1118 CCMP f/2 22 ¡C 45 50; 12:12 HQ263199 Nitzschia cf. pusilla CCMP560 CCMP f/2 17 ¡C 35 40; 13:11 HQ263200 Phaeodactylum tricornutum CCMP1327 CCMP f/2 17 ¡C 35 40; 13:11 HQ263201 Rhizosolenia setigera CCMP1330 CCMP f/2 17 ¡C 35 40; 13:11 HQ263202 Skeletonema costatum CCMP2092 CCMP L1 + Si 22 ¡C 45 50; 12:12 HQ263203 Thalassiosira nordenskioeldii CCMP995 CCMP f/2 4 ¡C 8 12; 12:12 HQ263204 Thalassiosira pseudonana CCMP1335 CCMP f/2 17 ¡C 35 40; 13:11 HQ263205 Thalassiosira weissflogii CCMP1051 CCMP f/2 17 ¡C 35 40; 13:11 HQ263206 Unknown Bacillariophyceae CCMP2297 CCMP L1 + Si 4 ¡C 8 12; 12:12 HQ263193 PELAGOPHYTES Aureoumbra lagunensis CCMP1502 CCMP K 22 ¡C 45 50; 12:12 N/A Aureococcus anophagefferens CCMP1794 CCMP L1 22 ¡C 45 50; 12:12 N/A RAPHIDOPHYTES Chattonella subsalsa CCFWC75 FWRI N/A 4 N/A 4 N/A 4 N/A

PAGE 42

! 33 Table 2, Continued. RAPHIDOPHYTES Heterosigma akashiwo CCMP452 CCMP L1 22 ¡C 45 50; 12:12 N/A BOLIDOPHYTES Bolidomonas pacifica CCMP1866 CCMP Prov50 22 ¡C 23 27; 12:12 N/A DINOFLAGELLATES Akashiwo sanguinea CCFWC31 FWRI N/A 4 N/A 4 N/A 4 N/A Alexandrium monilatum CCMP1305 CCMP L1 22 ¡C 23 27; 12:12 N/A Gambierdiscus toxicus CCMP1649 CCMP K 22 ¡C 23 27; 12:12 N/A Karenia brevis CCFWC261 FWRI N/A 4 N/A 4 N/A 4 N/A Karlodinium micrum CCFWC114 FWRI N/A 4 N/A 4 N/A 4 N/A Prorocentrum lima CCFWC381 FWRI N/A 4 N/A 4 N/A 4 N/A Pyrodinium bahamense CCFWC390 FWRI N/A 4 N/A 4 N/A 4 N/A CYANOBACTERIA Trichodesmium erythraeum CCMP1985 CCMP YBCII 22 ¡C 23 27; 12:12 N/A 1 S. Bates, DFO: Stephen Bates and Claude LŽger of Fisheries and Oceans Canada; CCMP: Center for the Culture of Marine Phytoplankton; S. Bargu, LSU; Sibel Bargu of Louisiana State University; FWRI: Florida Fish and Wildlife Research Institute. 2 Except for YBCII (Chen et al., 1996) media was obtained from the CCMP (Guillard, 1960, 1975; Guillard and Hargraves 1993; Guillard and Ryther, 1962; Keller and Guillard, 1985; Keller and Selvin, 1987) 3 The rbcS gene was sequenced for all marine diatoms only. 4 Cultures were obtained from FWRI for specificity testing but not cultured in our lab. 5 Identified as P. cuspidata by electron microscopy (S. Bargu, personal communication). 6 ldentification pending.

PAGE 43

! 34 rbcS gene for five marin e diatoms listed in GenBank (accession numbers M59080, AB018006, AB018007, EF067921, and AY819643) and were obtained from Eurofins MWG Operon (formerly Operon Biotechnologies, Huntsville, AL; Table 3). PCR amplification was conducted using GoTaq¨ Green Mas ter Mix (Promega Corp., Madison, WI; final concentrations of 1.5 mM MgCl 2 and 0.2 mM each dNTP) and with final primer concentrations of 0.5 M. Thermal c ycling conditions were as follows: 10 min at 95 ¡C; 40 cycles of 30 sec at 95 ¡C, 30 sec at 54 ¡C, and 45 sec at 72 ¡C; and a final extension for 10 min at 72 ¡C. Products were verified by gel electrophoresis and the amplicon was purified using the DNA Cle an & Concentrator 25 per manufacturer's instructions (Zymo Research Corp., Orange, CA). Cloning, sequencing and bioinformatic analysis PCR amplicons were TA TOPO cloned into either the pCR¨2.1 TOPO¨ or pCR¨II TOPO¨ Dual Promoter vectors according to the manufacturer's instructions (Invitrogen Life Technologies, Carlsbad, CA). White colonies were restreaked for purity at least twice and subsequ ently grown in Luria broth with 50 g/mL kanamycin. Plasmids were extracted using the Zyppy Plasmid Miniprep Ki t per manufacturer's instructions (Zymo Research Corp., Orange, CA). Bidirectional Sanger sequencing of the 420 bp insert was performed using M13 primers by the University of Florida DNA Sequencing Core. Sequences were manually examined, the vector and pri mers were trimmed, and orientation of the insert was verified using Sequencher 4.5 (Gene Codes Corp., Ann Arbor, MI). Sequences were aligned using the ClustalW algorithm (OMIGA 2.0, Accelrys,

PAGE 44

! 35 San Diego, CA). Neighbor joining phylogenetic trees were constru cted using MEGA 4 ( Tamura et al., 2007) and the bootstrap consensus tree was inferred from 1,000 replicates. All other sequence and phylogenetic analyses were conducted using MEGA 4. Accession numbers for the rbcS gene sequences are given in Table 2. Table 3. Sequences for primers, molecular beacons, TaqMan¨ probe, and IC RNA oligonucleotides. Sequence name Sequence (5' to 3') Marine diatom rbcS gene primers Marine diatom rbcS forward primer GTGAGACTTACACAAGGTTG Marine diatom rbcS reverse primer 1 TTAGTAACGGCCACCTTCTGG Marine diatom rbcS reverse primer 2 TTAGTAACGGCTACCTTCAGG Marine diatom rbcS reverse primer 3 TTAGTAACGACCACCTTCTGG IC NASBA assay P. multiseries forward primer AGATTTAACTGATGAACAAA P. multiseries reverse primer 1 AATTCTAATACGACTCACTATAGGG AG AAGG GGTAAACCCCATAATTCCCA P. multiseries molecular beacon [6 FAM] CGTGCTCTATTAGCCGCGGTTTAGCA AGCACG [DABCYL] IC RNA molecular beacon [6 ROX] CATGCGTGGCTGCTTATGGTGACAAT CGCATG [DABCYL] P. multiseries IC RNA generation forward oligo 1 AATTCTAATACGACTCACTATAGGG AG AAAGATTTAACTGATGAACAAATTGAA AAGCAAATTGCTTACGTGGCTGCTTAT GGTGACAAT P. multiseries IC RNA generation reverse oligo GGTAAACCCCATAATTCCCAGTAACTA TTACGTGGGTGTGGATCATCTGTCCA TTCAACGTTCATATTGTCACCATAAGC AGCCA qRT PCR assay P. multiseries forward primer AGATTTAACTGATGAACAAA P. multiseries reverse primer GTAACTATTACGTGGGTGT P. multiseries TaqMan¨ probe [6 FAM] CTATTAGCCGCGGTTTA [TAMRA] 1 Text highlighted in grey indicates T7 RNA polymerase promoter site.

PAGE 45

! 36 Synthesis of i n vitro transcript For each Pseudo nitzschia isolate, one sequenced rbcS clone was used for the synthesis of transcript. Plasmids were linearized by digestion with either HindIII or NotI restriction endonucleases, depending on the orientation of the insert Digested plasmids were purified using the DNA Clean & Concentrator 25 (Zymo Research Corp., Orange, CA). Run off transcripts were generated from either the T7 promoter or Sp6 promoter sites using the Riboprobe¨ in vitro Transcription System (Promega Cor p., Madison, WI). Transcripts were purified using the RNEasy¨ Mini Kit (Qiagen, Valencia, CA) per manufacturer's instructions and quantified with a NanoDrop spectrophotometer (ND 1000, NanoDrop Technologies, Wilmington, DE). Transcripts were mixed 1:1 in a n RNA storage buffer (8 M guanidinium isothiocyanate, 80 mM Tris HCl (pH 8.5), 24 mM MgCl 2 140 mM KCl) and frozen at 80 ¡C until use. IC NASBA assay design and reaction conditions P rimers were designed to target a 126 bp region of the P. multiseries rbcS gene. The downstream primer contained the T7 promoter sequence at the 5' end followed by a purine rich spacer region. The molecular beacon was designed internal to the two primers and sequence parameters were confirmed using Mfold software ( http://bio web.pasteur.fr/seqanal/interfaces/mfold simple.html ) to ensure a calculated free energy of 3 0.5 kcal/mol. The P. multiseries beacon was labeled with 6 carboxyfluorescein (FAM ) at its 5' end and quencher DABCYL at its 3' end. Synthesis of IC RNA was co nducted as previously described by Ulrich et al. (2010) and transcripts were quantified and stored as previously

PAGE 46

! 37 described The IC RNA beacon was labeled with 6 carboxy X rhodamine (ROX ¨ ) at its 5' end and DABCYL at its 3' end. Primers and beacons were obtained from Eurofins MWG Operon (Huntsville, AL), while oligonucleotides for IC RNA synthesis were obtained from Integrated DNA Technologies, Inc. (Coralville, IA). Sequences for primers, beacons, and calibrator oligonucleotides are listed in Table 3. IC NASBA was performed using a NucliSENS Basic Kit and EasyQ¨ System according to manufacturer's instructions (bioMŽrieux Inc., Durham, NC). Final concentrations for primers and beacons were 400 and 100 nM, respectively, and the fin al concentration of KCl was 80 mM. The RNA template and reagent mix were incubated at 65 ¡C for 2 min prior to the addition of the enzymes, with a final reaction volume of 10 L. Optimal IC RNA concentrations were determined empirically by titration to all ow for positive amplification of both the target and the internal control RNA ( IC RNA ) but ranged from 10 5 to 10 7 copies per reaction (data not shown). TTP ratios were calculated by dividing the TTP of the wild type (target) by the TTP of the IC RNA. The d etection threshold for all TTP calculations was 1.35 fluorescent units. A negative control (nuclease free wa ter) was included in each assay. TaqMan¨ qRT PCR assay design and reaction conditions Primers for a TaqMan¨ qRT PCR assay were designed to target a 106 bp region of the P. multiseries rbcS gene. The upstream IC NASBA primer was used as the forward primer for qRT PCR. Due to fewer thermal constraints on primer design compared to NASBA, the downstream primer for qRT PCR was

PAGE 47

! 38 shifted upstream to exploi t additional nucleotide differences between Pseudo nitzschia and other marine diatoms (Table 3). The TaqMan¨ probe sequence was located in the same region as the IC NASBA molecular beacon but was shortened by three nucleotides on the 3' end (Table 3). The reverse primer was obtained from Integrated DNA Technologies, Inc. (Coralville, IA) and the TaqMan¨ probe from Eurofins MWG Operon (Huntsville, AL). SYBR¨ Green dissociation ana lysis was conducted to aid in assay design RNA was extracted from P. multiseries cells as previously described, and cDNA was created using the reverse PCR primer and the SuperScript¨ III First Strand Synthesis System according to the manufacturer's instructions (Invitrogen Life Technologies, Carlsbad, CA). Reactions wer e performed in 50 L using SYBR ¨ Green PCR Master Mix (Applied Biosystems, Carlsbad, CA) and a final primer concentration of 0.5 M Cycling conditions were as follows: 10 min at 95 ¡ C; 35 cycles of 30 sec at 95 ¡C, 3 0 sec at 51 ¡C, and 45 sec at 60 ¡C; an d a melting curve analysis (45 ¡C to 95 ¡C) TaqMan¨ a ssays were performed in 50 L reactions using the TaqMan¨ One Step RT PCR Master Mix Kit (Applied Biosystems, Carlsbad, CA). Final concentrations for pr imers and TaqMan¨ probe were 0.5 M and 0.25 M, respectively. Cycling conditions were as follows: 30 min at 45 ¡C for reverse transcription; 10 min at 95 ¡C; and 40 cycles of 15 sec at 90 ¡C, 30 sec at 51 ¡C, and 80 sec at 56 ¡C. Fluorescence was measured after each 56 ¡C incubation. Optimization of the extension temperature was also conducted. Reactions were

PAGE 48

! 39 performed using a 7500 Real Time PCR System and analyzed with the software provided (Applied Biosystems, Carlsbad, CA). RNA extraction Standard protocol. P. multiseries cells (CCMP2708) were diluted in L1 + Si media (Guillard and Hargraves, 1993) based on t he desired number per IC NASBA or q RT PCR reaction. Cells were filtered onto a Durapore¨ HV polyvinylidene difluoride 0.45 m pore size filter (Millipore, Billerica, MA). The filter was placed in 500 L RLT lysis buffer ( Qiagen, Valencia, CA) with 0.143 M § mercaptoethanol ( § ME) and vortexed. Following a 10 min incubation, 350 L of 100% ethanol were added and the lysate was purified using RNEasy¨ Mini Kit (Qiagen, Valencia, CA) according t o manufacturer's instructions. The on column DNAase d igestion step was included for q RT PCR samples. Final elution of RNA was carried out in 50 L of nuclease free water. Efficiency experiment. Two variations on the stan dard protocol were evaluated in parallel for the RNA extraction efficiency experiment, which was performed using the IC NASBA assay: 1) The same volume of culture was directly filtered onto an RNEasy¨ column, incubated for 10 min with 500 L RLT/ § ME + 350 L 100% ethanol, and then purified as normal; and 2) After filtration of culture, the filter was placed in a 2 mL tube containing zirconium beads + 500 L RLT/ § ME and underwent bead beating for 2 min prior to purification using RNEasy¨. Each of the three extraction methods was performed in triplicate to yield a theoretical concentration

PAGE 49

! 40 of 100 cells per IC NASBA reaction. The TTP ratios for extracts were compared to a transcript standard curve to determine copy number per volume eluate. Percent recovery w as calculated as percent of the greatest recovery obtained. Specificity testing Specificity of the P. multiseries IC NASBA and qRT PCR assays was tested against the phytopl ankton strains listed in Table 2 Because rbcS transcripts were available for Pse udo nitzschia isolates, they were used at a concentration of 10 6 copies per reaction. For all non Pseudo nitzschia strains, several milliliters of culture were filtere d and extracted with the standard RNEasy¨ prot ocol Total RNA was quantified with an Agil ent Bioanalyzer (Model 2100, Agilent Technologies, Santa Clara, CA) and extracts were diluted to 10 pg per reaction. Positive controls ( P. multiseries CCMP2708) were included in each assay and prepared in the same manner as the non targets. Spiked environ mental samples For the spiked seawater experiment using the P. multiseries TaqMan¨ qRT PCR assay, water was collected from Bayboro Harbor, an embayment in Tampa Bay (29 June 2010). Three replicate aliquots were examined by light microscopy for the presence of Pseudo nitzschia cells After determining that the natural presence of Pseudo nitzschia was below the detection limit, aliquots of untreated seawater were spiked with various concentrations of P. multiseries cells in a total volume of 50 mL. Due to the loss of strain CCMP2708 after extended time in culture, isolate CLNN20 was used for this experiment, which has an identical rbcS nucleotide sequence. Spiked concentrations spanned five

PAGE 50

! 41 orders of magnitude, ranging from a theoretical 10 7 c ells/L to 10 3 cells/L. Each concentration and a non spiked sample were filtered in triplicate, and cultured cells were also filtered for the standard curve. Filters were stored in 500 L RLT/ § ME at 80 ¡C until processing, which occurred within one week. RNA was extracted using the standard RNEasy¨ protocol incorporating the on column DNAse digestion step. One initial qRT PCR run was conducted to confirm the absence of P. multiseries in the unspiked samples as well as determine the proper dilution require d for minimization of chemical inhibition of the reaction. The optimal dilution factor for these samples was determined to be 1:5 (data not shown). Calculated versus expected cell concentrations were determined by comparing the Ct for each spiked concentra tion with the standard curve. The Ct value (cycle threshold) is the number of cycles required for fluorescence to reach a threshold value. Due to extensive and variable inhibition of the IC NASBA assay in environmental samples, a spiked seawater experiment similar to the one conducted for qRT PCR could not be performed. Water samples were collected from the Pinellas Point area in southern Tampa Bay on 14 August 2009. Seawater was spiked with P. multiseries cells at a theoretical concentration of 10 5 cells/L as described in the above qRT PCR experiment, only this was done in a total volume of 30 mL. RNA was extracted using the standard RNEasy¨ protocol. Undiluted extracts and 1:10 dilutions were used in the IC NASBA reactions.

PAGE 51

! 42 Determination of IC NASBA assay inhibitor (s) Size fractionation experiment. Seawater was collected from the Pinellas Point area on 6 August 2009, spiked with cultured P. multiseries at a concentration of 10 5 cells/L, and 30 mL was filtered through a 2.0 m pore size polycarbonate filt er (Whatman, Kent, UK). The filtrate was then spiked with P. multiseries at the same concentration of 10 5 cells/L and filtered through a Durapore¨ HV polyvinylidene difluoride 0.45 m pore size filter (Millipore, Billerica, MA). Both filter fractions were extracted using the standard RNEasy¨ protocol An undiluted and a 1:10 dilution of each extract were used in IC NASBA Karenia brevis spike experiment Seawater was collected from the Pinellas Point area on 12 August 2009, spiked with cultured P. multiseries at a concentration of 10 5 cells/L, and 30 mL was filtered through a Durapore¨ HV polyvinylidene diflu oride 0.45 m pore size filter (Millipore, Billerica, MA). RNA was extracted as previously described. An undiluted and a 1:10 dilution of each extract were used in IC NASBA. In parallel, a subsample of the RNA extract was spiked with rbcL transcript from Karenia brevis and this was analyzed using the chemistry for a previously developed K. brevis IC NASBA assay (Casper et al., 2004) Sequence specific capture with Dynabeads ¨ Dynabead s ¨ MyOne Carboxylic Acid (Invitrogen Life Technologies, Carlsbad, CA ) were used for sequence specific capture of P. multiseries rbcS mRNA from RNEasy ¨ elu ate prior to performing the IC NASBA assay (Figure 5 )

PAGE 52

! 43 This step was included as an attempt to reduce inhibition of the IC NASBA assay. Figu re 5 General detection process incorporating bead based target mRNA capture Coupling of probe to beads. The capture probe contained the same sequence as the molecular beacon, with a primary amine group on its 5' end. Carbodiimide (N Ethyl N' (3 dimethylaminopropyl) carbodiimide hydrochloride ; EDC) activation was used for coupling of probe to the beads according to the manuf acturer's instructions

PAGE 53

! 44 (Figure 6 ), with 5 nmol probe used per mg of beads. All solutions used were prepared RN Ase free. Figure 6 Activation and coupling of oligonuc leotides to Dynabeads¨ MyOne Carboxylic Acid Probe coupling efficiency was measured using the Quant iT OliGreen ¨ ssDNA Assay Kit (Invitrogen Life Tec hnologies, Carlsbad, CA). A low range oligonucleotide standard curve was prepared according to the manufacturer's instructions. Pure probe stock coupling buffer, and washes we re diluted with 1X TE as needed to fall within range of the standard curve S tandards and s amples were mixed wit h OliGreen ¨ reagent and measured according to the manufacture r's instructions. The c oncentration of probe in pure stock, buffer, and washes was determined in ng/ L and total mass of probe exposed to beads and remaining in buffer/washes was calculated.

PAGE 54

! 45 Hyb ridization of probe conjugated beads to target mRNA. The hybridization buffers and a modified protocol were derived from the Dynabeads ¨ Oligo (dT) 25 manual (Invitrogen Life Technologies, Carlsbad, CA). Briefly, t he probe conjugated bead stock was mixed t horoughly and 25 L (0.1 mg) were transferred to a 2 mL tube. A magnetic particle concentrat or (MPC) was used to collect beads on the side of the tube, enabling removal of the storage buffer. Beads were subsequently washed twice in 200 L of 2X binding buf fer (20 mM Tris, 1 M LiCl, 2 mM EDTA; p H= 7.5; RNAse free). The RNEasy ¨ eluate was brought to a volume of 1 00 L using nuclease free water, and 100 L of 2X bindin g buffer were added. T his volume (200 L) was transferred to the washed beads. The tube containing beads and target was heated for 5 min at 65 ¡C and then immediately placed in a slow rotation device for 15 min at roo m temperature. After hybridization, the beads were separated using a MPC and washed twice in 200 L washing buffer (1 0 mM Tris, 0.15 mM LiCl, 1 mM EDTA; pH= 7.5; RNAse free). To elute the captured RNA, 50 L nuclease free water was added to the beads, and the tube was heated for 2 min at 80 ¡C. The tube was then immediately placed on the MPC, and the supernatant was tran sferred to a 0.5 mL tube. Expression patterns of the rbcS gene in P. multiseries A diel expression study was conducted with P. multiseries CCMP2708 using cultures in exponential phase. Every four hours over a diel cycle, the culture was enumerated and 1 mL was filter ed in triplicate as previously described Filters were stored in 500 L RLT/§ME at 80 ¡C until analysis with IC

PAGE 55

! 46 NASBA, which was completed within two weeks for all samples. The extracted RNA from a known number of cells was compared to a n rbcS transcript standard curve to obtain copy number per cell.

PAGE 56

! 47 RESULTS Sequence and phylogenetic analysis The rbcS primers successfully amplified the entire (420 bp) gene from Pseudo nitzschia and all marine diatoms tested. D ata presented are based on a 379 bp region of the rbcS gene af ter removal of the primer sites This sequence corresponds to 126 amino acids. The GC content of the rbcS gene ranged from 35.1% to 41.6%. For marine diatoms a lmost half of nucleotide site s were variable but only slightly more than 10% were variable within the Pseudo nitzschia genus specifically (Table 4) Table 4 Variability of rbcS nucleotide and amino acid sequences in Pseudo nitzschia and other marine diatoms. Alignment for Pseudo ni tzschia Variable sites Parsimony informative sites Percent similarity 1 Nucleotide 47/379 32/379 91 99% Amino acid 11/126 8/126 92 99% A lignment for a ll marine diatoms Variable sites Parsimony informative sites Percent similarity 1 Nucleotide 156/379 134/379 76 99% Amino acid 41/126 35/126 79 99% 1 Percent similarity calculated for different species only

PAGE 57

! 48 All Pseudo nitzschia species shared at least 91% identity at the nucleotide level and 92% identity at the amino acid level (Table 4). The closely related species P. multiseries and P. pungens differed by only three nucleotides. Two Gulf of Mexico isolates, AL 2 and LA1 St3, ha d an identical rbcS sequence to P. cuspidata. The phylogenetic analysis (Figure 7 ) revealed Pseudo nitzschia as a well supported monophyletic group (bootstrap value = 99%). Within the genus, P. multiseries and P. pungens formed a well supported cl ade (boot strap value = 98%; Figure 7 ). P. cuspidata and P. delicatissima were sister groups in another clade, although bootstrap value were low. P. cf. calliantha and P seudo nitzschia sp. LA2 StC6C were located outside these two clades. Sensitivity and specifici ty of IC NASBA and qRT PCR assays Dissociation curve analysis revealed a single peak for the qRT PCR reaction, indicating that no primer dimers were present (Figure 8). The melting temperature of the amplicon was calculated to be 75.6 ¡C and the TaqMan¨ assay had optimal results with a low extension temperature of 56 ¡C. Both assays were sensitive to one cell per reaction in culture and demonstrated excellent linearity over four and five orders of magnitude for IC NASBA and qRT PCR, respectively (Figures 9 11). These ranges were also observed when using rbcS gene transcripts (data not shown). The IC RNA concentration optimal for detecting at least one cell (~10 4 copies of transcript) in IC NASBA was determined to be 10 6 copies per reaction (data not shown)

PAGE 58

! 49 Fig ure 7 Evolutionary relationship of marine diatoms based on the rbcS gene. Bootstrap consensus tree was inferred from 1,000 replicates. Taxa include 14 Pseudo nitzschia isolates and 24 other marine diatoms. Sequences marked with a were used in the design of rbcS primers and have their GenBank accession numbers in parentheses. The remaining isolates were sequenced in this study.

PAGE 59

! 50 Figure 8 SYBR¨ Green dissociation curve. =1,000 cells; = 100 cells; # = 10 cells; = 1 cell. Figure 9 Representative IC NASBA plots for P. multiseries A) 100 cells; B) 1 cell The black line represents amplification of the target gene, while the grey line represents amplification of the IC RNA. The horizontal dashed line denotes the detection threshold value of 1.35. -0.04 0 0.04 0.08 0.12 0.16 0.2 45 55 65 75 85 95 Fluorescence Derivative Temperature (C) 0 1 2 3 0 50 Fluorescence value (A) Time (min) 0 1 2 3 0 50 Fluorescence value (B) Time (min)

PAGE 60

! 51 Figure 10 Representative qRT PCR plot for P. multiseries =1,000 cells; = 100 cells; # = 10 cells; = 1 cell The h orizontal dashed line denotes Ct value. Figure 11 Typical c ell standard curves. A) IC NASBA; B ) qRT PCR. ! 0.00001 0.0001 0.001 0.01 0.1 1 10 0 10 20 30 40 Delta Rn Cycle number y = -0.125ln(x) + 1.26 R = 0.987 0.2 0.4 0.6 0.8 1 1.2 1.4 1 10 100 1000 TTP Ratio (A) Cells per Reaction y = -1.94ln(x) + 33.4 R = 0.995 10 15 20 25 30 35 1 10 100 1000 10000 Ct value (B) Cells per Reaction

PAGE 61

! 52 Results of the specificity testing for both assays are presented in Table 5. The IC NASBA assay detected all four strains of P. multiseries as well as P. pungens, P. cuspidata, P. calliantha, and two of the Gulf of Mexico isolates, AL 2 and LA1 St3. The qRT PCR assay detected the four P. multiseries isolates but none of the other Pseudo nitzschia species. Neither assay detected any species outside the Pseudo nitzschia genus. Table 5 Specifici ty of IC NASBA and qRT PCR assays. Species Isolate IC NASBA result 1 qRT PCR result 1 P. multiseries CCMP2708 + + P. multiseries CLNN 20 + + P. multiseries CLNN 21 + + P. multiseries PM 02 + + Other Pseudo nitzschia species P. cf. calliantha NWFSC 186 + P. cuspidata NWFSC 189 + P. delicatissima CL 252 P. delicatissima CL 253 P. delicatissima CL 260 P. pungens CL 249 + P. pungens CL 259 + Pseudo nitzschia sp. AL2 + Pseudo nitzschia sp. LA1 St3 + Pseudo nitzschia sp. LA2 StC6C Other marine phytoplankton C. compressum CCMP168 C. closterium CCMP1855 C. fusiformis CCMP343 D. confervacea CCMP353 F. pinnata CCMP395 L. danicus CCMP1856 N. incerta CCMP542 N. alba CCMP2426 N. curvilineata CCMP555 N. frustulum CCMP558 N. laevis CCMP559 N. cf. ovalis CCMP1118 N. cf. pusilla CCMP560

PAGE 62

! 53 Table 5, Continued. Species Isolate IC NASBA result 1 qRT PCR result 1 P. tricornutum CCMP1327 R. setigera CCMP1330 S. costatum CCMP2092 T. nordenskioeldii CCMP995 T. pseudonana CCMP1335 T. weissflogii CCMP1051 Unidentified Bacillariophyceae CCMP2297 A. lagunensis CCMP1502 A. anophagefferens CCMP1794 C. subsalsa CCFWC75 H. akashiwo CCMP452 B. pacifica CCMP1866 A. sanguinea CCFWC31 A. monilatum CCMP3105 G. toxicus CCMP1649 K. brevis CCFWC261 K. micrum CCFWC114 P. lima CCFWC381 P. bahamense CCFWC390 T. erythraeum CCMP1985 1 +, detected; not detected RNA extraction efficiency experiment Three RNA extraction methods, all based on the RNEasy¨ protocol but with varying degrees of agitation for cell lysis, were compared to determine the method with the highest efficiency. The regular protocol, which had a 10 min incubation of the filter (plus cells) at room temperature with RLT/ § ME, resulted in the highest rbcS copy n u mbers in RNEasy eluate¨ (Figure 12 ). The bead beating and direct filtration methods yielded 36% and 32% as mu ch target in the elua te, respectively (Figure 12 ).

PAGE 63

! 54 Figure 12 Comparison of three RNA extraction methods as determined by rbcS copy number. Error bars represent standard deviation of triplicate filters run using P. multiseries IC NASBA assay. Percent recovery is calculated as percent of the greatest recovery. Spiked environmental samples Examination of environmental samples spiked with P. multiseries cells revealed extensive inhibition of the IC NASBA assay, as is evident by the depressed target an d IC RNA signal compared to the po sitive control (Figure 13 A C ). This inhibition was not lessened with a 1:10 dilution of RNA extract (Figure 13 C). The qRT PCR assay successfully detected P. multiseries spiked into environmental samples ove r five orders of magnitude (Figure 14 ). Positive, linear detection was achieved from 10 7 cells/L to 10 3 cells/L, which corresponded to 5 x 10 4 and 5 cells/reaction, respectively. The calculated versus expected cells/L had a slope slightly above 1, with an r 2 of 0.986 ( Figure 14 ). 36% 100% 32% 0.E+00 5.E+06 1.E+07 2.E+07 2.E+07 3.E+07 3.E+07 4.E+07 4.E+07 Bead Beating with RLT/ ME 10 min incubation with RLT/ ME Direct filtration and incubation with RLT/ ME rbcS copy number in eluate Method of RNA extraction

PAGE 64

! 55 Figure 13 Inhibition of IC NASBA assay in spiked environmental samples. Panel A shows amplification of the cell standard at 100 cells/reaction. Panels B and C show the spiked environmental sample (10 5 cells/L or ~150 cells/reaction) run as an undiluted extract and with a 1:10 dilution, respectively. Black curves represent amplification of target, grey curves represent amplification of IC RNA, and horizontal dashed lines denote detection threshold value 0 1 2 3 0 20 40 60 80 Fluorescence value (A) Time (min) 0 1 2 0 20 40 60 80 Fluorescence value (B) Time (min) 0 1 2 0 20 40 60 80 Fluorescence value (C) Time (min)

PAGE 65

! 56 Figure 14 Calculated versus expected cells per liter for qRT PCR spiked environmental experiment. E quation and coefficient of determination (r 2 ) value were derived from log transformed data plotted on a linear scale. Error bars represent standard deviation of replicates. For each concentration, three filters were extracted, and each extract was run in duplicate in the qRT PCR reaction. Determination of IC NASBA assay inhibitor The size fractionation experiment revea led inhibition in the > 2.0 m size fraction while it appeared absent from the smaller fraction (Figure 15 ). Calculations from the smaller fraction produced an average number of c ells per reaction similar to the expected value (123 and 150 cells, respectively). The P. multiseries and K. brevis ass ays performed differently with the same seawater sample. While the P. multiseries assay demonstrated inhibition, the K. brevis assay had positive uninhibi ted detection (Figure 16 ). y = 1.03x + 0.0644 R = 0.986 1E+02 1E+03 1E+04 1E+05 1E+06 1E+07 1E+08 1E+02 1E+03 1E+04 1E+05 1E+06 1E+07 1E+08 Calculated cells/L Expected cells/L

PAGE 66

! 57 Figure 15 Results from size fractionation experiment. Panel A shows amplification of the cell standard at 100 cells/reaction. Panels B and C show the spiked environmental sample at 150 cells/reaction for the large and sma ll fractions, respectively. Black curves represent amplification of target, grey curves represent amplification of IC RNA, and horizontal dashed lines denote detection threshold value. 0 1 2 3 0 20 40 60 80 Fluorescence value (A) Time (min) 0 1 2 0 20 40 60 80 Fluorescence value (B) Time (min) 0 1 2 3 0 20 40 60 80 Fluorescence value (C) Time (min)

PAGE 67

! 58 Figure 16 Comparison of P. multiseries and K. brevis IC NASBA assay performance Panel A shows inhibition in P. multiseries and Panel B shows detection by K. brevis assay. Black curves represent amplification of target, grey curves represent amplification of IC RNA, and horizontal dashed lines denote detection thresh old value. Sequence specific capture with Dynabeads¨ Probe coupling. Probe coupling efficiency was approximately 40% (Figure 17 ) A large percentage of prob e exposed to the beads remained in the coupling buffer (~50%), while a lesser amount was lost in Wash 1 (~8%). Less than 1% of the total probe was detected in W ashes 2 and 3. 0 1 2 0 10 20 30 40 50 60 70 80 90 Fluorescence value (A) Time (min) 0 1 2 3 4 0 10 20 30 40 50 60 70 80 90 Fluorescence value (B) Time (min)

PAGE 68

! 59 Figure 17 Relative p ercentage s of probe detected in various steps of the Dynabead¨ coupling procedure. Ta rget hybridization in culture and environmental samples Afte r testing different bead amounts per hybridization reaction ( 0.4 mg, 0.2 mg, and 0.1 mg ), it was determined tha t 0.1 mg did not result i n significantly lower detection (data not shown). T hus, 0.1 mg was used for subsequent experiments in order to conserve bead stock. Using P. multiser i es RNA extracts, percent recovery by beads compared to a cell standard curve was variable ranging from approximately 10 20%. D etection of 10 cells per IC NASBA reaction was not consistently achieved, an d 1 cell per reaction was never detected. Hybridization and elution times were increased, but this did not significantly improve recovery (data not shown).

PAGE 69

! 60 A replicate of a p reviously inhibited sample (collected 31 Ma rch 2009 from Mullet Key, Tierra Verde, FL ) was run using the IC NASBA assay and incorporating the bead hybridization step Although the target was below the limit of detection, successful amplification of IC RNA i ndicated removal of the i nhibitors (Figure 18 ). Figure 18 Comparison of IC NASBA plots for an environmental sample run without and with the Dynabead¨ target hybridization step. Panel A shows inhibition of IC RNA amplification when bead step was not performed, and Panel B sh ows successful amplification of IC RNA after bead step. Black curves represent amplification of target, grey curves represent amplification of IC RNA, and horizontal dashed lines denote detection threshold value. 0 1 2 0 10 20 30 40 50 60 70 80 90 Fluorescence value (A) Time (min) 0 1 2 0 10 20 30 40 50 60 70 80 90 Fluorescence value (B) Time (min)

PAGE 70

! 61 The bead hybridization step was also tested using environmental samples spiked with P. multiseries at concentrations of 10 4 cells/L and 10 6 cells/L. Detection of 10 4 cells/L (or 25 cells/reaction) was not consistently achieved, but the assay did detect 10 6 cells/L (2,500 cells/reaction; Figure 19). Percent recovery by beads compared to a cell standard curve usually ranged from 1.0 1.5%; however some experiments produced an inexplicably lower recovery (data not shown). Figure 19 Detection of 10 6 cells /L using Dynabeads¨ and IC NASBA. Panel A is the cell standard curve, and Panel B shows successful amplification of target and IC RNA for the 10 6 cell/L spiked sample. Black curves represent amplification of target, grey curves represent amplification of I C RNA, and horizontal dashed lines denote detection threshold value. 0 1 2 3 0 10 20 30 40 50 60 70 80 90 Fluorescence value (B) Time (min) y = -0.169ln(x) + 1.64 R = 0.981 0.0 0.4 0.8 1.2 1.6 2.0 1 10 100 1000 TTP ratio (A) Cells per reaction

PAGE 71

! 62 Expression patterns of the rbcS gene The overall average rbcS transcript copy number for cultured P. multiseries CCMP2708 was 3 x 10 4 copies/cell. There was some variability in expression over a diel cycle, with the highest occur r in g during early to mid photoperiod (Figure 20 ). The calculated copy number per cell was slightly higher for the second 8:00 a.m. time point compared to the sa me time on the previous day. Throughout the diel cycle, transcript abundance varied from 2.16 x 10 4 5.35 x 10 4 copies/cell. Figure 20 Diel expression pattern of rbcS gene in exponential phase P. multiseries CCMP2708 culture. Error bars represent standard deviation of replicates, and gray boxes denote dark phase of diel cycle.

PAGE 72

! 63 DISCUSSION Although the marine diatom rbcS phylogeny placed all Pseudo nitzschia species into a well supported monophyletic group, this gene did not exhibit substantial variation between species within the Pseudo nitzschia genus Only 12% of nucleotide sites were variable for the species/strains examined. Nevertheless, the rbcS gene phylogeny in Pseudo nitzschia appears to follow the same general patt ern observed in ribosomal genes based on the small number of strains sequenced. Both the 28S and ITS regions of ribosomal RNA have shown P. multiseries and P. pungens to be closely related sister groups (Lundholm et al., 2002a; Lundholm et al., 2006) Within the rbcS gene the difference between these two species is only three base pairs. Similar to findings by Amato and Montresor (2008) and Lundholm et al. (2006) P. delicatissima and P. cuspidata are more closely related to each other than to P. calliantha based on the rbcS gene Additional sequencing of other Pseudo nitzschia species, especially those within groups containing significant cryptic or pseudo cryptic diversity, would show the extent to which the rbcS gene phylogeny parallels that of other genetic makers. Based on the rbcS gene sequence data, the identity of two of the Gulf of Mexico i solate s (AL 2 and LA1 St3) was predicted to be P. cuspidata T his was later confirmed by electron microscopy, however identification of LA2 StC6C is

PAGE 73

! 64 still pending (Sibel Bargu, personal communication). It is interesting to note that P. multiseries isolates from locations as distant as eastern Canada (CCMP2708, CLNN 20, and CLNN 21) and Russia (PM O2) all contained 100% similarity in the rbcS gene. Using rbcS sequence data, IC NASBA and qRT PCR assays were developed for the detection of P. multiseries Both assay s were sensitive to one cultured cell per reaction and produced standard curves that spanned several orders of magnitude. Due to primer competition between target RNA and IC RNA, the dynamic range of the IC NASBA assay for a given concentration of IC RNA w as limited to four orders of magnitude. However, inclusion of IC RNA is advantageous because it increases assay precision and provides an indicator of inhibition in the sample, thus preventing false negatives (Patterson et al., 2005; Ulrich et al., 2010) Neither assay detected any species outside the Pseudo nitzschia genus. Moreover, w ithin the Pseudo nitzschia genus the qRT PCR assay was specific to P. multiseries wh ile IC NASBA exhibited some cross reactivity with other species. The IC NASBA assay detected sequences with one or two mismatches in the beacon site (e.g. P. pungens and P. calliantha respectively), but did not detect one of the Gulf of Mexico isolates (L A2 S t C6C, three mismatches) or any of the P. delicatissima strains (five mismatches). The molecular beacon exhibited greater specificity than the primers under NASBA reaction conditions, due to the stability of the stem loop structure as described by Tyag i and Kramer (1996) ; however single nucleotide disc rimination was not possible with this assay. The

PAGE 74

! 65 qRT PCR assay discriminated a single mismatch, supporting the specificity of the TaqMan¨ probe to P. multiseries The most closely related species, P. pungens which had only one mismatch in the probe site, was not detected with as much as 10 9 copies of RNA transcript per reaction. Because of the low average GC content of the rbcS gene (38.5%), the primers had a low melting temperature, enabling the design of a low annealing temperature assay and a short prob e (17 bp). Short probes result in greater variability in melting temperature between matched and mismatched probes, enabling the discrimination of a single nucleotide as discussed by Kostina et al. (2007) Only the P. multiseries qRT PCR assay proved successful with field samples, effectively detecting cells spiked into natural seawater at concentrations ranging from 10 7 cells/L to 10 3 cells/L, which is the equivalent of 5 x 10 4 and 5 cells per reaction, respectively. The slope obtained from plotting calculated versus expected cells /L was very close to one (1.03 ), indicating good recovery of target cells and high specificity in complex natural samples This limit of detection cou ld be lowered further simply filtering larger volume s of seawater (> 50 mL) but is sufficient for early detection of most Pseudo nitzschia blooms. A study performed by Trainer and Suddleson (2005) defined the P. multiseries trigger concentration for initiation of particulate domoic acid measurements of seawater to be approximately 10 5 cells/L. A n IC NASBA assay suitable for the detection of the P. multiseries rbcS gene in environmental samples could not be achieved due to constraints on assay design and a lack of diversity i n the rbcS gene. Primer depletion caused by

PAGE 75

! 66 cross reactivity with unknown species was determined to be the cause of inhibition in the IC NASBA assay based on the results of the following two experiments : 1.) Upon size fractionation of an "inhibited" environmental sample into particles larger and smaller than 2.0 m, cells spiked into the <2.0 um filtrate were readily detected, while the larger fraction inhibited detection of both target cells and IC RNA; and 2.) When cells of P. multiseries and cultured cells of Karenia brevis were spiked into the same inhibited environmental sample, the K. brevis assay, previously designed in our lab (Casper et al., 2004) had uninhibited positive detection. T ogether, these results indicate that the inhibitors were within the size fraction comprising single celled eukaryotes and that they were cross reactive to the P. multiseries assay. Sequence data for the rbcS gene in marine diatoms also supports this conc lusion. Several attempt s were made to reduce primer competition by non target organisms in environmental samples P rimer concentrations were increased to a maximum of 1.6 M and both primers were later redesigned to include a few additional mismatches be tween Pseudo nitzschia and other marine diatoms. However, neither of these approaches resulted in a reduction of inhibition (data not shown). A highly specific primer set could not be designed due to high conservation within the rbcS gene. Additionally, a magnetic bead based sequence specific capture method was incorporated into the RNA extraction protocol to select for P. multiseries transcripts. The capture probe contained the same sequence as the molecular beacon, which was highly specific for Pseudo nit zschia based on the results of non target testing While high concentrations

PAGE 76

! 67 (10 6 cells/L) of P. multiseries were successfully detected assay sensitivity was lost due to low recovery by the beads. The variability in recovery observed in some bead hybridiz ation experiments also indicates the potential inability for reliable cell quantification using this method The increased occurrence of primer depletion in IC NASBA compared to qRT PCR may be attribut able to the relatively low isothermal temperature (41 ¡C) at which NASBA is conducted. H ybridization conditions are less stringent than in PCR, which incorporates high temperature ( 90 ¡C) melting cycles and variable annealing temperatures. Even though the molecular beacon can be very specific, the ideal IC NASBA target gene should exhibit a great deal of variation to avoid nonspecific primer binding in complex samples. Because quantification using these assays is based on rbcS copy number per cell at a given time, it is necessary to take variability of expression into account. We conducted an experiment to investigate the presence of any diel periodicity in rbcS gene expression by cultured cells of P. multiseries Ba sed on our results, expression wa s highest during early to mid photoperiod, with lowest being at night. This is in general agreement with studies measuring rbcL gene expression in diatom cultures, including Thalassiosira pseudonana (Granum et al., 2009) and Phaeodactylum tricornutum (Wawrik e t al., 2002) One study examining rbcL gene expression in natural populations of the Mississippi River plume found peak heterokont transcript abundance during morning hours; however this was not attributed solely to diatoms (John et al., 2007) Extraction of RNA for our experiments was typically done in th e morning, meaning that rbcS

PAGE 77

! 68 gene expression was at its maximum. It is important to note that any slight under or over estimation of actual cell concentration using assays based on the rbcS gene could be due to natural fluctuations in expression. However the observed range in expression levels over a diel cycle was far less than an order of magnitude, so this would not translate to large differences in calculated cell concentration. Further studies using Pseudo nitzschia cultures, as well as natural pop ulations, should be conducted to provide a better understanding of fluctuations in rbcS gene expression These studies can include (but are not limited to) comparing rbcS copy number per cell with growth phase, cell size nutrient status, and light exposure. Additionally, we observed a difference in expression between the same time point s on consecutive days that was not attributable to measurement error (Figure 20 ) This discrepancy could have been caused by a change in growth conditions, or it could have resulted from changes in expression due to frequent sampling of the culture Future studies can also involve replicate culture flasks sampled over a longer period of time ( i.e. several days) t o balance out such dispariti es The molecular discrimination of Pseudo nitzschia species, as in other diatom genera, has proven to be an extremely difficult task and insight into the complexity of this genus continues to grow w ith the increased amount of genetic data available IC NASBA and qRT PCR are both sensitive and rapid methods for the detection of harmful algal species like P. multiseries The amplification of RNA transcripts enables a low limit of detection for viable cells within a natural

PAGE 78

! 69 phytoplankton assemblage, providi ng early warning of a bloom before the potential accumulation of toxin. IC NASBA is advantageous, because its isothermal nature eliminates the need for complex thermocycling equipment and allows for easier integration into remote sensing platforms (i.e.: Casper et al., 2007) ; however PCR is more amenable to mod ification of reaction temperature Despite a lack of extensive diversity in the rbcS gene, it can be used as a genetic target in conjunction with molecular techniques that are able to discriminate regions of low diversi ty. The P. multiseries qRT PCR assay was specific and capable of detecting this species in spiked field samples over a wide range of concentrations, demonstrating its utility in the early detection of potentially toxic blooms.

PAGE 79

! 70 R EFERENCES AkŽ Castillo, J.A., Okolodkov, Y.B., 2009. Pseudo nitzschia subcurvata (Bacillariophyceae) in the Gulf of Mexico? Harmful Algae News 40, 6 7. Amato, A., Kooistra, W.H.C.F., Ghiron, J.H.L., Mann, D.G., Pršschold, T., Montresor, M., 2007. Rep roductive isolation among sympatric cryptic species in marine diatoms Protist 158, 193 207. Amato, A., Montresor, M., 2008. Morphology, phylogeny, and sexual cycle of Pseudo nitzschia mannii sp. nov. (Bacillariophyceae): a pseudo cryptic species within the P. pseudodelicatissima complex. Phycologia 47, 487 497. Amzil, Z., Fresnel, J., Le Gal, D., Billard, C., 2001. Domoic acid accumulation in French shellfish in relation to toxic species of Ps eudo nitzschia multiseries and P. pseudodelicatissima Toxicon 39, 1245 1251. Anderson, C.R., Brzezinski, M.A., Washburn, L., Kudela, R., 2006. Circulation and environmental conditions during a toxigenic Pseudo nitzschia australis bloom in the Santa Barbar a Channel, California. Mar. Ecol. Prog. Ser. 327, 119 133. Anderson, D.M., Bricelj, V.M., Cullen, J.J., Rensel, J.E., 2001. Monitoring and management strategies for harmful algal blooms in coastal waters. APEC #201 MR 01.1, Asia Pacific Economic Program, S ingapore, and Intergovernmental Oceanographic Commission Technical Series No. 59, Paris. AOAC, 2005a. Official Method 991.26, Official Methods of Analysis of AOAC International, 18th ed. AOAC International, Gaithersburg, MD, USA. AOAC, 2005b. Official Meth od 2006.02, Official Methods of Analysis of AOAC International, 18th ed. AOAC International, Gaithersburg, MD, USA.

PAGE 80

! 71 Badylak, S., Phlips, E.J., Baker, P., Fajans, J., Boler, R., 2007. Distributions of phytoplankton in Tampa Bay Estuary, U.S.A. 2002 2003 Bul l. Mar. Sci. 80, 295 317. Bargu, S., Powell, C.L., Coale, S.L., Busman, M., Doucette, G.J., Silver, M.W., 2002. Krill: a potential vector for domoic acid in marine food webs. Mar. Ecol. Prog. Ser. 237, 209 216. Bates, S.S., 1998. Ecophysiology and metaboli sm of ASP toxin production, In: Anderson, D.M., Cembella, A.D., Hallegraeff, G.M. (Eds.), Physiological ecology of harmful algal blooms Springer Verlag, Heidelberg, pp. 405 426. Bates, S.S., Bird, C.J., de Freitas, A.S.W., Foxall, R., Gilgan, M., Hanic, L. A., Johnson, G.R., McCulloch, A.W., Odense, P., Pocklington, R., Quilliam, M.A., Sim, P.G., Smith, J.C., Subba Rao, D.V., Todd, E.C.D., Walter, J.A., Wright, J.L.C., 1989. Pennate diatom Nitzschia pungens as the primary source of DA, a toxin in shellfish f rom eastern Prince Edward Island, Canada. Can. J. Fish. Aquat. Sci. 46, 1203 1215. Bates, S.S., Douglas, D.J., Doucette, G.J., LŽger, C., 1995a. Effects of reintroducing bacteria on domoic acid production by axenic cultures of the diatom Pseudonitzschia pu ngens f. multiseries In: Lassus, P., Arzul, G., Erard, E., Gentien, P., Marcaillou, C. (Eds.), Harmful marine algal blooms. Lavoisier Sci. Publ., Paris, pp. 401 406. Bates, S.S., Douglas, D.J., Doucette, G.J., LŽger, C., 1995b. Enhancement of Domoic Acid Production by Reintroducing Bacteria to Axenic Cultures of the Diatom Pseudo nitzschia multiseries Natural Toxins 3, 428 435. Bates, S.S., Freitas, A.S.W.d., Milley, J.E., Pocklington, R., Quilliam, M.A., Smith, J.C., Worms, J., 1991. Controls on domoic a cid production by the diatom Nitzschia pungens f. multiseries in culture: nutrients and irradiance Can. J. Fish. Aquat. Sci. 48, 1136 1144. Bates, S.S., Garrison, D.L., Horner, R.A., 1998. Bloom dynamics and physiology of domoic acid producing Pseudo nitzs chia species, In: Anderson, D.M., Cembella, A.D., Hallegraeff, G.M. (Eds.), Physiological Ecology of Harmful Algal Blooms. Springer Verlag, Heidelberg, pp. 267 292. Bates, S.S., Gaudet, J., Kaczmarska, I., Ehrman, J.M., 2004. Interaction between bacteria a nd the domoic acid producing diatom Pseudo nitzschia multiseries

PAGE 81

! 72 (Hasle) Hasle; can bacteria produce domoic acid autonomously? Harmful Algae 3, 11 20. Bates, S.S., LŽger, C., Keafer, B.A., Anderson, D.M., 1993a. Discrimination between domoic acid producing and nontoxic forms of the diatom Pseudo nitzschia pungens using immunofluorescence Mar. Ecol. Prog. Ser. 100, 185 195. Bates, S.S., Leger, C., Satchwell, M., Boyer, G.L., 2001. The effects of iron on domoic acid production by Pseudo nitzschia multiseries In: Hallegraeff, G.A., Blackburn, S.I., Bolch, C.J., Lewis, R.J. (Eds.), Harmful Algal Blooms 2000. Intergovernmental Oceanographic Commission of UNESCO, Paris, pp. 320 323. Bates, S.S., Leger, C., Smith, K.M., 1996. Domoic acid production by the diatom Ps eudo nitzschia multiseries as a function of division rate in silicate limited chemostat culture, In: Yasumoto, T., Oshima, Y., Fukuyo, Y. (Eds.), Harmful and Toxic Algal Blooms. Intergovernmental Oceanographic Commission of UNESCO, pp. 163 166. Bates, S.S. Scholin, C.A., Ferguson, M., LegŽr, C., 1999. Application of ribosomal RNA targeted probes to detect Pseudo nitzschia multiseries and P. pungens in Atlantic Canadian waters, In: Martin, J.L., Haya, K. (Eds.), Sixth Canadian Workshop on Harmful Marine Algae St. Andrews, NB, Canada. Bates, S.S., Trainer, V.L., 2006. The ecology of harmful diatoms In: GranŽli, E., Turner, J.T. (Eds.), Ecology of Harmful Algae. Springer Verlag, Berlin, pp. 81 93. Bates, S.S., Worms, J., Smith, J.C., 1993b. Effects of ammon ium and nitrate on domoic acid production by Nitzschia pungens in batch culture. Can. J. Fish. Aquat. Sci. 50, 1248 1254. Baxa, D.V., Kurobe, T., Ger, K.A., Lehman, P.W., Teh, S.J., 2010. Estimating the abundance of toxic Microcystis in the San Francisco E stuary using quantitative real time PCR. Harmful Algae 9, 342 349. Bejarano, A.C., Van Dolah, F.M., Gulland, F.M., Rowles, T.K., Schwacke, L.H., 2008. Production and toxicity of the marine biotoxin domoic acid and its effects on wildlife: A review. Hum. Ec ol. Risk Assess. 14, 544 567.

PAGE 82

! 73 Bornet, B., Antoine, E., Bardouil, M., Baut, C.M. L., 2004. ISSR as new markers for genetic characterization and evaluation of relationships among phytoplankton. J. Appl. Phycol. 16, 285 290. Bornet, B., Antoine, E., Franoise S., Baut, C.M. L., 2005. Development of sequence characterized amplified region markers from intersimple sequence repeat fingerprints for the molecular detection of toxic phytoplankton Alexandrium catenella (Dinophyceae) and Pseudo nitzschia pseudodelica tissima (Bacillariophyceae) from French coastal waters. J. Phycol. 41, 704 711. Bowers, H.A., Tengs, T., Glasgow Jr., H.B., Burkholder, J.M., Rublee, P.A., Oldach, D.W., 2000. Development of real time PCR assays for rapid detection of Pfiesteria piscicida and related dinoflagellates. Appl. Environ. Microbiol. 66, 4641 4648. Bowler, C., Vardi, A., Allen, A.E., 2010. Oceanographic and Biogeochemical Insights from Diatom Genomes. Annu. Rev. Mar. Sci. 2, 333 365. Busse, L.B., Venrick, E.L., Antrobus, R., Miller P.E., Vigilant, V., Silver, M.W., Mengelt, C., Mydlarz, L., Prezelin, B.B., 2006. Domoic acid in phytoplankton and fish in San Diego, CA, USA. Harmful Algae 5, 91 101. Cˆmpas, M., Prieto Sim—n, B., Marty, J. L., 2007. Biosensors to detect marine toxins: Assessing seafood safety Talanta 72, 884 895. Campbell, D., Kelly, M., 2001. ASP in king scallops. Shellfish News 11, 24 25. Campbell, D.A., Kelly, M.S., Busman, M., Bolch, C.J., Wiggins, E., Moeller, P.D.R., Morton, S.L., 2001. Amnesic shellfish poisoning in the king scallop, Pecten maximus from the west coast of Scotland. J. Shellfish Res. 20, 75 84. Campbell, D.A., Kelly, M.S., Busman, M., Wiggins, E., Fernandes, T.F., 2003. Impact of preparation method on gonad domoic acid levels in the scallop, Pecten maximus (L.). Harmful Algae 2, 215 222. Casper, E.T., Patterson, S.S., Bhanushali, P., Farmer, A., Fries, D.P., Paul, J.H., 2007. A handheld NASBA analyzer for the field detection and quantification of Karenia brevis Harmful Algae 6, 112 118.

PAGE 83

! 74 Casper, E.T. Paul, J.H., Smith, M.C., Gray, M., 2004. Detection and quantification of the red tide dinoflagellate Karenia brevis by Real Time Nucleic Acid Sequence Based Amplification. Appl. Environ. Microbiol. 70, 4727 4732. Casteleyn, G., Chepurnov, V.A., Leliaert, F., Mann, D.G., Bates, S.S., Lundholm, N., Rhodes, L., Sabbe, K., Vyverman, W., 2008. Pseudo nitzschia pungens (Bacillariophyceae): A cosmopolitan diatom species? Harmful Algae 7, 241 257. Chen, Y.B., Zehr, J.P., Mellon, M., 1996. Growth and nitrogen fixa tion of the diazotrophic filamentous nonheterocystous cyanobacterium Trichodesmium sp IMS 101 in defined media: Evidence for a circadian rhythm. J. Phycol. 32, 916 923. Chesnick, J.M., Morden, C.W., Schmieg, A.M., 1996. Identity of the endosymbiont of Peri dinium foliaceum (Pyrrophyta): Analysis of the rbcLS operon. J. Phycol. 32, 850 857. Coale, K.H., Johnson, K.S., Fitzwater, S.E., Gordon, R.M., Tanner, S., Chavez, F.P., Ferioli, L., Sakamoto, C., Rogers, P., Millero, F., Steinberg, P., Nightingale, P., Co oper, D., Cochlan, W.P., Landry, M.R., Constantinou, J., Rollwagen, G., Trasvina, A., Kudela, R., 1996. A massive phytoplankton bloom induced by an ecosystem scale iron fertilization experiment in the equatorial Pacific Ocean. Nature 383, 495 501. Compton, J., 1991. Nucleic acid sequence based amplification. Nature 350, 91 92. Costa, P.R., Garrido, S., 2004. Domoic acid accumulation in the sardine Sardina pilchardus and its relationship to Pseudo nitzschia diatom ingestion. Mar. Ecol. Prog. Ser. 284, 261 26 8. Costa, P.R., Rodrigues, S.M., Botelho, M.J., Sampayo, M.A.d.M., 2003. A potential vector of domoic acid: the swimming crab Polybius henslowii Leach (Decapoda brachyura). Toxicon 42, 135 141. Costa, P.R., Rosa, R., Duarte Silva, A., Brotas, V., Sampayo, M.A.M., 2005. Accumulation, transformation and tissue distribution of domoic acid, the amnesic shellfish poisoning toxin, in the common cuttlefish, Sepia officinalis Aquat. Toxicol. 74, 82 91.

PAGE 84

! 75 Couture, J.Y., Levasseur, M., Bonneau, E., Desjardins, C., Sua vŽ, G., Bates, S.S., LŽger, C., Gagnon, R., Michaud, S., 2001. Spatial and temporal variations of domoic acid in molluscs and of Pseudo nitzschia spp. blooms in the St. Lawrence from 1998 2000. Can. Tech. Rep. Fish. Aquat. Sci. 2375, 24. Coyne, K.J., Cary, S.C., 2005. Molecular approaches to the investigation of viable dinoflagellate cysts in natural sediments from estuarine environments. J. Eukaryot. Microbiol. 52, 90 94. D'Alelio, D., Amato, A., Kooistra, W.H.C.F., Procaccini, G., Casotti, R., Montresor, M., 2009. Internal Transcribed Spacer Polymorphism in Pseudo nitzschia multistriata (Bacillariophyceae) in the Gulf of Naples: Recent Divergence or Intraspecific Hybridization? Protist 160, 9 20. Del Rio, R., Bargu, S., Baltz, D., Fire, S., Peterson, G., W ang, Z., 2010. Gulf menhaden ( Brevoortia patronus ): A potential vector of domoic acid in coastal Louisiana food webs. Harmful Algae 10, 19 29. DeLong, E.F., Wickham, G.S., Pace, N.R., 1989. Phylogenetic stains: ribosomal RNA based probes for the identifica tion of single cells. Science 243, 1360 1363. Dickey, R.W., Fryxell, G.A., Grande, H.R., Roelke, D., 1992. Detection of marine toxin okadaic acid and domoic acid in shellfish and phytoplankton in Gulf of Mexico. Toxicon 30, 355 359. Diercks, S., Metfies, K ., Medlin, L.K., 2008a. Molecular probe sets for the detection of toxic algae for use in sandwich hybridization formats. J. Plankton Res. 30, 439 448. Diercks, S., Metfies, K., Schroder, F., Medlin, L.K., Colijn, F., 2008b. Detection of Phytoplankton with Nucleic Acid Sensors, In: Evangelista, V., Barsanti, L., Frassanito, A.M., Passarelli, V., Gualtieri, P. (Eds.), Algal Toxins: Nature, Occurrence, Effect and Detection. Springer, London, pp. 285 299. Dortch, Q., Robichaux, R., Pool, S., Milsted, D., Mire, G., Rabalais, N.N., Soniat, T.M., Fryxell, G.A., Turner, R.E., Parsons, M.L., 1997. Abundance and vertical flux of Pseudo nitzschia in the northern Gulf of Mexico. Mar. Ecol. Prog. Ser. 146, 249 264.

PAGE 85

! 76 Doucette, G.J., Mikulski, C.M., Jones, K.L., King, K.L. Greenfield, D.I., Marin III, R., Jensen, S., Roman, B., Elliott, C.T., Scholin, C.A., 2009. Remote, subsurface detection of the algal toxin domoic acid onboard the Environmental Sample Processor: Assay development and field trials. Harmful Algae 8, 880 8 88. Douglas, D.J., Bates, S.S., 1992. Production of domoic acid, a neurotoxic amino acid, by an axenic culture of the marine diatom Nitzschia pungens f. multiseries Hasle. Can. J. Fish. Aquat. Sci. 49, 85 90. Douglas, D.J., Bates, S.S., Bourque, L.A., Selv in, R.C., 1993. Domoic acid production by axenic and non axenic cultures of the pennate diatom Nitzschia pungens f. multiseries In: Smayda, T.J., Shimizu, Y. (Eds.), Toxic Phytoplankton Blooms in the Sea. Elsevier, Amsterdam, pp. 595 600. Douglas, D.J., R amsey, U.P., Walter, J.A., Wright, J.L.C., 1992. Biosynthesis of the neurotoxin domoic acid by the marine diatom Nitzschia pungens forma multiseries determined with [13C] labelled precursors and nuclear magnetic resonance. J. Chem. Soc. Chem. Comm. 9, 714 716. Ellis, R.J., 1979. Most abundant protein in the world. Trends Biochem.Sci. 4, 241 244. Evans, K.M., Bates, S.S., Medlin, L.K., Hayes, P.K., 2004. Microsatellite marker development and genetic variation in the toxic marine diatom Pseudo nitzschia multiseries (Bacillariophyceae). J. Phycol. 40, 911 920. Evans, K.M., Hayes, P.K., 2004. Microsatellite markers for the cosmopolitan marine diatom Pseudo nitzschia pungens Mol. Ecol. Notes 4, 125 126. Evans, K.M., Wortley, A.H., Mann, D.G ., 2007. An assessment of potential diatom "barcode" genes ( cox 1, rbcL 18S, and ITS rDNA) and their effectiveness in determining relationships in Sellaphora (Bacillariophyta). Protist 158, 349 364. Fehling, J., Davidson, K., Bolch, C.J., Bates, S.S., 2004 Growth and domoic acid production by Pseudo nitzschia seriata (Bacillariophyceae) under phosphate and silicate limitation. J. Phycol. 40, 674 683. Ferdin, M.E., Kvitek, R.G., Bretz, C.K., Powell, C.L., Doucette, G.J., Lefebvre, K.A., Coale, S., Silver, M .W., 2002. Emerita analoga (Stimpson) possible new

PAGE 86

! 77 indicator species for the phycotoxin domoic acid in California coastal waters. Toxicon 40, 1259 1265. Fire, S.E., Wang, Z., Leighfield, T.A., Morton, S.L., McFee, W.E., McLellan, W.A., Litaker, R.W., Teste r, P.A., Hohn, A.A., Lovewell, G., Harms, C., Rotstein, D.S., Barco, S.G., Costidis, A., Sheppard, B., Bossart, G.D., Stolen, M., Durden, W.N., Van Dolah, F.M., 2009. Domoic acid exposure in pygmy and dwarf sperm whales ( Kogia spp.) from southeastern and m id Atlantic U.S. waters. Harmful Algae 8, 658 664. Fitzpatrick, E., Caron, D.A., Schnetzer, A., 2010. Development and environmental application of a genus specific quantitative PCR approach for Pseudo nitzschia species. Mar. Biol. 157, 1161 1169. Fritz, L. Quilliam, M.A., Wright, J.L.C., Beale, A.M., Work, T.M., 1992. An outbreak of domoic acid poisoning attributed to the pennate diatom Pseudonitzschia australis J. Phycol. 28, 439 442. Fryxell, G.A., Reap, M.E., Valencic, D.L., 1990. Nitzschia pungens Gru now f. multiseries Hasle: Observations of a known neurotoxic diatom. Nova Hedwigia 100, 171 188. Gallacher, S., Howard, G., Hess, P., MacDonald, E., Kelly, M.C., Bates, L.A., Brown, N., MacKenzie, M., Gillibrand, P., Turrell, W.R., 2001. The occurrence of amnesic shellfish poisons in shellfish from Scottish waters, In: Hallegraeff, G.A., Blackburn, S.I., Bolch, C.J., Lewis, R.J. (Eds.), Harmful Algal Blooms 2000. Intergovernmental Oceanographic Commission of UNESCO, Paris, pp. 30 33. Galluzzi, L., Penna, A. Bertozzini, E., Vila, M., Garces, E., Magnani, M., 2004. Development of a real time PCR assay for rapid detection and quantification of Alexandrium minutum (a Dinoflagellate). Appl. Environ. Microbiol. 70, 1199 1206. Garrison, D.L., Conrad, S.M., Eilers, P.P., Waldron, E.M., 1992. Confirmation of domoic acid production by Pseudo nitzschia australis (Bacillariophyceae) cultures. J. Phycol. 28, 604 607. Ghinaglia, L.T., Herrera Silveira, J.A., Com’n, F.A., 2004. Structural variations of phytoplankton in the coastal seas of Yucatan, Mexico. Hydrobiologia 519, 85 102.

PAGE 87

! 78 Gilgan, M.W., Burns, B.G., Landry, G.J., 1990. Distribution and magnitude of domoic acid contamination of shellfish in Atlantic Canada during 1988, In: Graneli, E., Anderson, D.M., Edler, L., Sun dstrom, B. (Eds.), Toxic Marine Phytoplankton. Elsevier, New York, pp. 469 474. Goldstein, T., Mazet, J.A.K., Zabka, T.S., Langlois, G., Colegrove, K.M., Silver, M., Bargu, S., Van Dolah, F., Leighfield, T., Conrad, P.A., Barakos, J., Williams, D.C., Denni son, S., Haulena, M., Gulland, F.M.D., 2008. Novel symptomatology and changing epidemiology of domoic acid toxicosis in California sea lions ( Zalophus californianus ): an increasing risk to marine mammal health. Proc. Roy. Soc. B 275, 267 276. Granum, E., R oberts, K., Raven, J.A., Leegood, R.C., 2009. Primary carbon and nitrogen metabolic gene expression in the diatom Thalassiosira pseudonana (Bacillariophyceae): Diel periodicity and effects of inorganic carbon and nitrogen. J. Phycol. 45, 1083 1092. Gray, M ., Wawrik, B., Paul, J., Casper, E., 2003. Molecular detection and quantitation of the red tide dinoflagellate Karenia brevis in the marine environment. Appl. Environ. Microbiol. 69, 5726 5730. Greenfield, D.I., Marin III, R., Doucette, G.J., Mikulski, C., Jones, K., Jensen, S., Roman, B., Alvarado, N., Feldman, J., Scholin, C., 2008. Field applications of the second generation Environmental Sample Processor (ESP) for remote detection of harmful algae: 2006 2007. Limnol. Oceanogr. Methods 6, 667 679. Green field, D.I., Marin III, R., Jensen, S., Massion, E., Roman, B., Feldman, J., Scholin, C.A., 2006. Application of environmental sample processor (ESP) methodology for quantifying Pseudo nitzschia australis using ribosomal RNA targeted probes in sandwich and fluorescent in situ hybridization formats. Limnol. Oceanogr. Meth. 4, 426 435. Guillard, R.R.L., 1960. A mutant of Chlamydomonas moewusii lacking contractile vacuoles. J. Protozool. 7, 262 268. Guillard, R.R.L., 1975. Culture of phytoplankton for feeding marine invertebrates, In: Smith, W.L., Chanley, M.H. (Eds.), Culture of Marine Invertebrate Animals. Plenum Press, New York, pp. 26 60. Guillard, R.R.L., Hargraves, P.E., 1993. Stichochrysis immobilis is a diatom, not a chrysophyte. Phycologia 32, 234 236.

PAGE 88

! 79 Guillard, R.R.L., Ryther, J.H., 1962. Studies of marine planktonic diatoms. I. Cyclotella nana Hustedt and Detonula confervacea Cleve. Can. J. Microbiol. 8, 229 239. Gulland, F., 2000. Domoic acid toxicity in California sea lions ( Zalophus californianus ) stranded along the central California coast, May October 1998, Report to the National Marine Fisheries Service Working Group on Unusual Marine Mammal Mortality Events. U.S. Dep. Commer., NOAA Tech. Memo, p. 45. Gulland, F.M.D., 2006. Review of the Marine M ammal Unusual Mortality Event Response Program of the National Marine Fisheries Services. U. S. Dept of Commerce, NOAA Tech. Memo., p. 37. Handy, S.M., Coyne, K.J., Portune, K.J., Demir, E., Doblin, M.A., Hare, C.E., Cary, S.C., Hutchins, D.A., 2005. Evalu ating vertical migration behavior of harmful raphidophytes in the Delaware Inland Bays utilizing quantitative real time PCR. Aquat. Microb. Ecol. 40, 121 132. Handy, S.M., Hutchins, D.A., Cary, S.C., Coyne, K.J., 2006. Simultaneous enumeration of multiple raphidophyte species by quantitative real time PCR: capabilties and limitations. Limnol. Oceanogr. Methods 4, 193 204. Hasle, G.R., 1972. The distribution of Nitzschia seriata (Cleve) and allied species. Nova Hedwigia 39, 171 190. Hasle, G.R., 1994. Pseudo nitzschia as a genus distinct from Nitzschia (Bacillariophyceae). J. Phycol. 30, 1036 1039. Hasle, G.R., 2002. Are most of the domoic acid producing species of the diatom genus Pseudo nitzschia cosmopolites? Harmful Algae 1, 137 146. Hasle, G.R., Lu ndholm, N., 2005. Pseudo nitzschia seriata f. obtusa (Bacillariophyceae) raised in rank based on morphological, phylogenetic and distributional data. Phycologia 44, 608 619. Holtermann, K.E., Bates, S.S., Trainer, V.L., Odell, A., Armbrust, E.V., 2010. Mas s sexual reproduction in the toxigenic diatoms Pseudo nitzschia australis and P. pungens (Bacillariophyceae) on the Washington coast, USA. J. Phycol. 46, 41 52.

PAGE 89

! 80 Horner, R.A., Garrison, D.L., Plumley, F.G., 1997. Harmful Algal Blooms and Red Tide Problems o n the U.S. West Coast. Limnol. Oceanogr. 42, 1076 1088. Horner, R.A., Postel, J.R., 1993. Toxic diatoms in western Washington waters (U.S. west coast). Hydrobiologia 269/270, 197 205. Howard, M.D.A., Cochlan, W.P., Ladizinksky, N., Kudela, R.M., 2007. Nitr ogenous preference of toxigenic Pseudo nitzschia australis (Bacillariophyceae) from field and laboratory experiments Harmful Algae 6, 206 217. Hubbard, K.A., Rocap, G., Armbrust, E.V., 2008. Inter and intraspecific community structure within the diatom ge nus Pseudo nitzschia (Bacillariophyceae). J. Phycol. 44, 637 649. Humbert, J.F., Quiblier, C., Gugger, M., 2010. Molecular approaches for monitoring potentially toxic marine and freshwater phytoplankton species. Anal. Bioanal. Chem. 397, 1723 1732. Hwang, S. R., Tabita, F.R., 1991. Cotranscription, deduced primary structure, and expression of the chloroplast encoded rbcL and rbcS genes of the marine diatom Cylindrotheca sp. strain N1. J. Biol. Chem. 266, 6271 6279. Hwang, S.R., Tabita, F.R., 1989. Cloning a nd expression of the chloroplast encoded rbcL and rbcS genes from the marine diatom Cylindrotheca sp. strain N1. Plant Mol.Biol. 13, 69 79. Jeffery, B., Barlow, T., Moizer, K., Paul, S., Boyle, C., 2004. Amnesic shellfish poison. Food Chem. Toxicol. 42, 54 5 557. John, D.E., Wang, Z.A., Liu, X., Byrne, R.H., Corredor, J.E., L—pez, J.M., Cabrera, A., Bronk, D.A., Tabita, F.R., Paul, J.H., 2007. Phytoplankton carbon fixation gene (RuBisCO) transcripts and air sea CO2 flux in the Mississippi River plume. ISME 1 517 531. Kaniou Grigoriadou, I., Mouratidou, T., Katikou, P., 2005. Investigation on the presence of domoic acid in Greek shellfish. Harmful Algae 4, 717 723.

PAGE 90

! 81 Keller, M.D., Guillard, R.R.L., 1985. Factors significant to marine diatom culture, In: Anderso n, D.M., White, A.W., Baden, D.G. (Eds.), Toxic Dinoflagellates. Elsevier, New York, pp. 113 116. Keller, M.D., Selvin, R.C., 1987. Media for the culture of oceanic ultrapytoplankton. J. Phycol. 23, 633 638. Kobayashi, K., Takata, Y., Kodama, M., 2009. Dir ect contact between Pseudo nitzschia multiseries and bacteria is necessary for the diatom to produce a high level of domoic acid. Chem. Biochem. 75, 771 776. Kostina, E.V., Ryabinin, V.A., Maksakova, G.A., Sinyakov, A.N., 2007. TaqMan probes based on oligo nucleotide hairpin minor groove binder conjugates. Russ. J. Bioorg. Chem. 33, 614 616. Kreuder, C., Miller, M.A., Jessup, D.A., Lowenstine, L.J., Harris, M.D., Ames, J.A., Carpenter, T.E., Conrad, P.A., Mazet, J.A.K., 2003. Patterns of mortality in southe rn sea otters ( Enhydra lutris nereis ) from 1998 2001. J. Wildlife Dis. 39, 495 509. Kudela, R., Roberts, A., Armstrong, M., 2003. Laboratory analyses of nutrient stress and toxin production in Pseudo nitzschia spp. from Monterey Bay, California, In: Steidi nger, K.A., Landsberg, J.H., Tomas, C.R., Vargo, G.A. (Eds.), Harmful Algae 2002. Florida and Wildlife Conservation Commission, Florida Institute of Oceanography, and Intergovernmental Oceanographic Commission of UNESCO, St. Pete Beach, FL, pp. 136 138. Le febvre, K.A., Bargu, S., Kieckhefer, T., Silver, M.W., 2002a. From sanddabs to blue whales: the pervasiveness of domoic acid. Toxicon 40, 971 977. Lefebvre, K.A., Dovel, S.L., Silver, M.W., 2001. Tissue distribution and neurotoxic effects of domoic acid in a prominent vector species, the northern anchovy, Engraulis mordax Mar. Biol. 138, 693 700. Lefebvre, K.A., Powell, C.L., Busman, M., Doucette, G.J., Moeller, P.D.R., Silver, J.B., Miller, P.E., Hughes, M.P., Singaram, S., Silver, M.W., Tjeerdema, R.S., 1999. Detection of Domoic Acid in Northern Anchovies and California Sea Lions Associated with an Unusual Mortality Event. Nat. Toxins 7, 85 92.

PAGE 91

! 82 Lefebvre, K.A., Robertson, A., 2010. Domoic acid and human exposure risks: A review. Toxicon 56, 218 230. Lefebv re, K.A., Silver, M.W., Coale, S.L., Tjeerdema, R.S., 2002b. Domoic acid in planktivorous fish in relation to toxic Pseudo nitzschia cell densities. Mar. Biol. 140, 625 631. Leone, G., van Schijndel, H., van Gemen, B., Kramer, F.R., Schoen, C.D., 1998. Mol ecular beacon probes combined with amplification by NASBA enable homogenous, real time detection of RNA. Nuc. Acids Res. 26, 2150 2155. Liefer, J.D., MacIntyre, H.L., Novovesk‡, L., Smith, W.L., Dorsey, C.P., 2009. Temporal and spatial variability in Pseud o nitzschia spp. in Alabama coastal waters: A "hot spot" linked to submarine groundwater discharge? Harmful Algae 8, 706 714. Livak, K.J., Flood, S.J.A., Marmaro, J., Giusti, W., Deetz, K., 1995. Oligonucleotides with fluorescent dyes at opposite ends prov ide a quenched probe system useful for detecting PCR product and nucleic acid hybridization. PCR Methods Appl. 4, 357 362. L—pez Rivera, A., Pinto, M., Insinilla, A., Isla, B.S., Uribe, E., Alvarez, G., Lehane, M., Furey, A., James, K.J., 2009. The occurrence of domoic acid linked to a toxic diatom bloom in a new potential vector: The tunicate Pyura chilensis (piure). Toxicon 54, 754 762. Lundholm, N., Andersen, P., Jrgensen, K., Thorbjrnsen, B.R., Cembella, A., Krock, B., 2005a. Domoic acid in Danish blue mussels due to a bloom of Pseudo nitzschia seriata Harmful Algae News 29, 8 10. Lundholm, N., Daugbjerg, N., Moestrup, ., 2002a. Phylogeny of the Bacillariaceae with emphasis on the genus Pseudo nitzschia (Bacillariophyceae) based on partial LSU rDNA data. Eur. J. Phycol. 37, 115 134. Lundholm, N., Hansen, P.J., Kotaki, Y., 2005b. Lack of allelopathic effects of the domoic acid producing marine diatom Pseudo nitzschia multiseries Mar. Ecol. Prog. Ser. 288, 21 33. Lundholm, N., Hasle, G.R., Fryxell, G.A., Hargraves, P.E., 2002b. Morphology, phylogeny, and taxonomy of species within the Pseudo nitzschia americana

PAGE 92

! 83 complex (Ba cillariophyceae) with descriptions of two new species, Pseudo nitzschia brasiliana and Pseudo nitzschia linea J. Phycol. 41, 480 497. Lundholm, N., Moestrup, ., 2002. The marine diatom Pseudo nitzschia galaxiae sp. nov. (Bacillariophyceae): morphology an d phylogenetic relationships. Phycologia 41, 594 605. Lundholm, N., Moestrup, ., Hasle, G.R., Hoef Emden, K., 2003. A study of the Pseudo nitzschia pseudodelicatissima/cuspidata complex (Bacillariophyceae): What is P. pseudodelicatissima ? J. Phycol. 39, 7 97 813. Lundholm, N., Moestrup, ., Kotaki, Y., Hoef Emden, K., Sholin, C., Miller, P., 2006. Inter and intraspecific variation of the Pseudo nitzschia delicatissima complex (Bacillariophyceae) illustrated by rRNA probes, morphological data and phylogenet ic analyses. J. Phycol. 42, 464 481. Lundholm, N., Skov, J., 1993. Pseudonitzschia pseudodelicatissima ... in Scandinavian coastal waters. Harmful Algae News 5, 4. Maldonado, M.T., Hughes, M.P., Rue, E.L., Wells, M.L., 2002. The effect of Fe and Cu on growt h and domoic acid production by Pseudo nitzschia multiseries and Pseudo nitzschia australis Limnol. Oceanogr. 47, 515 526. Mann, D.G., 1999. The species concept in diatoms. Phycologia 38, 437 495. Marchetti, A., Sherry, N.D., Kiyosawa, H., Tsuda, A., Harr ison, P.J., 2006. Phytoplankton processes during a mesoscale iron enrichment in the NE subarctic Pacific: Part I Biomass and assemblage. Deep Sea Research II 53, 2095 2113. Marchetti, A., Trainer, V.L., Harrison, P.J., 2004. Environmental conditions and ph ytoplankton dynamics associated with Pseudo nitzschia abundance and domoic acid in the Juan de Fuca eddy. Mar. Ecol. Prog. Ser. 281, 1 12. Martin, J.L., Haya, K., Burridge, L.E., Wildish, D.J., 1990. Nitzschia pseudodelicatissima a source of domoic aicd in the Bay of Fundy, eastern Canada. Mar. Ecol. Prog. Ser. 67, 177 182.

PAGE 93

! 84 McDonald, S.M., Sarno, D., Zingone, A., 2007. Identifying Pseudo nitzschia species in natural samples using genus specific PCR primers and clone libraries Harmful Algae 6, 849 860. Mig uez, A., Fernandez, M.L., Fraga, S., 1996. First detection of domoic acid in Galicia (NW of Spain), In: Yasumoto, T., Oshima, Y., Fukuyo, Y. (Eds.), Harmful and Toxic Algal Blooms. Intergovernmental Oceanographic Commission, UNESCO, Paris, pp. 143 145. Mil ler, P.E., Scholin, C.A., 1996. Identification of cultured Pseudo nitzschia (Bacillariophyceae) using species specific LSU rRNA targeted fluorescent probes. J. Phycol. 32, 646 655. Miller, P.E., Scholin, C.A., 1998. Identification and enumeration of cultur ed and wild Pseudo nitzschia (Bacillariophyceae) using species specific LSU rRNA targeted fluorescent probes and filter based whole cell hybridization J. Phycol. 34, 371 382. Moniz, M.B.J., Kaczmarska, I., 2010. Barcoding of Diatoms: Nuclear Encoded ITS Re visited. Protist 161, 7 34. Mos, L., 2001. Domoic acid: a fascinating marine toxin. Environ. Toxicol. Pharm. 9, 79 85. Nassif, J., Timperi, R.J., 1991. Massachusetts Marine Biotoxin Monitoring Project FDA/PHS/HHS No. 223 89 4064 Interim Report, November 19 89 March 1991. Ness, J.V., Chen, L., 1991. The use of oligonucleotide probes in chaotrope based hybridization solutions. Nuc. Acids Res. 19, 5143 5151. Ness, J.V., Kalbfleisch, S., Petrie, C.R., Reed, M.W., Tabone, J.C., Vermeulen, N.M.J., 1991. A versatil e solid support system for oligonucletodie probe based hybridization assays. Nuc. Acids Res. 19, 3345 3350. Nezan, E., Antoine, E., Fiant, L., Amzil, Z., Billard, C., 2006. Identification of Pseudo nitzschia australis and P. multiseries in the Bay of Seine. Was there a relation to presence of domoic acid in king scallops in autumn 2004? Harmful Algae News 31, 1 3.

PAGE 94

! 85 NMFS, 2004. Interim report on the bottlenose dolphin ( Tursiops truncatus ) unusual mortality event along the panhandle of Florida March April 2004, Silver Spring, MD, USA. Orsini, L., Procaccini, G., Sarno, D., Montresor, M., 2004. Multiple rDNA ITS types within the diatom Pseudo nitzschia delicatissima (Bacillariophyceae) and their relative abundances across a spring bloom in the Gulf of Naple s. Mar. Ecol. Prog. Ser. 271, 87 98. Orsini, L., Sarno, D., Procaccini, G., Poletti, R., Dahlmann, J., Montresor, M., 2002. Toxic Pseudo nitzschia multistriata (Bacillariophyceae) from the Gulf of Naples: morphology, toxin analysis and phylogenetic relatio nships with other Pseudo nitzschia species. Eur. J. Phycol. 37, 247 257. Osada, M., Stewart, J.E., 1997. Gluconic acid/gluconolactone: physiological influences on domoic acid production by bacteria associated with Pseudo nitzschia multiseries Aquat. Microb Ecol. 12, 203 209. Pan, Y., Parsons, M.L., Busman, M., Moeller, P.D.R., Dortch, Q., Powell, C.L., Doucette, G.J., 2001. Pseudo nitzschia sp. cf. pseudodelicatissima a confirmed producer of domoic acid from the northern Gulf of Mexico. Mar. Ecol. Prog. Ser. 220, 83 92. Pan, Y., Subba Rao, D.V., Mann, K.H., 1996a. Changes in domoic acid production and cellular chemical composition of the toxigenic diatom Pseudo nitzschia multiseries under phosphate limitation. J. Phycol. 32, 371 381. Pan, Y., Subba Rao, D .V., Mann, K.H., Brown, R.G., Pocklington, R., 1996b. Effects of silicate limitation on production of domoic acid, a neurotoxin, by the diatom Pseudo nitzschia multiseries. I. Batch culture studies. Mar. Ecol. Prog. Ser. 131, 225 233. Pan, Y., Subba Rao, D .V., Mann, K.H., Li, W.K.W., Harrison, W.G., 1996c. Effects of silicate limitation on production of domoic acid, a neurotoxin, by the diatom Pseudo nitzschia multiseries II. Continuous culture studies. Mar. Ecol. Prog. Ser. 131, 235 243. Park, T. G., de S alas, M.F., Bolch, C.J.S., Hallegraeff, G.M., 2007. Development of a real time PCR probe for quantification of the heterotrophic dinoflagellate Cryptoperidiniopsis brodyi (Dinophyceae) in environmental samples. Appl. Environ. Microbiol. 73, 2552 2560.

PAGE 95

! 86 Pars ons, M.L., Dortch, Q., Turner, E.E., 2002. Sedimentological evidence of an increase in Pseudo nitzschia (Bacillariophyceae) abundance in response to coastal eutrophication Limnol. Oceanogr. 47, 551 558. Parsons, M.L., Scholin, C.A., Miller, P.E., Doucette, G.J., Powell, C.L., Fryxell, G.A., Dortch, Q., Soniat, T.M., 1999. Pseudo nitzschia species (Bacillariophyceae) in Louisiana coastal waters: Molecular probe field trials, genetic variability, and domoic acid analyses. J. Phycol. 35, 1368 1378. Patterson, S.S., Casper, E.T., Garcia Rubio, L., Smith, M.C., Paul, J.H., 2005. Increased precision of microbial RNA quantification using NASBA with an internal control J. Microbiol. Meth. 60, 343 352. Paul, J.H., Pichard, S.L., 1995. Extraction of DNA and RNA from a quatic environments, In: Trevors, J.D., Elsas, J.D.V. (Eds.), Nucleic Acids in the Environment: Methods and Applications. Springer Verlag, pp. 153 177. Penna, A., Galluzzi, L., 2008. PCR Techniques as Diagnostic Tools for the Identification and Enumeration of Toxic Marine Phytoplankton Species, In: Evangelista, V., Barsanti, L., Frassanito, A.M., Passarelli, V., Gualtieri, P. (Eds.), Algal Toxins: Nature, Occurrence, Effect and Detection. Springer, London, pp. 261 283. Perl, T.M., Bedard, L., Kosatsky, T., Hockin, J.C., Todd, E.C.D., Remis, R.S., 1990. An outbreak of toxic encephalopathy caused by eating mussels contaminated with domoic acid. N. Eng. J. Med. 322, 1775 1780. Popels, L.C., Cary, S.C., Hutchins, D.A., Forbes, R., Pustizzi, F., Gobler, C.J., Co yne, K.J., 2003. The use of quantitative polymerase chain reaction for the detection and enumeration of the harmful alga Aureococcus anophagefferens in environmental samples along the United States East Coast. Limnol. Oceanogr. Methods 1, 92 102. Powell, C .L., Ferdin, M.E., Busman, M., Kvitek, R.G., Doucette, G.J., 2002. Development of a protocol for determination of domoic acid in the sand crab ( Emerita analoga ): a possible new indicator species. Toxicon 40, 485 492. Quijano Scheggia, S.I., GarcŽs, E., Lun dholm, N., Moestrop, ., Andree, K., Camp, J., 2009. Morphology, physiology, molecular phylogeny and sexual compatibility of the cryptic Pseudo nitzschia delicatissima complex

PAGE 96

! 87 (Bacillariophyta), including the description of P. arenysensis sp. nov. Phycolog ia 48, 492 509. Ramsey, U.P., Douglas, D.J., Walter, J.A., Wright, J.L.C., 1998. Biosynthesis of domoic acid by the diatom Pseudo nitzschia multiseries Nat. Toxins 6, 137 146. Reap, M.E., 1991. Nitzschia pungens f. multiseries : growth phases and toxicity of clonal cultures isolated from Galveston Bay, Texas. Texas A&M University, p. 78. Rhodes, L., Scholin, C., Garthwaite, I., 1998a. Pseudo nitzschia in New Zealand and the role of DNA probes and immunoassays in refining marine biotoxin monitoring programme s. Nat. Toxins 6, 105 111. Rhodes, L., Scholin, C., Garthwaite, I., Haywood, A., Thomas, A., 1998b. Domoic acid producing Pseudo nitzschia species educed by whole cell DNA probe based and immunochemical assays, In: Reguera, B., Blanco, J., Fernandez, M.L., Wyatt, T. (Eds.), Harmful Algae. Xunta de Galicia and Intergovernmental Oceanographic Commission of UNESCO, pp. 274 277. Rhodes, L., Scholin, C., Tyrrell, J., Adamson, J., Todd, K., 2001. The integration of DNA probes into New Zealand's routine phytoplank ton monitoring programmes, In: Hallegraeff, G.M., Blackburn, S.I., Bolch, C.J., Lewis, R.J. (Eds.), Harmful Algal Blooms 2000. Intergovernmental Oceanographic Commission of UNESCO, Paris, pp. 429 432. Rhodes, L.L., 1998. Identification of potentially toxic Pseudo nitzschia (Bacillariophyceae) in New Zealand coastal waters, using lectins. New Zeal. J. Mar. Fresh. 32, 537 544. Rhodes, L.L., Holland, P.T., Adamson, J.E., McNabb, P., Selwood, A.I., 2003. Production of a new isomer of domoic acid by New Zealand isolates of the diatom Pseudo nitzschia australis In: Villalba, A., Regura, B., Romalde, J., Beiras, R. (Eds.), Molluscan Shellfish Safety. Xunta de Galicia & IOC of UNESCO, Santiago de Compostela, Spain, pp. 43 48. Rue, E., Bruland, K., 2001. Domoic acid binds iron and copper: a possible role for the toxin produced by the marine diatom Pseudo nitzschia Mar. Chem. 76, 127 134.

PAGE 97

! 88 Sarthou, G., Timmermans, K.R., Blain, S., TrŽguer, P., 2005. Growth physiology and fate of diatoms in the ocean: a review J. Sea R es. 53, 25 42. Schnetzer, A., Miller, P.E., Schaffner, R.A., Stauffer, B.A., Jones, B.H., Weisberg, S.B., DiGiacomo, P.M., Berelson, W.M., Caron, D.A., 2007. Blooms of Pseudo nitzschia and domoic acid in the San Pedro Channel and Los Angeles harbor areas o f the Southern California Bight, 2003 2004. Harmful Algae 6, 372 387. Scholin, C., Doucette, G., Jensen, S., Roman, B., Pargett, D., Marin III, R., Preston, C., Jones, W., Feldman, J., Everlove, C., Harris, A., Alvarado, N., Massion, E., Birch, J., Greenfi eld, D., Vrijenhoek, R., Mikulski, C., Jones, K., 2009. Remote detection of marine microbes, small invertebrates, harmful algae, and biotoxins using the Environmental Sample Processor (ESP). Oceanography 2, 158 167. Scholin, C.A., Buck, K.R., Britschgi, T. I., Cangelosi, G.I., Chavez, F.P., 1996. Identification of Pseudo nitzschia australis (Bacillariophyceae) using rRNA targeted probes in whole cell and sandwich hybridization formats. Phycologia 35, 190 197. Scholin, C.A., Gulland, F., Doucette, G.J., Benso n, S., Busman, M., Chavez, F.P., Cordaro, J., DeLong, R., De Vogelaere, A., Harvey, J., Haulena, M., Lefebvre, K., Lipscomb, T., Loscutoff, S., Lowenstine, L.J., Marin III, R., Miller, P.E., McLellan, W.A., Moeller, P.D.R., Powell, C.L., Rowles, T., Silvag ni, P., Silver, M., Spraker, T., Trainer, V., Van Dolah, F.M., 2000. Mortality of sea lions along the central California coast linked to a toxic diatom bloom. Nature 403, 80 84. Scholin, C.A., Marin III, R., Miller, P.E., Doucette, G.J., Powell, C.L., Hayd ock, P., Howard, J., Ray, J., 1999. DNA probes and a receptor binding assay for detection of Pseudo nitzschia (Bacillariophyceae) species and domoic acid activity in cultured and natural samples. J. Phycol. 35, 1356 1367. Scholin, C.A., Miller, P., Buck, K., Chavez, F., Harris, P., Haydock, P., Howard, J., Cangelosi, G., 1997. Detection and quantification of Pseudo nitzschia australis in cultured and natural populations using LSU rRNA targeted probes. Limnol. Oceanogr. 42, 1265 1272.

PAGE 98

! 89 Sierra Beltr‡n, A., Palafox Uribe, P., Grajales Montiel, J., Cruz Villacorta, A., Ochoa, J.L., 1997. Sea bird mortality at Cairo San Lucas, Mexico: evidence that toxic diatom blooms are spreading. Toxicon 35, 447 453. Sierra Beltr‡n, A.P., CortŽ s Altamirano, R., Gallo Reynoso, J.P., Licea Duran, S., ƒgido Villarreal, J., 2005. Is Pseudo nitzschia pseudodelicatissima toxin the principal cause of sardines, dolphins, sea lions and pelicans mortality in 2004 in Mexico? Harmful Algae News 29, 6 8. Sie rra Beltr‡n, A.P., Cruz, A., Nunez, E., Del Villar, L.M., Cerecero, J., Ochoa, J.L., 1998. An overview of the marine food poisoning in Mexico. Toxicon 36, 1493 1502. Skov, J., Lundholm, N., Moestrup, ., Larsen, J., 1999. Leaflet No. 185 Potentially toxic phytoplankton 4. The diatom genus Pseudo nitzschia (Diatomophyceae/Bacillariophyceae), In: Lindley, J.A. (Ed.), ICES Identification Leaflets for Plankton, pp. 1 23. Smith, G.J., Ladizinsky, N., Miller, P.E., 2001. Amino acid profiles in species and strains of Pseudo nitzschia from Monterey Bay California: Insights into the metabolic role(s) of domoic acid, In: Hallegraeff, G.M., Blackburn, S.I., Bolch, C.J., Lewis, R.J. (Eds.), Harmful Algal Blooms 2000. Intergovernmental Oceanographic Commission of UNESCO, Paris, pp. 324 327. Sommer, U., 1994. Are marine diatoms favoured by high Si:N ratios? Mar. Ecol. Prog. Ser. 115, 309 315. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. E vol. 24, 1596 1599. Thessen, A.E., Bowers, H.A., Stoecker, D.K., 2009. Intra and interspecies differences in growth and toxicity of Pseudo nitzschia while using different nitrogen sources. Harmful Algae 8, 792 810. Thessen, A.E., Dortch, Q., Parsons, M.L. Morrison, W., 2005. Effect of salinity on Pseudo nitzschia species (Bacillariophyceae) growth and distribution J. Phycol. 41, 21 29.

PAGE 99

! 90 Thessen, A.E., Stoecker, D.K., 2008. Distribution, abundance and domoic acid analysis of the toxic diatom genus Pseudo ni tzschia from the Chesapeake Bay. Estuaries Coasts 31, 664 672. Todd, E.C.D., 1993. Domoic Acid and Amnesic Shellfish Poisoning: A review. J. Food Protect. 56, 69 83. Torres de la Riva, G., Johnson, C.K., Gulland, F.M.D., Langlois, G.W., Heyning, J.E., Rowl es, T.K., Mazet, J.A.K., 2009. Association of an unusual marine mammal mortality event with Pseudo nitzschia spp. blooms along the southern California coastline. J. Wildlife Dis. 45, 109 121. Touzet, N., Keady, E., Raine, R., Maher, M., 2009. Evaluation of taxa specific real time PCR, whole cell FISH and morphotaxonomy analyses for the detection and quantification of the toxic microalgae Alexandrium minutum (Dinophyceae), Global Clade ribotype. FEMS Microbiol. Ecol. 67, 329 341. Trainer, V.L., 2002. Harmful algal blooms on the U.S. west coast, In: Taylor, F.J., Trainer, V.L. (Eds.), Harmful algal blooms in the PICES region of the North Pacific. PICES Scientific Report, pp. 89 118. Trainer, V.L., Adams, N.G., Bill, B.D., Anulacion, B.F., Wekell, J.C., 1998. C oncentration and dispersal of a Pseudo nitzschia bloom in Penn Cove, Washington, USA. Nat. Toxins 6, 113 126. Trainer, V.L., Adams, N.G., Bill, B.D., Stehr, C.M., Wekell, J.C., Moeller, P., Busman, M., Woodruff, D., 2000. Domoic acid production near Califo rnia coastal upwelling zones, June 1998. Limnol. Oceanogr. 45, 1818 1833. Trainer, V.L., Adams, N.G., Wekell, J.C., 2001. Domoic acid producing Pseudo nitzschia species off the U.S. west coast associated with toxification events, In: Hallegraeff, G.A., Bla ckburn, S.I., Bolch, C.J., Lewis, R.J. (Eds.), Harmful Algal Blooms 2000. Intergovernmental Oceanographic Commission of UNESCO, Paris, pp. 46 49. Trainer, V.L., Cochlan, W.P., Erickson, A., Bill, B.D., Cox, F.H., Borchert, J.A., Lefebvre, K.A., 2007. Recen t domoic acid closures of shellfish harvest areas in Washington State inland waterways. Harmful Algae 6, 449 459.

PAGE 100

! 91 Trainer, V.L., Suddleson, M., 2005. Monitoring approaches for early warning of domoic acid events in Washington State. Oceanography 18, 228 23 7. Trainer, V.L., Wells, M.L., Cochlan, W.P., Trick, C.G., Bill, B.D., Baugh, K.A., Beall, B.F., Herndon, J., Lundholm, N., 2009. An ecological study of a massive bloom of toxigenic Pseudo nitzschia cuspidata off the Washington State coast. Limnol. Oceanog r. 54, 1461 1474. Turner, R.E., Rabalais, N.N., 1991. Changes in Mississippi River water quality this century. BioScience 41, 140 147. Turrell, E., Bresnan, E., Collins, C., Brown, L., Graham, J., Grieve, M., 2008. Detection of Pseudo nitzschia (Bacillario phyceae) species and amnesic shellfish toxins in Scottish coastal waters using oligonucleotide probes and the Jellet Rapid Test. Harmful Algae 7, 443 458. Tweddle, J.F., Strutton, P.G., Foley, D.G., O'Higgins, L., Wood, A.M., Scott, B., Everroad, R.C., Pe terson, W.T., Cannon, D., Hunter, M., Forster, Z., 2010. Relationships among upwelling, phytoplankton blooms, and phycotoxins in coastal Oregon shellfish. Marine Ecology Progress Series 405, 131 145. Tyagi, S., Kramer, F.R., 1996. Molecular beacons: Probes the fluoresce upon hybridization. Nature Biotech. 14, 303 308. Ulrich, R.M., Casper, E.T., Campbell, L., Richardson, B., Heil, C.A., Paul, J.H., 2010. Detection and quantification of Karenia mikimotoi using real time nucleic acid sequence based amplificat ion with internal control RNA (IC NASBA). Harmful Algae 9, 116 122. Verity, P.G., 2010. Expansion of potentually harmful algal taxa in a Georgia Estuary (USA). Harmful Algae 9, 144 152. Villac, M.C., Roelke, D.L., Chavez, F.P., Cifuentes, L.A., Fryxell, G. A., 1993. Pseudonitzschia australis Frenguelli and related species from the west coast of the U.S.A.: Occurrence and domoic acid production. J. Shellfish Res. 12, 457 465. Villareal, T.A., Roelke, D.L., Frxyell, G.A., 1994. Occurrence of the toxic diatom Nitzschia pungens f. multiseries in Massachusetts Bay, Massachusetts, USA. Mar. Environ. Res. 37, 417 423.

PAGE 101

! 92 Vrieling, E.G., Koeman, R.P.T., Scholin, C.A., Scheerman, P., Peperzak, L., Veenhuis, M., Gieskes, W.W.C., 1996. Identification of a domoic acid prod ucing Pseudo nitzschia species (Bacillariophyceae) in the Dutch Wadden Sea with electron microscopy and molecular probes. Eur. J. Phycol. 31, 333 340. Wawrik, B., Paul, J.H., Tabita, F.R., 2002. Real time PCR quantification of rbcL (ribulose 1,5 biphosphate carboxylase/oxygenase) mRNA in diatoms and pelagophytes. Appl. Environ. Microbiol. 68, 3771 3779. Wekell, J.C., Gauglitz Jr., E.J., Barnett, H.J., Hatfield, C.L., Simons, D., Ayres, D., 1994. Occurrence of domoic acid in Washingto n State razor clams ( Siliqua patula ) during 1991 1993. Nat. Toxins 2, 197 205. Wells, M.L., Trick, C.G., Cochlan, W.P., Hughes, M.P., Trainer, V.L., 2005. Domoic acid: The synergy of iron, copper, and the toxicity of diatoms. Limnol. Oceanogr. 50, 1908 191 7. Work, T.M., Barr, B., Beale, A.M., Fritz, L., Quilliam, M.A., Wright, J.L.C., 1993. Epidemiology of domoic acid poisoning in brown pelicans ( Pelecanus occidentalis ) and Brandt's cormorants ( Phala crocorax penicillatus ) in California J. Zoo Wildlife Med. 24, 54 62. Wright, J.L.C., Boyd, R.K., de Freitas, A.S.W., Falk, M., Foxall, R.A., Jamieson, W.D., Laycock, M.V., McCulloch, A.W., McInnes, A.G., Odense, P., Pathak, V.P., Quilliam, M.A., Ragan, M.A., Sim, P.G., Thibault, P., Walter, J.A., Gilgan, M., Ric hard, D.J.A., Dewar, D., 1989. Identification of domoic acid, a neuroexcitatory amino acid, in toxic mussels from eastern Prince Edward Island. Can. J. Chem. 67, 481 490.

PAGE 102

! 93 APPENDICES

PAGE 103

! 94 Appendix 1: IC NASBA assays for P. delicatissima and LA2 StC6C Table A1. P. delicatissima and LA2 StC6C beacon sequences Sequence name Sequence (5' to 3') P. delicatissima beacon [5 HEX] CGCGATGATCAATCGTGGTTTAGCAA TCGCG [DABCYL] LA2 StC6C beacon [Cy5] CCGGATTATTAACCGTGGCTTAGCAAT CCGG [DABCYL] Figure A1 T ranscript standard curves for P. delicatissima and LA2 StC 6C IC NASBA assays A) P. delicatissima ; B) LA2 StC6C. y = -0.121ln(x) + 2.34 R = 0.984 0 0.5 1 1.5 2 2.5 1.E+04 1.E+05 1.E+06 1.E+07 TTP Ratio A rbcS Transcripts per Reaction y = -0.190ln(x) + 3.63 R = 0.954 0 0.5 1 1.5 2 2.5 1.E+04 1.E+05 1.E+06 1.E+07 TTP Ratio B rbcS Transcripts per Reaction

PAGE 104

! 95 Appendix 1 Continued Table A2. Specificity of P. delicatissima and LA2 StC6C IC NASBA assays Species Isolate P.deli beacon 1 LA2 beacon 1 P. multiseries CCMP2708 P. multiseries CLNN 20 P. multiseries CLNN 21 P. multiseries PM 02 Other Pseudo nitzschia species P. cf. calliantha NWFSC 186 P. cuspidata NWFSC 189 P. delicatissima CL 252 + P. delicatissima CL 253 + P. delicatissima CL 260 + P. pungens CL 249 P. pungens CL 259 P. sp. AL2 P. sp. LA1 St3 P. sp. LA2 StC6C + Other marine phytoplankton C. compressum CCMP168 C. closterium CCMP1855 C. fusiformis CCMP343 D. confervacea CCMP353 F. pinnata CCMP395 L. danicus CCMP1856 N. incerta CCMP542 N. alba CCMP2426 N. curvilineata CCMP555 N. frustulum CCMP558 N. laevis CCMP559 N. cf. ovalis CCMP1118 N. cf. pusilla CCMP560 P. tricornutum CCMP1327 R. setigera CCMP1330 S. costatum CCMP2092 T. nordenskioeldii CCMP995 T. pseudonana CCMP1335 T. weissflogii CCMP1051 Unidentified Bacillariophyceae CCMP2297 A. lagunensis CCMP1502 A. anophagefferens CCMP1794

PAGE 105

! 96 Appendix 1, Continued Table A2, Continued. C. subsalsa CCFWC75 H. akashiwo CCMP452 B. pacifica CCMP1866 A. sanguinea CCFWC31 A. monilatum CCMP3105 G. toxicus CCMP1649 K. brevis CCFWC261 K. micrum CCFWC114 P. lima CCFWC381 P. bahamense CCFWC390 T. erythraeum CCMP1985 1 +, detected; not detected

PAGE 106

! 97 Appendix 2: P. multiseries CCMP2708 g rowth curve and toxin data Figure A2. Growth curve for P. multiseries CCMP2708 based on cell counts and fluorescence Counts were performed using a Sedgwick Rafter slide and chlorophyll a fluore scence was measured using a LS 5 fluorescence spectrophotometer (PerkinElmer, Waltham, MA ; excitation: 425 nm, emission: 680 nm). 0 5 10 15 20 25 30 35 40 45 50 0 20,000 40,000 60,000 80,000 100,000 120,000 140,000 0 5 10 15 20 Raw Fluorescence Cell counts (per mL) Day Cell counts Raw fluorescence

PAGE 107

! 98 Appendix 2, Continued Figure A3. Fluorescence g rowth curve and domoic acid measurement of stationary phase P. multiseries C CMP2708 cells S tationary phase c ells were enumerated and 10 m L was filtered onto 25 mm GF/F filters and stored at 20 ¡ C. For analysis of particulate domoic acid, filters were extracted in 5 mL of 20% methanol and vortexed for 2 min. After centrifugation for 10 min at 4,000 rpm, t he supernatant was removed diluted accordingly, and used in ASP ELISA (Biosense Laboratories, Bergen, Norway)

PAGE 108

! 99 Appendix 3 : rbcS p hylogeny of marine diatoms and environmental clones

PAGE 109

! 100 Appendix 3, Continued Figure A4. Evolutionary relationship of marine diatoms and environmental rbcS clones A n environmental clone library was created using diatom rbcS primers with cDNA from Pinellas Point in southern Tampa Bay ( collected 14 May 2009) The bo otstrap consensus tree was inferred from 1,000 replicates.