USF Libraries
USF Digital Collections

Inhibition of p53 dna binding function by the mdm2 acidic domain

MISSING IMAGE

Material Information

Title:
Inhibition of p53 dna binding function by the mdm2 acidic domain
Physical Description:
Book
Language:
English
Creator:
Cross, Brittany Lynne
Publisher:
University of South Florida
Place of Publication:
Tampa, Fla
Publication Date:

Subjects

Subjects / Keywords:
Arf
Bortezomib
Conformation
Mdmx
Nutlin
Suv39h1
Dissertations, Academic -- Molecular Biology Cellular Biology Oncology -- Doctoral -- USF   ( lcsh )
Genre:
bibliography   ( marcgt )
non-fiction   ( marcgt )

Notes

Abstract:
ABSTRACT: MDM2 regulates p53 predominantly by promoting p53 ubiquitination. However, ubiquitination-independent mechanisms of MDM2 have also been implicated. Here we show that MDM2 inhibits p53 DNA binding activity in vitro and in vivo. MDM2 binding promotes p53 to adopt a mutant-like conformation, losing reactivity to antibody Pab1620, while exposing the Pab240 epitope. The acidic domain of MDM2 is required to induce p53 conformational change and inhibit p53 DNA binding. ARF binding to the MDM2 acidic domain restores p53 wild type conformation and rescues DNA binding activity. Furthermore, histone methyl transferase SUV39H1 binding to the MDM2 acidic domain also restores p53 wild type conformation and allows p53-MDM2-SUV39H1 complex to bind DNA. These results provide further evidence for an ubiquitination-independent mechanism of p53 regulation by MDM2, and reveal how MDM2-interacting repressors gain access to p53 target promoters and repress transcription. Furthermore, we show that the MDM2 inhibitor Nutlin cooperates with the proteasome inhibitor Bortezomib by stimulating p53 DNA binding and transcriptional activity, providing a rationale for combination therapy using proteasome and MDM2 inhibitors.
Thesis:
Disseration (Ph.D.)--University of South Florida, 2011.
Bibliography:
Includes bibliographical references.
System Details:
Mode of access: World Wide Web.
System Details:
System requirements: World Wide Web browser and PDF reader.
Statement of Responsibility:
by Brittany Lynne Cross.
General Note:
Title from PDF of title page.
General Note:
Document formatted into pages; contains 141 pages.
General Note:
Includes vita.

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
usfldc doi - E14-SFE0004951
usfldc handle - e14.4951
System ID:
SFS0028190:00001


This item is only available as the following downloads:


Full Text

PAGE 1

Inhibition of p53 DNA Binding Func tion by the MDM2 Acidic Domain by Brittany Lynne Cross A dissertation submitted in partial fulfillment of the requirement s for the degree of Doctor of Philosophy Department of Cancer Biology College of Arts and Sciences University of South Florida Major Professor: Jiandong Chen, Ph.D. Kenneth L. Wright, Ph.D. Alvaro Monteiro, Ph.D. Jia Fang, Ph.D. Date of Approval: May 12, 2011 Keywords: MDMX, ARF, SUV39H1, conformation, Bortezomib Copyright 2011, Brittany Lynne Cross

PAGE 2

DEDICATION I would like to dedicate this dissertati on to all of my family and friends who have supported me through gr aduate school. I am espec ially grateful to my husband for his patience and support thr oughout this process, along with his constant ability to keep me grounded and extremely happy. Also, to my parents and sisters who have been a source of encouragement and amusement. Lastly, my Grandma and Grandpa Woodruff who lost there brave battle with cancer and are the reason I am where I am today.

PAGE 3

ACKNOWLEDGMENTS First, I would like to thank my advisor, Dr. Jiandong Chen, for his guidance, teaching and advic e throughout my graduate trai ning. I would also like to thank my committee members: Dr. Wri ght, Dr. Monteiro and Dr. Fang for all the support and insightful ideas not only for my projects, but also my future career as a scientist. Many thanks to fellow lab mates and friends: Neha Kabra, Daniele Gilkes, Cindy Lebron, Alyson Fr eeman, Scott Freeman, Lihong Chen and Qian Cheng. Lastly, thanks to Cathy Gaffney who coordinat es everything for the Cancer Biology Program and was a huge help all the way through to graduation.

PAGE 4

i TABLE OF CONTENTS LIST OF FI GURES...............................................................................................iv LIST OF ABBREVI ATIONS.................................................................................vii ABSTRACT. ......................................................................................................v iii INTRODUC TION..................................................................................................1 Carcinog enesis..........................................................................................1 Tumor Suppresso r and Oncogenes........................................................... 2 Tumor Suppr essor p53..............................................................................4 History of p53..................................................................................4 P53 Structure and Localizat ion.......................................................5 P53 Functions .................................................................................7 Cell Cycl e Arre st................................................................... 8 Apoptosis-Intrins ic and Ex trinsic .......................................... 9 DNA Repair........................................................................ 11 Senescence........................................................................ 11 Metabolism......................................................................... 12 Angiogenesis and Metast asis............................................. 12 Transcriptional Repression .................................................13 Regulation of p53..........................................................................14 P53 Ubiqui tination.............................................................. 15 P53 Phos phorylation.......................................................... 17 P53 Ac etylation.................................................................. 19 P53 Me thylation.................................................................. 20 P53 Neddylation and Sumoylation .....................................20 P53 Mutations in Canc er...............................................................21 Non-Mutated p53 in Cancer..........................................................24 P53 as a Ther apeutic Tar get.........................................................25 Oncogene MD M2.....................................................................................27 History of MDM2...........................................................................27 MDM2 Stru cture............................................................................28 MDM2-p53 Inte raction ...................................................................30 MDM2 Regul ation.........................................................................32 DNA Da mage..................................................................... 32 Oncogenic Stre ss/ARF Induction....................................... 35 Ribosomal Stress ...............................................................35

PAGE 5

MDM2 Mous e Models ...................................................................36 MDM2 Interact ing Proteins............................................................37 ARF.................................................................................... 37 SUV39H1 ...........................................................................39 Oncogene MD MX....................................................................................40 History of MDMX...........................................................................40 MDMX Structur e and Functi on......................................................41 MDMX-p53-MDM2 Interactio n.......................................................44 MDMX Regul ation.........................................................................46 DNA Da mage..................................................................... 46 Oncogenic Stre ss/ARF Induction....................................... 48 Ribosomal Stress ...............................................................48 MDMX Mous e Models ...................................................................49 MDMX interacting Proteins...........................................................50 CK1.................................................................................. 50 MATERIALS AND METHODS............................................................................51 Cell Lines and Plasmids ...........................................................................51 Drug Treatm ents......................................................................................51 Transfect ions...........................................................................................51 Calcium Ph osphate .......................................................................51 Lipofecta mine................................................................................52 Protein An alysis.......................................................................................52 Western Blot................................................................................. 52 Immunoprecip itation ......................................................................53 DNA Binding Assays ................................................................................54 Chromatin Immunopr ecipitatio n....................................................54 DNA Affinity Immunoblotti ng.........................................................55 Luciferase Assay.....................................................................................56 RNA Isolation and Analysis......................................................................57 MTT Cell Viabilit y Assay..........................................................................57 RESULTS.........................................................................................................59 MDM2 inhibits p53 DNA bindin g..............................................................59 MDM2 acidic domain is critical for inhibiting p53 DNA binding ......62 MDM2 but not MDMX induces p5 3 conformational change.....................66 Nutlin blocks MDM2 mediated p53 conformational change.....................68 MDM2 acidic domain is critical for inducing conformational change ...........................................................................................70 CK1 -MDMX binding increases MDMX ability to block p53-DNA binding ...........................................................................................74 Increasing MDMX-p53 binding does not induce conformational change ...........................................................................................79 Acidic domain-p53 binding correlates with p53 conformational change ...........................................................................................80 DNA damage abrogates the abilit y of MDM2 to shift p53 ii

PAGE 6

iii conforma tion.......................................................................................81 ARF prevents p53 conformational change and restores DNA binding ...........................................................................................84 SUV39H1 blocks p53 conformational change to access p53 target pr omoters.................................................................................90 Inhibition of MDM2 cooperates with Bortezomib to activate p53 ...........................................................................................95 DISCUSSION ..................................................................................................100 LIST OF REFE RENCES..................................................................................107

PAGE 7

LIST OF FIGURES Figure 1: p53 Structur e........................................................................................6 Figure 2: p53 Function.........................................................................................8 Figure 3: p53 Posttranslati onal Modifica tions....................................................15 Figure 4: Distrubution of Cancers and p53 Mu tations........................................22 Figure 5: Distribution of p53 point muta tions.....................................................23 Figure 6: MDM2 Structure.................................................................................28 Figure 7: MDM2 Regulatio n...............................................................................34 Figure 8: MDM2 Regulation by Ribosomal Stress.............................................36 Figure 9: Ink4a/ARF locu s.................................................................................38 Figure 10: SUV39H1-MD M2 Interaction............................................................40 Figure 11: Structure Homology of MDM2 and MDMX.......................................42 Figure 12: Regula tion of MD MX........................................................................47 Figure 13: Inhibition of p53-o ligonucleotide bindi ng by MDM2..........................60 Figure 14: Inhibition of p53-DNA binding by MDM2...........................................60 Figure 15: MDM2 overexpression inhibits endogenous p53 activi ty..................62 Figure 16: MDM2 acidic domain inhibits p53-oligonucleotide binding ...........................................................................................63 Figure 17: MDM2 acidic domain inhibits DN A binding .......................................64 Figure 18: MDM2 inhibits DNA binding prior to proteosomal degradatio n........................................................................................65 Figure 19: MDMX acidic domain does not inhibit p53-DN A bindin g..................65 Figure 20: MDM2 but not MDMX induces p53 conformational change ...........................................................................................67 Figure 21: Amplified MDM2 indu ces p53 conformati onal change ......................68 Figure 22: Nutlin blocks MDM2 induced p53 conformati onal change................69 iv

PAGE 8

v Figure 23: Mapping the MDM2 domain that mediates p53 conformational change.......................................................................71 Figure 24: Small deletions in the MDM2 acidic domain partially inhibit p53 confo rmational c hange.......................................................72 Figure 25: Induction of p53 conformational change by MDM2-MDMX hybrid constructs.........................................................73 Figure 26: Analysis of MDM2 acidic domain phosphorylation mutants ...........................................................................................74 Figure 27: CK1 binds to MDMX and requires the 306 cysteine residue ...........................................................................................75 Figure 28: CK1 -MDMX binding increases MDMX-p53 bi nding........................76 Figure 29: MDMX-CK1 binding decreases p53-DNA bindi ng..........................78 Figure 30: CK1 binding to MDMX is requir ed for p53 regul ation.....................79 Figure 31: CK1 expression does not induce MDMX-mediated p53 conformational change.......................................................................80 Figure 32: Acidic domain-p53 binding correlates with p53 conformational change.......................................................................81 Figure 33: DNA damage and ATM phosphorylation of the MDM2 RING domain inhibit p53 conformational change...............................82 Figure 34: DNA damage inhibits MD M2 induced p53 conformational change ...........................................................................................83 Figure 35: DNA damage inhibits the MDM2 acidic domain-p53 interact ion...........................................................................................84 Figure 36: ARF expression stimulates p53-DNA binding ...................................85 Figure 37: ARF increases p53 transcriptional activity........................................86 Figure 38: ARF inhibits MD M2-mediated p53 conformational change ...........................................................................................88 Figure 39: ARF blocks p53 conformational change...........................................89 Figure 40: p53-MDM2-ARF form a trimeric co mplex.........................................89 Figure 41: ARF binds at p53 ta rget promoters via trimeric complex fo rmation..............................................................................90

PAGE 9

Figure 42: SUV restores p53oligonucleotide binding........................................91 Figure 43: SUV39H1 restor es p53-DNA binding...............................................92 Figure 44: SUV39H1 increases p53 transcriptional activity...............................93 Figure 45: SUV39H1 restores p53 wild-type conf ormation................................94 Figure 46: SUV39H1 binds at p53 target promoter s via trimeric complex fo rmation..............................................................................94 Figure 47: Nutlin activates p53 in Bortezomib-t reated ce lls...............................95 Figure 48: Nutlin increases p53-DNA binding and transcription of target genes in Bortezom ib treated SJ SA cells..................................96 Figure 49: Nutlin increases p53-DNA binding and transcription of target genes in Bortezomib treated U2OS cells..................................97 Figure 50: Combination of Velcade and Nutlin treatment lead to increased cytotoxicity in p53 wild type containing cell lines ...........................................................................................99 Figure 51: A model for ubiquitinindependent regulation of p53 by MDM2 .........................................................................................103 vi

PAGE 10

vii LIST OF ABBREVIATIONS Ab antibody ARF alternative reading frame ATM atazia-telangiectasia mutated CDK cyclin-dependent kinase Chk1 checkpoint kinase 1 Chk2 checkpoint kinase 2 DNA deoxyribose nucleic acid FBS fetal bovine serum GFP green florescent protein HAUSP herpesvirus-associated ubiquitin-specific protease HDAC histone deacetylase HIF-1 hypoxia inducibl e transcription factor HPV human papilloma virus hTERT human telomerase catalytic subunit IP immunoprecipitation IR ionizing radiation LOH loss of heterozygosity MDM2 mouse double minutes 2 MDMX mouse double minutes x MEF mouse embryo fibroblast l microliter M micromolar ml milliliter mM millimolar NLS nuclear localization signal NES nuclear export signal NoLS nucleolus localization signal PBS phosphate buffer saline PCR polymerase chain reaction Rb retinoblastoma protein RNA ribonucleic acid SV40 simian virus Ub ubiquitin UV ultraviolet light WCE whole cell extract

PAGE 11

ABSTRACT MDM2 regulates p53 predominantly by promoting p53 ubiquitination. However, ubiquitinationindependent mechanisms of MDM2 have also been implicated. Here we show that MDM2 inhibits p53 DNA binding activity in vitro and in vivo MDM2 binding promotes p53 to adopt a mutant-like conformation, losing reactivity to antibody Pab1620, while exposing the Pab240 epitope. The acidic domain of MDM2 is required to induce p53 conformational change and inhibit p53 DNA binding. ARF binding to t he MDM2 acidic domain restores p53 wild type conformation and rescues DNA bi nding activity. Furthermore, histone methyl transferase SUV39H1 binding to the MDM2 acidic domain also restores p53 wild type conformation and allows p53-MDM2-SUV39H1 complex to bind DNA. These results provide further evidence for an ubiquitination-independent mechanism of p53 regulation by MDM2, and reveal how MDM2-interacting repressors gain access to p53 target promoters and repre ss transcription. Furthermore, we show that the MDM2 inhibitor Nutlin cooperates with the proteasome inhibitor Bortezomib by stimulating p53 DNA binding and transcriptional activity, providing a ra tionale for combination therapy using proteasome and MDM2 inhibitors. viii

PAGE 12

1 INTRODUCTION Carcinogenesis Carcinogenesis is a mult i-step process by which normal cells are transformed into cancer cells, ultimately reprogr amming a cell to undergo uncontrolled cell division. Under normal cellular c onditions there is a balance between proliferation and pr ogrammed cell death that is tightly regulated to ensure cellular integrity. Both genetic and epigenetic DNA alterations t hat lead to cancer disrupt this balance, resulting in not only uncont rolled cellular division, but also genetic instability (Cahill et al., 1999). More than one mutation is necessary for carcinogenesis, and this genetic instability allows for successive accumulation of mutations in certain classes of genes. This series of mutations is the requirement for a normal cell to transform into a cancer cell (Fearon and Vogelstein, 1990). Genetic instability is defined as a set of events that are capable of causing unscheduled DNA alterations within the genome. These genetic changes can occur at multiple levels, anywhere from gai ning or losing an entire chromosome to mutating a single oligonucleotide in a particular gene. DNA mutations at a single nucleotide level include point mutati ons, deletions or insertions. These small changes have the potential to affect the expression of the gene, or alter the function or stability of the protein product. Large-scale mu tations will occur at the chromosomal level, which results in t he loss or gain of portions (or entire) chromosomes. Chromosomal instabilit y can involve genomic amplification, causing a cell to gain multiple copies of one or more genes, or translocations, which occur when two or more separate chromosome regions become fused at uncharacteristic locations (Lengauer et al., 1998).

PAGE 13

2 Epigenetic alterations involve modi fications in gene expression from mechanisms other than changes in the DNA sequence itself (Bird, 2007). These modifications occur through DNA methyl ation, histone modifications and gene imprinting (Feinberg and Tycko, 2004). Epigenetic changes occur naturally in eukaryotic biology during the process of ce llular differentiation, creating multiple different cell types that will have activa ted some genes, yet inhibited others (Reik, 2007). In some instances t he DNA modifying events may lead to the activation of oncogenes or inactivation of tumor suppressor genes, leading to cancer. A variety of compounds or environmental factors ar e also associated with epigenetic alterations and result in increas ed incidence of tumors. These include environmental factors such as UV and ioni zing radiation, tobacco smoke or even viral infections. Following tumor initiation via the culm ination of mutations that deregulate genes necessary to control homeostasis and the selective clonal expansion of these unstable, abnormal cells there is tu mor progression. This process results in a group of malignant cells that disp lay the following biological properties: unchecked cellular growth (self-suffici ency in growth signals and loss of sensitivity to anti-grown signals), evasion from cell death, loss of senescence leading to limitless replic ative potential, and the ab ility to invade and build metastases in other tissues (Hanahan and Weinberg, 20 00). Many of the genes that lead to these malignant phenotypes are involved in cell cycle control, DNA damage responses and DNA repair, making discovery and characterization of these genes critical for development of c ancer therapies. One such example is the Guardian of the genome, or the tumor suppressor gene, TP53 (Lane, 1992) and oncogenes MDM2 and MDMX. Tumor Suppressor and Oncogenes Tumor suppressor genes code for proteins that suppress cell growth, protecting a normal cell from the path to cancer. Tumor suppressors have several functions, including repression of cell cycle progressing genes, coupling the cell cycle to DNA damage and initiating apoptosis if the cell is unable to repair the damage (Croce, 2008). When a tu mor suppressor gene is mutated in

PAGE 14

3 a way that causes it to lose or reduce its function, the cell has an increased probability of tumor formation, combi ned with other genetic changes. Tumor suppressor genes generally follow the Knud son two-hit hypothesis, first proposed by A.G. Knudson for cases of retinoblastoma. It implies that both alleles that code for a particular gene must be affect ed before an effect is manifested (Knudson, 1971). Theref ore, mutated tumor suppressor s are recessive, in that if only one allele is damaged, the second c an still produce the correct protein. These observations propose that the devel opment of cancer via mutations in tumor suppressors involves at least two mutational events. There are exceptions to this two-hit rule fo r tumor suppressors. These involve tumor suppressors with mutations that exhibit haploinsuffi ciency, where the mutation of a single allele can cause an increase in carcinoge n susceptibility (Fero et al., 1998). Another exception would be genes that have a dominate negative function, meaning that the mutated pr otein can prevent the func tion of the normal protein from the un-mutated alle le (Baker et al., 1990). Certain individuals with mutations in the tumor suppressor p53 ge ne product function with this dominate negative effect. Unlike tumor suppressor genes, oncogenes encode for proteins that promote cell growth through a variety of ways and they also have the potential to cause cancer. Proto-oncogene functions include proteins that help regulate cell growth and differentiation and are involv ed in signal transduction and execution of mitogenic signals. Following activati ng mutations, the proto-oncogene then becomes an oncogene (Todd and Wong, 1999). There are three main activation mutation types. First, a mutation that causes a change in the protein structure, leading to an increase in enzyme activity or loss of regulation. Second, an increase in protein concentra tion caused by an increa se in expression, mRNA stability or gene duplication. Third, a chromosomal translocation that can cause an increase in gene expression in t he wrong cell or at the wrong time or expression of a constitutively active hy brid protein (Croce, 2008). Normally these genes are critical for growth, repair and homeostasis, it is only when they become mutated that growth signals becom e excessive. Under this condition

PAGE 15

4 oncogenes can also inactivate specific tumor suppressor genes, as is the case with MDM2 and MDMX regulating p53 activity. Tumor Suppressor p53 P53 is a tumor suppressor protein that, in humans, is encoded by the TP53 gene located on the s hort arm of chromosome 17 (17p13.1) (Isobe et al., 1986; Kern et al., 1991; Matlashewski et al., 1984; McBride et al., 1986). The p53 protein belongs to a family of tran scription factors that include p53, p63 and p73. All three are required for norma l development, yet only p53 seems to prevent tumor formation (Yang and McKeon, 2000). It does this by inducing cellcycle arrest, DNA repair or apoptosis in response to various types of damage (Levine, 1997; Levine et al., 2004; V ogelstein et al., 2000) Consequently, mutations or deletions in the p53 gene occu r in over 50% of all human cancers (Soussi et al., 2006). P53 History P53 was identified in 1979 by two groups as a 55-kDa protein that coprecipitated with the large-T antigen of t he simian virus (SV40) and accumulated in the nuclei of cancer cells (Lane and Crawford, 1979; Linzer and Levine, 1979). It was initially presumed to be an oncoge ne due to these observations and the use of cDNA containing missense mutated forms of p53, not the wild type, that acquired gain of function activities. T hese mutated forms can stabilize p53 due to its increased interaction with HSP90, which inhibits ubquitination by MDM2, and can suppress the activity of wild-type p53 by binding and forming inactive tetramers (Peng et al., 2001; Sigal and Rotter, 2000). This idea was further supported by the fact that p53 was shown to cooperate with the activated Ha-Ras oncogene by immortalizing normal embryoni c cells, leading to cells sensitive to ras transformation (Eliyahu et al., 1984; Par ada et al., 1984). In 1989, the Arnold Levine lab was the first to characterized p53 as a protein that suppresses cellular transformation (Finlay et al., 1989). This was further established in studies showing p53 was deleted in human colorectal cancers and that DNA viruses, such as HPV and the adenovir us E1B 55K, could inactivate p53 (Baker et al., 1990; Scheffner et al., 1990; Zantema et al., 1985). In 1992 a consensus

PAGE 16

5 sequence to which human p53 could bind was discovered, defining p53 as a transcription factor (el-Deiry et al., 1992) The transcription factor, p53, is now widely recognized as a tumor suppressor that responds to a wide variety of stress signals and is thought to be the ratelimiting factor in specific steps of tumor development. P53 Structure and Localization P53 is a polypeptide chain of 393 ami no acids, consisting of five major domains: a transactivation domain, a pr oline rich region, a sequence specific DNA binding domain, a te tramerization domain and a regulatory domain ( Figure 1 ). The N-terminus transactivation domain (TAD, residues 145) can facilitate transcription activity and regulate p53 func tion by interacting with transcription coactivators such as p300/CBP and p21 (Joer ger and Fersht, 2008). This region is also involved in negat ive regulation of p53 by in teracting with one of its negative regulators, MDM2 (Lin et al., 1994). The proline rich domain (PxxP, residues 61-94) is reportedly necessary for p53 induced cell cycle arrest and apoptosis (Sakamuro et al., 1997). The DNA binding domain (Core domain, residues 102-292) is required for sequence specific DNA binding and is basic in charge (Wang et al., 1996; Wang et al., 1995). The most common consensus DNA binding sequence consists of two ta ndem repeats separated by a 0-13 bp spacer (el-Deiry et al., 1992). The p53 core domain has poor thermo stability at physiological temperatures and can under go spontaneous denaturation (Bullock et al., 1997; Canadillas et al., 2006; Hansen et al., 1996). Changes in p53 conformation can inhibit the ability of p53 to induce expression of its downstream transcriptional targets (Olivier et al., 2002; Soussi et al., 2000).The tetramerization domain (TD, residues 32 4-355) resides near the C-terminus and is required for the efficient oligomeriz ation of p53 tetramers through hydrophobic interactions. The p53 regulatory domain (Carboxyl terminus, residues 311-393) is located at the extreme C-terminus and is rich in lysines and arginines, subjecting this domain to multiple pos t-translational modifications that are important for p53 regulat ion (Appella and Anderso n, 2000; Brooks and Gu, 2003).

PAGE 17

Figure 1: p53 Structure. P53 is a polypeptide chain consisting of five major domains: a transactivation domain, a pr oline rich region, a sequence specific DNA binding domain, a tetramerization domain and a regulatory domain. P53 also contains multiple nuclear expor t signals and nuclear localization signals. 6 Also located within the carboxyl te rminus are nuclear localization signals (NLS), and there is a nuclear export s equence located in the oligomerization domain and activation domain (Cho et al ., 1994; Dang and Lee, 1989; Hainaut et al., 1997). Working mainly as a transcription factor, p53 nuclear import is essential for normal function as a tumo r suppressor. Therefore, there are multiple cellular mechanisms that exist to regulate the nuclear import and export of p53 (Knippschild et al., 199 6; Moll et al., 1996; Ryan et al., 1994). Regulation of nuclear localization occurs either by direct modifications of the NLS or NES sites or interaction with other protei ns that interfere with NLS or NES accessibility. For example, phosphorylation by insulin-like growth factor I, IGFI, can induce elevated levels of phosphor ylated p53 resulting in high cytoplasmic levels in human breast cancer cells (Takahas hi et al., 1993). MDM2 can regulate p53 localization both by protein-prot ein interaction and posttranslational modifications. MDM2 protein interact ion itself mediates nuclear export and degradation of p53 by shuttling it to the cytoplasm, while ubiquitination of p53 in the nucleus unmasks the p53 NES (Inoue et al., 2005; Roth et al., 1998; Tao and Levine, 1999). It is important to note that there are conflicting studies reporting that nuclear export of p53 is a MDM2 independent event, yet knockdown of MDM2 results in nuclear import and ret ention, and mutations of the lysine residues ubiquitinated by MDM2 abrogate nuc lear export (Nakamura et al., 2000; Stommel et al., 1999). It has been suggest ed that tumorigenesis could result from a defect in the r egulation of p53 nuclear im port and some studies have

PAGE 18

7 shown that wild-type p53 is abnormally s equestered in the cytoplasm in a subset of human tumor cells (Bosari et al., 1995; Liang and Clarke, 2001; Moll et al., 1995; Moll et al., 1992). P53 Function P53 plays a role in a variety of cell signaling mechanisms by both transcription-dependent and in dependent mechanisms, wh ich lead to cell cycle arrest, DNA repair, apoptosis-mediated cell death, inhibition of angiogenesis, differentiation and cellular senescence ( Figure 2 ). The p53 prot ein is normally maintained at low levels in unstress ed cells with a short half-life (Shu et al., 2007). Once cells encounter stress, post-translational modifications occur, leading to an increase in p53 levels due to stabilization (Lakin and Jackson, 1999; Saito et al., 2003). Once transcripti onally activated, t he p53 protein binds to DNA as a tetramer and stimulates the expression of downstream genes, which facilitates the repair and survival of damaged cells or eliminates severely damaged cells through apoptosis (Ko and Pr ives, 1996; Levine, 1997; Vogelstein et al., 2000). Occasionally, p53 can act as a transcriptional repressor through interactions with basal transcription ma chinery, co-repressors or other DNA binding proteins (Chen et al., 2010; Seto et al., 1992).

PAGE 19

Figure 2: p53 Function. P53 plays a critical role in a variety of cell signaling mechanisms (Bullock and Fersht, 2001). Cell Cycle Arrest 8 The cell cycle is a series of events t hat lead a cell to di vide and duplicate. Regulating the cell cycle is a critical st ep to ensure that genetic material is correctly passed onto daughter cells, as we ll as for the detection and repair of

PAGE 20

9 genetic damage and prevent ion of uncontrolled cellular di vision. Disregulation of any number of the cell cycle components can lead to tumor formation. There are four distinct phases to the cell cycl e: G1-phase, S-phase, G2-phase and Mphase. Each phase has checkpoints that monitor and regulate the progress of the cell cycle and prevent cell cycle progression until all necessary phase processes and repair of DNA damage occu r (Elledge, 1996). Two classes of regulatory molecules, cyclins and cyclin-dependent kinases (CDKs), along with CDK inhibitors, control cell cycle progression (Nigg, 1995). In order for the cell to move from G1 to S phase, DNA must be intact. Upon DNA damage recognition, the G1 checkpoint will st op the progression into S phase giving the cell time to repair the damage. Follo wing DNA damage activat ed p53 binds DNA and activates expression of several cell cycle inhibiting genes, including p21WAF1. P21 binds to the G1-S/CDK and S/CDK co mplexes, inhibiting their activity, and preventing the cell from continuing on to t he next stage of cell divi sion (el-Deiry et al., 1993). When p53 is unable to bind to the DNA properly, the p21 protein will not be available at high enough levels to act as a stop signal for the cell cycle, leading to uncontrollable divi sion and tumor formation. Another transcriptional target of p53 that is involved in cell cycle arrest is the 14-3-3 gene (Hermeking et al., 1997). The 14-3-3 protein functions at both the G1/S and G2/M transitions and regulat es cellular activity by binding and sequestering phosphorylated proteins. Following p53 induction, 14-3-3 binds and sequesters CDC2 and Cdc25 into the cytoplasm, which are essential for transition into mitosis, causing cell cyc le arrest (Chan et al., 1999; Lopez-Girona et al., 1999). The 14-3-3 protein can also delay apopto tic signaling, resulting in G2 arrest, by promoting the translocation of Bax out of the cytoplasm (Samuel et al., 2001). Apoptosis-Intrinsic and Extrinsic Apoptosis is the process of prog rammed cell death involving biochemical events that lead to changes in cell morphology and event ually death. Apoptosis can be initiated by two distinct pathways: the intrinsic and extrinsic pathways. P53 plays a distinct role in both of t hese pathways. The intrinsic pathway is

PAGE 21

10 initiated from within the cell in response to cellular signals resulting from DNA damage and involves the releas e of pro-apoptotic proteins that activate caspase enzymes from the mitochondria (Coultas and Strasser, 2003; Fulda and Debatin, 2006; Thornberry and Lazebnik, 1998). Th is pathway involves a balance between the pro-apoptotic (Bax, Bad, Bid) and anti-apoptotic (Bcl-2, Bcl-XL) members of the Bcl-2 family of prot eins, which ultimately regulate the permeability of the mitochondrial me mbrane and release of cytochrome C (Coultas and Strasser, 2003; Green and Evan, 2002). There are also BH3 domain-only proteins, such as PUMA and Bim. Several of the Bcl-2 proteins are transactivated by p53, the first one bei ng Bax (Miyashita and Reed, 1995). Upon initiation of apoptotic si gnaling, p53 transcr ibed Bax undergoes a conformation shift, homodimerizes and inserts into the outer mitochondrial membrane, creating pores and promoting the release of cytochrome C (Adams and Cory, 2001; Wolter et al., 1997). P53 can also induc e PUMA, Noxa and Bid (Moroni et al., 2001; Nakano and Vousden, 2001; Oda et al., 2000a; Walensky et al., 2006). PUMA and Noxa also promote mitoc hondrial depolarization via homoor heterodimerization, leading to cytochrome C release. BID interacts with Bax, leading to the insertion of Bax into t he mitochondrial membrane. Recently it was shown that following extracel lular stress signals, p53 can also translocate to the mitochondria, bind to Bcl-2 and MDMX creating mitochondrial outer membrane permeabilization (MOMP) and release of cytochrome C (Mancini et al., 2009). The extrinsic pathway begins outside of the cell through activation of specific pro-apoptotic rec eptors on the cell surface, which are activated by molecules known as pro-apopt otic ligands (Fulda and Debatin, 2006). This leads to the induction of caspase 8 and 3 activi ties. An example of this would be the binding of the Fas ligand to the Fas recept or. P53 can induce the transcription of Fas following DNA damage, resulting in the formation of death-receptor-inducingsignaling-complexes (DISCs). This leads to the activation of effector caspases 8 and 3 (Bouvard et al., 2000; Muller et al., 1998). P53 can also induce the transcription of the death-dom ain-containing receptor DR5 in response to DNA damage (Wu et al., 1997).

PAGE 22

11 DNA Repair DNA repair refers to the multiple pr ocesses by which a cell identifies and corrects damage to the DNA that encodes its genome. P53 has been linked to both the base excision repair (BER), nucleotide excision repair (NER) and correction of double stranded breaks (Gatz and Wiesmuller, 2006). P53 induces transcription of GADD45, a protein that promotes NER mechanisms following gamma irradiation (Smith et al., 2000) Following DNA damage, p53 induction can also transcribe p53R2, a ribonucleotide reductase that is important for repair, and lead to an increase in 3-methyladen ine (3-MeAde), an enzyme required for BER (Guittet et al., 2001; Zurer et al., 2004). When these normal repair processes fail to occur and cellar apoptosis also does not occur, irreparable DNA damage accumulates which can lead to tumor formation. Senescence Cellular senescence is the phenomenon by which normal diploid cells lose the ability to divide. Normally this occu rs after a set number of cellular divisions in response to DNA damage (this includes telomere shortening) and the cells either age or self-destruct vi a apoptosis due to damage t hat cannot be repaired. This is called the Hayf lick phenomenon or Hayflick limit (Hayflick, 1965). Early on, senescence was found to be me diated by two major tumor suppressor pathways, p53 and Rb (Gil and Peters, 2006; Kim and Sharpless, 2006) In fact, inactivating these proteins in mouse embr yonic fibroblasts is sufficient to evade cellular senescence (Dirac and Bernards, 2003). P53 induces transcription of the p21 protein, leading to the activation of the Rb pathway and triggering senescence following DNA damage and te lomere uncapping (Herbig et al., 2004). INK4a/ARF, a critical positive regulator of p53 stability, has been shown to have increasing mRNA and protein levels as tissues age, leading to increased p53 transcriptional activity (Herbig et al ., 2004). Telomere shortening can be prevented by overexpression of the hTERT protein and has been shown to be downregulated when p53 is activated. Overexpression of hTERT can actually overcome p53-induced apoptotsis (Xu et al., 2000).

PAGE 23

12 Metabolism Metabolism is a set of chemical reactions that happen in living organisms necessary to maintain life and allow said organism to grow, reproduce, maintain their structure and respond to their environment. Metabolic alterations are common features of cancer cells and have recently been shown to have an important role in the ma intenance of malignancies (Kroemer and Pouyssegur, 2008). Like any other stress signal, the me tabolic responses to limited nutrients, energy or oxygen availability stimulate p53 activity. For example, reduced nutrients result in the failure to stimul ate the MDM2 activator, AKT, leading to increased p53 stability by remo ving the negative regulation normally imposed by MDM2 (Mayo et al., 2002; Mayo and Donner, 2002). U nder low oxidative stress conditions, p53 can transcribe TIGAR (T P-53 induced glycolysis and apoptosis regulator), which results in an inhibition of glycolysis and a decrease in overall reactive oxygen species (ROS) levels. TIGAR can then protect cells from ROS induced apoptosis and allow for repair and survival of the cells. Knockdown of TIGAR expression has been shown to sensitize cells to p53-induced death (Bensaad et al., 2006). Under acute oxi dative stress, p53 induces pro-apoptotic genes, including Bax and PUMA, leading to the removal of the damaged cells (Liu et al., 2005). P53 can also activate AMPK, a protein th at drives energy producing responses under conditions of metabolic stress, and negatively regulates mTOR, a protein that promotes protein synthesis and suppresses induction of autophagy (Feng et al., 2005; Hardie, 2007). A disruption in balance of these processes is associated with mutations in p53 and oncogenic transformation (Vousden and Ryan, 2009). Angiogenesis and Metastasis Angiogenesis is the physiological proc ess involving the growth of new blood vessels from pre-existing ones and is the fundamental step in the transition of tumors to a malignant state (Weidner et al., 1991). It can by triggered by activation of Hypoxia-inducib le factors (HIFS), which are transcription factors that respond to changes in availa ble oxygen in the cellular environment (Smith et al., 2008). HIF-1 can induce the expression of VEGF (vascular endothelial growth

PAGE 24

13 factor), which is necessary for the fo rmation of new blood vessels (Dachs and Tozer, 2000). P53 can mediate the MDM2-dependent proteos omal degradation of the alpha subunit of HIF-1, ther efore downregulating VEG F expression (Ravi et al., 2000). P53 can also upregulate a number of anti-angiogenic and metastasis suppressor proteins, such as Tsp-1 and Nm23-H1 (Bouvet et al., 1998). Moreover, a number of matrix me talloproteinases, such as MMP-1 and MMP-13, that promote tissue invasion by causing extra cellular matrix degradation are repressed by activated p53. (Sun et al., 2000; Sun et al., 1999). Therefore, loss of p53 activity could lead to uncontrolled blood vessel growth and eventually metastasis of tumor cells. Transcriptional Repression In addition to serving as a DNA bind ing transcriptional activator, p53 has been reported to play a role in repression at a variety of promoters. As previously mentioned, p53 can negatively regulate the hTERT gene by interfering with the coactivator sp-1 binding at its promoter, contributing to the in duction of cellular senescence (Xu et al., 2000). P53 can also mediate cell cycle arrest by not only upregulating p21 and 14-3-3 but also by repressing cyclin B and cdc2 (Krause et al., 2000). P53 transcriptional repression can also influence apoptotic activity by downregulating Survivin, a putative caspase inhibitor (Hoffman et al., 2002). P53 can actually compete with other transcription fact ors for binding to certain target promoters, such as AFP (alpha-fetoprotein gene), which results in the overlapping of DNA binding for p53 and HNF-3. This leads to displacement of HNF-3 and a reduction of AFP transcription (Lee et al., 1999). Transcriptional repression also s eems to be partially due to the association of p53 with basal transcripti on machinery. For example, p53 has been shown to interact with TATA-box binding protein (TBP) and TBP-associated factors, which leads to p53 repressed basal transcription via disruption of the preinitiation complex assembly (Seto et al., 1992). However, recent reports have suggested that the p53-TBO interaction is not sufficient for transcriptional repression by p53 and that it involves the interaction of other factors called TAFs (TATA box binding protein associated factor) (Farmer et al., 1996).

PAGE 25

14 P53 can also alter the chromati n structure by recruiting histone deactylases and methyltransferases. P53 has been shown to physically interact with HDACS in vivo and even decrease histone acetylati on at certain promoters, such as Survivin (Murphy et al., 1999) Histone methyltransferases SUV39H1 and EHMT1 bind specifically to MDM2 and, following the formation of a SUV39H1/EHMT1-MDM2-p53 complex, increase H3 K9 methylation at p53 target promoters and cause a decrease in p53 mediated transcription (Chen et al., 2010). MDM2 also interacts with se veral other transcription repressors, including YY1 and KAP1, and it is presum ed that under certain conditions these interactions can actively repress basal acti vity of p53 target genes by recruiting these corepressors to p53 ta rget promoters (Sui et al., 2004; Wang et al., 2005). Regulation of p53 The p53 protein is normally maintained at low levels in unstressed cells with a short half-life to prevent unnecessa ry cell death (Shu et al., 2007). Once cells encounter stress, post-translationa l modifications occur, leading to an increase in p53 levels due to stabilizati on (Lakin and Jackson, 1999; Saito et al., 2003). This accumulation, fo llowed by p53 activation, resu lts in the transcription of genes involved in multiple cellular processes necessary to prevent the accumulation of errors in the genome and the outgrowth of cells with malignant potential (Ko and Prives, 1996; Lev ine, 1997). Increases in rates of transcription and translation may affect the cellular level of p53, but post-translational modifications, such as ubiquitination, phosphorylation acetylat ion, methylation, sumolyation and neddylat ion are the most efficient ways to increase p53 stability and activity (Appella and Anderson, 2000). The fact that p53 is highly regulated at the post-translational le vel greatly underscores its importance in maintaining cellular homeostasis.

PAGE 26

Figure 3: p53 Posttran slational Modifications. (Meek and Anderson, 2009). P53 Ubiquitination 15 P53 was first shown to be ubiquitinat ed by cellular factors associated with viral E6 protein in papilloma virus infect ed cells (Scheffner et al., 1993). Later it was determined that p53 is ubiquiti nated and degraded mainly through the proteosomal pathway (Chowdary et al ., 1994). Ubiquitin begins with the formation of the thioester bond between a cysteine residue of an E1 ubiquitinactivating enzyme and the terminal glyci ne residue of ubiquitin. Next, the ubiquitin is transferred to a ubiquitinconjugating enzyme E2, which links the ubiquitin molecular to the -amino group of a lysine resi due on the target protein. Once activated E2 is able to ubiquiti nate a substrate but needs the targeting function provided by E3 ligases. These E3 ligases are divided into two classes, depending on whether they cont ain a HECT domain or a RING domain (Pickart and Eddins, 2004). Once the polyubiquitin chains are attached to the target

PAGE 27

16 protein, the protein is then subjected to 26S prot eosomal degradation (Glickman and Ciechanover, 2002) In normal cells the MDM2 E3 ligase has been shown to bind p53 and direct degradation via ubiquitin-dependent proteolysis (Haupt et al., 1997; Honda et al., 1997; Kubbutat et al., 1997). In the absence of st ress signals the p53 protein is kept at low levels in order to allow normal ce ll proliferation and maintain cell viability. Therefore, p53 assists in its own gene regulation by driving the gene expression of MDM2, creating a negativ e feedback loop (Wu et al., 1993). (Haupt et al., 1997)Ubiquitination by MDM2 has actually been shown to catalyze either monoubquitinat ion or polyubiquitination of p53 in a dose-dependent manner (Li et al., 2003). Low levels of MDM2 induce monoubquitination and nuclear export of p53, in contrast to hi gh levels of oligomerized MDM2, which promote polyubiquitination and nuclear degradation of p53 by providing a recognition signal for the 26S proteosome (Cheng et al., 2009). It is likely that these distinct mechanisms are exploited under differ ent physiological settings. In addition to MDM2, other E3 ligases can mediate the ubiquitination and degradation of p53, including Pirh2 and COP1. Both these genes are also p53 inducible, thus, similar to MDM2, create a negative feedback loop (Barak et al., 1993; Dornan et al., 2004; Leng et al., 2003). Pirh2, a RING domain-H2 containing, interacts with p53 and promotes MDM2-independent p53 ubiquitination and degradation (Leng et al., 2003). COP1, also an E3 ligase, promotes MDM2-independent p53 ubiqu itination and degradation, and knockdown of COP1 enhances p53 mediated G1 arrest and sensitizes cells to ionizing radiation (Dornan et al., 2004). AR F-BP1, a recently identified E3 ligase that contains a HECT domain that was purified as an ARF-BP 1 binding protein, can also ubiquitinate and degrade p53. ARF-BP1 inactivation has been shown to induce tumor suppression in p53 wild-type cells However, it is important to note that it has also been shown to i nduce tumor suppression in p53 null cells, suggesting that ARF-BP1 has both p53-independent and p53-dependent functions (Chen et al., 2005a). E4F1 is an atypical ubiquitin ligase, as it facilitates p53 ubiquitination, but not for degradation. Rather, ubiquitination at the

PAGE 28

17 Lysine 320 residue seems to affect onl y p53 dependent cell cycle arrest, not apoptosis (Le Cam et al., 2006). Together, these proteins represent an array of E3 ligases that the cell requires to regul ate p53 stability, suggest ing that the cell utilizes both MDM2-independent and MDM2-dependent mechanisms to maintain tight regulation of p53. Deubiquitinates are specific protease enzymes that catalyze the removal of ubiquitin from substrates. The enzym es do this by cleaving the isopeptide bond between ubiquitin and th e substrate. The He rpesvirus-AssociatedUbiquitin-Specific-Protease (HAUSP) was first identified as a cellular factor that bound to Herpes simplex virus type 1 regul atory protein ICP0 (Everett et al., 1997). HAUSP can bind to and stabilize p53 by directly removing the ubiquitin in order to induce growth arrest and apoptosis (Li et al., 2002a). It has also been demonstrated that the p53-HAUSP interaction is enhanced under DNA damage (Li et al., 2002a; Lim et al., 2004). Howeve r, siRNA knockout of HAUSP in wildtype p53 containing cells resulted in p53 st ability. This is because HAUSP can also interact with MDM2 and deubiqui tinate it under certain conditions, suggesting that HAUSP is required to mainta in sufficient levels of MDM2 in order to keep p53 levels regulated (Li et al., 2004). P53 Phosphorylation There are multiple residues in both the amino terminus and the carboxyl terminus of p53 that are phosphorylated or dephosphorylated in response to genotoxic stress, for a total of 23 sites (Appella and Anderson, 2001). Upon DNA damage, ATM, Chk1 and Chk2 phosphorylat e p53 on several serine residues. ATM phosphorylates Ser-15 and Chk2 phosphorylates Ser-20. These modifications eliminate the p53-MDM2 in teraction followin g double strand DNA breaks (Canman and Lim, 1998; Hirao et al., 2000; Unger et al., 1999). Threonine 18 phosphorylation by Chk2 is also important for destabilizing the MDM2-p53 interaction (Schon et al., 2002) Phosphorylation at these three residues helps recruit other regulatory factors, such as p300, CBP and pCAF to p53 in order to facilitate p53 acetylation (Li et al., 2002b). However, there have been reports that when all serine residues were changed to alanine, p53

PAGE 29

18 continued to display wild-type stability and transactivation (Wahl, 2006). Mouse models with similar mutations at Ser15 and Ser-23 (equivilant to Ser-18 and Ser-20) had modest, tissue-specific deficie ncies and did not destabilize p53, as one would have predicted if they were crit ical residues for blocking MDM2-p53 binding following DNA damage (MacPherson et al., 2004; Sluss et al., 2004; Wu et al., 2002). The difficulty in showi ng strong phenotypic changes when these sites are mutated suggests a more comple x role for these events. In fact, modifications to MDM2 may be required to efficiently block the MDM2-p53 interaction following stress. For example, MDM2 can also be phosphorylated on Ser-395 by the ATM pathway and can be phosphorylated on Tyrosine 394 by cAbl, both shown to destabilize MDM2p53, resulting in p53 stabilization (Goldberg et al., 2002; Mayo et al., 1997). Phosphorylation of p53 on Ser-33, Th r-81 and Ser-315 pr omotes Pin1-p53 interaction, a regulator of p53 following genotoxic stress, and results in a p53 conformational change and activation of p53 (Zheng et al., 2002). DNA-PK has also been shown to induce phosphorylation on N-terminal residues of p53, which is necessary but not sufficient alone to initiate p53-DNA binding (Woo et al., 1998). Oncogenic stress signaling by Ras can stimulate Ser-33 and Ser-46 phosphorylation on p53 by stress kinase p38 and has been reported to result in senescence and tumor suppression (Bulavin et al., 2002; Ferbeyre et al., 2002). Phosphorylation has been shown to contribu te to p53 gene target specificity, as is the case with CDKs, PKC and CKII phosphorylation on Ser-315, 378, and 392 (Bischoff et al., 1990; Delphin and Baudier, 1994; Hall et al., 1996). On Ser-46, p53 can be phosphorylated by DRK2 follo wing severe DNA dam age resulting in p53-mediated apoptosis. HIPK2, which lead s to dissociation of MDM2-p53 also induces p53-mediated apoptosis (Di Stefano et al., 2004; Oda et al., 2000b). Inhibitory phosphorylation also exists. For example, phosphorylation of Ser-215 by aurora kinase A overrides p53 DNA da mage induced stress response (Liu et al., 2004) Conversely, there are also sites t hat are constitutively phosphorylated under normal conditions that undergo dephos phorylation during stress, resulting

PAGE 30

19 in p53 activation. For example, Se r-376, when dephosphoryl ated following DNA damage, enhances p53-14-3-3 interaction and increases p53 DNA binding affinity (Stavridi et al., 2001). Dephosphorylation can also have inhibitory effects on p53 activity. The NOTCH-1 protein can bind p53 and inhibit phosphorylation on Ser-15, 37 and 46, leading to a decrease in p53 activation (Kim et al., 2007). P53 Acetylation Acetylation is the covalent linkage of an acetyl group to lysine residues located on histone tails and other proteins, such as transcription factors. It is involved with transcriptional regulation and correlates with an increase in transcriptional activity (Kouzarides 2000). CBP/p300, a histone acetyltransferase (HAT), acts as a coactiva tor of p53 and an increas e in p53-CBP/p300 association is observed following DNA damage. This interaction enhances p53 acetylation and results in its activation (B arlev et al., 2001). PCAF also has been shown to acetylate the c-terminus of p53, resulting in its activation (Appella and Anderson, 2001). MDM2 has been shown to inhibt the intera ction of p53 and p300 in normal cellular conditions (Ito et al., 2002). Phosphorylation at the Nterminus has been implicated in facilitatin g an increase in acetylation and in CBP/p300 and PCAF binding (Avantaggiati et al., 1997; Dumaz and Meek, 1999; Gu et al., 1997; Lill et al ., 1997). Acetylation may have an even more direct role in p53 stabilization, as it was shown t hat c-terminal p53 acetylation can inhibit MDM2 mediated ubiquitination, further emphasizing how cr itically important this process is for the activation of p53 (Chuikov et al., 2004). Histone deacetylase complexes ( HDACs) are often associated with corepressor complexes and repress both histone and non-histone proteins by removing acetyl groups. Much less is known about HDAC activity on p53 function. However, it was recently shown that Sir2 (SIRT1), a NAD-dependent histone deacetylatse can deacetyate p53 and attenuate its transcriptional activity (Vaziri et al., 2001). It is not known if deacetylation can also serve as an important step in MDM2 -mediated p53 degradation.

PAGE 31

20 P53 Methylation Histone and protein methylation is now recognized as an important modification linked to both transcrip tional repression and activation (Margueron et al., 2005). It is believed that methylatio n of lysine residues on target proteins can influence the signaling po tential of the modified pr otein, leading to diverse physiologic consequences (Shi et al., 2007). Recent r eports indicate that there are multiple residues on p53 that can be methylated, affecting its transcriptional activity. Set7/9 monomethylation of p53 and Lys-372 activates p53 via stabilization of chromatin-associated p53 (Chuikov et al., 2004). Set 8 monomethylates p53 at Lys-382, which supp resses p53-mediated transcriptional activity. In fact, Set8 expression is downregulated upo n DNA damage (Shi et al., 2007). Smyd2 monomethylated p53 at L ys-370, repressing p53 activity which can be impeded by Set7/9 methylation at Lys-372 (Huang et al., 2006). P53 can also be demethylated by the lysine dem ethylase, LSD1, removing both di-and monomethylation at Lys-370. This demethylase activity represses p53-mediated transcription and inhibits p53-dependent apoptosis (Huang et al., 2007). It is important to note that wh ile we know monometylatio n occurs at Lys-370 via Smyd2 activity, it is not yet known what methyltransferase creates dimethylation at this particular site on p53. P53 Neddylation and Sumoylation The Nedd8 protein is in the ubiquitin-like family of proteins and uses E1 activating and E2 transferring enzymes, simila r to that of ubiquitin. Neddylation inhibits p53 transcriptional activation via MDM2 (Xirodim as et al., 2004). MDM2 acts as a specific E3 Nedd8 ligase fo r p53 and also itself. C-terminal glycine residue of Nedd8 can be covalently linked to Lys-372, 372 and 373 of p53. P53 proteins with mutations at these residues ar e no longer transcriptionally inhibited. These neddylation residues overlap with ly sine residues that can be ubiquitinated and acetylated, however, it is not k nown whether there are de-neddylation pathways or if neddylation is in competit ion with ubiquitin and acetylation, with one process favoring the other in certain conditions.

PAGE 32

21 Sumolyation is similar to ubiquiti nation in that an isopeptide bond is formed between the C-terminal carboxy group of the sma ll ubiquitin-like protein SUMO1 and the -amino group of a lysine residue in the target protein. It has been shown that p53 sumolyatio n on Lys-386 can enhance tr anscriptional activity and, similar neddylation, seems to be regulated by MDM2 and also ARF mediated nuclear targeting (Chen and Chen, 2003; Gostissa et al., 1999). P53 Mutations in Cancer P53 mutations occur in more than 50% of human cancers. A distribution of organ specific tumors and percentages of p53 gene mutation s are depicted in Figure 4. The most common mechanism in wh ich p53 is inactivated are point mutations (93.6%), which have been identi fied in more than 250 codons of p53. About 95% of these lie in the core DNA binding domain of p53, while only about 5% of the mutations are found in the regulatory domains ( Figure 5) These DNA binding domain mutations incapacitate the ability of p53 to transactivate the target genes that are necessary for mediation of p53 tumor suppressor functions. Of these point mutations, 75% occur as a single missense mutation in one allele of p53, rather than deletions, insertions or frameshifts. The second wild-type allele is generally also lost (loss of heterozygosis, LOH), resulting in genetic instability. In fact, a germ-line mutation in just one of the two p53 alleles abrogates p53 function and predisposes humans to cancer (Li-Fraumeni syndrome). This creates an extremely stable mutant p53 pr otein that is seen at high expression levels in cancer cells. There can also be a dominante negative effect from the mutant p53, forming inac tive hetero-oligomer s with the wild-type p53, rendering it inactive (de Vries et al., 2002). A majority of these point mutations will either affect the structural int egrity of p53 or its ability to contact DNA directly.

PAGE 33

Figure 4: Distrubution of Cancers and p53 Mutations. Soussi, Thierry. Online Posting. The TP53 Website n.d. Web. 14 Oct. 2010. 22

PAGE 34

Figure 5: Distribution of p53 point mutations. Lodish, et. al. Molecular Cell Biology 4th Addition New York: W. H. Freeman, 2000. 23 There are six hotspot mutations that are clustered in the DNA binding surface; two affect p53 DNA contact Arg248 and Arg273 and four affect the structure of the p53 DNA binding surfac e Arg175, Gly245, Arg249 and Arg282. The contact mutations are capable of maintaining a wild-type conformation, however, the p53 DNAbinding capability is severely compromised. In fact, the most prevalent point mutation that occurs in human cancer is Arg 248 (Ory et al., 1994). Structural mutations result in an altered conformation in p53, also decreasing its ability to bind DNA (Legros et al., 1994). There are also less common point mutations that affect p53 thermostability, oligomerization and interactions with other proteins. Some mutants of p53 have even been suggested to have oncogenic activity by gai n-of-function mechani sms (Dittmer et al., 1993; Harvey et al., 1995) For example, mice wit h the Val135 mutation in one allele exhibited accelerated tumor development and an altered tumor spectrum, compared to the wild-type only counterparts (Harvey et al., 1995).

PAGE 35

24 Non-Mutated p53 in Cancer The remaining 50% of cancers that do not contain mutant p53 actually suppress p53 by disrupting its activity. One of the mechanisms is through inhibition by viral oncoprotiens. In adenovirus transformed cells, the EIB oncoprotein can bind to p53 and inhibit it s transcriptional transactivation by blocking PCAF acetylation (Liu, Colosimo et al. 2000; Zhao a nd Liao 2003). The E6 protein of human papillomavirus ty pes 16 and 18 facilitates the rapid degradation of p53 via ubiq uitin dependent proteolytic degradation. The E6 protein binds to the cellular E6-AP protei n, and this complex in teracts with p53 to induce ubiquitination (Sc heffner et al., 1993). Likewise, cellular proteins that r egulate the activity of p53 cause many wild-type p53-inactivating lesions. For example, MDM2 overexpression through gene duplication enhances transcription or tr anslation and is frequently observed in tumors that retain wild-type p53 ( Landers, Haines et al. 1994; Momand, Jung et al. 1998; Phelps, Darley et al. 2003). Increased expression of MDM2 leads to the continuous degradation of p53 and therefore suppresses its activity, even under conditions of cellular stress. Hypomorphic MDM2 mice that express reduced levels of MDM2 show enhanced p53 activity, but without an increase in p53 protein levels. This suggests that MDM2 mediated degradation is not the only way it inactivates p53 (Mendrysa, McElwee et al. 2003). MDMX, a MDM2 homologue, is also overexpressed in several tumor types, particularly retinoblastomas. MDMX overexpression does not lead to a reduction in p53 levels, but rather a reduction in transcriptional activity (Danovi, Meulmeester et al. 2004). Proteins that are furt her upstream in the p53 pathway are inactivated in some tumors. For example, the loss of the INK4A locus through deletions, mutations or DNA methylation is frequently seen in cancers (Sherr, 2001). This gene codes for the ARF protein that binds directly to MDM2, preventing MDM2mediated degradation of p53 following mitogenic stress. Without ARF, tumors with oncogene activation signaling cannot reach p53 (Ruas and Peters, 1998). Mutations in upstream proteins critical in the DNA damage pathway are also

PAGE 36

25 frequently inactivated in cancers with wild -type p53. For example, AT (human disease ataxia-telangiectasia) patients have mutations in the ATM protein, leaving p53 unphosphoryl ated following DNA damage and unable to transcribe proteins needed for its tumor suppressor ac tivity (Maya, Balass et al. 2001). LiFraumeni-like syndrome patients that have wild-type p53 have Chk2 germline mutations that behave in a similar manner to those with ATM mutations (Bell, Varley et al. 1999). Thus, human tumo rs frequently select for not only p53 mutations itself, but mutations in its regulatory proteins to promote tumor progression. P53 as a therapeutic Target The p53 pathway provides an import ant target for drug therapy because a damaged p53 pathway provides a key diffe rence between tumor cells and normal cells (Bell and Ryan, 2007). In fact, loss of p53 function has been linked with unfavorable prognosis and is indicated by more aggressive tumors, early metastasis and decreased survival rate (G allagher and Brown, 1999). Multiple studies have indicated that loss of p53 function confers increased resistance to anti-tumor agents (Lowe, Bodis et al. 19 94; Ruley 1996). There are two main strategies employed by researchers to r eactivate p53 signaling: restore wild-type function to mutant p53 and rescue the func tionality of wild-type p53 that has been compromised by loss or over-expression of its regulators. There are three types of cancer ther apies that target mutations within p53 itself. One cancer p53-oriented therapy ta rgets the p53 dysfun ction itself using pharmacological agents. PRIMA-1 and CP-31398 ar e compounds that have been found to restore transcriptional trans activation function and reduce tumor size in animal models with both DNA binding and conformational mutants (Foster, Coffey et al. 1999; Bykov, Iss aeva et al. 2002). Another method would be to restore functional activity of p53 mutants using a second site suppressor mutation. In theory, these second site mutations will restore the stability of mutant p53, resulting in the restoration of normal p53-DNA binding function. One example is the second site mutant N239Y that can restore the hotspot mutation G245S, resulting in increased p53-DNA bind ing (Nikolova, Wong et al. 2000).

PAGE 37

26 Unfortunately, the practica lity in creating these sec ond site suppressors in a clinical setting is not optimal. A third approach to treating mutant p53 containing tumors is the use of gene replacement therapy with wild-type p53 or proteins that selectively target mutant p53 cells. Using genetic engineeri ng, researchers are looking at both viral and non-viral ways to introduce wild -type p53 in hopes to restore its tumor suppressor function and to increase sensit ivity to conventional anti-tumor agents, such as chemotherapy or radiation. A candidate for this type of therapy are retroviruses, which integrate stably into the genome of infected cells, require cell division for transduction and are used in t he majority of approved gene transfer clinical protocols (Roth and Cristiano, 1997). It has been de monstrated that retrovirus gene transfer or wild-type p53 into human lung tumor cells and xenograft models could lead to inhibition of tumor cell growth, which was limited to tumor cells null or mutated for p53 (C ai, Mukhopadhyay et al. 1993; Fujiwara, Grimm et al. 1993; Fujiwara, Cai et al. 1994). Although promising, this type of treatment is in its infancy and requires further improvements before becoming part of the standard care. A nother gene therapy that spec ifically targets mutant p53 cancers cells involves an adenovirus called ONYX-015, which encodes the E1b protein that specifically targets p53. In this case the virus is engineered with a specific defect that causes it to selectively target cells with or without mutant p53. Preliminary research on animal models were promising, however, preclinical testing has been less effect ive, although better results have been obtained when combined with conventiona l chemotherapies (Heise, SampsonJohannes et al. 1997; Yang, You et al. 2001). Rescuing the functionalit y of wild-type p53 that ha s been compromised by loss or overexpression of its regulat ors is another popular approach for the development of p53 based cancer therapies. MDM2 is an essential regulator of p53 and is a key target in discovering therapeutic ways to activate p53, particularly in tumors that retain wild-ty pe p53 but have a functionally inactivated pathway through MDM2 overexpression or amplifications. Reactivating p53 could serve as a means to reduce tumor size or eliminate tumors all together.

PAGE 38

27 The discovery of a small molecular compund, called Nutlin-3 (a cis-imidazoline analog), has been shown to inhibit t he p53-MDM2 binding with a low IC50 (Bottger et al., 1996). Nutlin-3 treat ment results in p53 stabilzation and transcriptional activation, le ading to cells that undergo cell cycle arrest and inhibition of tumor growth in vivo (V assilev 2004; Vassilev, Vu et al. 2004; Vassilev 2005). It is important to note that this compound w ould be unable to target tumor cells overexpressing t he MDM2 homolog, MDMX. Although they have similar N-terminal binding regions for p53, Nutlin does not disrupt the MDMX-p53 interaction, therefore more work needs to be done to identify small molecular inhibitors specific for disrupti on of MDMX-p53 binding (Hu et al., 2006). For instance, using a phage display library, our lab identified a peptide sequence that blocks both MDM2 and MDMX-p53 bi nding. P53 activation and growth arrest are greater with t he addition of the peptide than with blocking MDM2-p53 binding alone (Hu et al., 2007). The E3 ligase activity of MDM2 has also been used as a therapeutic target and identification of small mole cules that interfere with th is activity have resulted in suppression of ubiquitination (Lai, Yang et al. 2002; Yang, Ludwig et al. 2005). One would conjecture that a problem would be lack of specificity, however, preliminary studies reveal ed that one of the compound s was selective for MDM2 with no off target effects and the co mpounds differentiated between MDM2 ubiquitination of p53 and self-ubiquitination. Oncogene MDM2 History of MDM2 The MDM2 (murine double minute 2) pr otein was first identified as the product of gene amplification on muri ne double-minute chromosomes in a 3T3DM spontaneously transformed mouse cell li ne (Cahilly-Snyder et al., 1987). Overexpression of MDM2 resulted in tumo r formation in nude mice and leads to transformation of primary rodent fibroblasts in cooperation with Ras, suggesting an oncogenic role for MDM2 (Fakharzadeh, Trusko et al. 1991; Finlay 1993). The human homologue of MDM2 (also re ferred to as HDM2) has been mapped to chromosome 12q14.3-15. In a subseq uent study MDM2 wa s co-purified with

PAGE 39

p53 and found to inhibit p53 transcriptional activity and negatively regulate its stability, providing a mechanism for it s oncogenic properties (Momand, Zambetti et al. 1992; Oliner, Pietenpol et al. 1993). Concurrent ly, several tumor types have been shown to have amplified MDM2, including many osteosarcomas and soft tissue sarcomas that retained wild-type p53 (Momand et al., 1998). MDM2 Structure The MDM2 gene is conserved across mammalian species and found in other multicellular organisims (Momand et al., 2000). Expression of MDM2 is found ubiquitously and at low levels in normal human tissues. The human MDM2 gene is composed of 12 exons and 491 amino acids in length with a predicted molecular weight of 56 kD a. The MDM2 gene can be transcribed from two different promoters: an upstream constitu tive promoter (P1) and a second (P2) promoter within the first in tron that is responsive to p53 (Barak et al., 1994). MDM2 is a member of the RING finger domai n family of E3 ubiq uitin ligases that contains four domains. These inclu de: an N-terminal domain (aa 19-102), a central acidic domain (aa 223-274), a zinc finger (aa 305-322) and a C-terminal RING domain (aa 438-478) ( Figure 6 ). Figure 6: MDM2 Structure. The MDM2 protein contains an N-terminal/p53binding domain, a central acidic domai n, a zinc finger domain and C-terminal RING finger domain. MDM2 also has a nuclear localization and nuclear export signal. 28 The N-terminus of MDM2 contains a p53-binding domain that interacts with the transactivation domain of p53. The binding between MDM2 and p53 has been shown to prevent the association of tr anscriptional co-activators, inhibiting p53 transactivation function (Momand, Zam betti et al. 1992). The binding of MDM2 to p53 also mediates the transloca tion of p53 from the nucleus to the

PAGE 40

29 cytoplasm, which is dependent on the ability of MDM2 to bind to and ubiquitinate p53 (Geyer et al., 2000). However, ther e are recent studies that have shown MDM2 constructs without the N-terminus p5 3-binding domain retain the ability to bind to and inhibit p53 acti vity (Ma, Martin et al. 2006). The p53 amino acids essential for p53 binding to MDM2 in clude phenylalanine 19, tryptophan 23 and lysine 26 (Lin, Chen et al. 1994). MDM2 contains both a nuclear loca lization and a nuclear export signal between the N-terminal domain and the central acidic domain, however, the protein is primarily localized in the nucleus (Hay and M eek 2000). There is also a nucleolar localization si gnal found in the C-terminus of MDM2, which is required for MDM2 to localize to the nuc leolus in the presence of the ARF tumor suppressor. This leads to stabilization of p53 in response to oncogene activation (Lohrum, Ashcroft et al. 2000; Weber, Kuo et al. 2000). The MDM2 central acidic domain has been shown to play an important role in p53 ubiquitination and degradation (Argentin i, Barboule et al. 2001; Kawai, Wiederschain et al. 2003; Meulmeester, Frenk et al. 2003). The acidic domain is also required for MDM2 binding to a number of proteins that can either attenuate or enhance its activity, including p14ARF, p300, YY1, ribosomal subunits, KAP1 and SUV39H1 (Pomerantz, Schreiber-Agus et al. 1998; Grossman, Deato et al. 2003; Zhang, Wolf et al. 2003; Jin, Itahana et al. 2004; Su i, Affar el et al. 2004; Wang, Ivanov et al. 2005; Chen, Li et al. 2010). The central domain also contains a cluster of serine and th reonine residues that are sites for phosphorylation and import ant for regulation of MDM2 function. Serines 240, 242 and 246 are CK1 phosphorylation sites, Ser-2 56 is a site targeted by GSK3 and Ser-269 is targeted by CHK2 following DNA damage, impairing the MDM2-Rb interaction and subsequent proteosomal degradation of pRb (Winter, Milne et al. 2004; Allende-Vega, Dias et al. 2005; Kulikov, Boehme et al. 2005). In addition, it has been revealed that the ce ntral acidic domain contains a second p53 interaction site that binds to the core of p53 and is sufficient to target p53 for ubiquitination in vitro (Burch, Midgley et al. 2000; Shimizu, Burch et al. 2002; Ma, Martin et al. 2006).

PAGE 41

30 MDM2 harbors a central zinc finger domain between the acidic domain and the C-terminal RING domain. In the ca se of MDM2, the zinc finger domain is critical for mediating the MDM2-ribosomal protein interaction and its ability to degrade p53 under ribosomal conditions (Lindstrom, Jin et al. 2007). MDM2 also contains a C-terminal RING domain with two zinc ions coordinated by a Cis3-His2-Cis3 consensus that is essential fo r proper folding of the domain (Boddy et al., 1994). The RI NG domain is typically involved in protein-protein interactions (Bor den, 2000). CBP/p300 interaction and subsequent acetylation occurs at particula r lysine residues in the RING domain leading to inhibition of the ubiquitin ligas e activity (Wang et al., 2004). The RING can also bind specifically to 5S RNA, alth ough this interaction and its function is poorly understood (Elenbaas et al., 1996). Likewise, the domain is critical for binding nucleotides, strongly preferring ATP, which is important for translocation of MDM2 from the nucleoplasm to the nucleolus (Poyurovsky, Jacq et al. 2003). MDM2 is also capable of self-oligomerization through its RING domain and heterodimerizing with MDMX. The RI NG domain is also necessary for MDM2 ubiquitin E3 ligase activity towa rds p53 and MDMX, as well as itself (Tanimura, Ohtsuka et al. 1999; Borden 2000; Fang, Jensen et al. 2000; Honda and Yasuda 2000; Poyurovsky, Priest et al 2007). A knock-in mouse model of MDM2 with a point mutation inactivating t he RING domain functi ons is embryonic lethal and is rescued in a p53 null background, indicati ng it is essential for MDM2-mediated suppression of p53 (Itahana, Mao et al. 2007). This area also contains a cryptic nucleolar localizati on signal that is only revealed upon interaction with p14ARF (Lohrum, Ashcroft et al. 2000). MDM2-p53 Interaction MDM2 is a vital regulator of p53, thus this interaction is controlled through several mechanisms. The direct intera ction between p53 and MDM2 is mediated by a hydrophobic pocket domain locate d in the N-terminus of MDM2 and residues 18-26 in the N-terminus of p53 (Chen, Marechal et al. 1993; Kussie, Gorina et al. 1996). p53 mutants that can not bind MDM2 are resistant to degradation by MDM2, and mutations of crit ical N-terminal residues in MDM2

PAGE 42

31 lack p53-binding (Freedman, Epstein et al. 1997; Kubbut at, Jones et al. 1997). There are three critical p53 hydrophobic residues that fit into the hydrophobic cleft of MDM2 (Phe-19, Trp-23 and Leu-26) and are the target of the previously described MDM2-p53 small molecule inhibitor Nutlin. The MDM2-p53 interaction allows MD M2 to control p53 through two distinct mechanisms: directly binding and masking the N-terminal transactivation domain and promoting ubiquitin-depend ent proteosomal 26S degradation (Momand, Zambetti et al. 1992; Haupt, Maya et al. 1997). By binding to the p53 transactivation domain, MDM2 is able to transcriptionally inactivate p53 by blocking the recruitment of coactivators and transcriptional machinery. The most prominent target of MDM2 E3 ubiquitin liga se activity is p53, which is constantly being ubiquitinated by MDM2 However, mutants of MDM2 that lack E3 ligase activity can still bind wild-type p53 and, al though significantly hindered, inhibit p53-mediated transcriptional activation (L eng et al., 1995). The extent of ubiquitination can also determine the fate of the p53 protein. Po lyubiquitination is believed to target p53 for proteos omal degradation and monoubiquitination assists in nuclear export, both regulati ng p53 localization and its function as a transcription factor (Freedman and Levine 1998; Roth, Dobbelstein et al. 1998; Yang and Yu 2003). Recent studies have shown that MDM2 requires p300 to catalyze p53 polyubiquit ination, but MDM2 alone can only catalyze monoubiquitination (Zhu, Yao et al. 2001). MDM2 can also promote its own degradation by autoubi quitination and ub iquitination of MDMX, promoting p53 stabilization and transcriptional activation (Fang, Jensen et al. 2000). MDM2 can influence other forms of p53 posttranslational modifications, such as acetylation, sumolyation and neddylation. MDM2 suppresses CBP/p300 mediated p53 acetylation, increasing its ability to be ubiquitinated and degraded (Grossman, Perez et al. 1998). MDM2 mediated p53 sumoylation enhances p53 activity, while promotion of neddylati on leads to the inhibition of p53 transcriptional activity (Chen and Chen 2003; Xirodimas, Saville et al. 2004). MDM2 is also a transcriptional target of p53, creating an autoregulatory feedback loop (Momand, Zambetti et al. 1992; Barak, Juven et al. 1993; Wu,

PAGE 43

32 Bayle et al. 1993). The MDM2 gene contains two promoter regions: P1 that is thought to be constitutively on, and P2 that contains two p53 responsive elements (Montes de Oca Luna et al., 1995). The ability of the cell to maintain p53 at low levels is critic al for cellular survival and to allow for cell cycle progression. Similarly, decreasing p53 activity will lead to a decrease in MDM2 protein levels. Therefore, the ratio of MDM2 to p53 protein is critical for the correct response to multiple cellular condi tions. In support of this relationship was the observation that the lethalit y of MDM2 null mice is rescued by simultaneous knockout of p53 (Jones, Ro e et al. 1995; Montes de Oca Luna, Wagner et al. 1995). Several reports suggest that MDM2 has additional non-degradation mechanisms for regulating p53 activity A previous study showed that a temperature-sensitive p53 mu tant does not bind to DNA after forming a complex with MDM2 (Zauberman et al., 1993). EMSA ex periments showed that full-length MDM2 does not interact with p53-DNA complex, suggesting that p53 binding to DNA and MDM2 are mutually exclusive (Burch et al., 2000). However, a GSTMDM2-1-188 fragment was able to super-s hift p53-DNA complex (Bottger et al., 1997). More recent work shows that MD M2-hsp90 complex inhibits DNA binding by p53 in vitro and induces p53 unfolding (Burch et al., 2004). However, conflicting results suggest that MDM2 acts as a chaperone to promote p53 folding and stimulates p53 DNA binding in vitro (Wawrzynow et al., 2007). A recent study monitored p53 conforma tion under conditions in which MDM2 mediated degradation was inhi bited and showed that MDM2 binding promotes conformational change, which preceded p53 ubiquitination and degradation (Sasaki et al., 2007). MD M2-mediated conformational change may expose lysine residues on p53 for ubiquitination, which can be opposed by overexpression of hsp90 (Nie et al., 2007; Sasaki et al., 2007). MDM2 Regulation DNA Damage MDM2 is also controlled at the post-translational level. Upon DNA damage, several kinases can phosphorylate MDM2 on several of its serine or

PAGE 44

33 threonine residues which modulate th e p53-MDM2 interaction (Moll and Petrenko, 2003) ( Figure 7). The DNA-activated prot ein kinase (DNA-PK) has been shown to phosphorylate MDM2 at serine 17, located in the p53-binding site leading to decreased binding affinity to p53 (Meek and Knippschild, 2003). ATM, an important DNA damage responsive kinase, phosphorylates MDM2 at Ser-395 in the RING domain, disrupting the nuclear export signal necessary for efficient p53 export to the cytoplasm (Maya, Balass et al. 2001). The tyrosine kinase cAbl, whose activity is stimulated by ATM, phosphorylates MDM2 on Tyr-394, suppressing MDM2 mediated degradatio n of p53 and contributing to DNA damage induced apoptosis (Goldberg, Vogt Sionov et al. 2002). In response to growth factors, the PI-3 kinase pathway activated a signaling cascade that promotes cell growth and survival. This included activation of AKT, a serine/threonine kinase, that phosphorylates MDM2 on multiple residues leading to MDM2 stabilization and increased p53 su ppression (Ogawara, Kishishita et al. 2002). The mitogenic p38 kinase (MAPK) also phosphorylated MDM2 at the same sites of AKT, resulting in a si milar outcome (Weber et al., 2005). Modifications of MDM2 by cyclin-CDK complexes (cyclin A-CDK2 and cyclin ACDK1) stimulated the interaction between MDM2 and ARF and decreased the interaction between MDM2 and p53 (Meek and Knippschild, 2003). The CK2 kinase has also been shown to phosphoryl ate MDM2, although the significance of this modification is currently unknown (Meek and Knippschild, 2003).

PAGE 45

Figure 7: MDM2 Regulation. Regulation of the MDM2 and p53 interaction following DNA damage and mitogenic stress. 34 Dephosphorylation is also a potential mechanism for MDM2 regulation. The association of MDM2 with cyclin G-protein phosphatase 2A (G1-PP2A), a serine/threonine protein phosphatase and one of the first p53 responsive genes identified, results in d ephosphorylation of Ser-166 a nd Thr-216 (Okamoto and Beach, 1994). This leads to the gener ation of a positive feedback loop where stress activated p53 increases G1-PP2A ex pression, which then associates with MDM2, dephosphorylating it and destabilizing MDM2. This process leads to the liberation of p53 where it ca n further transcribe target genes (Okamoto, Li et al. 2002). Wip1, a nuclear serine/threoni ne phosphatase, is also a downstream target of p53 whose expressi on is stimulated by stress Wip1 dephosphorylates MDM2 on Ser-395, the same site that is phosphorylated by ATM following DNA damage, resulting in the stabilization and s uppression of p53 and returning it to basal levels (Lu, Ma et al. 2007). The acidic domain is phosphorylated under

PAGE 46

35 unstressed conditions and depho sphorylation of the acidic domain is also thought to play a role in mediating p53 inducti on. Ck2 phosphorylates Ser-262 and 269 reducing Rb binding, GSK3 phosphorylates Ser-256 enhancing MDM2 activity toward p53 degradation, and Ser-240, 242 and 246 are Ck1 / targets (Winter, Milne et al. 2004; Gotz, Kartarius et al 2005; Kulikov, Boehme et al. 2005). Following ionizing radiation, Ser-240, 242, 260 and 263 are rapidly dephosphorylated before p53 starts to accumulate, and alanine mutations at these phospho-sites alleviate degradati on of p53 suggesting that these modifications result in positive regulati on of p53 (Blattner, Hay et al. 2002). These findings seem to add another laye r of complexity to the MDM2-p53 negative regulatory feedback loop. Oncogenic Stress/ARF Induction Deregulation of oncogenes, such as Ras mutants, pRb-E2F, c-myc or viral E1A, is another way of in terfering with the MDM2-p53 in teraction, allowing for the stabilization and activation of p53. Following oncogenic stress there is an increase in the p14ARF protein, which binds to t he acidic domain of MDM2 and inhibits its E3 ligase activity (Honda and Yasuda 1999; Sherr 2006). It is thought that ARF binding sequesters MDM2 in the nucleolus while p53 remains in the nucleoplasm resulting in stabilizat ion of nuclear p53 and increased p53 transcriptional activity (Tao and Levine 19 99; Weber, Taylor et al. 1999). Ribosomal Stress Ribosomal stress induced by inhibiting rRNA synthesis causes the release of ribosomal proteins from the nucleolus to the nu cleoplasm. Once in the nucleoplasm, ribosomal large subunit protei ns such as L5, L11 and L23, bind to the central acidic domain/zinc finger of MDM2 (Marechal, Elenbaas et al. 1997; Lohrum, Ludwig et al. 2003; Dai, Zeng et al. 2004). This leads to the inhibition of MDM2 E3 ligase activity towards p53, in creasing the expression of p53 target genes and cell cycle arrest (Bhat, Itahana et al. 2004; Dai, Zeng et al. 2004). It is believed that MDM2-L protein interactions cause a steric hindrance that prevents the transfer of ubiquitin from E2 to p53 (Zhang, Wolf et al. 2003). Knockdown of these L proteins by siRNA can lead to decreased p53 activation following

PAGE 47

ribosomal stress. Also, point mutations in the MDM2 zinc finger domain (C305F) can abrogate L5 and L11, not L23 binding. This creates an MDM2 protein with decreased export capabilities and delayed ubi quitination and degradat ion of p53. Figure 8: MDM2 Regula tion by Ribosomal Stress. Following ribosomal stress the L proteins move from the large ri bosomal subunit and bind to the MDM2 acidic domain. This attenuates MDM2s ability to degrade p53. It also increases MDM2 ubiquitination of MDMX. MDM2 Mouse Models 36 The importance of MDM2 in regulation of p53 is best exemplified in mouse models. Homozygous knockouts of MDM2 result in embryonic lethality at day 3.5, mainly due to uncontrolled apoptosis induced by p53. This lethality is rescued in a p53 null background, indicating that the primary role of MDM2 is to control p53 activity (Jones, Roe et al 1995; Montes de Oca Luna, Wagner et al. 1995). Other conditional knockout mouse models have shown some tissue specificity with regard to MD M2 function. Conditional deletion of MDM2 in osteoblasts results in severe skeleta l defects during devel opment and embryonic lethality, suggesting MDM2 is required to control p53 activity in these cells (Lengner, Steinman et al. 2006). MDM2 k nockout in cardiomyoctyes, red blood

PAGE 48

37 cells, smooth muscle cells and in the central nervous system all lead to p53dependent lethality at birth, suggesting MDM2 plays a critical role in p53 regulation in multiple cell types (Boesten, Zadelaar et al. 2006; Grier, Xiong et al. 2006; Xiong, Van Pelt et al. 2006; Maetens, Doumont et al. 2007). Mice with a hypomorphic allele that expressed 30% of the total MDM2 levels have decreased body weight, defects in hematopoeisis and increased radiosensitivity due to decr eased p53 inhibition (Mendrysa, McElwee et al. 2003). Also in a p53-dependent manne r, MDM2 heterozygous mice are more resistant to lymphoid tumor developm ent when crossed to an E -Myc mouse model (Alt, Greiner et al. 2003). Mice overexpressing MDM2 in the mammary epithelium were prone to tumor formation and increas ed hypertrophy, as well as reducing the anti-tumor suppressor functions of p53 (Lundgren, Montes de Oca Luna et al. 1997; Jones, Hancock et al. 1998). MDM2 Interacting Proteins ARF The ARF tumor suppressor is a prot ein that is transcribed from an alternate reading frame of the INK4a/ARF locus (CDKN2A) ( Figure 9) The gene is located on the short arm of chromo some 9 and translated into a 14kDa, 132 amino acid protein. AR F is a highly basic and hy drophobic protein with more than 20% of its amino acids being argi nine, making it a largely unstructured protein unless bound to other targets (Sherr, 2001). It therefore makes sense that ARF interacts with the acidic domain of MDM2. This interaction directly inhibits MDM2 E3 ligase activity (Honda and Yasuda 1999). ARF binding also causes MDM2 to be sequestered into the nucleolus, while p53 remains in the nucleoplasm, therefore blocking MDM2 medi ated exportation of p53 from the cell nucleus to the cytoplasm for degradation (T ao and Levine 1999; Weber, Taylor et al. 1999).

PAGE 49

Figure 9: Ink4a/ARF locus. The ARF tumor suppressor is transcribed from an alternate reading frame of the INK4a/ARF locus. Following mitogenic stress ARF expression is increased. ARF then binds and antagonizes MDM2, permitting the transcriptional activation of p53 (Sherr, 2001). 38 ARF expression is increased following aberrant mitogenic stimulation, such as overexpression of MYC or Ra s or enforced E2F expression. By antagonizing MDM2, ARF permits the transcriptional activity of p53, which leads to cell cycle arrest and apoptosis. Therefore, loss of function in ARF is commonly associated with cancer ( Lowe and Sherr, 2003). In fact, the INK4a/ARF locus is deleted or silenced in many kinds of tumo rs. For example, 41% of breast carcinomas have p14ARF defects, while 32% of colorectal adenomas have p14ARF inactivation due to hypermethylation of the promoter (Yi, Shepard et al. 2004). Mouse models that lack p19ARF are also more prone to tumor development. This is because without ARF, MDM2 inappropriately inhibits p53, leading to increased cell survival. Therefore, ARF has become a popular target in the search for novel cancer treatments. Some exam ples would include small molecular compounds that would ac t as ARF and bind to MDM2 in cells with INK4a/ARF deletions, or treatments t hat could reverse hypermethylation in cancers with silenced INK4a/ARF loci.

PAGE 50

39 SUV39H1 Histone-lysine N-methyltransferase SUV39H1 is an enzyme that, in humans, is encoded by the SUV39H1 gene (Aagaard, Laible et al. 1999). The SUV39H1 gene is the hum an ortholog to the Drosphila Su(var)3-9 histone methyltransferase. Mice and humans al so express a second isoform, SUV39H2 (O'Carroll, Scherthan et al. 2000). The gene encodes a protein with a chromodomain and a C-terminal SET domain. The chro modomain is about 4050 amino acid residues in length and found in proteins associated with remodeling and manipulation of chromatin. These domain-containing proteins can recognize and bind methylated histones (Nielsen, Nietlispach et al. 2002). The function of the SET-domain (130 aa long ) is to transfer a methyl group from S -adenosyl-L-methionine (AdoMet) to the am ino group of a lysine residue on a histone or another protein. This serves as a post-translational epigenetic modification that can then control the expression of genes or the activity of proteins. It can also lead to recruitment of certain protein co mplexes that direct the organization of chromatin, or can in fluence protein function (Dillon et al., 2005). Mouse knockout experiments have s hown that the SUV39H1/2 genes are required for viability and pr oper H3 K9 tri-methylation at heterochromatin regions (Peters, O'Carroll et al. 2001). Overa ll, SUV39H1 plays a vital role in heterochromatin organization, chromosome segregation and mitotic progression. SUV39H1 null mice are viable but tumor prone (Peters, O'Carroll et al. 2001). Recently, our lab has shown that MDM2 re cruits SUV39H1 through binding of the methyltransferase to the MDM2 acidic domain, leading to the formation of a trimeric complex between MDM2, SUV39H 1 and p53 (Chen, Li et al. 2010). This interaction promotes histone H3 K9 methyl ation at p53 target promoters, leading to transcriptional repression of p53 target genes ( Figure 10 ). Knockdown of SUV39H1 following DNA damage can furt her enhance p53 transcriptional output. Likewise, overexpression of the tumor suppressor ARF inhibits the MDM2SUV39H1 interaction, leading to functionally activated p53. So far, SUV39H1

PAGE 51

has shown increased expression in 25% of primary colorectal cancers indicating it has proto-oncogene characteristics (Kang, Lee et al. 2007). Figure 10: SUV39H1-MDM2 Interaction. SUV39H1 binds to the MDM2 acidic domain, creating a trimer ic protein complex (SUV 39H1-MDM2-p53). This interaction promotes histone H3K9 methyl ation at p53 target promoters, leading to transcriptional repre ssion of p53 target genes. Oncogene MDMX History of MDMX 40 In 1996, through a mouse cDNA library screen, a p53 binding protein that shared 60% homology at the DNA and protein level with MDM2 was discovered. The protein was named MDMX (murine dou ble minute X), also known as MDM4, (Shvarts, Bazuine et al. 1997). Although MDMX is structurally similar to MDM2, it

PAGE 52

41 does not have intrinsic E3 ligase activi ty, nor does it promote p53 degradation (Stad, Little et al. 2001). However, MDMX has emerged as another critical regulator of p53 and overex pression of MDMX leads to suppression of p53 transcriptional activity following st ress imposed by DNA damage, aberrant mitogenic signaling and ribosomal stress. Early studies also found that MDMX is constitutively expressed during cell proliferation, differentiation and stress (Jackson and Berberich 1999). In addition, overexpression of MDMX resulted in cellular transformation when the H-Ra s oncogene was also co-expressed (Danovi, Meulmeester et al. 2004). Several studies have implicated MDMX functions as oncogenic and implicated it in tumor formation. HDMX is located on chromosome 1q32, which is an area frequently aberrant in cervical and ovarian carcinomas (Danovi, Meulmeester et al. 2004). A subset of g liomas that were wild-type for p53 were found to have amplifications of MDMX, not MDM2 (Riemenschneider et al., 1999). Increased MDMX levels were also found in pre-B acute lymphoblastic leukemias, tumor cell lines and primary tumors that retained wild-type p53 (Ramos, Stad et al. 2001; Han, Garcia-Manero et al. 2007). Notably, elevated MDMX levels were found in 65% of re tinoblastomas containing wild-type p53 (Laurie, Donovan et al. 2006). These data indicate that there is a clear link between MDMX overexpression and p53 suppr ession, making mutations in p53 unnecessary for tumor formation. MDMX Structure and Function The MDMX gene has 11 exons that enc odes a protein of 490 amino acids in length. MDMX and MDM2 share signi ficant homology in several functional domains ( Figure 11 ). The highest homology is located in the N-terminal p53binding domain (54.6%, aa 42-94). The residues required for interaction with p53 are conserved between the two proteins (Shvarts, Steegenga et al. 1996). Binding of MDMX to p53 occurs at the Nterminus of both proteins and inhibits p53 transactivation function (Jackson and Berberich 2000; Stad, Little et al. 2001).

PAGE 53

Figure 11. Structure Homology of MDM2 and MDMX. Both proteins contain N-terminal p53-binding domains central acidic domains, zinc finger domains and form heterodimers through their RING fi nger domains. Unlike MDM2, MDMX does not have distinct nuclear localiz ation and nuclear export signals. The central domain of MDMX shares little sequence homology with MDM2, yet it does contain several acidic residues (Parant, Reinke et al. 2001). The MDMX acidic domain, to date, has a relatively unknown function. A MDM2 protein containing the MDMX acidic domain is incapable of rescuing the loss of degradation that occurs with t he deletion of the MDM2 acidic domain (Kawai et al., 2003). The binding of casein kinase 1 alpha (CK1 ) to MDMX, not MDM2, occurs at the zinc finger domain and phosphorylates Ser-289 in the acidic domain, leading to an enhanced MDMX: p53 interaction (Chen et al., 2005c). ARF interaction with the MDMX acidic dom ain is somewhat cont roversial. Some studies suggest that the binding of AR F to the MDMX acidic domain can translocate MDMX to the nucleolus, while another study suggests that there is no direct binding between MDMX and ARF (J ackson, Lindstrom et al. 2001; Wang, Arooz et al. 2001). Therefore, there is still work to be done in determining the exact function of the MDMX acidic domain. 42

PAGE 54

43 The zinc finger domain (aa 301-329) shares 41.9% homology to MDM2 (Marine et al., 2007). The function of this domain is largely unclear, however, a p53-induced caspase cleavage site lies be tween the zinc-finger and RING finger domains that regulates MDMX stability (Gentiletti, Mancini et al. 2002). The RING domain (aa 444-483) shar es 53.2% homology with MDMX (Marine et al., 2007). MDMX forms heterodimers with MDM2 through the Cterminal RING:RING interactions (Sharp, Kratowicz et al. 1999; Tanimura, Ohtsuka et al. 1999). It was long thought the MDMX itself does not contain a functional nuclear localizat ion or nuclear export signal and depends on binding to MDM2 through the RING domain to localize to the nucleus (Migliorini, Lazzerini Denchi et al. 2002). However, a recent study by our lab has shown that, in response to DNA damage, 14-33 binds MDMX revealing a cryptic nuclear localization signal and leading to MDMX translocation to the nucleus (LeBron, Chen et al. 2006). A major difference between the MDM2 and MDMX RING domain is that MDMX lacks E3 ligase activity. Yet although MDMX does not have intrinsic E3 ligase activity, it can enhance the abil ity of MDM2 to ubiquitinate substrates, in cluding p53 (Badciong an d Haas 2002). Recent studies have found that the key differ ence between the MDM2 and MDMX RING lies in the extreme C-termi nal residues, and the mutation of these key amino acids abrogates MDM2 E3 ligase activi ty, which interestingly is rescued by oligomerization with MDMX (Singh, Iyappan et al. 2007; Uldrijan, Pannekoek et al. 2007). At the genomic level, the 5 ends of MDM2 and MDMX are quite distinct. Unlike MDM2, the expression of MDMX is not dependent on p53 activity as it does not contain a p53 responsive elem ent (Parant, Reinke et al. 2001). However there have been recent reports i ndicating that MDMX is a weak p53 responsive gene (Li et al., 2010). Unlike MDM2 the mRNA levels of MDMX do not correlate with a stress response, suggesting the MDMX has a different regulatory mechanism (Jackson and Be rberich 1999). In fact, following stimulation the mitogen-activated prot ein kinase pathway upregulates MDMX

PAGE 55

44 mRNA levels via activation of c-Ets-1 transcription factors (Gilkes, Pan et al. 2008). MDMX-p53-MDM2 Interaction The importance of MDMX was estab lished when MDMX-null mice were found to be embryonic lethal, and that this phenotype can be rescued by crossing to the p53-null background. This proc ess suggests a unique role in the regulation of p53 (Parant, Reinke et al. 20 01; Migliorini, Lazzerini Denchi et al. 2002). MDMX was first reported to inhi bit p53-induced transcription following ectopic expression on p53 target genes (Shvarts, Steegenga et al. 1996). MDMX does this by binding to the same amino acids in the transactivation domain that are required for MDM2 bindin g and are located at the N-terminus of p53 (Bottger et al., 1999). This bindin g suggests that, sim ilar to MDM2, MDMX can inhibit p53 transcriptional activity by interfering with the ability of p53 to interact with basal transcription machinery, recruitment of coactivators and binding to target promoters. Indeed, in MDM2 null cells or cells with MDMX unable to bind MDM2, MDMX abrogates CBP/ p300 acetylation of p53, resulting in the stimulation of p53 activation (S abbatini and McCormick 2002; Danovi, Meulmeester et al. 2004). MDM2 binds MDMX through RING:RING domain interactions, resulting in changes to the MDM2-p53 autoregulatory f eedback loop. It is well known that p53 transcriptionally activates MDM2, wh ich negatively regulates p53 by inhibiting its transactivation and affect ing its stabilization through ubiquitindependent proteosomal degradation. Although MDMX does not contain intrinsic E3 ligase activity, it has been shown in some studies to stabilize MDM2 by blocking auto-ubiquitination. This relati onship leads to an increase in MDM2 ubiquitination and de gradation of p53 (Stad, Little et al. 2001; Badciong and Haas 2002; Gu, Kawai et al. 2002). Howe ver, other studies have shown that knockdown of MDMX via siRNA in certain cancer cell lines either increased or had no significant effect on MDM2 or p53 levels and ubiquit ination (Jackson and Berberich 2000; Stad, Littl e et al. 2001; Danovi, Meulmeester et al. 2004).

PAGE 56

45 Notably, MDMX itself is also a target of MDM2 and is polyubiquitinated by MDM2, followed by proteosomal degradation (Pan and Chen 2003). It seems that MDMX works along si de MDM2 to maintain correct p53 stability and transcriptional activity. The discrepancies in the above findings suggest that the key factor is the ratio of MDMX to MDM2 when determining the overall effect of the protei ns on p53. When the MDMX to MDM2 ratio is lesser or equal to 1, p53 prefer entially undergoes MDM2 -dependent proteosomal degradation. When MDMX expression is gr eater than MDM2, MDMX inhibits this process. Because MDM2 and MDMX share a binding site on p53, when MDMX is overexpressed it competes with MDM2 for p53 binding, rendering p53 more stable (Jackson and Berberich 2000). This scenario leads to MDMX inhibiting p53 transcriptional activity, independent of MDM2 (Marine and Jochemsen, 2005). The importance of these ratios and their ability to work together to correctly regulate p53 is also evident in a number of mouse model studies. These studies show neither protein can compensate fo r the other in regulating p53 function. Likewise, studies of t he CNS with knockouts to both MDM2 and MDMX showed a more dramatic phenotype than single knockouts (Xiong, Van Pelt et al. 2006). However, in conditional knockout systems it seems that MDMX is only required for the inhi bition of p53 in a subset of cell types and only under certain physiological conditions. In fac t, one study found that the overexpression of the MDM2 transgene could compensate for the embryonic lethality that occurs in the MDMX knockout mice, however, t he opposite remains embryonically lethal (Steinman, Hoover et al. 2005). In the absence of cellular stress it seems that the pr imary function of MDM2 is to maintain p53 at low levels, whereas the function of MDMX is to inhibit p53 transcriptional ac tivity. When DNA damage or other stresses occur, p53 is post-translationally modified, which leads to the inhibi tion of the MDM2p53 interaction and p53 stability. Although MDM2 is a direct target of p53 transcription, there is a lag between DN A damage p53 activation and an increase in MDM2 protein levels, possibly because of the p53-MDMX interaction. Our lab has shown that, following cellular stress, the level of p53 activation is inversely

PAGE 57

46 correlated with the amount of MDMX in these cells due to the formation of inactive p53-MDMX complexes (Chen, G ilkes et al. 2005; Gilkes, Chen et al. 2006). Conversely, MDMX become very un stable following DN A damage. This is due to phosphorylation, enhanced de gradation via MDM2 ubiquitination and not being transcriptionally induced by p53. The MDM2-MDMX-p53 interaction also influences MDMX localization. Exogenous MDMX is mainly lo calized in the cytoplasm (R allapalli, Strachan et al. 1999). Co-expression of MDM2 recruits MDMX into the nucl eus, independent of p53, but does require the RING finger domain of both proteins and the NLS of MDM2 (Migliorini, Danovi et al. 2002). Another study reports that MDMX is targeted to the nucleus in a p53dependent, MDM2-independent manner (Li, Chen et al. 2002). However, this same study showed that MDMX nuclear entry was also observed following DNA damage in p53/MDM2 null MEFs, suggesting that MDMX nuclear localization can al so be independent of both p53 and MDM2. MDMX Regulation DNA Damage The primary mechanism of MDMX regulation occurs at the posttranslational level. The destabilization of both MDMX and MDM2 are required for proper p53 response to DNA damage. Although MDMX expression is constant under non-stressed conditions, there are dr amatic changes to the MDMX protein levels in response to stress. Not only is MDMX ubiquitinat ed and targeted for degradation via MDM2 following DNA damage, but phosphorylation also plays a key role in efficient degradation ( Figure 12 ). Activation of ATM in response to DNA damage leads to phosphorylation on Ser-403 and activation of downstream kinases, such as Chk2, phosphorylates Ser-342 and 367 (Chen et al., 2005b; Pereg et al., 2005). DNA damage by ultraviolet radiation results in Chk1 phosphorylation at Ser367 (Jin et al., 2006). Phosp horylation led to increased MDMX-MDM2 binding, followed by ubiqui tination and degradation of MDMX. The increase in MDM2-MDMX binding was necessary fo r p53 activation following DNA damage since cells overexpressing MDMX were unable to undergo cell cycle arrest. (Chen et al., 2005b). Intere stingly, phosphorylation at Ser-367 led

PAGE 58

to 14-3-3 binding, yet did not lead to direct MDMX degradation. The phosphorylation does, however, stimulate nuclear import of MDMX by exposing a cryptic NLS region where it is preferentially degraded (LeBron et al., 2006). Another suggestion is that following ionizing radiat ion, the 14-3-3 binding prevents the association of HAUSP with MDMX, r endering it less stable (Meulmeester et al., 2005a; Meulmeester et al., 2005b). However, in response to UV radiation, where Chk1 leads to 14-3-3 binding, MDMX is sequestered mainly in the cytoplasm (Jin et al., 2006). Al though there are multiple pathways, these mechanisms explain the abilit y of DNA damage to prefer entially inactivate MDMX and stimulate p53 transcription. Figure 12: Regulation of MDMX. Following DNA damage protein kinases phosphorylate p53, MDM2 and MDMX on t he indicated residues. MDM2-MDMX binding increases leading to MDMX ubiquitination and degradation. MDM2 also undergoes auto ubiquitination. This leads to enhanced p53 stability and transcriptional activity. 47

PAGE 59

48 There have been reports of other ki nases phosphorylaing MDMX. Ck1 phosphorylates MDMX on Ser-289 and st imulates MDMX-p53 binding (Chen et al., 2005c). CDK2 phosphorylates Ser-96 and results in nuclear export of MDMX and consequently the export of MDM2 (E lias et al., 2005). Growth factor stimulation of the PI-3 ki nase/AKT pathway leads to phosphorylation at Ser-367, 14-3-3 binding and stabilization of MD MX and MDM2 (Lopez-Pajares et al., 2008). Oncogenic Stress/ARF Induction Mitogenic stimulation can also regulate MDMX protein levels. Our lab has shown that, following oncogenic stress, ARF binds to MDM2 selectively and blocks p53-ubiquitination, ye t promotes ubiquitination of MDMX (Pan and Chen, 2003) ( Figure 7). In cells overexpressing MDMX there is a reduction of p21 and cell cycle arrest following E2F activation of ARF. MDMX knockdown has the opposite effect, sensitizing the cells to ARF-induced cell cycle arrest. Another study showed that MDMX gene amplif ication occurs in preneoplastic retinoblastoma cells, causing the p53 -MDM2-ARF pathway that is usually activated following Rb inactivation to become inactive. Cells with the amplified MDMX had a growth advantage over t hose with an intact ARF-MDM2-MDMXp53 pathway resulting in retinoblastoma development (Laurie et al., 2006). These studies highlight the importance in finding inhibi tors specifically for the MDMX-p53 interaction. Ribosomal Stress Recent studies have shown that the p53 response to ri bosomal stress is another important factor in tumor su ppression due to aberrant rRNA and biogenesis sensed by p53 (Lohrum et al., 2003; Marechal et al., 1994; Zhang et al., 2003). Following the addition of Actinomycin D, a drug that induces ribosomal stress, there is an activation of p53 leading to induction of p21 and MDM2 target proteins. However, the MDMX levels decrease due to increased L11 stimulating MDM2 to ubiquitinate MDMX ( Figure 8). This process can be blocked by overexpression of MDMX in both cell culture and xenograft models

PAGE 60

49 (Gilkes et al., 2006). These observations suggest that MDMX plays an important role in regulating the p53 response to ribosomal stress. MDMX Mouse Models The physiological importance of MD MX negative regulation of p53 was characterized by the embryoni c lethality of MDMX null mi ce at day 8.5, and this lethality can be rescued by a concomitant p53 deletion (P arant et al., 2001). This lethality resulted from a severe prolif eration deficiency, rather than the uncontrolled apoptosis seen in MDM2 null mice These results also suggest that MDM2 and MDMX have non-redundant roles, as they do not compensate for the loss of each other. In these models MDMX contributes to p53 dependent regulation of both pr oliferating and quiescent cells (Francoz et al., 2006). Studies have also examined the role of MDM2 and MDMX using tissuespecific knockout systems, some of whic h were described earlier. While MDM2 appears to be important in a majority of different cell types, the only severe phenotype observed when MDMX was kno cked out occurred in neuronal cells and in the CNS (Boesten et al., 2006; Miglio rini et al., 2002; Xi ong et al., 2006). Knockout of MDMX in cardiomyocytes and smooth muscle cells of the GI tract only caused minor defects (Boesten et al ., 2006; Migliorini et al., 2002; Xiong et al., 2006). Despite some increased apoptosis obser ved in neuronal cells that lack MDMX, it is believed that t he primary role of MDMX is to regulate cell cycle arrest specific p53 transcriptional activity. In support of this, concomitant deletion of the CDK inhibitor, p21, partially rescued the lethality of MDMX knockout mice in these cells (Steinman et al., 2004). It is thought that these mice would retain wild-type p53 transcription capabilities an d stimulate MDM2 expression, thus leading to higher MDM2 levels that c an compensate for the loss of MDMX. In fact, this has been observed in transgeni c MDM2 mice that rescue the loss of MDMX (Steinman et al., 2005). This ph enotype and the difference between the MDM2 and MDMX null phenotypes seems to re sult from the fact that loss of MDM2 leads to the accumulation of t he p53 protein, whereas loss of MDMX does not significantly increase p53 levels in vivo.

PAGE 61

50 MDMX interacting Proteins CK1 Casein kinase I (CKI) was one of t he first serine/threonine protein kinases to be isolated and characterized, and functi ons as a regulator of multiple signal transduction pathways. CK1 is a protei n that is highly conserved from Saccharomyces cerevisiae to the human and has been genetically linked to the regulation of DNA repair, cell cycle pr ogression and cytokines in yeast (Gross and Anderson, 1998). There are seven mammalian isoforms that have been cloned and characterized, including: , 1, 2, 3, and (Rowles et al., 1991). CK1 is expressed equally in all ti ssues and detected in all cellular compartments (Zhang et al., 1996). In addition to containing a catalytic domain the CK1 protein posseses a small carbox yl terminus area. Following DNA damage p53 can be phos phorylated by CK1 in vitro provided that p53 is modified at Ser-15 by ATM (Knippschild et al., 1997). Other is oforms of the CK1 family of proteins have been linked to phosphorylation of p53 and MDM2 upon cellular stress, resulting in a weakening of their interaction (Knippschild et al., 2005). Recent studies by our lab have shown that CK1 is a novel MDMXbinding protein. Specifical ly, it binds to the zinc finger domain of MDMX and stimulates MDMX inhibition of p53 by increasing the fo rmation of the MDMX-p53 complex. The binding of CK1 also leads to phosphorylation on Ser-289, although the significance of this is yet to be determined (Chen et al., 2005c). These observations suggest that the CK1 family kinases are potential drug targets for sensitizing p53 to DNA damaging agents.

PAGE 62

51 MATERIALS AND METHODS Cell Lines and Plasmids MDM2, MDMX, p53, ARF and SUV39H1 constructs used in this study were of human origin. MDM2-MDMX hybrid constructs were described previously (Kawai et al., 2003). Human pCIN4-HA-F LAG-p53 was kindly provided by Dr. Wei Gu (Brooks et al., 2007). NARF6 (U 2OS expressing IPTG inducible ARF) was provided by Dr. Dawn Quelle. MDM2 and MDMX deletion mutants were generated by PCR amplification and subc loning. H1299 (non-small cell lung carcinoma, p53-null), U2OS (osteosar coma, wild-type p53), NARF6, SJSA, (osteosarcoma, wild-type p53, amplified MDM2), DLD1 (colon carcinoma, mutant p53), MDA-231 (human breast adinocarci noma, mutant p53), HCT116 +/+ (human colon carcinoma, wild-type p53), and HCT116 -/(human colon carcinoma, p53 null) and H1299-V1 38 (H1299 stably transfected with temperature-sensitive mutant p53-V138) were maintained in DMEM with 10% fetal bovine serum. Drug Treatments MDM2 inhibitor Nutlin (C ayman) was used at 5 M and the cells were incubated for 5h. Proteosomal inhibito r Velcade (Selleck) was used at 50 nM (unless otherwise indicated) and the cells were incubated for 5 h. Proteosomal inhibitor MG132 (BIOMOL Research) was used at 30 uM for 5h. Transfections Calcium Phosphate Calcium phosphate transfections were performed in H1299 cells due to their high transfection efficiency and the fact that they are p53 null with undetectable levels of MDM2 and MDMX. In transient transfection assays > 2 x 106 cells were seeded into 10 cm tiss ue culture dishes for 24 h. For each transfection 40 ug of plasmid DN A was mixed with 450 ul of H2O and 125 mM

PAGE 63

52 calcium chloride. A mixture of 500 ul of HEPES (0.28 M NaCl, 0.05 M HEPES, 1.5 mM CaCl2) was bubbled with air and the wa ter/DNA mixture was added dropwise to the HEPES. After a 10 minute incubation the mixture was added to the cells and incubated for 16 h. After incubation t he transfected cells were washed 3 times with PBS and refed with complete medium. The cell cultures were then incubated for another 10 h before harvest. Lipofectamine For the LipofectamineTM 2000 (Invitrogen) trans fection experiments 5 x 104 U2OS cells were seeded into 24 well tissue culture plates for 24 h. The following day the cells were washed once with serum free media and refed with 0.4 ml of serum free media. For each transfection a total amount of 0.6 g of plasmid DNA was mixed with 37.5 l of Opti-MEM I Reduces Serum Medium. Lipofectomine 2000 was diluted (1.4 l) in 37.5 l of the Opti-MEM I Reduces Serum Medium and incubated for 5 min. After incubation the lipofectomine mix was combined with the dilut ed DNA (total volume = 75 l) and incubated for 20 min at room temperature. The mixture was added to each well and mixed gently by rocking the plate back and forth at room temperature. The ce ll culture plates were then incubated at 37 c for 20 h prior to testi ng for transgene expression. Protein Analysis Western Blot Cells were lysed in lysis buffer (50 mM Tris-HCl [pH 8.0], 5 mM EDTA, 150mM NaCl, 0.5% NP-40, 1 mM phenylmet hylsulfonyl fluoride), centrifuged for 10 minutes at 14,000 x g and the insoluble debris was discarded. Cell lysate (10 to 50 g of protein) was fractionated by sodium dodecyl sulfate (SDS)polyacrylammide gel electroph oresis and transferred to Immobilion P filters (Millipore). The filter was blocked for 1 h with phosphate-buffered saline (PBS) containing 5% nonfat dry m ilk and 0.1% Tween 20. The filter was then incubated overnight with primar y antibodies diluted in blocking buffer. The filter was washed three times (5 min each) with PB S containing 0.1% Tween-20. Next, bound primary antibodies were conjugated wit h secondary antibody horseradish peroxidase IgG goat-anti-mouse or goat-anti-rabbit by incubating the filter with

PAGE 64

53 the secondary antibody dilut ed in blocking buffer for tw o hours. The filter was then washed three times (5 min each) wit h PBS containing 0.1% Tween-20. The filters were developed using either S upersignal (Pierce) or ECL-plus reagent (Amersham Biosciences). The following antibodies were used: Human p53 was detected using DO-1 (mouse, Pharmigen) with 1:5,000 dilution or FL393 (rabbit, SantaCruz) with a 1:10,000 dilution Human MDM2 was detected using m onoclonal mouse 5B10, 3G9 or 4B2 with a 1:40 dilution or a rabbit polyclonal antibody at a 1:20,000 dilution Human MDMX was detected using m onoclonal mouse 10G11 or 8C6 with a 1:40 dilution or a rabbit polyclona l antibody at a 1:20,000 dilution ARF was detected by 14P02 (mouse, N eomarkers) with a 1:1,000 dilution FLAG-tagged proteins were detected with an -FLAG monoclonal mouse antibody (Sigma) at a 1: 5000 dilution and a rabbit polyclonal antibody with a 1:10,000 dilution Myc-tagged proteins were detected (Sigma) with mouse 9B11 antibody at a 1:40 dilution and a rabbit polyclonal antibody at a 1:10,000 dilution P21 was detected using anti-WAF1 (B D Bioscience) at a 1:1,000 dilution PUMA was detected using NT (P roScilnec) at a 1:1,000 dilution Actin was detected using a mouse monoclonal antibody (Sigma) at a 1:30,000 dilution Immunoprecipitation Cells were lysed in lysis buffer (50 mM Tris-HCl [pH 8.0], 5 mM EDTA, 150mM NaCl, 0.5% NP-40, 1 mM phenylmet hylsulfonyl fluoride), centrifuged for 10 minutes at 14,000 x g and the insolubl e debris was discarded. Cell lysate (200-1000 g of protein) was immunoprecipitated with 30 l slurry of protein A agarose beads (Sigma) and MDM2 anti bodies overnight at 4C. For immunoprecipitations using conformation-s pecific p53 antibodies the lysate was divided into equal halves and each immunopr ecipitated for 18 h at 4C with wildtype conformation specific antibody (Pab1620) or mutant conformation specific antibody (Pab240). For immunoprecipitation of FLAG t agged proteins the lysate was incubated with 50 l slurry of M2-agarose beads overnight at 4C (Sigma).

PAGE 65

54 The beads were washed three times with lysis buffer, boiled in SDS sample buffer, fractionated by SDS-PAGE and analyzed by Western blot. DNA Binding Assays Chromatin Immunoprecipitation Two confluent 10 cm plat es per cell line (2 x 107 2 x 108 cells) were used per sample, one for the chromatin immunop recipitation assay and one for protein analysis via Western blot. Formaldehyde was added directly to tissue culture media to a final concentration of 1% and incubated on a shaking platform for 10 minutes at room temperatur e. The crosslinking reac tion was stopped by adding glycine to a final concentration of 0.125 M and mixing for 5 minutes. The plates were rinsed twice with cold PBS plus protease inhibitors and PMSF, scraped and centrifuged to collect. The pellets were resuspended in 0.45 ml of RIPA lysis buffer (50 mM Tris pH 8.0, 150 mM Na Cl, 1% Triton X-100, 0.1% SDS, 1% sodium doexycholate) and incubated on ic e for 10 min. Next, samples were sonicated to an average chromatin leng th of about 500-1000 base pairs and then centrifuged at 14,000 rp m for 1 minute at 4 c. The supernatant was transferred to a new tube, precleared by adding 60 l of protein A agar ose/salmon sperm DNA beads (Millipore) and incubated on a rotating platform at 4 c for 30 min. Samples were centrifuged at 4,000 rp m for 1 minute and divided into the appropriate aliquots for immunoprecipitation and 50 l per sample was set aside for input control. The pr otein-DNA complexes from tr ansiently transfected H1299 cells were immunoprecipitated with 2 g DO-1 antibody for p53 or 9B11 for MYC tagged proteins. The final volume of each sample was adjusted to 1 ml using IP dilution buffer (0.01% SDS, 1.1% Trit on X-100, 1.2 mM EDTA, 16.7 mM Tris-Cl pH 8.0, 167 mM NaCl). Control sample s that were used for experiments included an untransfected plat e of p53 null-H1299 cells, as well as samples that were immunoprecipited with 2 g of IgG specific antibody. Samples were incubated on a rotating platform overnight at 4 c. The following day a 40 l slurry of protein A agarose/salmon sperm DNA beads (Millipore) was added and incubated on a rotating platform overnight at 4 c. Samples were centrif uged at 4,000 rpm for 1 min at room temperature.

PAGE 66

55 Beads were washed one time in low salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl pH 8.0, 150 mM NaCl), one time in high salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl pH 8.0, 500 mM NaCl), one time in LiCl buffer (0.25 M LiCl, 1% NP-40, 1% sodium deoxycholate, 1 mM EDTA, 10 mM Tris-HCl pH 8.0) and tw o times in TE (1 mM EDTA, 10 mM Tris-HCl pH 8.0). For each wash samp les were rotated for 3 minutes at 4c and then centrifuged at 4,000 rpm for 1 min at room temperature. Chromatin was eluted two times by added 100 l elution buffer (1% SDS, 0.1 M NaHCO3) while shaking at 1000 rpm for 15 min. To the input control 150 l of elution buffer was also added. The elutes were combi ned and then centrifuged at 4,000 rpm for 1 min at room temperature to remove any remaining beads and transferred to a new tube. The elutes received an addition of 0.3 M NaCl and were incubated at 65c overnight, shaking at 650 rpm, to reve rse the crosslinking. The following morning 1 ul of a 10 mg/ml RNAse A so lution was added and the elutions were incubated for 30 min at 37 c, shaking at 640 rpm. Next, 16 l of 1.0 M Tris-HCl pH 6.8, 2 l 1 M EDTA and 1 l of 10 mg/ml proteinase K were added per sample and incubated at 45 c for 2 h. The DNA was purified using the Qiagen PCR purification kit and reconstituted in 50 l of water. The samples were then further diluted 1:4 in water and then 4 l was utilized per PCR reaction. For p53, ARF and SUV39H1 promoter binding, samples were s ubjected to SYBR Green real-time PCR analysis using the foll owing forward and reverse primers: (5AGGAAGGGGATGGTAGGAGA and 5 ACACAAGCACACATGCATCA) to amplify the human p21 promoter and (5CTGT GGCCTTGTGTCTGTGAGTAC and 5CCTAGCCCAAGGCAAGGAGGAC) to amplify the human PUMA promoter, both containing t he p53-binding site. The readouts were normalized using 10% input chromatin for each sample [ Ct [normalized ChIP] = (Ct[ChIP](Ct[input] Log2(input dilution factor)))]. The % Occupancy was then calculated for each ChIP fraction [% Occupancy =2(Ct [Normalized ChIP])]. Samples were analyzed in triplicate and standard deviati on was calculated [% Occupancy x ((2Ct Dev.)-1)]. Error bars represent mean + standard deviation. Each sample was treated with

PAGE 67

56 the indicated n values and the di fference between eac h condition was determined by calculating the p values using a two-tailed students t-test. DNA Affinity Immunoblotting H1299 cells were transiently trans fected with FLAG tagged MDM2, MDMX and p53, along with M yc-tagged ARF and SUV39H1 when indicated. Cells from a 10 cm plate were lysed in 1 ml lysi s buffer [50 mM Tris-HCl (pH 8.0), 5 mM EDTA, 150 mM NaCl, 0.5% NP-40, 1 mM phenylmethylsulfonyl fluoride], centrifuged for 10 minutes at 14,000 x g and the insoluble debris was discarded. The lysate was incubated wit h 40 l slurry of M2-agarose beads (Sigma) for 18 h at 4C. The beads were washed with lysis buffer and the FLAG-tagged proteins with their binding partners we re eluted with 150 l of l ysis buffer containing 50 g/ml FLAG epitope peptide (Sigma) for 2 h at 4C. An aliquot of the eluted proteins were analyzed for expression leve ls by western blot. Lysates containing equal levels of p53 were added to a 200 l DNA binding reac tion mixture and incubated at 4C for 30 min. The DNA binding reaction mixture contains 25 nM double stranded biotinylated oligonucleotide DNA repr esenting the p53 binding site at the p21 promoter (Biotin-5-TCGAGAGGCATGTCTAGGCATGTCTC annealed with 5-GAGACAT GCCTAGACATGCCTCTCGA) 2 g poly(dIdC), 5 mM DTT, 150 mM NaCl, 20 mM Tris-HCl (p H 7.2), 1 mM EDTA, 0.1% Triton X100, and 4% glycerol. Mutant contro l oligonucleotide contains Biotin-5TCGAGAGGTCGCTCTAGGTCGCTCTC annealed with 5GAGAGCGACCTAGAGCGACCTCTCGA. The DNA/protein complexes were captured with 0.1 mg of m agnetic Streptavidin beads (P romega) at 4C for 30 min. The beads were collected usi ng a magnet and washed 3 times with DNA binding buffer. The bound pr oteins were eluted by boi ling in sample buffer (4% SDS, 20% glycerol, 200 mM DTT, 120 mM Tris pH 6.8, 0.002% bromophenol blue). The protein complexes were resolved by SDS-PAGE, and p53 was detected by western blot using DO-1 antibody.

PAGE 68

57 Luciferase Assay U2OS cells (50,000/well) were cult ured in 24-well plat es and transfected with a DNA plasmid mixture containing 10 ng p53-respon sive BP100-luciferase reporter (Freedman et al., 1997), 5 ng CMV1-lacZ, 10 ng MDM2, or 20 ng MDMX, 5 ng of GFP and up to 600 ng using ssDNA. Transfection was performed using Lipofectamine 2000 reagent (Invitrogen) as described above and cells were analyzed for luciferase and beta-galactosidase expression after 24 h. The ratio of luciferase/beta-galac tosidase was used as an indicator of p53 transcriptional activity. RNA Isolation and Analysis To determine the levels of p21, PUMA and GAPDH expression, total RNA was extracted using the Qiagen Rneas e Mini Kit per the manufacturer instructions. Briefly, samples were lysed and homogenized using the QIAshredder columns in a highly denat uring guanidine-thiocyanate containing buffer. Ethanol was added and the samp les were applied to an RNeasy Mini sping column. The total RNA was bound to the membrane and contaminants were washed away. The RNA was el uted from the column using 50 l of water. cDNAs were prepared by reverse transcription of total RNA using the SuperScript III Invitrogen kit. The primers used for Sy brgreen quantitative P CR of human p21, PUMA and GAPDH mRNA were as follows. Human p21 forward: 5ATGAAATTCACCCCCTTTCC; revers e: 5AGGTGAGGGGACTCCAAAGT. PUMA forward: 5TTGGGTGA GACCCAGTAAGG; reverse: 5TTGTTACTTCCTGCCCTGCT. GAPDH forward: 5GAGTCAACGGATTTGGTCGT; revers e: 5GACAAGCTTCCCGTTCTCAG. Samples were analyzed in triplicate. Sa mples were normalized to the GAPDH Ct [ Ct = Ct[Target]-Ct[Gapdh]], the Ct was converted to the fold difference between samples [ Ct= Ct[untreated]Ct[sample being compared]; FOLD=2(-Ct)] and samples were analyzed in triplicate [Standard Devi ation Error Bar = -FOLD + FOLD x (2Ct Dev.)].

PAGE 69

58 MTT Cell Viability Assay Cell viability was measured by a MTT colorimetric survival assay. SJSA, U2OS, DLD1, MDA-231, HCT +/+ and HCT-/ cells (10,000 per well) were seeded into 24 well plates and then tr eated the next day with different concentrations of Velcade (5-150 nM) and/or Nutlin (3-8 M) for 48 h. After treatment, cells were washed once with 0.5 ml PBS and then incubated with 0.25 ml PBS containing 10 l CellTiter 96 Aqueous One Solution Reagent (Promega) for 15 min. Reaction was stopped by pl acing the plates on ice and the OD490 was measured using Microplate Manage r Version 5.2.1 Build 106 software (BioRad). The absorbance reading correla tes with the number of live cells per well.

PAGE 70

59 RESULTS MDM2 inhibits p53 DNA binding A previous study using the McKay assay suggested that MDM2-p53 complex did not bind DNA (Z auberman et al., 1993). Ho wever, several studies reported detection of MDM2 bi nding to p53 target gene pr omoters, indicating that the MDM2-p53 complex has DNA binding activity in vivo (Arva et al., 2005; Jin et al., 2003; Tang et al., 2008; Wang et al., 2004; White et al., 2006). To further investigate the effect of MDM2 on p53 DNA binding, we purified MDM2-p53 complex from H1299 cells cotransfe cted with p53 and FLAG-MDM2 using M2 beads and eluted with FLAG peptide. The MDM2-p53 complex was incubated with biotinylated oligonucleotide DNA c ontaining p53-binding sequence from the p21 promoter. P53-DNA co mplex was captured by st reptavidin beads and analyzed by western blot. The analysi s showed that p53 purified as FLAGMDM2-p53 complex had very low DNA bi nding activity, whereas FLAG-p53 directly purified without MDM2 bound DNA efficiently ( Figure 13). In the same assay, purified FLAG-MDMX-p53 complex retained significant DNA binding, suggesting that only MDM2 has strong ability to inhibit p53 DNA binding. As a specificity control, FLAGp53 did not bind to oligonu cleotide with mutated p53 consensus sequence.

PAGE 71

Figure 13: Inhibition of p53oligonucleotide binding by MDM2. H1299 cells were transfected with FL AG-p53, or un-tagged p53 wit h FLAG-MDM2 or FLAGMDMX plasmids. The protein complexe s were purified using M2 Beads and eluted using a FLAG peptide. Elutes containing equal amounts of p53 were captured with biotinylated oligonucleotide DN A containing p53 bind ing site (wt) or a mutated sequence (mut). An aliquot of eluate was analyzed to confirm similar levels of p53 expression. To test whether MDM2 i nhibits p53 DNA binding in vivo H1299 cells were cotransfected with p53 and MDM2, treated with MG132 to bloc k MDM2 mediated degradation and then followed by p53 Ch IP and quantitative PCR (qPCR) analysis. Western blot of duplicate sample s confirmed comparable expression of p53, MDM2 and MDMX levels ( Figure 14 c, lower panels ). The p53 ChIP showed that coexpression of MDM2 significantly inhibited p53 binding to the p21 (n = 3, p = 0.01) and PUMA (n = 3, p = 0.05) promoter ( Figure 14 a & b), whereas MDMX had a less dramatic effect (n = 3, p = 0. 07 and 0.08). P21 protein expression was also significantly repressed by MDM2, compared to the modest decrease by MDMX ( Figure 14 c). 60

PAGE 72

Figure 14: Inhibition of p53-DNA binding by MDM2. (a) & (b) H1299 cells were transfected with p53, MDM2 or MD MX and analyzed by ChIP, followed by quantitative PCR (qPCR) to detect p53 DNA binding to the p21 promoter. (c) WCE (whole cell extracts) of parallel samp les were analyzed to confirm levels of protein expression. Next, to test the effect of MDM2 or MDMX over expression on endogenous p53 transcriptional activity, U2 OS cells were transfected with the BP100-luciferase reporter. Co-transfect ion with the MDM2 plasmid resulted in strong inhibition of luciferase expression, while MDMX only weakly inhibited p53 activity (n = 4, p = 0.002 compared to p = 0.07) ( Figure 15). These results corroborated the in vitro and in vivo DNA binding assay and showed that MDM2, not MDMX, efficiently inhibits p53 DNA binding and transcriptional activity. 61

PAGE 73

Figure 15: MDM2 overexpression in hibits endogenous p53 activity. Endogenous p53 activity in U2 OS cells was measured by transfection of BP100luciferase reporter. Inhi bition by MDM2 or MDMX was determined by cotransfection and luciferase assay. MDM2 acidic domain is critical for inhibiting p53 DNA binding To identify the domain on MDM2 necessa ry for blocking p53 DNA binding, different C terminal mutants of FLAG-MD M2 were tested. The results showed that the MDM2 RING domain mutant (457S ) was as active as wt MDM2. MDM21-300 (without the RING dom ain and zinc finger) still retained strong activity in blocking p53 DNA binding despite being expr essed at lower levels. However, further deletion of the acidic domain (MDM2-1-200) completely abrogated the ability to inhibit p53 DNA binding ( Figure 16 a). In a control experiment, different C terminal truncation mutants of FLAG-M DMX were also tested. The results showed that full length or fragments of MDMX had no effect on p53 DNA binding despite forming complexes with p53 efficiently ( Figure 16 b). It is important to note that in this assay sample input was equalized for the amount of co62

PAGE 74

precipitated p53. Some samples may have excess free MDM2, but is not expected to influence the result. Figure 16: MDM2 acidic domain inhibits p53-oligonucleotide binding (a) & (b) H1299 cells were transiently transfected and the FLAG-tagged protein complexes were immunopurified. Eluates containing equal am ounts of p53 were captured with biotinylated ol igonucleotide DNA containi ng p53 binding site. An aliquot of eluate was analyzed to confi rm similar levels of p53 expression. 63 When p53 DNA binding in vivo was analyzed by ChIP in transfected cells, the effects of MDM2 mutant s were consistent with the in vitro DNA pull down assay. The full length and MDM2-457S E3 mu tant were both efficient in blocking p53 DNA binding (n = 3, p = 0.03 and p = 0. 08 for p21 and p = 0.06 and p = 0.09 for PUMA). However, deletion of both acidic domain and RING domains (MDM21-200) completely restored p53 DNA bindin g (n = 3, p = 0.55 for p21 and p = 0.2 for PUMA) ( Figure 17 a, b & c ). Treatment with MG132 for 5 hours before ChIP analysis produced similar results (n = 3, p = 0.02 and 0.05 versus p = 0.17 for p21 and p = 0.24 and 0.33 versus p = 0.53 for PUMA) ( Figure 18 a & b ), suggesting that MDM2 can inhibit p53 DNA binding in vivo without targeting it for degradation. As expected, MDMX wild type or mutants showed no difference in regulating p53 DNA binding in ChIP assay, consistent with the in vitro DNA binding result (n = 3, p = 0.31, 0.2 and 0.25 for p21 and p = 0.4, 0.21, 0.2 for

PAGE 75

PUMA) (Figure 19 a, b & c ). These results showed that the MDM2 acidic domain has an important role in regulating p53 DNA binding. Figure 17: MDM2 acidic domain inhibits DNA binding. (a) & (b) H1299 cells were transiently transfected with the i ndicated plasmids, treated with MG132 for 5 h and analyzed by ChIP qPCR to de tect p53 DNA binding to the p21 and PUMA promoter. (c) H1299 cells were tr ansiently transfect ed with the indicated plasmids and analyzed by ChIP to detect p53 DNA binding to the p21 promoter. GAPDH promoter primers were used for a spec ificity control. In put is 1% of the starting lysate material. WCE of para llel samples were analyzed to confirm levels of protein expression. 64

PAGE 76

Figure 18: MDM2 inhibits DNA binding pr ior to proteosomal degradation. (a) & (b) H1299 cells were transiently transfected with the indicated plasmids, treated with 30 M MG132 for 5 h and analyzed by ChIP qPCR to detect p53 DNA binding to the p21 and PUMA promoter. 65 Figure 19: MDMX acidic domain does not inhibit p53-DNA binding. (a) & (b) H1299 cells were transiently transfected with the indicated plasmids, treated with MG132 for 5 h and analyzed by ChIP qPCR to detect p53 DN A binding to the p21 and PUMA promoter. (c) H1299 cells were transiently transfected with the indicated plasmids and analyzed by ChIP to detect p53 DNA binding to the p21 promoter. GAPDH prom oter primers were used for a s pecificity control. Input is 1% of the starting lysate material. WC E of parallel samples were analyzed to confirm levels of protein expression.

PAGE 77

66 MDM2 but not MDMX induces p53 conformational change DNA binding by p53 require s proper folding of a conformation-labile core domain. To determine how MDM2 inhibits p53 DNA binding, we tested the ability of MDM2 and MDMX in inducing p53 conf ormational change. A recent study showed that MDM2 induces p53 conf ormational change as measured by reactivity to wild type-specific P ab1620 and mutant-specific Pab240, which recognize epitopes located in the p53 core domain (Sas aki et al., 2007). Using this assay, p53 was cotransfected with MDM2 or MDMX into H1299 cells, incubated without or with MG132 to prevent p53 deg radation, and analyzed by Pab1620/Pab240 IP. The ratios of p53 with wild type and mutant conformation were determined by western blot wit h pan-specific p53 antibody FL393. The results showed that p53 wa s predominantly in a wild type conformation when expressed alone ( Figure 20 a). Coexpression with MDM2 induced a significant switch from wild type to mutant conformation as reported previously (Sasaki et al., 2007). In add ition, MDM2-457S RING mutant retained full effect, indicating that E3 ligase f unction was not required for inducing p53 conformational change. Furthermore, MDMX expression did not alter p53 conformation ( Figure 20 a). In the absence of MG132, p53 with mutant conformation did not accumulate, presumably because of subsequent ubiquitination and degradation by t he proteasome ( Figure 20 a). In contrast, MDM2-457S-induced p53 conformational c hange was readily detectable in the absence of MG132 because it did no t promote p53 ubiquitination and degradation ( Figure 20 a). Direct loads for each transfection were run as well to determine p53, MDM2 and MDMX protein expression ( Figure 20 b). These results showed that MDM2 inhibiti on of p53 DNA binding correlates with induction of conformational change before ubiquitination.

PAGE 78

Figure 20: MDM2 but not MDMX induces p53 conformational change. (a) H1299 cells were transfect ed with the indicated plasmids and left untreated or treated with 30 M MG132 for 5 h. Cell lysates were immunoprecipitated with wild-type conformation specific (Pab1620) or mutant conformation specific (Pab240) antibodies. The precipitated p53 was detected by western blot. (b) WCE were analyzed for protein expression levels. The amount of sample used for the IP was empirically adjusted to compensate for large changes in expression levels p53249S is a confo rmational mutant as a positive control. To test whether MDM2-induced p53 conformational change occurs with endogenous proteins, SJSA cells (MDM2 amplification) was analyzed in comparison to HCT116 cells (no MDM2 amp lification). The re sult showed that whereas p53 was present mostly in wild type conformation in HCT116, >50% of endogenous p53 in SJSA wa s present in the mutant conformation ( Figure 21 ). In comparison, endogenous mutant p53 in DLD1 cells was nearly 100% in the mutant conformation. As another contro l, the temperature-sensitive p53-V138 mutant stably expressed in H1299 cells showed conformational switch between permissive and non-permissive te mperatures as expected (Figure 21). 67

PAGE 79

Figure 21: Amplified MDM2 induces p53 conformational change. Cell lines expression different levels of endogen ous MDM2 and wt or mutant p53 were treated with 30 M MG132 for 5 h and immunoprecipitated with Pab1620 or Pab240. Protein expression was conf irmed by western blot of WCE. Nutlin blocks MDM2 mediated p53 conformational change To further test whether mutant c onformation p53 in SJSA cells and transient transfections was due to inte raction with overexpressed MDM2, cells were treated with Nutlin to disrupt p53-MDM2 binding. The result showed that Nutlin treatment not only increased total p53 level, but also increased the ratio of Pab1620-positive p53 over Pab240-positiv e p53 in both transient transfection assays and SJSA cells ( Figure 22 a & b ). As expected, MDM2 coprecipitation with p53 was reduced, but not eliminated after Nutlin treatment, presumably due to the fact that Nutlin induces very high le vel MDM2 expression ( Figure 22 b, 68

PAGE 80

right panels ). Taken together, the data sugges ts that a direct interaction between endogenous MDM2 and p53 is needed to change p53 conformation. Figure 22: Nutlin blocks MDM2 induced p53 conformational change. (a) & (b) Transiently transfected H1299 cells and SJSA cells were treated with 30 M MG132 for 5 h with or without 5 M Nutlin and analyzed fo r p53 conformation by Pab1620 and Pab240 IP. MDM2 coprec ipitated with p53 was detected by western blot. Protein ex pression was confirmed by western blot of WCE. 69

PAGE 81

70 MDM2 acidic domain is critical for inducing conformational change To map the MDM2 domain that m ediates p53 conformational change a panel of MDM2 deletion mutants were co-expressed with p53 in H1299 cells ( Figure 23 a). Conformational analysis of p53 showed that delet ion of the MDM2 acidic domain (1-230, 1-200, 220-325) abrogated the conformational effect ( Figure 23 b). As expected, deleting the N terminal p53-binding domain (50-491, 230-491) also abrogated the activity, whereas mutati ons affecting the RING domain (1-440, 1-290, 457S) had no effect. The expression and binding between p53 and MDM2 mutants were conf irmed by IP-western blot analysis ( Figure 23 c & d ). Therefore, the MDM2 acidic domain has a critical role in inducing the p53 switch to mutant confor mation, but requires targeting by the high-affinity N terminal p53-binding domain.

PAGE 82

Figure 23: Mapping the MDM2 domai n that mediates p53 conformational change. (a) Diagram of MDM2 deletion and point mutants. (b) H1299 cells were transfected with the indicated plasmids, treated with MG132 (30 M, 5 h) and analyzed by Pab1620 and Pab240. (c) MDM2 mutants were co-transfected with p53 into H1299 cells. MDM2 was immunopr ecipitated with a mixture of 4B2, 5B10 and 3G9 antibodies and co-precipitati on of p53 was detected by western blot. Immunoprecipitation of MDM2 mut ants were confirmed by western blot (bottom panel). (d) Expression of p53 and MDM2 mutations were confirmed by western blot of WCE. We also attempted to determine whet her sub regions of the MDM2 acidic domain are critical for p53 conformational change using a series of acidic domain small internal deletion mutants ( Figure 24 a). The results showed that all small internal deletions had similar defects on the p53 conformational change as the complete acidic domain deletion ( Figure 24 b & c ). This suggests that different parts of the MDM2 acidic domain cont ribute to p53 conformational change in an additive fashion. Consistent with this notion, a study showed that the binding 71

PAGE 83

affinity of MDM2 acidic domain to p53 co re is proportional to the length of the acidic domain tested (Yu et al., 2006). Figure 24 : Small deletions in the MDM2 acidic domain partially inhibit p53 conformational change. (a) Diagram of MDM2 and internal deletions in the acidic domain. (b) H1299 cells were trans iently transfected with the indicated expression plasmids and then treated with 30 M MG132. The lysates were immunoprecipitated with Pab1620 or Pab240 antibodies, followed by immunoblotting for total p53 a nd FLAG-MDM2. (c) Wester n blot of whole cell extract showing expression leve ls of p53 and MDM2 mutants. 72 To further test the functional signific ance of the MDM2 acidic domain, we took advantage of the fact that MDMX has negligible activity in p53 conformational change. A panel of MDM2-MDMX hybrid constructs was analyzed for induction of p53 mutant conformation ( Figure 25 a & c ). The results showed that although MDMX did not alter p53 conformation, replacing its acidic domain and C terminal half with the MDM2 counterpart conferred partial to full activity ( Figure 25 a & c, #4, #6 ). In contrast, trans planting the MDM2 RING domain alone to MDMX had no effect ( Figure 25 a & c, #8, #10 ). Additionally, the MDMX acidic domain had no activi ty if transplanted to MDM2 ( Figure 25 a & c, #3, #5). We should note that the phenotypes of #5 and #6 were somewhat

PAGE 84

ambiguous in multiple exper iments, possibly because placement of the junction was not optimal for protein function. Direct loads were run as well to show expression of all plasmids in the indicated transient transfections ( Figure 25 b). Overall, these results corroborate t he MDM2 deletion analysis and reveal a critical role of the MDM2 acidic domain in p53 conformational change. Furthermore, the p53-binding domain of MDM2 simply provided a targeting function, which can be replaced by the MDMX N terminus. Figure 25: Induction of p53 conformational change by MDM2-MDMX hybrid constructs. (a) H1299 cells were tranfec ted with p53 and FLAG tagged MDM2MDMX hybrid constructs. Cells we re treated with MG132 (30 M, 5 hr) and immunoprecipitated with Pab1620 or Pab240 followed by we stern blot for p53. Co-immunoprecipitation of the hybrid proteins was detected by western blot. (b) Expression of p53 and FLAG-tagged MDM2-MDMX hybrid proteins were confirmed by western blot of WCE. (c) Diagram of MDM2-MDMX hybrid constructs and summary of results in (a). 73 Previous studies sugges ted that phosphorylation of MDM2 acidic domain on S256 is needed for efficient degradation of p53 (Blattner et al., 2002). Our mass spectrometric analysis of MDM2 id entified two additional phosphorylation sites S232 and S290 in the acidic domai n (unpublished results). While S232A

PAGE 85

and S290A mutants had no obvious effect on p53 degradation, S256A mutation caused a moderate defect in p53 degradation as reported (data not shown). To test whether phosphorylation of these sites play a role in p53 conformational change, alanine substitution mutants were analyzed. The result showed no significant difference compared to wild-type MDM2 ( Figure 26), suggesting that acidic domain phosphorylation is not necessary for induction of p53 conformational change. Figure 26: Analysis of MDM2 acidic domain phosphorylation mutants. (a) H1299 cells were tranfected with the indi cated plasmids, treated with MG132 (30 M, 5 hr) and analyzed by Pab1620 and Pab240 IP. (b ) WCE of samples was analyzed to confirm similar levels of protein expression for the MDM2 mutants. CK1 -MDMX binding increases MDMX ability to block p53-DNA binding 74 Next we wanted to determine if increasing MDMX-p53 binding would create an MDMX-dependent shift in the p53 conformation. Despite the Nterminal switching of the MDM2 and MDMX protein in Figure 25 (#3 & #4) having no effect on p53 conformational change, it is possible that the lack of shift in p53 to a mutant conformation, when co-transfected with MDMX, is due to inefficient overall binding e fficiency. Therefore, we decided to look at a major MDMX binding protein that has been shown to increase MDMX-p53 DNA binding (Chen et al., 2005c). Affinity purification of MDMX revealed stable bind of the CK1 in HeLa cells stably over expressing wild-type MDMX ( Figure 27 a). CK1 binds to the zinc finger domain of MDMX (data not shown) and a point mutation of the conserved cysteine residue (C306S), located in the MDMX-CK1 binding

PAGE 86

region, was deficient for CK1 binding in a coimmuno precipitation assay ( Figure 27 b). Figure 27: CK1 binds to MDMX and requires the 306 cysteine residue. (a) HeLa cells alone or stably transfect ed with human MDMX. Molecular mass marker (M) (in kilodaltons) is shown to the left of the gel. Coomassie blue staining of affinity-purified MDMX and associated proteins. The two marked bands were identified as CK1 and 14-3-3 by mass spectrometric peptide sequencing. (b) The indicated plasmids were transiently transfected into H1299 cells, IPed for MDMX and analyzed for CK1 binding. WCE were analyzed to confirm protein expression. 75 To determine whether MDMX-p53 binding can be regulated by the CK1 MDMX interaction, a panel of MDMX pl asmids that retained the p53-binding domain was used to determine their p53binding response when co-expressed with CK1 Co-transfection of CK1 with wild-type MDMX and p53 showed a significant increase in p53-MDMX bind ing compared to the MDMX-p53 only transfection ( Figure 28 a). The C306S mutation, which abrogates MDMX-CK1 binding, showed no difference in MDMX-p53 binding whether or not CK1 was also transfected ( Figure 28 a). Previous reports indi cated that, once bound to MDMX, CK1 can phosphorylate Ser-289 located in the MDMX acidic domain (Chen et al., 2005c). The significance of this phosphorylation has yet to be

PAGE 87

established. Therefore, we also look ed at how mutating the serine to an alanine residue might affect the ability of CK1 to increase MDMX-p53 binding. Compared to similar transfections with wi ld-type MDMX, there was a significant decrease in the ability of CK1 to increase MDMX-p53 binding when Ser-289 phosphorylation was blocked ( Figure 28 a). Therefore, the MDMX-CK1 interaction and its subsequent Ser-289 phosphor ylation are critical for increasing the MDMX-p53 binding interaction ( Figure 28 b). This raises the question: does this increase in MDMX-p53 binding via the MDMX-CK1 interaction lead to an increase in MDMX-mediated in hibition of p53 activity? Figure 28: CK1 -MDMX binding increases MDMX-p53 binding. (a) Binding efficiency between MDMX mutants and p53 was determined by transient cotransfection of H1299 cells with MDMX, p53 and CK1 expression plasmids, followed by MDMX IP/p53 western blotting. WCE were analyzed to confirm protein expression. (b) Diagram of the MDMX-CK1 -p53 interaction. 76 Therefore, to further invest igate the effect of MDMX-CK1 binding on p53 DNA binding activity, we purified MDMX-p53 complex from H1299 cells cotransfected with p53 and FLAG -MDMX, with or without CK1 using M2 beads and eluted with FLAG peptide. The protein complex was incubated with biotinylated oligonucleoti de DNA containing p53-bindin g sequence from the p21 promoter. P53-DNA comple x was captured by strept avidin beads and analyzed by western blot. The analysis showed that p53 purified as FLAG-MDMX-p53

PAGE 88

77 complex still had significant DNA bindi ng activity compared to FLAG-p53 only, whereas FLAG-p53 copurif ied with MDMX and CK1 had a significant decrease in p53 bound to DNA ( Figure 29 a). As a specificity cont rol, FLAG-p53 did not bind to an oligonucleotide with a muta ted p53 consensus sequence. To test whether MDMX inhibits p53 DNA binding in vivo H1299 cells were cotransfected with p53 and MDMX, with or without CK1 and analyzed by p53 ChIP-PCR analysis. Western blot of duplicate sample s confirmed comparable expression of p53, MDMX and CK1 levels ( Figure 29 c, red bars). The p53 ChIP showed that coexpression of MDMX with CK1 significantly inhibit ed p53 binding to the p21 promoter ( Figure 29 b), whereas the MDMX-only transfection had a less dramatic effect. P21 protein expressi on was also significantly repressed by MDMX-CK1 compared to the modest decrease by MDMX only ( Figure 29 c).

PAGE 89

Figure 29: MDMX-CK1 binding decreases p53-DNA binding. (a) H1299 cells were transiently transfected and the FLAG-tagged protein complexes were immunopurified. Eluates c ontaining equal amounts of p53 were captured with biotinylated oligonuc leotide DNA containing p53 binding site. An aliquot of eluate was analyzed to confirm similar levels of p53 expression. (b) H1299 cells were transiently transfected with the indica ted plasmids and analyzed by ChIP to detect p53 DNA binding to the p21 promoter. (c) WCE of parallel samples were analyzed to confirm levels of protein expression. 78 In order to specifically det ermine the function of the CK1 -MDMX interaction, the effect of CK1 expression on transcriptional activity of p53 was examined by our lab using mouse embryo fibroblasts null for both MDMX and p53. Transfection with p53 alone with the Bp100-luciferase reporter containing the p53-binding site derived form the MDM2 P2 promoter resulted in strong activation of luciferase ex pression, with or without CK1 co-transfection ( Figure 30). Cotransfection of MDMX expressi on plasmid resulted in only a weak

PAGE 90

inhibition of p53 function, w hereas cotransfection with CK1 resulted in more efficient inhibition of p53 activity ( Figure 30 ). MDMX-C306S mutant was found to be nonresponsive to CK1 stimulation ( Figure 30 ). Therefore the MDMXCK1 interaction is critical for MDMX to efficiently block p53-DNA binding and transcriptional activity. Figure 30: CK1 binding to MDMX is re quired for p53 regulation P53 activation of BP100-luciferase reporter wa s detected after transient transfection into MDMX/p53 double null mouse embryoni c fibroblast cells. The effects of MDMX mutants and CK1 were determined by cotransfection. Increasing MDMX-p53 binding does not induce conformational change 79 Since CK1 can increase p53-MDMX bindi ng, which leads to a decrease in p53-DNA binding and transcriptional acti vity, could it also cause MDMX to switch p53 to a mutant conformation? To investigate this H1299 cells were cotransfected with p53, MDMX and CK1 in the indicated combinations and surprisingly there was no significant shift in the ratio of wild-type to mutant p53 when all three proteins were co-transfected ( Figure 31 a & b). Another transient transfection assay using increasing amounts of CK1 also showed no p53 shift towards a more mutant conformation ( Figure 31 c & d ). Therefore, MDMX deficiency in causing a p53 conformational shift has little to do with its overall

PAGE 91

binding efficiency. This observation leads to a signifi cant question: what is the difference between MDM2 and MDMX that allows for only a MDM2-mediated p53 conformational change? Figure 31: CK1 expression does not induce MDMX-mediated p53 conformational change. (a) & (c) H1299 cells were transiently transfected with the indicated expression plasmids and then treated with 30 M MG132. The lysates were immunoprecipitated wit h Pab1620 or Pab240 antibodies, followed by immunoblotting for total p53 and FLAG -MDM2. (b) & (d) Western blot of whole cell extract showing expression levels of p53 and MDM2 mutants. Acidic domain-p53 binding correlates with p53 conformational change 80 MDM2 acidic domain has been shown to interact weakly with p53 core domain (Ma et al., 2006; Wallace et al., 2006; Yu et al., 2006). Whether MDMX acidic domain has such activity has not been reported. To fu rther test whether the ability to induce p53 conformational switch correlates with p53 core domain binding, MDM2-100-361 and MDMX-100361 fragments were tested for p53 binding after cotransfection into H1299 cells. The result showed that MDM2-100-

PAGE 92

361 coprecipitated with p53 at a clearly detectable le vel, although much weaker than full-length MDM2 as expected ( Figure 32 ). In contrast, MDMX-100-361 showed no interaction with p53. This resu lt adds further evidence that the MDM2 acidic domain is unique compared to MDMX in its ability to bind p53, which may be why MDM2, not MDMX, promotes p53 misfolding and inhibits p53 DNA binding. Figure 32: Acidic domain-p53 binding correlates with p53 conformational change. The indicated FLAG tagged proteins were transiently co-transfected with p53 into H1299 cells. FLAG-MDM2 or MDMX was immunoprecipitated using M2 Beads. Co-precipitated p53 was detected by western blot. DNA damage abrogates the ability of MDM2 to shift p53 conformation 81 We also examined how this conforma tional response to high levels of MDM2 expression would be affected by ph osphorylation of the RING domain of MDM2 following DNA damage. P53 was transfected with or without MDM2 and either left untreated or exposed to 10 Gy i rradiation. These results showed that following DNA damage the 1620/240 ratio of p53, alone or with MDM2, began shifting towards a more wildtype conformation ( Figure 33 a & b ). Previous

PAGE 93

reports have indicated that ATM phosphor ylation of MDM2 is important for stabilization of p53 followi ng DNA damage (Cheng, et al., 2009). Therefore, we also transfected p53 with the ATM resistant MDM2 6A mu tant containing alanine substitution of six ATM phosphorylati on sites near the RING domain. In unstressed cells this mutant is still able to shift the p53 c onformation, however, following DNA damage the increase in 1620-reactive p53 that was observed when co-transfected with wild type MDM2 no longer occurs ( Figure 33 a & b ). Figure 33: DNA damage and ATM pho sphorylation of the MDM2 RING domain inhibit p53 conformational change (a) H1299 cells were tranfected with the indicated plasmids, treated with MG132 (30 M 5 hr) and analyzed by Pab1620 and Pab240 IP. (b) WCE of samp les was analyzed to confirm similar levels of protein expression for the MDM2 mutants. 82

PAGE 94

To test if this DNA damage induc ed shift takes place with endogenous proteins we treated SJSA cells with DNA damage and MG132. Compared to untreated cells, there is a significant sh ift back to the wild-type conformation following DNA damage, regardless of the high levels of MDM2 observed in the cell line ( Figure 34 ). To determine if DNA damage leads to a decrease in the MDM2 acidic domain-p53 interaction, p53 was transfected with or without full length or a.a. 50-491 MDM2 and either left untreated or exposed to 10 Gy irradiation. The results showed that t here was a significant decrease in the p53 co-immunoprecipitated with the a.a. 50-491 MDM2 protein following gamma irradiation ( Figure 35 ) This data suggests that phosphorylation of the MDM2 RING domain also plays a role in prevent ion of p53 conformational shift following DNA damage by decreasing the MDM2 acid ic domain-p53 binding interaction. This observation helps explain one wa y that DNA damage results in a transcriptionally activated p53 prot ein that can bind DNA and stimulate expression of downstream genes, facilitat ing the repair and survival of damaged cells or eliminate severely damaged ce lls through apoptosis (Ko and Prives, 1996; Levine, 1997; Vogelstein et al., 2000). Figure 34: DNA damage inhibits MDM2 induced p53 conformational change. SJSA cells were treated with 30 uM of MG132, with or without 10 Gy irradiation, for 5 hours. Lysate was analyzed by Pab1620 and Pab240 IP. WB of WCE used to confirm protein expression. 83

PAGE 95

Figure 35: DNA damage inhibits the MDM2 acidic domain-p53 interaction (a) H1299 cells were tranfected with the indicated plasmids, treated with MG132 (30 M, 5 hr) and analyzed by MDM2 IP. (b) WCE of samples was analyzed to confirm similar levels of protein ex pression for the transfected plasmids. ARF prevents p53 conformational change and restores DNA binding The ARF protein is critical for p53 activation in response to hyper proliferative stress through interacting with MDM2 acidic domain (Sherr, 2006). Although the best-established effect of ARF is to cause p53 stabilization, we asked whether ARF also stimulates p53 DNA binding by in terfering with the acidic domain of MDM2. When tested in the oligonucleot ide DNA pull-down assay, coexpression of AR F significantly rescued the DNA binding activity of p53-MDM2 complex ( Figure 36a ). Furthermore, ARF expression also stimulated p53 binding to the p21 and PUMA promoter in vivo (n = 3, p = 0.07 versus p = 0.24 for p21 and p = 0.06 versus p = 0.4 for PUMA) ( Figure 36 b, c & d ). Western blots of duplicate samples were used to verify equal p53 expression and confirm expression of ARF and MDM2 ( Figure 36 c, bottom panels ) 84

PAGE 96

Figure 36: ARF expression stimulates p53-DNA binding. (a) H1299 cells were transiently transfected and the FLAG-tagged protein complexes were immunopurified. Eluates c ontaining equal amounts of p53 were captured with biotinylated oligonucleot ide DNA containing p53 binding site. (b) & (c) H1299 cells were transiently transfected with the indicated plasmids and analyzed by ChIP-qPCR to detect p53 DNA binding to the p21 and PUMA promoter. (c) H1299 cells were transiently transfected with the indicated plasmids and analyzed by ChIP to detect p53 DNA binding to the p21 promoter. Input is 1% of the starting lysate material. GAPDH prom oter primers were us ed for a specificity control. WCE of parallel samples was analyzed to confirm levels of protein expression. 85

PAGE 97

To test the effect of ARF expr ession on endogenous p53 transcriptional activity, U2OS cells were transfected wit h the BP100-luciferase reporter. Cotransfection with the MDM2 plasmid, ag ain, resulted in strong inhibition of luciferase expression (n = 4, p = 3.75 x 10-6), while the addition of ARF partially restored p53 transcriptional activity (n = 4, p = 1.4 x 10-4) (Figure 37 ). These results corroborated the in vitro and in vivo DNA binding assay and showed that ARF efficiently increases p53 DNA bindin g and transcriptional activity, even in the presence of overexpressed MDM2. Figure 37: ARF increases p53 transcriptional activity. Endogenous p53 activity in U2OS cells was measured by transfection of BP100-luciferase reporter. Inhibition or stimulation by MDM2 or MDM2 + AR F was determined by co-transfection and luciferase assay. 86 Next, the effect of ARF on MDM2 -mediated p53 conformational change was analyzed by co-transfection in H1299. The result showed that ARF blocked p53 conformational change in a dose-dependent fashion ( Figure 38 a). This

PAGE 98

87 occurred without affecting p53-MDM2 complex formation. In fact, ARF coprecipitated with p53 in the presence of MDM2, indicating formation of p53MDM2-ARF trimeric complex ( Figure 38 a). Furthermore, restoring ARF expression in SJSA cells (ARF-negative, MDM2 amplification) by infection with ARF adenovirus partially reverted endo genous p53 to wild type conformation ( Figure 38 b). In additional experiments, expr ession of ARF in U2OS cells with IPTG-inducible ARF (NARF6 cells) al so showed that endoge nous p53 reverted back to wild-type conformation ( Figure 39 ). To confirm the trimeric complex formation FLAG-p53 was transiently tr ansfected with the indicated plasmid combinations and only when MDM2 was co-transfected with ARF did p53 coprecipitate the ARF protein ( Figure 40 a & b). These results showed that ARF has a novel function in preventing p53 conformational change mediated by MDM2.

PAGE 99

Figure 38: ARF inhibits MDM2-med iated p53 conformational change. (c) H1299 cells were transiently transfe cted with the indicated plasmids and increasing amounts of ARF. Cells were treated with MG132 (30 M, 5 hr) and analyzed by Pab1620 and Pab240 IP. Co -immunoprecipitation of ARF and MDM2 were detected by western blo t. (d) SJSA cells were infected with adenovirus expressing ARF or GFP (MOI=50) for 24 hr. Cells were treated with MG132 (30 M, 5 hr) and analyzed by Pab1620 and Pab240 IP. Coimmunoprecipitation of ARF and MDM2 were detected by western blot. Expression levels were confirmed by western blot of WCE (right panels). 88

PAGE 100

Figure 39: ARF blocks p53 conformational change. ARF restores p53 wild type conformation. NARF6 cells (U2OS with stable IPTG-inducible ARF) were treated with or without 1 mM IPTG fo r 24 hours to induce ARF expression, followed by 5 hrs of 30 M MG132. Lysates were immunoprecipitated with Pab1620 and Pab240 ant ibodies, followed by imm unoblotting for p53, MDM2 and ARF. Expression of each protein was confirmed by western blot of WCE. Figure 40: p53-MDM2-ARF form a trimeric complex. (a) H1299 cells were transiently transfected wit h the indicated plasmids followed by 5 h of 30 M MG132. Lysates were immunoprecipit ated with M2Beads, followed by immunoblotting for p53, MDM2 ARF and SUV39H1. (b) Expression of proteins were confirmed by western blot of WCE. 89

PAGE 101

Since p53-MDM2-ARF trimeric complex was detectable after coexpression ( Figure 38, 39 & 40 ), ARF may be recruited to DNA by binding to MDM2 and keeping p53 in a wild type conformation. As expected, ChIP analysis using Myc-tagged ARF showed that it was detected at the p21 and PUMA promoters in an MDM2 and p53-dependent manner (n = 3, p = 0.05 for p21 and p = 0.15 for PUMA) ( Figure 41 a & b ). Besides restoring p53 DNA binding, it remains to be determined whether chromatin recruitment of ARF has other functional consequence. Figure 41: ARF binds at p53 target promoters via trimeric complex formation. (a) & (b) H1299 cells were transfected with Myc-ARF, MDM2 and p53. Cells were analyzed by ChIP usi ng the anti-Myc antibody. ARF recruitment to p21 and PUMA promoters by p53 and MDM2 were detected by qPCR of ChIP samples. SUV39H1 blocks p53 conformationa l change to access p53 target promoters The MDM2 acidic domain interacts with several transcription repressors including YY1, KAP1 and SUV39H1. These interactions suggest that MDM2 may actively repress p53 targets by recrui ting corepressors to promoters. We hypothesized that similar to ARF, co-repressors may also prevent MDM2 acidic domain from blocking p53 DNA binding, thus allowing recrui tment of the p53MDM2-repressor complex to promot ers and repress transcription. 90

PAGE 102

We tested this hypothesis using SUV39H1 as an example due to its efficient MDM2 binding (Chen et al., 2010). In vitro DNA binding assay showed that co-expression of SU V39H1 with MDM2 partially restored p53 DNA binding function ( Figure 42 ). Co-expression of SUV39H 1 with MDM2 and p53 also led to an increase in p53-DNA binding in vivo (n = 3, p = 0.06 versus p = 0.13 for p21 and p = 0.06 versus p = 0.1 for PUMA) ( Figure 43 a, b & c ). Figure 42: SUV restores p5 3-oligonucleotide binding. H1299 cells were transiently transfected and the FL AG-tagged protein complexes were immunopurified. Eluates c ontaining equal amounts of p53 were captured with biotinylated oligon ucleotide DNA contai ning p53 binding site. 91

PAGE 103

Figure 43: SUV39H1 rest ores p53-DNA binding. (a) & (b) H1299 cells were transiently transfected wit h the indicated plasmids and analyzed by ChIP-qPCR to detect p53 DNA binding to the p21 and PUMA promoter (c) H1299 cells were transiently transfected with the indica ted plasmids and analyzed by ChIP to detect p53 DNA binding to t he p21 promoter. Input is 1% of the starting lysate material. WCE of parallel samples were analyzed to confirm levels of protein expression. 92 Next, to test the effect of SUV39H1 expression on endogenous p53 transcriptional activity, U2OS cells were transfected with the BP100-luciferase reporter. Co-transfection with the MDM2 plasmid, again, resulted in strong inhibition of luciferase expression and the addition of SUV39H1 was unable to restore p53 transcriptional activity (n = 4, p = 0.017 for MDM2 transfected alone compared to p = 0.015 fo r MDM2 and SUV39H1) ( Figure 44 ). These results corroborated the in vitro and in vivo DNA binding assay and showed that

PAGE 104

SUV39H1 efficiently increases p53 DNA binding, even in the presence of overexpressed MDM2. However, SUV3 9H1 still acts as a transcriptional repressor and blocks p53 transcriptional activity. Figure 44: SUV39H1 increases p 53 transcriptional activity. Endogenous p53 activity in U2OS cells was measured by transfection of BP100-luciferase reporter. Inhibition or stimulation by MDM2 or MDM2 + SUV39H1 was determined by co-transfection and luciferase assay. 93 To determine if the increase in p53-DNA binding when SUV39H1 is overexpressed correlates with a block in MDM2-mediated p53 conformational change a p53 conformational analysis wa s conducted. Overexpression of SUV39H1 partially inhibi ted the ability of MDM2 to induce p53 mutant conformation ( Figure 45 ). Co-preciptation of p53, MDM2 and SUV39H1 indicated that these proteins also formed a trimeric complex ( Figure 45 & 40 ). SUV39H1 ChIP analysis showed that coexpression of p53 a nd MDM2 promoted SUV39H1 recruitment to p21 and PUMA prom oters ( n = 3, p = 0.06 for p21 and p = 0.1 for PUMA) ( Figure 46 a & b). Additional attempts to detect recruitment of endogenous SUV39H1 to the p21 and PUMA pr omoters by p53 and MDM2 were

PAGE 105

not informative, possibly limited by the SUV39H1 antibody These results showed that similar to ARF, SUV39HI bi nding to MDM2 acid ic domain prevents p53 misfolding by MDM2, thus allowing the trim eric repressive complex to bind p53 target promoters. Figure 45: SUV39H1 restores p53 wild-type conformation. H1299 cells were transiently transfected with the indica ted plasmids and in creasing amounts of SUV39H1. Cells were treated with MG132 (30 M, 5 hr) and analyzed by Pab1620 and Pab240 IP. Co-immunoprecip itation of SUV39H1 and MDM2 was detected by western blot. Figure 46: SUV39H1 binds at p53 target promoters via trimeric complex formation. (a) & (b) H1299 cells were transf ected with Myc-SUV39H1, MDM2 and p53. Cells were analyzed by ChIP using the anti-Myc antibody. SUV39H1 recruitment to p21 and PUMA promoter s by p53 and MDM2 was detected by qPCR of ChIP samples. 94 Inhibition of MDM2 cooperates wi th Bortezomib to activate p53

PAGE 106

Given the observation that p53 accumula ted after proteasome inhibition is partially misfolded due to MDM2 binding, we asked whether this phenomenon has clinical relevance. The proteasome inhibitor Bortezomib (Velcade) induces cell death independent of p53 ( Hideshima et al., 2003b). Our results suggest that proteasome inhibition stabilizes both p53 and MDM2, forming complexes that are partially def icient for DNA binding or transcription activation. Thus the p53-mediated anti-tumor activity is not fully exploited. If this is the case, Nutlin should cooperate with Bortezomib to induce p53 targets by inhibiting MDM2. When SJSA and U2OS cells were tr eated with Bortezomib, there was negligible to weak increase in protein levels of PUMA and p21. Combination of Bortezomib and Nutlin resu lted in strong indu ction of PUMA and p21 compared to either drug alone, without further increasing p53 level ( Figure 47 ). RT-PCR analysis showed that in MDM2-overexpre ssing SJSA cells, Bortezomib caused p53 accumulation but did not induce PUMA and p21 mRNA. Bortezomib and Nutlin combination induced PUMA and p21 m RNA to levels similar to Nutlin alone ( Figure 48 a & b ). ChIP analysis show ed that p53 DNA bind was moderately induced by Bortezomib in SJ SA cells, and was further enhanced by Nutlin (n = 3, p = 0.001 increased to p = 0.004 for p21 and p = 0.0085 increased to p = 0.009 for PUMA) ( Figure 48 c & d ). Figure 47: Nutlin activates p53 in Bortezomib-treated cells. (a) SJSA & (b) U2OS cells were treated with the indicat ed drugs and analyzed by western blot at indicated time points for expression of p53 targets. 95

PAGE 107

Figure 48: Nutlin increases p53-DNA bi nding and transcription of target genes in Bortezomib treated SJSA cells. (a) & (b) SJSA cells were treated with 8 M Nutlin and 50 nM Bortezomib for 5 hours. Cells were analyzed by p53 ChIP and qPCR of PUMA and p21 promoters. (c) & (d) SJSA cells were treated with 8 M Nutlin and 50 nM Bortezomib for 5 hours. Total RNA isolated from the cells was analyzed by quantit ative RT-PCR. PUMA an d p21 mRNA levels were normalized to GAPDH. Similar results were observed in U2OS cells (n = 3, p = 0.001 increased to p = 0.007 for p21 and p = 0.006 increased to p = 0.05 for PUMA), although higher level of PUMA and p21 mRNA we re induced by Bortezomib alone ( Figure 49 a d ), as expected from the lower level of MDM2 in this cell line. These results showed that p53 stabilized by Bo rtezomib has poor DNA binding and poor transcriptional activity due to interaction with MDM2. Inhibition of MDM2 restores the DNA binding and activation functions of p53 in Bortezomib-treated cells. 96

PAGE 108

Figure 49: Nutlin increases p53-DNA bi nding and transcription of target genes in Bortezomib treated U2OS cells. (a) & (b) U2OS cells were treated with 8 M Nutlin and 50 nM Bortezomib for 5 hours. Cells were analyzed by p53 ChIP and qPCR of PUMA and p21 promoters. (c) & (d) U2OS cells were treated with 8 M Nutlin and 50 nM Bortezomib for 5 hours. Total RNA isolated from the cells was analyzed by quantit ative RT-PCR. PUMA an d p21 mRNA levels were normalized to GAPDH. 97 To establish if the inhibition of MD M2-p53 interaction by Nutlin might potentiate the effects of the proteosomal inhibitor Bortezom ib in a p53-dependent manner we assessed the effect of combinin g the drugs on cell viability using the MTT assay. Following a 48 h exposure of Bortezomib or Nutlin alone, and in combination, on cells containing wild type p53 (SJSA, U2OS & HCT +/+) or mutant and null p53 (DLD1, MDA-231 & HCT -/-), we showed that the combination produced a strong synergist ic cytotoxic effect on the wild-type containing cell lines, co mpared to the mutant and null p53 ce ll lines ( Figure 50 a,

PAGE 109

98 b & e compared to Figure 50 c, d & f ). Nutlin alone was slightly cytotoxic to the wild-type p53 containing cell li nes, however, the combination treatment increased the cytotoxic effects, as indi cated by the drastic decline in cell viability from 0 to 5 M Bortezomib, compared to Bortezom ib only treatment from 0 to 5 M. These results indicate that the inhibition of MD M2 from Nutlin treat ment, which restores DNA binding and activation functions of p53 in Bortezom ib-treated cells, ultimately leads to decreased cell viability in wild-type-p53 containing cancer cell lines.

PAGE 110

Figure 50: Combination of Bortezom ib and Nutlin treatment lead to increased cytotoxicity in p53 wild type containing cell lines. (a), (b), (c), (d), (e) & (f) Cell viability of SJSA, U2OS, DLD1, MDA-231, HCT +/+ and HCT -/cell lines after exposure to the indicated drug treatments for 48 h was assessed by MTT. The black line indicates Bortezomib only treatment, the grey line indicates combination 8 M Nutlin and Bortezomib. 99

PAGE 111

100 DISCUSSION The experiments described above show ed that MDM2 binding to p53 leads to its conformational change to a st ate similar to misfolded mutant p53. This activity does not require the ubiquitin E3 ligase activity of MDM2, consistent with recent reports from the Maki lab ( Nie et al., 2007; Sasaki et al., 2007). Furthermore, our study produced several new observations: (1) MDM2 inhibits p53 binding to DNA through an E3-inde pendent mechanism. (Gilmore et al., 2008) The acidic domain of MDM2 is crit ical for inducing p53 misfolding and inhibiting p53 DNA binding. (3) The MDMX acidic domain does not bind p53 or induce p53 misfolding. (4) DNA damage blocks MDM2-mediated p53 conformational change. (5) ARF prev ents p53 misfolding by MDM2. (6) SUV39H1 binding to MDM2 acidic domain prev ents p53 misfolding and allows its recruitment to p53 target promoters. The detailed mechanism by which MDM2 binding induces p53 conformational change remains to be dete rmined. The core domain of p53 is known to have poor thermo stab ility and spontaneously denatures at physiological temperature in vitro (Bullock et al., 1997). Presumably, p53 in cells also exist in a dynamic equ ilibrium as wild type and mis-folded forms. A simple scenario is that the MDM2 acidic domain preferentially interacts with p53 at a mutant-like conformation with exposed internal residues. The presence of MDM2 will alter the p53 conformation equilibrium and trap it in a mutant conformation. It is also possible that MDM2 binding to p53 N terminus causes allosteric changes in its core domain, which is then trapped by subsequent interaction with the MDM2 acidic domain. Molecular chape rones that normally promote protein folding, such as hsp90, have been show n to antagonize the effect of MDM2 (Sasaki et al., 2007).

PAGE 112

101 It is noteworthy that the use of c onformation-sensitive p53 antibodies resulted in the arbitrary definition of wild type (Pab1620-positive) and mutant (Pab240-positive) conformational st ates. In reality, p53 is likely to also exist in many intermediate states between Pab1620 and Pab240-reactive conformations. After binding to MDM2, p53 may rapidly lo se DNA binding activity before fully adopting a Pab240-positive conf ormation. Consistent with this notion, MDM2 inhibits p53 DNA binding in ChIP assay in the absence of MG132, when most p53 complexed with MDM2 are still Pa b1620-positive. The MDM2-457S E3 mutant also efficiently inhibits p53 DNA binding in vivo while only switching a fraction of p53 to Pab240-pos itive conformation. Therefore, MDM2-induced p53 misfolding may be more efficient than th e Pab240 reactivity suggests. This distinct function may enable MDM2 to act rapidly without relying on ubiquitination and degradation of p5 3, or serve as backup mechanism as a counter balance to p53 deubiquitinating enzymes. Our results underscore the importance of the MDM2 acidic domain in p53 regulation. The central region between re sidues 200-300 of MDM2 is a busy hub for binding multiple transcription cor epressors and coactivators, and contains several phosphorylation sites (Blattner et al., 2002; Kulikov et al., 2005). Important p53 activators such as ARF and many ribosomal proteins also bind to the acidic domain. The regi on is predicted to be structur ally disordered, which is a pre-requisite for interaction with multiple partners by adopting different conformations upon binding (Dunker et al., 2008). The acidic domain has also been shown to bind to p53 core domain, a nd our results add a new function to this interaction, which is blocking DNA binding by p53. Surprisingly, the MDMX central domain does not have this acti vity, probably because of low sequence homology to MDM2 acidic domain. In fact, most MDM2 acidic domain-binding partners do not bind MDMX (ARF, L5, L11, L23, SUV39H1, EHMT1). Although it is not clear which is the primitive member of the MD M2/X family, we speculate that MDM2 may be an evolved version of MDMX that gained a multitude of new regulatory capabilities to cont rol p53. Alternatively, MDMX may have evolved in a different direction to perfo rm distinct but essential fu nctions in p53 regulation.

PAGE 113

102 The specific ability of MDM2 to switch p53 to a mutant conformation should enable more effective p53 inhibition than MDMX. This is consistent with findings in animal models that MDM2 is a more critical r egulator of p53 than MDMX in adult organs (Grier et al ., 2006; Maetens et al., 2007). By simultaneously promoting p53 ubiquitinat ion and blocking DNA binding, MDM2 efficiently neutralizes p53 function without entirely relying on its degradation. This function is further enhanced by recrui tment of corepressors to p53 target genes that directly repress transcription. It is possible that p53 misfolding by MDM2 also serves to increase ubiquitination efficiency by increasing access to lysine residues in the core or C terminal domains. Although the novel activities of MDM2 acidic domain are most evident in overexpression assays, they are likely to be physiologically relevant, as shown using endogenous proteins in SJSA cells. Our results reveal novel mechanisms by which p53 can be regulated ( Figure 51 ). It has been well do cument that the tumor suppressor, p53, has the ability to couple the cell cycle to DNA damage and initiate apoptosis if the cell is unable to repair the damage (Croce, 2008). In fact, followi ng DNA damage p53 plays a critical role in prevention agai nst malignant transformation by inducing not just apoptosis, but also cell cycle arrest and DNA repair depending on the level and type of cellular dam age that has occurred (Levi ne, 1997; Levine et al., 2004; Vogelstein et al., 2000). Many studies have shown that once the cells encounter DNA damage, multiple post-translational modifications occur, leading to an increase in p53 levels due to stabilization and an increase in p53 transcriptional activity (Lakin and Jackson, 1999; Saito et al., 2003). There are still questions as to how DNA damage stabilizes and activates p53. Here we show that one possible mechanism woul d be through blocki ng MDM2-mediated conformational change. This would a llow p53, now in a mainly wild-type conformation, to bind DNA and transcribe target genes. It is also a possible explanation for the observations by our lab and other groups that show DNA damage leads to p53 stabilization, yet MD M2-p53 binding is not significantly decreased. DNA damage might prevent the secondary MDM2 acidic domain-

PAGE 114

p53 interaction, decreasing p53 ubiquitination and prot eosomal degradation while also allowing for the protein complex to bind DNA. Figure 51: A model for ubiquitin-independent regulation of p53 by MDM2 MDM2 binding to p53 leads to subsequent conformational change of p53 core domain, resulting in loss of DNA bindi ng. Following DNA damage MDM2 is not longer able to shift p53 to a mutant c onformation, leading to DNA binding and transcriptional activity. ARF binding to MDM2 acidic domain inhibits ubiquitination of p53, but also prevents p53 confo rmational change and loss of DNA binding activity, resulting in stab ilized p53 competent in transcription activation. SUV39H1 binding to MDM2 acidic domain prevents p53 conformational change, which allows p53-MDM2-SUV39H1 trimeric complex to bind DNA and repress p53 target promoters. 103 The ARF tumor suppressor is best k nown for its ability to block p53 ubiquitination by MDM2. He re we showed that ARF bi nding to the MDM2 acidic domain also prevents p53 misfolding, and stimulates p53 DNA binding. ARF binding to MDM2 has been shown to pr omote stable beta sheet formation (Bothner et al., 2001; Sivakolundu et al., 2008), which may trap MDM2 acidic domain in a conformation that cannot bind p53 core domain or induce p53 misfolding. It is still not clear how p53-MDM2-ARF complex can activate transcription after binding DNA. Possibly because p53 binds DNA as a tetramer,

PAGE 115

104 a fraction of the p53 molecules have N terminal domain that are not concealed by MDM2. Furthermore, p53-DNA binding may be more stable than p53-MDM2 interaction, eventually leaving free p53 on the DNA. If MDM2-p53 complex does not bi nd DNA, why is endogenous MDM2 detected on p53 target promoters in tumor cells devoid of ARF (Arva et al., 2005; Jin et al., 2003; Tang et al., 2008; W ang et al., 2004; White et al., 2006)? Our results suggest that binding of MDM2 ac idic domain by SUV39H1 has effects similar to ARF, preventi ng p53 misfolding and allowing p53-MDM2 complex to bind DNA. It is possible that other proteins that interact with the acidic domain of MDM2 also protect p53 from misfolding. Therefore, when MDM2 is detected on p53 target promoters, it is likely to be in complexes with acidic domain binding partners. In the case of p53 activators such as ARF and ribosomal proteins, these interactions promote p53 DNA bindi ng and transcription activation. In the case of corepressors such as KAP1 and SUV39H1, t he interactions allow their recruitment to p53 target promoters to repress transcription. Furthermore, ARF has been shown to displace KAP1 and SUV39H1 from MDM2 (Chen et al., 2010; Wang et al., 2005), suggesting that ARF binding to p53-MDM2 complex on chromatin may block the recruitment of corepressors by MDM2. These mechanisms enable the MDM2 acidic domain to function as an important signal conduit for both activators and inhibitors of p53. Our findings also have obvious translati onal implications. The proteasome inhibitor Bortezomib was in itially shown to induce cell death indepen dent of p53 status (Hideshima et al., 2003b). Howeve r, there is evidenc e that Bortezomib induces pro-apoptotic protei n NOXA more efficiently in the presence of Wt p53 (Perez-Galan et al., 2006). Bortezomib ac ts as a reversible inhibitor of the chymotrypsin-like activity of the 26S proteasome in mammalian cells. The ubiquitin proteasome pathway plays an essential role in regulating the intracellular concentration of specific proteins, thereby maintaining homeostasis within the cells. Inhibition of the 26S proteasome can a ffect multiple signaling cascades within the cell, leading to disruption of normal homeostatic mechanisms and eventually cell death. Bortezomib ha s been reported to induce

PAGE 116

105 cytotoxicity in a variety of cancer cell types in vitro and delay tumor growth in vivo in pre-clinical tumor models, includ ing multiple myeloma and mantel cell lymphoma cells (Perez-Galan et al., 2006; Wang et al., 2008). Although the drug has a variety of effects, bortezomib is capable of activating the p53 apoptotic pathway by stabilizing p53 through proteosom al blockade (Lowe et al., 1993). Recent studies showed that Nutlin synergizes with Bortezomib to induce cell death in multiple myelomas and mantel cell lymphoma. The molecular mechanism of this cooperation was either not investigated (Ooi et al., 2009; Tabe et al., 2009), or was shown to be due to induction of p53 tar get genes (Saha et al., 2010). Our results suggest that prot easome inhibition st abilizes both p53 and MDM2, forming complexes that are partially deficient for DNA binding due to conformational switch by MDM2, or bind DN A but inactive for transcription due to MDM2 recruitment of repressors. As such Nutlin cooperates with Bortezomib by relieving the repressive effects of MDM2, resulting in high-level expression of p53 target genes and increased p53-dependent cytotox icity. This finding provides a molecular rationale for combination therapy using proteasome and MDM2 inhibitors against tumors that express wild type p53. On the basis of a phase 3 clinical tria l, Bortezomib is currently approved for the treatment of newly diagnosed and relapsed mu ltiple myeloma patients (Lee et al., 2008; Richardson et al., 2005; S an Miguel et al., 2008). Nutlin-like MDM2 disruptor is also being investigated in a phase 2 clinical trial but at this time there is no published data. Althou gh bortezomib has been shown to be active against multiple myeloma, resist ance to bortezomib, plus lack of response in solid tumors, have been an issue and an obstacle to overcome in order to achieve better clinical results. Our data indicates that the combination treatment of Nutlin-3 with bortezomib results in coope rative cytotoxicity in cells from solid tumor harboring wild-type p53 and high le vels of MDM2. This combination treatment may be able to restore bortezo mib sensitivity in advanced multiple myeloma patients and extend bortezomib activity against a larger spectrum of tumors. The results also explain why p53 does not seem to play a major role as a mediator of the effects of bortezomib in mono therapy. All though the total p53

PAGE 117

106 mRNA and protein levels are increased, it is still functionally inactivated by MDM2 (Hideshima et al., 2003a). Therefor e, the combination therapy includes the addition of MDM2 inhibition to proteas omal inhibition, not only stablizing p53 but also increasing its DNA binding activi ty. This ultimately makes p53 a more functional protein and is no w able to induce apoptosis in previously functionally compromised cancer cells. This information supports the need for a combination clinical trial in order to improve patient outcomes with not only multiple myeloma and lymphoma malignancies, but also in patients with solid tumors contai ning wt p53 and high levels of MDM2. Also of significance, the addition of MDM2 inhibitor treatment with bortezomib may allow a reduction in the therapeutic dose of this and other genotoxic drugs, which has the potential to reduce unwanted side effects. Similarly, because bortezomib has alr eady been shown to induce an excellent response in some multiple myeloma and mantal cell lymphoma patients, the combinatorial effects from the addition of MDM2 inhibitor ma y allow for more flexibility in dosing patients on clinical trials and an increase in quality of life. In summary, our basic research on the biochemical activity of MDM2 has led to unexpected insight directly rele vant to cancer treatment. With the anticipated advance of MDM2 inhibitors currently in development, our results provide the rationale for implementing clinical trials of nov el combination of approved and experimental drugs in the near future.

PAGE 118

107 REFERENCES Adams, J.M., and Cory, S. (2001). Life-o r-death decisions by the Bcl-2 protein family. Trends Biochem Sci 26 61-66. Appella, E., and Anderson, C.W. (2000). Signaling to p53: breaking the posttranslational modification code. Pathol Biol (Paris) 48 227-245. Appella, E., and Anderson, C.W. (2001). Post-translational modifications and activation of p53 by genotoxic stresses. Eur J Biochem 268 2764-2772. Arva, N.C., Gopen, T.R., Talbott, K.E., Ca mpbell, L.E., Chicas, A., White, D.E., Bond, G.L., Levine, A.J., and Bargonetti, J. (2005). A chromatin-associated and transcriptionally inactive p53-Mdm2 complex occurs in mdm2 SNP309 homozygous cells. J Biol Chem 280 26776-26787. Avantaggiati, M.L., Ogryzko, V., Gardner, K., Giordano, A., Levine, A.S., and Kelly, K. (1997). Recruitment of p300/CBP in p53-dependent signal pathways. Cell 89 1175-1184. Baker, S.J., Markowitz, S., Fearon, E.R., Willson, J.K., and Vogelstein, B. (1990). Suppression of human colorectal carc inoma cell growth by wild-type p53. Science 249 912-915. Barak, Y., Gottlieb, E., Ju ven-Gershon, T., and Oren, M. (1994). Regulation of mdm2 expression by p53: alternativ e promoters produce transcripts with nonidentical translation potential. Genes Dev 8 1739-1749. Barak, Y., Juven, T., Haffner, R., and Or en, M. (1993). mdm2 expression is induced by wild type p53 activity. EMBO J 12 461-468. Barlev, N.A., Liu, L., Chehab, N.H., Mansfi eld, K., Harris, K.G., Halazonetis, T.D., and Berger, S.L. (2001). Acetylation of p53 activates transcription through recruitment of coactivators/his tone acetyltransferases. Mol Cell 8 1243-1254. Bell, H.S., and Ryan, K.M. (2007). Targeting the p53 family for cancer therapy: 'big brother' joins the fight. Cell Cycle 6 1995-2000. Bensaad, K., Tsuruta, A., Selak, M.A ., Vidal, M.N., Nakano, K., Bartrons, R., Gottlieb, E., and Vousden, K.H. (2006). T IGAR, a p53-inducible regulator of glycolysis and apoptosis. Cell 126 107-120.

PAGE 119

108 Bird, A. (2007). Percepti ons of epigenetics. Nature 447 396-398. Bischoff, J.R., Friedman, P.N., Marshak, D. R., Prives, C., and Beach, D. (1990). Human p53 is phosphorylated by p60-cdc2 and cyclin B-cdc2. Proc Natl Acad Sci U S A 87 4766-4770. Blattner, C., Hay, T., Meek, D.W., and Lane, D.P. (2002). Hypophosphorylation of Mdm2 augments p53 stability. Mol Cell Biol 22 6170-6182. Boddy, M.N., Freemont, P.S., and Borden K.L. (1994). The p53-associated protein MDM2 contains a newly characte rized zinc-binding domain called the RING finger. Trends Biochem Sci 19 198-199. Boesten, L.S., Zadelaar, S.M., De Clerc q, S., Francoz, S., van Nieuwkoop, A., Biessen, E.A., Hofmann, F., Feil S., Feil, R., Jochemsen, A.G. et al. (2006). Mdm2, but not Mdm4, protects terminally differentiated smooth muscle cells from p53-mediated caspase-3-independent cell death. Cell Death Differ 13, 20892098. Borden, K.L. (2000). RING domains: mast er builders of molecular scaffolds? J Mol Biol 295 1103-1112. Bosari, S., Viale, G., Roncalli, M., Grazi ani, D., Borsani, G., Lee, A.K., and Coggi, G. (1995). p53 gene mutations, p53 pr otein accumulation and compartmentalization in colore ctal adenocarcinoma. Am J Pathol 147 790-798. Bothner, B., Lewis, W.S., DiGiammarino, E.L., Weber, J.D., Bothner, S.J., and Kriwacki, R.W. (2001). Defining t he molecular basis of Arf and Hdm2 interactions. J Mol Biol 314 263-277. Bottger, A., Bottger, V., Garcia-Echeve rria, C., Chene, P., Hochkeppel, H.K., Sampson, W., Ang, K., Howard, S.F. Picksley, S.M., and Lane, D.P. (1997). Molecular characterization of t he hdm2-p53 interaction. J Mol Biol 269 744-756. Bottger, V., Bottger, A., Garcia-Echeverri a, C., Ramos, Y.F. van der Eb, A.J., Jochemsen, A.G., and Lane, D.P. (1999). Comparative study of the p53-mdm2 and p53-MDMX interfaces. Oncogene 18 189-199. Bottger, V., Bottger, A., Howard, S.F. Picksley, S.M., Chene, P., GarciaEcheverria, C., Hochkeppel, H.K., and Lane, D.P. (1996). Identif ication of novel mdm2 binding peptides by phage display. Oncogene 13 2141-2147. Bouvard, V., Zaitchouk, T., Vacher, M., Duthu, A., Canivet, M ., Choisy-Rossi, C., Nieruchalski, M., and May, E. (2000). Tiss ue and cell-specific expression of the p53-target genes: bax, fas, mdm2 and wa f1/p21, before and fo llowing ionising irradiation in mice. Oncogene 19 649-660.

PAGE 120

109 Bouvet, M., Ellis, L.M., Nishizaki, M., Fuj iwara, T., Liu, W., Bucana, C.D., Fang, B., Lee, J.J., and Roth, J.A. (1998). Adenovirus-mediated wild-type p53 gene transfer down-regulates vascular endothelia l growth factor expression and inhibits angiogenesis in human colon cancer. Cancer Res 58 2288-2292. Brooks, C.L., and Gu, W. (2003). Ubiquitinat ion, phosphorylation and acetylation: the molecular basis for p53 regul ation. Curr Opin Cell Biol 15 164-171. Brooks, C.L., Li, M., and Gu, W. (2007). Mechanistic studies of MDM2-mediated ubiquitination in p53 r egulation. J Biol Chem 282 22804-22815. Bulavin, D.V., Amundson, S.A., and Fornac e, A.J. (2002). p38 and Chk1 kinases: different conductors for the G(2)/M c heckpoint symphony. Curr Opin Genet Dev 12, 92-97. Bullock, A.N., and Fersht, A.R. (2001). Re scuing the function of mutant p53. Nat Rev Cancer 1 68-76. Bullock, A.N., Henckel, J., DeDecker, B.S., Johnson, C.M., Nikolova, P.V., Proctor, M.R., Lane, D.P., and Fersht, A. R. (1997). Thermodynamic stability of wild-type and mutant p53 core domain Proc Natl Acad Sci U S A 94, 1433814342. Burch, L., Shimizu, H., Smith, A., Patterson, C., and Hupp, T.R. (2004). Expansion of protein intera ction maps by phage pepti de display using MDM2 as a prototypical conformationally flex ible target prot ein. J Mol Biol 337 129-145. Burch, L.R., Midgley, C.A., Currie, R.A., Lane, D.P., and Hupp, T.R. (2000). Mdm2 binding to a conformationally s ensitive domain on p53 can be modulated by RNA. FEBS Lett 472 93-98. Cahill, D.P., Kinzler, K.W., Vogelstei n, B., and Lengauer, C. (1999). Genetic instability and darwinian selection in tumours. Trends Cell Biol 9 M57-60. Cahilly-Snyder, L., Yang-Feng, T., Francke, U., and George, D.L. (1987). Molecular analysis and chromosomal mappi ng of amplified genes isolated from a transformed mouse 3T3 cell line. Somat Cell Mol Genet 13 235-244. Canadillas, J.M., Tidow, H., Freund, S.M., Rutherford, T.J ., Ang, H.C., and Fersht, A.R. (2006). Solution structure of p53 core domain: struct ural basis for its instability. Proc Natl Acad Sci U S A 103 2109-2114. Canman, C.E., and Lim, D.S. (1998). The role of ATM in DNA damage responses and cancer. Oncogene 17 3301-3308.

PAGE 121

110 Chan, T.A., Hermeking, H., Lengauer, C., Kinzler, K.W., and Vogelstein, B. (1999). 14-3-3Sigma is required to pr event mitotic catastrophe after DNA damage. Nature 401 616-620. Chen, D., Kon, N., Li, M., Zhang, W ., Qin, J., and Gu, W. (2005a). ARFBP1/Mule is a critical mediator of the ARF tumor suppressor. Cell 121, 10711083. Chen, L., and Chen, J. (2003). MDM2-ARF complex regulates p53 sumoylation. Oncogene 22 5348-5357. Chen, L., Gilkes, D.M., Pan, Y., Lane, W.S., and Chen, J. (2005b). ATM and Chk2-dependent phosphorylation of MDMX contribute to p53 activation after DNA damage. EMBO J 24 3411-3422. Chen, L., Li, C., Pan, Y., and Chen, J. (2005c). Regulation of p53-MDMX interaction by casein kinase 1 alpha. Mol Cell Biol 25 6509-6520. Chen, L., Li, Z., Zwolinska, A.K., Smith, M.A., Cross, B., Koomen, J., Yuan, Z.M., Jenuwein, T., Marine, J.C., Wright, K.L. et al. (2010). MDM2 recruitment of lysine methyltransferases regulates p53 transcriptional output. EMBO J 29 25382552. Cheng, Q., Chen, L., Li, Z., Lane, W.S., and Chen, J. (2009). ATM activates p53 by regulating MDM2 oligomerizat ion and E3 processivity. EMBO J 28, 38573867. Cho, Y., Gorina, S., Jeffrey, P.D., and Pavl etich, N.P. (1994). Cr ystal structure of a p53 tumor suppressor-DNA complex: understanding tumorigenic mutations. Science 265 346-355. Chowdary, D.R., Dermody, J.J., Jha, K. K., and Ozer, H.L. (1994). Accumulation of p53 in a mutant cell line defective in the ubiquitin pathway. Mol Cell Biol 14, 1997-2003. Chuikov, S., Kurash, J.K., Wilson, J. R., Xiao, B., Justin, N., Ivanov, G.S., McKinney, K., Tempst, P., Prives, C., Gamblin, S.J. et al. (2004). Regulation of p53 activity through lysine methylation. Nature 432 353-360. Coultas, L., and Strasser, A. (2003). The role of the Bcl-2 protein family in cancer. Semin Cancer Biol 13 115-123. Croce, C.M. (2008). Oncogenes and cancer. N Engl J Med 358 502-511.

PAGE 122

111 Dachs, G.U., and Tozer, G.M. (2000). Hy poxia modulated gene expression: angiogenesis, metastasis and therapeut ic exploitation. Eur J Cancer 36, 16491660. Dang, C.V., and Lee, W.M. (1989). Nuclear and nucleolar targeting sequences of c-erb-A, c-myb, N-myc, p53, HSP70, and HIV tat proteins. J Biol Chem 264, 18019-18023. de Vries, A., Flores, E.R., Miranda, B., Hsieh, H.M., van Oostrom, C.T., Sage, J., and Jacks, T. (2002). Targeted point mutati ons of p53 lead to dominant-negative inhibition of wild-type p53 functi on. Proc Natl Acad Sci U S A 99 2948-2953. Delphin, C., and Baudier, J. (1994). The pr otein kinase C activator, phorbol ester, cooperates with the wild-type p53 species of Ras-transf ormed embryo fibroblasts growth arrest. J Biol Chem 269 29579-29587. Di Stefano, V., Blandino, G., Sacchi, A ., Soddu, S., and D'Orazi, G. (2004). HIPK2 neutralizes MDM2 inhibition rescuing p53 transcriptional activity and apoptotic function. Oncogene 23 5185-5192. Dillon, S.C., Zhang, X., Tr ievel, R.C., and Cheng, X. (2005). The SET-domain protein superfamily: protein lysi ne methyltransferases. Genome Biol 6 227. Dirac, A.M., and Bernards, R. (2003). Reversal of senescence in mouse fibroblasts through lentiviral suppression of p53. J Biol Chem 278 11731-11734. Dittmer, D., Pati, S., Zambe tti, G., Chu, S., Teresky, A.K., Moore, M., Finlay, C., and Levine, A.J. (1993). Gain of f unction mutations in p53. Nat Genet 4 42-46. Dornan, D., Wertz, I., Shim izu, H., Arnott, D., Frantz, G.D., Dowd, P., O'Rourke, K., Koeppen, H., and Dixit, V.M. (2004). The ubiquitin ligase COP1 is a critical negative regulator of p53. Nature 429 86-92. Dumaz, N., and Meek, D.W. (1999). Se rine15 phosphorylation stimulates p53 transactivation but does not directly in fluence interaction with HDM2. EMBO J 18 7002-7010. Dunker, A.K., Oldfield, C.J., Meng, J., Ro mero, P., Yang, J.Y., Chen, J.W., Vacic, V., Obradovic, Z., and Uversky, V.N. (2008 ). The unfoldomics decade: an update on intrinsically disordered proteins. BMC Genomics 9 Suppl 2 S1. el-Deiry, W.S., Kern, S.E., Pietenpol, J.A., Kinzler, K.W., and Vogelstein, B. (1992). Definition of a consensus binding site for p53. Nat Genet 1 45-49.

PAGE 123

112 el-Deiry, W.S., Tokino, T., Velculescu, V.E., Levy, D.B ., Parsons, R., Trent, J.M., Lin, D., Mercer, W.E., Kinzler, K.W., and Vogelstein, B. (1993) WAF1, a potential mediator of p53 tumor suppression. Cell 75 817-825. Elenbaas, B., Dobbelstein, M., Roth, J., Shenk, T., and Levine, A.J. (1996). The MDM2 oncoprotein binds specifically to RNA through its RING finger domain. Mol Med 2 439-451. Elias, B., Laine, A., and Ronai, Z. (2005). Phosphorylation of MdmX by CDK2/Cdc2(p34) is required for nuclear export of Mdm2. Oncogene 24 25742579. Eliyahu, D., Raz, A., Gruss, P., Givol, D., and Oren, M. (1984) Participation of p53 cellular tumour ant igen in transformation of norma l embryonic cells. Nature 312 646-649. Elledge, S.J. (1996). Cell cycl e checkpoints: preventing an identity crisis. Science 274 1664-1672. Everett, R.D., Meredith, M., Orr, A., Cross, A., Kathor ia, M., and Parkinson, J. (1997). A novel ubiquitin-specific proteas e is dynamically associated with the PML nuclear domain and binds to a herpesvirus regulat ory protein. EMBO J 16, 1519-1530. Farmer, G., Friedlander, P ., Colgan, J., Manley, J.L., and Prives, C. (1996). Transcriptional repression by p53 involves molecular interactions distinct from those with the TATA box binding protein. Nucleic Acids Res 24 4281-4288. Fearon, E.R., and Vogelstein, B. (1990). A genetic model for colorectal tumorigenesis. Cell 61 759-767. Feinberg, A.P., and Tycko, B. (2004). The hi story of cancer epigenetics. Nat Rev Cancer 4 143-153. Feng, Z., Zhang, H., Levine, A.J., and Jin, S. (2005). The coordinate regulation of the p53 and mTOR pathways in cells. Proc Natl Acad Sci U S A 102 8204-8209. Ferbeyre, G., de Stanchina, E., Lin, A.W., Querido, E., McCurrach, M.E., Hannon, G.J., and Lowe, S. W. (2002). Oncogenic ras and p53 cooperate to induce cellular senescence. Mol Cell Biol 22 3497-3508. Fero, M.L., Randel, E., Gurley, K.E., R oberts, J.M., and Kemp, C.J. (1998). The murine gene p27Kip1 is haplo-insuffici ent for tumour suppression. Nature 396, 177-180.

PAGE 124

113 Finlay, C.A., Hinds, P.W., and Levine, A.J. (1989). The p 53 proto-oncogene can act as a suppressor of transformation. Cell 57 1083-1093. Francoz, S., Froment, P., Bogaerts, S., De Clercq, S., Maetens, M., Doumont, G., Bellefroid, E., and Marine, J.C. (2006) Mdm4 and Mdm2 cooperate to inhibit p53 activity in proliferating and quiescent cells in vivo. Proc Natl Acad Sci U S A 103 3232-3237. Freedman, D.A., Epstein, C.B., Roth, J. C., and Levine, A.J. (1997). A genetic approach to mapping the p53 binding site in the MDM2 protein. Mol Med 3 248259. Fulda, S., and Debatin, K.M. (2006). Ex trinsic versus intrinsic apoptosis pathways in anticancer chemotherapy. Oncogene 25 4798-4811. Gallagher, W.M., and Brown, R. (1999). p53-oriented cancer therapies: current progress. Ann Oncol 10 139-150. Gatz, S.A., and Wiesmuller, L. (2006). p53 in recombination and repair. Cell Death Differ 13 1003-1016. Geyer, R.K., Yu, Z.K., and Maki, C.G. ( 2000). The MDM2 RING-finger domain is required to promote p53 nuclear export. Nat Cell Biol 2 569-573. Gil, J., and Peters, G. (2006). Regulat ion of the INK4b-ARF-INK4a tumour suppressor locus: all for one or o ne for all. Nat Rev Mol Cell Biol 7 667-677. Gilkes, D.M., Chen, L., and Chen, J. ( 2006). MDMX regulation of p53 response to ribosomal stress. EMBO J 25 5614-5625. Gilmore, J.L., Scott, J.A., Bouizar, Z., Robling, A., Pitfield, S. E., Riese, D.J., 2nd, and Foley, J. (2008). Amphiregulin-E GFR signaling regulates PTHrP gene expression in breast cancer cells. Breast Cancer Res Treat 110 493-505. Glickman, M.H., and Ciechanover, A. (2002). The ubiquitin-proteasome proteolytic pathway: destruction for the sake of construction. Physiol Rev 82, 373-428. Goldberg, Z., Vogt Sionov, R., Berger, M., Zwang, Y., Perets R., Van Etten, R.A., Oren, M., Taya, Y ., and Haupt, Y. (2002). Tyrosine phosphorylation of Mdm2 by c-Abl: implications for p53 regulation. EMBO J 21 3715-3727. Gostissa, M., Hengstermann, A., Fogal, V ., Sandy, P., Schwarz, S.E., Scheffner, M., and Del Sal, G. (1999). Activation of p53 by conjugation to the ubiquitin-like protein SUMO-1. EMBO J 18 6462-6471.

PAGE 125

114 Green, D.R., and Evan, G.I. (2002). A ma tter of life and death. Cancer Cell 1 1930. Grier, J.D., Xiong, S., E lizondo-Fraire, A.C., Paran t, J.M., and Lozano, G. (2006). Tissue-specific differences of p53 inhi bition by Mdm2 and Mdm4. Mol Cell Biol 26, 192-198. Gross, S.D., and Anderson, R.A. (1998). Casein kinase I: spatial organization and positioning of a mult ifunctional protein kinase family. Cell Signal 10 699-711. Gu, W., Shi, X.L., and Roeder, R.G. (1997). Sy nergistic activation of transcription by CBP and p53. Nature 387 819-823. Guittet, O., Hakansson, P., Voevodskaya, N., Fridd, S., Graslund, A., Arakawa, H., Nakamura, Y., and Thelander, L. ( 2001). Mammalian p53R2 protein forms an active ribonucleotide reductase in vitro with the R1 protein, which is expressed both in resting cells in re sponse to DNA damage and in pr oliferating cells. J Biol Chem 276 40647-40651. Hainaut, P., Soussi, T., Shomer, B., Ho llstein, M., Greenblatt, M., Hovig, E., Harris, C.C., and Montesano, R. (1997). Database of p53 gene somatic mutations in human tumors and cell lines: updated compilation and future prospects. Nucleic Acids Res 25 151-157. Hall, S.R., Campbell, L.E., and Meek, D.W. (1996). Phosphorylat ion of p53 at the casein kinase II site selectively regulates p53-dependent transcriptional repression but not transactivation. Nucleic Acids Res 24 1119-1126. Hanahan, D., and Weinberg, R.A. ( 2000). The hallmarks of cancer. Cell 100 5770. Hansen, S., Hupp, T.R., and Lane, D.P. (1996). Allosteric regulation of the thermostability and DNA binding activity of human p53 by specific interacting proteins. CRC Cell Transformation Group. J Biol Chem 271 3917-3924. Hardie, D.G. (2007). AMP-activated/SNF1 protein kinases: conserved guardians of cellular energy. Nat Rev Mol Cell Biol 8 774-785. Harvey, M., Vogel, H., Morris, D., Bradl ey, A., Bernstein, A., and Donehower, L.A. (1995). A mutant p53 transgene acce lerates tumour development in heterozygous but not nullizygous p53-deficient mice. Nat Genet 9 305-311. Haupt, Y., Maya, R., Kazaz, A., and Oren, M. (1997). Md m2 promotes the rapid degradation of p53. Nature 387 296-299.

PAGE 126

115 Hayflick, L. (1965). The Limited in Vitro Li fetime of Human Diploid Cell Strains. Exp Cell Res 37 614-636. Herbig, U., Jobling, W.A., Chen, B.P ., Chen, D.J., and Sedivy, J.M. (2004). Telomere shortening triggers senescenc e of human cells through a pathway involving ATM, p53, and p21(CIP1 ), but not p16(INK4a). Mol Cell 14 501-513. Hermeking, H., Lengauer, C., Polyak, K., He, T.C., Zhang, L., Thiagalingam, S., Kinzler, K.W., and Vogelstein, B. (1997). 14-3-3 sigma is a p53-regulated inhibitor of G2/M progression. Mol Cell 1 3-11. Hideshima, T., Mitsiades, C., Akiyam a, M., Hayashi, T., Chauhan, D., Richardson, P., Schlossm an, R., Podar, K., Munshi, N.C., Mitsiades, N., et al. (2003a). Molecular mechanisms mediating antimyeloma activity of proteasome inhibitor PS-341. Blood 101 1530-1534. Hideshima, T., Richardson, P.G., and A nderson, K.C. (2003b). Targeting proteasome inhibition in hematologic malignancies. Rev Clin Exp Hematol 7 191-204. Hirao, A., Kong, Y.Y., Matsuoka, S., Wak eham, A., Ruland, J., Yoshida, H., Liu, D., Elledge, S.J., and Mak, T.W. (2000). DNA damage-induced activation of p53 by the checkpoint kinase Chk2. Science 287 1824-1827. Hoffman, W.H., Biade, S., Zilfou, J. T., Chen, J., and Murphy, M. (2002). Transcriptional repression of the anti-apoptotic survivin gene by wild type p53. J Biol Chem 277 3247-3257. Honda, R., Tanaka, H., and Yasuda, H. ( 1997). Oncoprotein MDM2 is a ubiquitin ligase E3 for tumor suppressor p53. FEBS Lett 420 25-27. Hu, B., Gilkes, D.M., and Chen, J. (2007). Efficient p53 activation and apoptosis by simultaneous disruption of binding to MDM2 and MDMX. Cancer Res 67, 8810-8817. Hu, B., Gilkes, D.M., Farooqi, B., S ebti, S.M., and Chen, J. (2006). MDMX overexpression prevents p53 activation by the MDM2 inhibitor Nutlin. J Biol Chem 281 33030-33035. Huang, J., Perez-Burgos, L., Placek, B. J., Sengupta, R., Richter, M., Dorsey, J.A., Kubicek, S., Opravil, S., Jenuwei n, T., and Berger, S.L. (2006). Repression of p53 activity by Smyd2-m ediated methylation. Nature 444 629-632. Huang, J., Sengupta, R., Espejo, A.B., L ee, M.G., Dorsey, J.A., Richter, M., Opravil, S., Shiekhattar, R ., Bedford, M.T., Jenuwein, T. et al. (2007). p53 is regulated by the lysine demethylase LSD1. Nature 449 105-108.

PAGE 127

116 Inoue, T., Wu, L., Stuart, J., and Maki C.G. (2005). Control of p53 nuclear accumulation in stressed cells. FEBS Lett 579 4978-4984. Isobe, M., Emanuel, B.S., Givol, D., Oren, M., and Croce, C.M. (1986). Localization of gene for human p53 tumour antigen to band 17p13. Nature 320, 84-85. Ito, A., Kawaguchi, Y., Lai, C. H., Kovacs, J.J., Higashimo to, Y., Appella, E., and Yao, T.P. (2002). MDM2-HDA C1-mediated deacetylat ion of p53 is required for its degradation. EMBO J 21 6236-6245. Jin, Y., Dai, M.S., Lu, S.Z., Xu, Y., Luo, Z., Zhao, Y., and Lu, H. (2006). 14-33gamma binds to MDMX that is phosphoryl ated by UV-activated Chk1, resulting in p53 activation. EMBO J 25 1207-1218. Jin, Y., Lee, H., Zeng, S.X., Dai, M. S., and Lu, H. (2003). MDM2 promotes p21waf1/cip1 proteasomal turnover inde pendently of ubiquit ylation. Embo J 22, 6365-6377. Joerger, A.C., and Fersht, A.R. (2008). Structural biology of the tumor suppressor p53. Annu Rev Biochem 77 557-582. Kawai, H., Wiederschain, D., and Yuan, Z.M. (2003). Crit ical contribution of the MDM2 acidic domain to p53 ubiquitination. Mol Cell Biol 23 4939-4947. Kern, S.E., Kinzler, K.W., Bruskin, A., Jarosz, D., Friedman, P., Prives, C., and Vogelstein, B. (1991). Ident ification of p53 as a sequenc e-specific DNA-binding protein. Science 252 1708-1711. Kim, S.B., Chae, G.W., Lee, J. Park, J., Tak, H., Chung, J.H., Park, T.G., Ahn, J.K., and Joe, C.O. (2007). Activated Notc h1 interacts with p53 to inhibit its phosphorylation and transactiva tion. Cell Death Differ 14 982-991. Kim, W.Y., and Sharpless, N.E. (2006). The regulation of INK4/ARF in cancer and aging. Cell 127 265-275. Knippschild, U., Gocht, A., Wolff, S., Huber, N., Lohler, J., and Stoter, M. (2005). The casein kinase 1 family: participation in multiple cellular processes in eukaryotes. Cell Signal 17 675-689. Knippschild, U., Milne, D.M., Campbell, L.E., DeMaggio, A.J., Christenson, E., Hoekstra, M.F., and Meek, D.W. (1997). p53 is phosphorylated in vitro and in vivo by the delta and epsilon isoforms of casein kinase 1 and enhances the level of casein kinase 1 delta in response to topoisomerase-directed drugs. Oncogene 15, 1727-1736.

PAGE 128

117 Knippschild, U., Oren, M., and Deppert, W. (1996). Abrogation of wild-type p53 mediated growth-inhibition by nuclear exclusion. Oncogene 12 1755-1765. Knudson, A.G., Jr. (1971). Mutation and cancer: statistical study of retinoblastoma. Proc Natl Acad Sci U S A 68 820-823. Ko, L.J., and Prives, C. (1996). p53: puzzle and paradigm. Genes Dev 10, 10541072. Kouzarides, T. (2000). Acetylation: a regulatory modification to rival phosphorylation? EMBO J 19 1176-1179. Krause, K., Wasner, M., Re inhard, W., Haugwitz, U., Dohna, C.L., Mossner, J., and Engeland, K. (2000). The tumour s uppressor protein p53 can repress transcription of cyclin B. Nucleic Acids Res 28, 4410-4418. Kroemer, G., and Pouyssegur, J. (2008). Tumor cell metabolism: cancer's Achilles' heel. Cancer Cell 13 472-482. Kubbutat, M.H., Jones, S.N., and Vousd en, K.H. (1997). Re gulation of p53 stability by Mdm2. Nature 387 299-303. Kulikov, R., Boehme, K.A., and Blattner C. (2005). Glycogen synthase kinase 3dependent phosphorylation of Mdm2 regul ates p53 abundance. Mol Cell Biol 25, 7170-7180. Lakin, N.D., and Jackson, S.P. (1999). Regulation of p53 in response to DNA damage. Oncogene 18 7644-7655. Lane, D.P. (1992). Cancer. p53, guardian of the genome. Nature 358 15-16. Lane, D.P., and Crawford, L.V. (1979). T antigen is bound to a host protein in SV40-transformed cells. Nature 278 261-263. Laurie, N.A., Donovan, S.L., Shih, C.S., Zha ng, J., Mills, N., Fuller, C., Teunisse, A., Lam, S., Ramos, Y., Mohan, A. et al. (2006). Inactivation of the p53 pathway in retinoblastoma. Nature 444 61-66. Le Cam, L., Linares, L.K., P aul, C., Julien, E., Lacroix, M., Hatchi, E., Triboulet, R., Bossis, G., Shmueli, A., Rodriguez, M.S. et al. (2006). E4F1 is an atypical ubiquitin ligase that modulates p53 effector functions independently of degradation. Cell 127 775-788. LeBron, C., Chen, L., Gilkes, D.M., and Chen, J. (2006). Regulation of MDMX nuclear import and degradation by Chk2 and 14-3-3. EMBO J 25 1196-1206.

PAGE 129

118 Lee, K.C., Crowe, A.J., and Barton, M.C. (1999). p53-m ediated repression of alpha-fetoprotein gene expression by sp ecific DNA binding. Mol Cell Biol 19, 1279-1288. Lee, S.J., Richardson, P.G., Sonneveld, P., Schuster, M.W., Irwin, D., San Miguel, J.F., Crawford, B., Massa ro, J., Dhawan, R., Gupta, S. et al. (2008). Bortezomib is associated with better health-related quality of life than high-dose dexamethasone in patients with relapsed mu ltiple myeloma: results from the APEX study. Br J Haematol 143 511-519. Legros, Y., Meyer, A., Ory, K., and Soussi T. (1994). Mutations in p53 produce a common conformational effect that can be detected with a panel of monoclonal antibodies directed toward the cent ral part of the p53 protein. Oncogene 9 36893694. Leng, P., Brown, D.R., Shivakumar, C.V., Deb, S., and Deb, S.P. (1995). Nterminal 130 amino acids of MDM2 ar e sufficient to inhibit p53-mediated transcriptional activation. Oncogene 10 1275-1282. Leng, R.P., Lin, Y., Ma, W., Wu, H., Lemmers, B., Chung, S., Parant, J.M., Lozano, G., Hakem, R., and Benchimol, S. (2003). Pirh2, a p53-induced ubiquitin-protein ligase, pr omotes p53 degrad ation. Cell 112, 779-791. Lengauer, C., Kinzler, K.W., and Vogelstein, B. (1998). Genetic instabilities in human cancers. Nature 396 643-649. Levine, A.J. (1997). p53, the cellular gat ekeeper for growth and division. Cell 88, 323-331. Levine, A.J., Finlay, C.A., and Hinds, P. W. (2004). P53 is a tumor suppressor gene. Cell 116 S67-69, 61 p following S69. Li, B., Cheng, Q., Li, Z., and Chen, J. (2010). p53 inactivati on by MDM2 and MDMX negative feedback loops in testicular germ cell tumors. Cell Cycle 9 1411-1420. Li, M., Brooks, C.L., Kon, N., and Gu, W. (2004). A dynamic role of HAUSP in the p53-Mdm2 pathway. Mol Cell 13 879-886. Li, M., Brooks, C.L., Wu-Baer, F., Chen, D., Baer, R., and Gu, W. (2003). Monoversus polyubiquitination: differential control of p53 fate by Mdm2. Science 302, 1972-1975. Li, M., Chen, D., Shiloh, A., Luo, J., Nikolae v, A.Y., Qin, J., and Gu, W. (2002a). Deubiquitination of p53 by HAUSP is an important pathway fo r p53 stabilization. Nature 416 648-653.

PAGE 130

119 Li, M., Luo, J., Brooks, C.L., and Gu, W. (2002b). Acetylation of p53 inhibits its ubiquitination by Mdm2. J Biol Chem 277 50607-50611. Liang, S.H., and Clarke, M. F. (2001). Regulation of p53 localization. Eur J Biochem 268 2779-2783. Lill, N.L., Grossman, S.R., Ginsberg, D., DeCaprio, J., and Livingston, D.M. (1997). Binding and modulation of p53 by p300/CBP coactivators. Nature 387, 823-827. Lim, S.K., Shin, J.M., Kim, Y.S., and Baek, K.H. (2004). Identification and characterization of murine mHAUSP encoding a deubiquitinat ing enzyme that regulates the status of p53 ubiquitination. Int J Oncol 24 357-364. Lin, J., Chen, J., Elenbaas, B., and Levin e, A.J. (1994). Se veral hydrophobic amino acids in the p53 amino-terminal domain are required for transcriptional activation, binding to mdm-2 and the adenovirus 5 E1B 55-kD protein. Genes Dev 8 1235-1246. Linzer, D.I., and Levine, A.J. (1979). Char acterization of a 54K dalton cellular SV40 tumor antigen present in SV40-trans formed cells and uninfected embryonal carcinoma cells. Cell 17 43-52. Liu, Q., Kaneko, S., Yang, L., Feldman, R.I., Nicosia, S.V., Chen, J., and Cheng, J.Q. (2004). Aurora-A abrogation of p53 DNA binding and transactivation activity by phosphorylation of serine 215. J Biol Chem 279 52175-52182. Liu, Z., Lu, H., Shi, H., Du, Y., Yu, J., Gu, S., Chen, X., Liu, K.J., and Hu, C.A. (2005). PUMA overexpression induces r eactive oxygen species generation and proteasome-mediated stathm in degradation in colorectal cancer cells. Cancer Res 65 1647-1654. Lohrum, M.A., Ludwig, R.L., Kubbutat, M. H., Hanlon, M., and Vousden, K.H. (2003). Regulation of HDM2 activity by the ribosomal protei n L11. Cancer Cell 3 577-587. Lopez-Girona, A., Furnari, B., Mondesert, O., and Russell, P. (1999). Nuclear localization of Cdc25 is regulated by DNA damage and a 14-3-3 protein. Nature 397 172-175. Lopez-Pajares, V., Kim, M.M., and Yuan, Z.M. (2008). Phosphor ylation of MDMX mediated by Akt leads to stabilization and induces 14-3-3 binding. J Biol Chem 283 13707-13713.

PAGE 131

120 Lowe, S.W., Ruley, H.E., Jacks, T., and Housman, D.E. ( 1993). p53-dependent apoptosis modulates the cytotoxic ity of anticancer agents. Cell 74 957-967. Lowe, S.W., and Sherr, C.J. (2003). Tu mor suppression by Ink4a-Arf: progress and puzzles. Curr Opin Genet Dev 13 77-83. Ma, J., Martin, J.D. Zhang, H., Auger, K.R., Ho, T. F., Kirkpatrick, R.B., Grooms, M.H., Johanson, K.O., Tummino, P.J., Copeland, R.A. et al. (2006). A second p53 binding site in the central domain of Mdm2 is essential for p53 ubiquitination. Biochemistry 45 9238-9245. MacPherson, D., Kim, J., Ki m, T., Rhee, B.K., Van Oost rom, C.T., DiTullio, R.A., Venere, M., Halazonetis, T.D., Bronson, R., De Vries, A. et al. (2004). Defective apoptosis and B-cell ly mphomas in mice with p53 poi nt mutation at Ser 23. EMBO J 23 3689-3699. Maetens, M., Doumont, G., Clercq, S.D., Fr ancoz, S., Froment, P., Bellefroid, E., Klingmuller, U., Lozano, G. and Marine, J.C. (2007). Dis tinct roles of Mdm2 and Mdm4 in red cell production. Blood 109 2630-2633. Mancini, F., Di Conza, G., Pellegrino, M., Rinaldo, C., Prodos mo, A., Giglio, S., D'Agnano, I., Florenzano, F., Felicioni, L., Buttitta, F. et al. (2009). MDM4 (MDMX) localizes at the mitochondria and facilitates the p53-mediated intrinsicapoptotic pathway. EMBO J 28 1926-1939. Marechal, V., Elenbaas, B., Piette, J., Nic olas, J.C., and Levine, A.J. (1994). The ribosomal L5 protein is associated with mdm-2 and mdm-2-p53 complexes. Mol Cell Biol 14 7414-7420. Margueron, R., Trojer, P., and Reinberg, D. (2005). The key to development: interpreting the histone code? Curr Opin Genet Dev 15 163-176. Marine, J.C., Dyer, M.A., and Jochemsen, A.G. (2007). MDMX: from bench to bedside. J Cell Sci 120 371-378. Marine, J.C., and Jochemsen, A.G. (2005). Mdmx as an essential regulator of p53 activity. Biochem Biophys Res Commun 331 750-760. Matlashewski, G., Lamb, P., Pim, D., Peaco ck, J., Crawford, L., and Benchimol, S. (1984). Isolation and characterization of a human p53 cDNA clone: expression of the human p53 gene. EMBO J 3 3257-3262. Mayo, L.D., Dixon, J.E., Durden, D.L., Tonks, N.K., and D onner, D.B. (2002). PTEN protects p53 from Mdm2 and sensitizes cancer cells to chemotherapy. J Biol Chem 277 5484-5489.

PAGE 132

121 Mayo, L.D., and Donner, D.B. (2002). The PTEN, Mdm2, p53 tumor suppressoroncoprotein network. Trends Biochem Sci 27 462-467. Mayo, L.D., Turchi, J.J., and Berberich, S.J. (1997). Mdm-2 phosphorylation by DNA-dependent protein kinase prevent s interaction with p53. Cancer Res 57, 5013-5016. McBride, O.W., Merry, D., and Givol, D. (1986). The gene for human p53 cellular tumor antigen is located on chromosome 17 short arm (17p13). Proc Natl Acad Sci U S A 83 130-134. Meek, D.W., and Anderson, C.W. (2009). Posttranslational modification of p53: cooperative integrators of function. Cold Spring Harb Perspect Biol 1 a000950. Meek, D.W., and Knippschild, U. (2003). Posttranslational modification of MDM2. Mol Cancer Res 1 1017-1026. Meulmeester, E., Maurice, M.M., Boutell, C., Teunisse, A.F., Ovaa, H., Abraham, T.E., Dirks, R.W., and Jochemsen, A.G. (2005a). Loss of HAUSP-mediated deubiquitination contributes to DNA damage -induced destabilization of Hdmx and Hdm2. Mol Cell 18 565-576. Meulmeester, E., Pereg, Y., Shiloh, Y., and Jochemsen, A.G. (2005b). ATMmediated phosphorylations inhibit Mdmx/M dm2 stabilization by HAUSP in favor of p53 activation. Cell Cycle 4 1166-1170. Migliorini, D., Lazzerini Denchi, E., D anovi, D., Jochemsen, A., Capillo, M., Gobbi, A., Helin, K., Pelicci, P.G., and Marine, J.C. (2002). Mdm4 (Mdmx) regulates p53-induced growth arrest and neuronal cell death during early embryonic mouse development. Mol Cell Biol 22 5527-5538. Miyashita, T., and Reed, J.C. (1995). Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 80 293-299. Moll, U.M., LaQuaglia, M., Benard, J., and Riou, G. (1995). Wild-type p53 protein undergoes cytoplasmic sequestrat ion in undifferentiated neuroblastomas but not in differentiated tumors. Proc Natl Acad Sci U S A 92 4407-4411. Moll, U.M., Ostermeyer, A.G., Haladay, R., Winkfield, B., Frazier, M., and Zambetti, G. (1996). Cytoplasmic sequestrat ion of wild-type p53 protein impairs the G1 checkpoint after DNA damage. Mol Cell Biol 16 1126-1137. Moll, U.M., and Petrenko, O. (2003). The MD M2-p53 interaction. Mol Cancer Res 1 1001-1008.

PAGE 133

122 Moll, U.M., Riou, G., and Levine, A.J. ( 1992). Two distinct mechanisms alter p53 in breast cancer: mutation and nuclear ex clusion. Proc Natl Acad Sci U S A 89, 7262-7266. Momand, J., Jung, D., Wilczynski, S ., and Niland, J. (1998). The MDM2 gene amplification database. Nucleic Acids Res 26 3453-3459. Momand, J., Wu, H.H., and Dasgupta, G. (2000). MDM2--master regulator of the p53 tumor suppressor protein. Gene 242 15-29. Montes de Oca Luna, R., Wagner, D.S., and Lozano, G. (1995). Rescue of early embryonic lethality in md m2-deficient mice by deletion of p53. Nature 378, 203206. Moroni, M.C., Hickman, E.S., Lazzerini Denchi, E., Caprara, G., Colli, E., Cecconi, F., Muller, H., and Helin, K. (2001). Apaf-1 is a transcriptional target for E2F and p53. Nat Cell Biol 3 552-558. Muller, M., Wilder, S., Bannasch, D., Is raeli, D., Lehlbach, K., Li-Weber, M., Friedman, S.L., Galle, P.R., Stremmel, W., Oren, M. et al. (1998). p53 activates the CD95 (APO-1/Fas) gene in response to DNA damage by anticancer drugs. J Exp Med 188 2033-2045. Murphy, M., Ahn, J., Walker, K.K., Hoffm an, W.H., Evans, R.M., Levine, A.J., and George, D.L. (1999). Transcriptional repression by wild-type p53 utilizes histone deacetylases, mediated by interaction with mSin3a. Genes Dev 13 2490-2501. Nakamura, S., Roth, J.A., and Mukhop adhyay, T. (2000). Multiple lysine mutations in the C-terminal domain of p53 interfere with MDM2-dependent protein degradation and ubiquitination. Mol Cell Biol 20 9391-9398. Nakano, K., and Vousden, K.H. (2001). PUMA, a novel proapoptotic gene, is induced by p53. Mol Cell 7 683-694. Nie, L., Sasaki, M., and Maki, C.G. ( 2007). Regulation of p53 nuclear export through sequential changes in conformati on and ubiquitination. J Biol Chem 282, 14616-14625. Nigg, E.A. (1995). Cyclin -dependent protein kinases: key regulators of the eukaryotic cell cycle. Bioessays 17, 471-480. Oda, E., Ohki, R., Murasawa H., Nemoto, J., Shibue, T ., Yamashita, T., Tokino, T., Taniguchi, T., and Tanaka, N. (2000a). Noxa, a BH3-only member of the Bcl2 family and candidate mediator of p53-induced apoptosis. Science 288, 10531058.

PAGE 134

123 Oda, K., Arakawa, H., Tanaka, T., Matsuda, K., Tanikawa, C., Mori, T., Nishimori, H., Tamai, K., Toki no, T., Nakamura, Y. et al. (2000b). p53AIP1, a potential mediator of p53-dependent apoptosis, and its r egulation by Ser-46phosphorylated p53. Cell 102 849-862. Okamoto, K., and Beach, D. (1994). Cyclin G is a transcriptional target of the p53 tumor suppressor protein. EMBO J 13 4816-4822. Olivier, M., Eeles, R., Hollstein, M., Khan, M.A., Harris, C.C., and Hainaut, P. (2002). The IARC TP53 database: new online mutation analysis and recommendations to users. Hum Mutat 19 607-614. Ooi, M.G., Hayden, P.J., Kotoula, V., McMillin, D.W., Charalambous, E., Daskalaki, E., Raje, N.S., Munshi N.C., Chauhan, D., Hideshima, T. et al. (2009). Interactions of the Hdm2/p53 and proteasome pat hways may enhance the antitumor activity of bortezomib. Clin Cancer Res 15 7153-7160. Ory, K., Legros, Y., Auguin C., and Soussi, T. (1994) Analysis of the most representative tumour-deriv ed p53 mutants reveals t hat changes in protein conformation are not correlated with loss of transactivation or inhibition of cell proliferation. EMBO J 13 3496-3504. Pan, Y., and Chen, J. (2003). MDM2 promotes ubiquitination and degradation of MDMX. Mol Cell Biol 23 5113-5121. Parada, L.F., Land, H., Weinberg, R. A., Wolf, D., and Rotter, V. (1984). Cooperation between gene encoding p53 tumour antigen and ras in cellular transformation. Nature 312 649-651. Parant, J., Chavez-Reyes, A., Little, N.A ., Yan, W., Reinke, V., Jochemsen, A.G., and Lozano, G. (2001). Rescue of embryonic lethality in Mdm4-null mice by loss of Trp53 suggests a nonoverlapping pathw ay with MDM2 to regulate p53. Nat Genet 29 92-95. Peng, Y., Chen, L., Li, C., Lu, W., Agrawal, S., and Chen, J. (2001). Stabilization of the MDM2 oncoprotein by mutant p53. J Biol Chem 276 6874-6878. Pereg, Y., Shkedy, D., de Graaf, P., M eulmeester, E., Edelson-Averbukh, M., Salek, M., Biton, S., Teunisse, A. F., Lehmann, W.D., Jochemsen, A.G. et al. (2005). Phosphorylation of Hdmx mediates its Hdm2and ATM-dependent degradation in response to DNA damage. Proc Natl Acad Sci U S A 102 50565061.

PAGE 135

124 Perez-Galan, P., Roue, G., Villamor, N., Montserrat, E ., Campo, E., and Colomer, D. (2006). The pr oteasome inhibitor bortezomib induces apoptosis in mantle-cell lymphoma through generat ion of ROS and No xa activation independent of p53 status. Blood 107 257-264. Pickart, C.M., and Eddins, M.J. (2004). Ubiquitin: structures, functions, mechanisms. Biochim Biophys Acta 1695 55-72. Ravi, R., Mookerjee, B., Bhujwalla, Z.M ., Sutter, C.H., Artemov, D., Zeng, Q., Dillehay, L.E., Madan, A., Semenza, G.L., and Bedi, A. (2000). Regulation of tumor angiogenesis by p53-induced degradat ion of hypoxia-inducible factor 1alpha. Genes Dev 14 34-44. Reik, W. (2007). Stability and flexibilit y of epigenetic gene regulation in mammalian development. Nature 447 425-432. Richardson, P.G., Sonneveld, P., Schuster, M.W., Irwin, D., Stadtmauer, E.A., Facon, T., Harousseau, J.L., BenYehuda, D., Lonial, S ., Goldschmidt, H., et al. (2005). Bortezomib or highdose dexamethasone for rel apsed multiple myeloma. N Engl J Med 352 2487-2498. Riemenschneider, M.J., Buschges, R., Wolter, M., Reifenberger, J., Bostrom, J., Kraus, J.A., Schlegel, U., and Reifenberger, G. (1999). Amplification and overexpression of the MDM4 (MDMX) gene from 1q32 in a subset of malignant gliomas without TP53 mutation or MD M2 amplificatio n. Cancer Res 59, 60916096. Roth, J., Dobbelstein, M., Freedman, D. A., Shenk, T., and Levine, A.J. (1998). Nucleo-cytoplasmic shuttling of the hdm2 on coprotein regulates the levels of the p53 protein via a pathway used by t he human immunodeficiency virus rev protein. EMBO J 17 554-564. Roth, J.A., and Cristiano, R.J. (1997). G ene therapy for cancer: what have we done and where are we going? J Natl Cancer Inst 89 21-39. Rowles, J., Slaughter, C., Moomaw, C., Hsu, J., and Cobb, M.H. (1991). Purification of casein kinase I and isolation of cDNA s encoding multiple casein kinase I-like enzymes. Proc Natl Acad Sci U S A 88 9548-9552. Ruas, M., and Peters, G. (1998). The p16I NK4a/CDKN2A tumor suppressor and its relatives. Biochim Biophys Acta 1378 F115-177. Ryan, J.J., Prochownik, E., Gottlieb, C. A., Apel, I.J., Merino, R., Nunez, G., and Clarke, M.F. (1994). c-myc and bcl-2 m odulate p53 function by altering p53 subcellular trafficking during the ce ll cycle. Proc Natl Acad Sci U S A 91, 58785882.

PAGE 136

125 Saha, M.N., Jiang, H., Jayakar, J., Reec e, D., Branch, D.R. and Chang, H. (2010). MDM2 antagonist nutlin plus prot easome inhibitor velcade combination displays a synergistic anti-myeloma activity. Cancer Biol Ther 9 936-944. Saito, S., Yamaguchi, H., Higashimoto, Y. Chao, C., Xu, Y., Fornace, A.J., Jr., Appella, E., and Anderson, C.W. (2003). Phosphorylation site interdependence of human p53 post-translational modifications in response to stress. J Biol Chem 278 37536-37544. Sakamuro, D., Sabbatini, P., Whit e, E., and Prendergast, G.C. (1997). The polyproline region of p53 is required to ac tivate apoptosis but not growth arrest. Oncogene 15 887-898. Samuel, T., Weber, H.O., Rauch, P., Verdoodt, B., Eppel, J.T., McShea, A., Hermeking, H., and Funk, J. O. (2001). The G2/M regulator 14-3-3sigma prevents apoptosis through sequestration of Bax. J Biol Chem 276 45201-45206. San Miguel, J.F., Schlag, R., Khuageva, N.K., Dimopoulos, M.A., Shpilberg, O., Kropff, M., Spicka, I., Pe trucci, M.T., Palumbo, A., Samoilova, O.S. et al. (2008). Bortezomib plus melphalan and predniso ne for initial treatment of multiple myeloma. N Engl J Med 359 906-917. Sasaki, M., Nie, L., and Maki, C .G. (2007). MDM2 binding induces a conformational change in p53 that is opposed by heat-shock protein 90 and precedes p53 proteasomal degradation. J Biol Chem 282 14626-14634. Scheffner, M., Huibregtse, J.M., Vierst ra, R.D., and Howley, P.M. (1993). The HPV-16 E6 and E6-AP complex functions as a ubiquitin-protein ligase in the ubiquitination of p53. Cell 75 495-505. Scheffner, M., Werness, B.A. Huibregtse, J.M., Levine, A.J., and Howley, P.M. (1990). The E6 oncoprotein encoded by hu man papillomavirus types 16 and 18 promotes the degradation of p53. Cell 63 1129-1136. Schon, O., Friedler, A., Bycroft, M., Fr eund, S.M., and Fersht, A.R. (2002). Molecular mechanism of the interact ion between MDM2 and p53. J Mol Biol 323 491-501. Seto, E., Usheva, A., Zam betti, G.P., Momand, J., Hori koshi, N., Weinmann, R., Levine, A.J., and Shenk, T. (1992). Wild-type p53 binds to the TATA-binding protein and represses transcripti on. Proc Natl Acad Sci U S A 89 12028-12032. Sherr, C.J. (2001). The INK4a/ARF network in tumour suppression. Nat Rev Mol Cell Biol 2 731-737.

PAGE 137

126 Sherr, C.J. (2006). Divorcing ARF and p53: an unsettled case. Nat Rev Cancer 6 663-673. Shi, X., Kachirskaia, I., Yamaguchi, H., We st, L.E., Wen, H., Wang, E.W., Dutta, S., Appella, E., and Gozani, O. (2007). Modulation of p53 function by SET8mediated methylation at lysine 382. Mol Cell 27 636-646. Shu, K.X., Li, B., and Wu, L.X. (2007) The p53 network: p53 and its downstream genes. Colloids Surf B Biointerfaces 55 10-18. Sigal, A., and Rotter, V. (2000). On cogenic mutations of the p53 tumor suppressor: the demons of the guardian of the genome. Cancer Res 60 67886793. Sivakolundu, S.G., Nourse, A., Moshiach, S., Bothner, B., Ashley, C., Satumba, J., Lahti, J., and Kriwacki, R.W. (2008). Intrinsically un structured domains of Arf and Hdm2 form bimolecular oligomeric stru ctures in vitro and in vivo. J Mol Biol 384 240-254. Sluss, H.K., Armata, H., Gallant, J., and Jones, S.N. (2004). Phosphorylation of serine 18 regulates distinct p53 f unctions in mice. Mol Cell Biol 24 976-984. Smith, M.L., Ford, J.M., Hollander, M.C. Bortnick, R.A., Amundson, S.A., Seo, Y.R., Deng, C.X., Hanawalt, P.C., and For nace, A.J., Jr. (2000). p53-mediated DNA repair responses to UV radiation: studies of mouse cells lacking p53, p21, and/or gadd45 genes. Mol Cell Biol 20 3705-3714. Smith, T.G., Robbins, P.A., and Ratcli ffe, P.J. (2008). The human side of hypoxia-inducible factor. Br J Haematol 141 325-334. Soussi, T., Dehouche, K., and Beroud, C. (2000). p53 websit e and analysis of p53 gene mutations in human cancer: forging a link between epidemiology and carcinogenesis. Hum Mutat 15 105-113. Soussi, T., Ishioka, C., Claustres, M., and Beroud, C. (2006). Locus-specific mutation databases: pitfalls and good practi ce based on the p53 experience. Nat Rev Cancer 6 83-90. Stavridi, E.S., Chehab, N.H., Malikza y, A., and Halazonetis, T.D. (2001). Substitutions that compromise the ioni zing radiation-induced association of p53 with 14-3-3 proteins also compromise the ab ility of p53 to induc e cell cycle arrest. Cancer Res 61 7030-7033. Steinman, H.A., Hoover, K.M., Keeler, M. L., Sands, A.T., and Jones, S.N. (2005). Rescue of Mdm4-deficient mice by Mdm2 reveals functional overlap of Mdm2 and Mdm4 in development. Oncogene 24 7935-7940.

PAGE 138

127 Steinman, H.A., Sluss, H.K., Sands, A.T., Pihan, G., and J ones, S.N. (2004). Absence of p21 partially rescues Mdm4 loss and uncovers an antiproliferative effect of Mdm4 on cell growth. Oncogene 23 303-306. Stommel, J.M., Marchenko, N.D., Jimenez, G.S., Moll, U.M ., Hope, T.J., and Wahl, G.M. (1999). A leucine-rich nuclear export signal in the p53 tetramerization domain: regulation of subcellular localization and p53 activity by NES masking. EMBO J 18 1660-1672. Sui, G., Affar el, B., Shi, Y., Brignone, C ., Wall, N.R., Yin, P., Donohoe, M., Luke, M.P., Calvo, D., and Grossman, S.R. (2004). Yin Yang 1 is a negative regulator of p53. Cell 117 859-872. Sun, Y., Cheung, J.M., Martel -Pelletier, J., Pelletier, J.P., Wenger, L., Altman, R.D., Howell, D.S., and Cheung, H.S. (2000). Wild type and mutant p53 differentially regulate t he gene expression of human collagenase-3 (hMMP-13). J Biol Chem 275 11327-11332. Sun, Y., Wenger, L., Rutter, J.L., Brinckerhoff, C.E ., and Cheung, H.S. (1999). p53 down-regulates human matrix meta lloproteinase-1 (Collagenase-1) gene expression. J Biol Chem 274 11535-11540. Tabe, Y., Sebasigari, D., Jin, L., Rudelius, M., Davies-Hill, T., Miyake, K., Miida, T., Pittaluga, S., and Raffeld, M. (2009) MDM2 antagonist nutlin-3 displays antiproliferative and proapoptotic activity in mantle cell lymphoma. Clin Cancer Res 15 933-942. Takahashi, K., Sumimoto, H ., Suzuki, K., and Ono, T. (1993). Protein synthesisdependent cytoplasmic translocation of p53 protein after serum stimulation of growth-arrested MCF-7 cells. Mol Carcinog 8 58-66. Tang, Y., Zhao, W., Chen, Y., Zhao, Y., and Gu, W. (2008). Acetylation is indispensable for p53 activation. Cell 133 612-626. Tao, W., and Levine, A.J. (1999). Nucl eocytoplasmic shuttling of oncoprotein Hdm2 is required for Hdm2-mediated degradat ion of p53. Proc Natl Acad Sci U S A 96 3077-3080. Thornberry, N.A., and Lazebnik, Y. (1998). Caspases: enemies within. Science 281 1312-1316. Todd, R., and Wong, D.T. (1999). Oncogenes. Anticancer Res 19 4729-4746. Unger, T., Juven-Gershon, T., Moallem, E ., Berger, M., Vogt Sionov, R., Lozano, G., Oren, M., and Haupt, Y. (1999). Critical role for Ser20 of human p53 in the negative regulation of p53 by Mdm2. EMBO J 18 1805-1814.

PAGE 139

128 Vaziri, H., Dessain, S.K., Ng Eaton, E., Imai, S.I., Frye, R.A., Pandita, T.K., Guarente, L., and Weinberg, R.A. (2001). hSIR2(SIRT1) functions as an NADdependent p53 deacetylase. Cell 107 149-159. Vogelstein, B., Lane, D., and Levine, A. J. (2000). Surfing the p53 network. Nature 408 307-310. Vousden, K.H., and Ryan, K.M. (2009). p53 and metabolism. Nat Rev Cancer 9 691-700. Wahl, G.M. (2006). Mouse bites dogma: how mouse model s are changing our views of how P53 is regulated in vivo. Cell Death Differ 13 973-983. Walensky, L.D., Pitter, K., Morash, J., Oh, K.J., Barbuto, S., Fisher, J., Smith, E., Verdine, G.L., and Korsmeyer, S.J. (2006). A stapled BID BH3 helix directly binds and activates BAX. Mol Cell 24 199-210. Wallace, M., Worrall, E., Pe ttersson, S., Hupp, T.R., and Ball, K.L. (2006). Dualsite regulation of MDM2 E3-ubi quitin ligase activity. Mol Cell 23 251-263. Wang, C., Ivanov, A., Chen, L., Fredericks, W.J., Seto, E., Rauscher, F.J., 3rd, and Chen, J. (2005). MDM2 interactio n with nuclear corepressor KAP1 contributes to p53 inactivation. Embo J 24 3279-3290. Wang, M., Han, X.H., Zhang, L., Yang, J. Qian, J.F., Shi, Y.K., Kwak, L.W., Romaguera, J., and Yi, Q. (2008) Bortezomib is synergistic with rituximab and cyclophosphamide in inducing a poptosis of mantle cell ly mphoma cells in vitro and in vivo. Leukemia 22 179-185. Wang, X., Taplick, J., Geva, N., and Oren, M. (2004). Inhibition of p53 degradation by Mdm2 acetylation. FEBS Lett 561 195-201. Wang, X.W., Vermeulen, W., Coursen, J. D., Gibson, M., Lupold, S.E., Forrester, K., Xu, G., Elmore, L., Y eh, H., Hoeijmakers, J.H. et al. (1996). The XPB and XPD DNA helicases are components of the p53-mediated apoptosis pathway. Genes Dev 10 1219-1232. Wang, Y., Farmer, G., Soussi, T., and Pr ives, C. (1995). Xenopus laevis p53 protein: sequence-specific DNA bind ing, transcriptional regulation and oligomerization are evolutio narily conserved. Oncogene 10 779-784. Wawrzynow, B., Zylicz, A., Wallace, M., H upp, T., and Zylicz, M. (2007). MDM2 chaperones the p53 tumor suppressor. J Biol Chem 282 32603-32612.

PAGE 140

129 Weber, H.O., Ludwig, R.L., Morrison, D., Kotlyarov, A., Gaestel, M., and Vousden, K.H. (2005). HDM2 phosphorylation by MAPKAP kinase 2. Oncogene 24, 1965-1972. Weidner, N., Semple, J.P., Welch, W. R., and Folkman, J. (1991). Tumor angiogenesis and metastasis--correlation in invasive breast carcinoma. N Engl J Med 324 1-8. White, D.E., Talbott, K.E., Arva, N.C ., and Bargonetti, J. (2006). Mouse double minute 2 associates with chromatin in the presence of p53 and is released to facilitate activation of transcription. Cancer Res 66 3463-3470. Wolter, K.G., Hsu, Y.T., Smith, C.L., Ne chushtan, A., Xi, X.G., and Youle, R.J. (1997). Movement of Bax fr om the cytosol to mitoc hondria during apoptosis. J Cell Biol 139 1281-1292. Woo, R.A., McLure, K.G., Lees-Miller, S.P., Rancourt, D.E., and Lee, P.W. (1998). DNA-dependent protein kinase acts upstream of p53 in response to DNA damage. Nature 394 700-704. Wu, G.S., Burns, T.F., McDonald, E.R., 3rd, Jiang, W., Meng, R., Krantz, I.D., Kao, G., Gan, D.D., Zhou, J.Y., Muschel, R. et al. (1997). KILLER/DR5 is a DNA damage-inducible p53-r egulated death receptor gene. Nat Genet 17 141-143. Wu, X., Bayle, J.H., Olson, D., and Levine, A.J. (1993). The p53-mdm-2 autoregulatory feedback loop. Genes Dev 7 1126-1132. Wu, Z., Earle, J., Saito, S., Anderson, C.W., Appella, E., and Xu, Y. (2002). Mutation of mouse p53 Ser23 and the re sponse to DNA damage. Mol Cell Biol 22, 2441-2449. Xiong, S., Van Pelt, C.S., Elizondo-Fr aire, A.C., Liu, G., and Lozano, G. (2006). Synergistic roles of Mdm2 and Mdm4 for p53 inhibition in central nervous system development. Proc Natl Acad Sci U S A 103 3226-3231. Xirodimas, D.P., Saville, M. K., Bourdon, J.C., Hay, R.T ., and Lane, D.P. (2004). Mdm2-mediated NEDD8 conjugation of p53 inhibits its transcriptional activity. Cell 118 83-97. Xu, D., Wang, Q., Gruber, A., Bjorkholm, M., Chen, Z., Zaid, A., Selivanova, G., Peterson, C., Wiman, K.G., and Pisa, P. (2000). Downregulatio n of telomerase reverse transcriptase mRNA expression by wild type p53 in human tumor cells. Oncogene 19 5123-5133. Yang, A., and McKeon, F. (2000). P63 and P73: P53 mimics, menaces and more. Nat Rev Mol Cell Biol 1 199-207.

PAGE 141

130 Yu, G.W., Rudiger, S., Veprintsev, D., Freund, S., Fernandez-Fernandez, M.R., and Fersht, A.R. (2006). The central regi on of HDM2 provides a second binding site for p53. Proc Natl Acad Sci U S A 103 1227-1232. Zantema, A., Fransen, J.A., Davis-Olivie r, A., Ramaekers, F.C., Vooijs, G.P., DeLeys, B., and Van der Eb, A.J. (1985). Localization of the E1B proteins of adenovirus 5 in transformed cells, as re vealed by interaction with monoclonal antibodies. Virology 142 44-58. Zauberman, A., Barak, Y., Ragimov, N., Levy, N., and Oren, M. (1993). Sequence-specific DNA bindin g by p53: identification of target sites and lack of binding to p53 MDM2 complexes. EMBO J 12 2799-2808. Zhang, J., Gross, S.D., Schroeder, M.D ., and Anderson, R.A. (1996). Casein kinase I alpha and alpha L: alternative splicing-generated kinases exhibit different catalytic properties. Biochemistry 35 16319-16327. Zhang, Y., Wolf, G.W., Bhat, K., Jin, A., Allio, T., Burkhart, W.A., and Xiong, Y. (2003). Ribosomal protein L11 negativel y regulates oncoprotein MDM2 and mediates a p53-dependent ribosomal-stres s checkpoint pathway. Mol Cell Biol 23, 8902-8912. Zheng, H., You, H., Zhou, X.Z., Murray, S. A., Uchida, T., Wul f, G., Gu, L., Tang, X., Lu, K.P., and Xiao, Z.X. (2002). The pr olyl isomerase Pin1 is a regulator of p53 in genotoxic response. Nature 419 849-853. Zurer, I., Hofseth, L.J., Cohen, Y., Xu-W elliver, M., Hussain, S.P., Harris, C.C., and Rotter, V. (2004). The role of p53 in base excision repair following genotoxic stress. Carcinogenesis 25 11-19.


xml version 1.0 encoding UTF-8 standalone no
record xmlns http:www.loc.govMARC21slim xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.loc.govstandardsmarcxmlschemaMARC21slim.xsd
leader nam 22 Ka 4500
controlfield tag 007 cr-bnu---uuuuu
008 s2011 flu ob 000 0 eng d
datafield ind1 8 ind2 024
subfield code a E14-SFE0004951
035
(OCoLC)
040
FHM
c FHM
049
FHMM
090
XX9999 (Online)
1 100
Cross, Brittany Lynne.
0 245
Inhibition of p53 dna binding function by the mdm2 acidic domain
h [electronic resource] /
by Brittany Lynne Cross.
260
[Tampa, Fla] :
b University of South Florida,
2011.
500
Title from PDF of title page.
Document formatted into pages; contains 141 pages.
Includes vita.
502
Disseration
(Ph.D.)--University of South Florida, 2011.
504
Includes bibliographical references.
516
Text (Electronic dissertation) in PDF format.
3 520
ABSTRACT: MDM2 regulates p53 predominantly by promoting p53 ubiquitination. However, ubiquitination-independent mechanisms of MDM2 have also been implicated. Here we show that MDM2 inhibits p53 DNA binding activity in vitro and in vivo. MDM2 binding promotes p53 to adopt a mutant-like conformation, losing reactivity to antibody Pab1620, while exposing the Pab240 epitope. The acidic domain of MDM2 is required to induce p53 conformational change and inhibit p53 DNA binding. ARF binding to the MDM2 acidic domain restores p53 wild type conformation and rescues DNA binding activity. Furthermore, histone methyl transferase SUV39H1 binding to the MDM2 acidic domain also restores p53 wild type conformation and allows p53-MDM2-SUV39H1 complex to bind DNA. These results provide further evidence for an ubiquitination-independent mechanism of p53 regulation by MDM2, and reveal how MDM2-interacting repressors gain access to p53 target promoters and repress transcription. Furthermore, we show that the MDM2 inhibitor Nutlin cooperates with the proteasome inhibitor Bortezomib by stimulating p53 DNA binding and transcriptional activity, providing a rationale for combination therapy using proteasome and MDM2 inhibitors.
538
Mode of access: World Wide Web.
System requirements: World Wide Web browser and PDF reader.
590
Advisor:
Chen, Jiandong .
653
Arf
Bortezomib
Conformation
Mdmx
Nutlin
Suv39h1
690
Dissertations, Academic
z USF
x Molecular Biology Cellular Biology Oncology
Doctoral.
773
t USF Electronic Theses and Dissertations.
4 856
u http://digital.lib.usf.edu/?e14.4951