Lysogeny and transduction in the marine environment

Citation
Lysogeny and transduction in the marine environment

Material Information

Title:
Lysogeny and transduction in the marine environment
Creator:
Jiang, Chenyang
Place of Publication:
Tampa, Florida
Publisher:
University of South Florida
Publication Date:
Language:
English
Physical Description:
xiv, 197 leaves : ill. (some col.) ; 29 cm.

Subjects

Subjects / Keywords:
Lysogeny ( lcsh )
Transduction ( lcsh )
Dissertations, Academic -- Marine Science -- Doctoral -- USF ( FTS )

Notes

General Note:
Includes vita. Thesis (Ph. D.)--University of South Florida, 1996. Includes bibliographical references.

Record Information

Source Institution:
University of South Florida
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
023490509 ( ALEPH )
37046486 ( OCLC )
F51-00196 ( USFLDC DOI )
f51.196 ( USFLDC )

Postcard Information

Format:
Book

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

LYSOGENY AND TRANSDUCTION IN THE MARINE ENVIRONMENT by JIANG A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Marine Science University of South Florida December 1996 Major Professor: John H. Paul Ph.D.

PAGE 2

Graduate School University of South Florida Tampa, Florida CERTIFICATE OF APPROVAL Ph.D. Di ssertation This is to certify that the Ph.D Dissertation of CHENY ANG JIANG with a major in Marine Science has been approved by the Examining Committee on November 25 1996 as s atisfactory for the dissertation requirement for the Doctor of Philosophy degree Examining Committee: Majo r Professor: John H. Paul, Ph. D Member : W Guy Bradley Ph.D. Member : Paula G. Coble Ph D Member : David D Dunigan Ph D. Member : Joan B. Rose, Ph.D.

PAGE 3

Chenyang Jiang 1996 ------------------------------------All Right Reserved

PAGE 4

DEDICATION To tho se who love me and those who I lo ve

PAGE 5

VITA Chenyang Jiang r eceived her B .S. in biochemistry from Nankai University Tianjin China in 1989 She joined the Marine Science graduate program at the Universit y of South Florida in 1990 and received her M.S. degree in 1993 She i s an author on over 1 3 research publications and has presented at more than 12 conferences. Her research interest s include aquatic microbiology and ecology, viral-bacterial interactions and gen e transduction in the marine environment. She is a specialist in the concentration of microbia l populations, isolation and cultivation of aquatic microorganisms the concentration and purification of aquatic free DNA and gene transfer via transduction She has participated in seven research expedition cruises and has been involved in two major wat e r quality studies in Mamala Bay, Hawaii and the Florida Key s Sh e i s a recipient of both a Marine Science Knight Oceanographic Fellowship and a Gulf Oceanographic Fellowship in 1995 and 1994 respectively

PAGE 6

TABLE OF CONTENTS LIST OF TABLES v LIST OF FIGURES Vll ABSTRACT X PERF ACE Xlll CHAPTER 1. INTRODUCTION: LYSOGENY AND TRANSDUCTION IN THE MARINE ENVIRONMENT 1 1 Background 1 1 1 1 Viral-Induced Mortality of Microbial Populations 5 1.1.2 Bacteriophage Life Cycles 11 1 .2 Lysogenic Life Cycle 1 3 1.2 1 General Description and Terminology 1 3 1 .2.2 Mechanisms 1 4 1.3 Ecologica l Advantage of Ly s ogeny 1 6 1.4 Methods for Detecting Lysogenic Bacteria 18 1.5 Occurrence of Lysogeny 19 1.6 E nvironmental Factors for Prophage Induction 2 1 1 7 Genetic Significance of Viruse s in the Marine Environment 22 1 .8 Bacteriophage Transduction 23 1.8 1 Termino l ogy 23 1.8. 2 Mechanisms 24 1.8.3 Transduction Assay 27 1.9 Transduction in the Environment 29 1 10 Environmenta l Factors for Transduction 31 1 .11 Significance of Transduction in Marine Envi r onments 34 Bibliography 36 CHAPTER 2. ABUNDANCE OF LYSOGENIC BACTERIA FOUND AMONG MARINE BACTERIAL ISOLAT ES FROM A VARIETY OF MARINE ENVIRONMENTS 47

PAGE 7

2.1 Abstract 4 7 2 2 Introduction 48 2 3 Material And Methods 50 2.3 .1 Sampling Sites 50 2 3.2 Isolation of Bacteria 50 2 3.3 Prophage Induction of Marine Lysogenic Bacteria by Mitomycin C 51 2.3.4 Prophage Induction of Marine Lysogenic Bacteria by UV Radiation 51 2.4 Results 53 2.5 Discussion 60 References 62 CHAPTER 3 OCCURRENCE OF LYSOGENIC BACTERIA IN MARINE MICROBIAL COMMUNITIES AS DETERMINED BY PROPHAGE INDUCTION 65 3.1 Abstract 65 3.2 Introduction 66 3.3 Material and Methods 68 3.31 Sampling Sites 68 3.3.2 Induction of Lysogenic Bacteria by Chemical and Physical Inducing Agents 69 3.3.3 Induction of Lysogenic Bacteria by Aromatic and Aliphatic Hydrocarbons 70 3.3.4 Induction Time Series 71 3 3 5 Viral Direct Counts and Bacterial Direct Counts 71 3.3.6 Statistical Analyses 73 3.4 Results 73 3.4.1 Induction of Lysogenic Bacteria from Marine Environments 73 3.4.2 Induction Time Series 86 3.5 Discussion 91 References 99 CHAPTER 4. PRELIMINARY CHARACTERIZATION OF BACTERIAL HOSTS AND TEMPERATE PHAGES ISOLATED FROM MAMALA BAY, HA WAll 102 4.1 Abstract 102 4.2 Introduction 103 4 3 Material and Methods 104 11

PAGE 8

4.3 .1 Isolation of Bacterial Hosts and Phages 1 04 4.3.2 Characterization of Marine Bacterial Isolates 105 4 3.3 TEM Examination of Phage Morphology 106 4.3.4 Determination of Phage Genome Size by Restriction Enzyme Digestion 1 06 4 3.5 One step Growth Experiments 107 4.3.6 Purification of Plasmid and Chromosomal DNA 108 4.3.7 Probe Labeling and Dot Blot Hybridization 109 4.4 Results 1 1 0 4.4.1 Isolation of Bacterial Ho s ts and Phages from Marine Environments 11 0 4.4 2 Genome Sizes and Types ofPhage Isolates 118 4.4.3 Phage One-step Growth Curve 119 4.4.4 Lysogenic Characteristics 122 4.5 Discussion 124 References 128 CHAPTER 5. BACTERIOPHAGE GENE TRANSDUCTION IN THE MARINE ENVIRONMENT 131 5.1 Abstract 131 5.2 Introduction 131 5.3 Material and Methods 135 5.3 .1 Bacteria, Phages and Plasm ids 13 5 5.3 .2 Triparental Mating 137 5 3.3 Transduction Assays 138 5.3.4 Purification ofPlasmid DNA and Gene Probe Construction 141 5.3 5 Colony Lift, Dot Blot and Southern Hybridization 141 5.3.6 PCR Amplification 142 5.4 Results 144 5.4.1 Establishing Indigenous Marine Phage-Ho s t Transduction Systems 144 5.4.2 Transduction Assays using Bacterial Isolates as Recipients 145 5.4.3 Analysis of Plasmid DNA from Transductants 149 5.4.4 Transduction Assay using Indigenous Bacterial Communities as Recipients 156 5 5 Discussion 165 5 5 1 Transduction as a Possible Mechanism for Plasmid Evolution 166 5.5 .2 Potential for Gene Transduction in the Marine Environment 168 References 173 CHAPTER 6. SUMMARY AND DISCUSSION 177 lll

PAGE 9

References 185 APPENDICES 187 APPENDIX 1. ANTIMICROBIAL ACTIVITY FOUND IN MARINE BACTERIAL ISOLATES 188 APPENDIX 2 RESEARCH ENVIRONMENTS AND SAMPLING LOCATIONS 193 VITA End Page lV

PAGE 10

LIST OF TABLES Table 1.1 Marine Viral Abundance as Determined by Direct Counting Methods 3 Table 1.2 Marine Viral Decay Rates 5 Table 1.3 Viral-In d uced Mortality of Microbial Popu l ations 9 Table 2.1 Occurrence of Lysogenic Bacteria amongst Marine Bacterial Isolates as Determined by Mitomycin C Induction 59 Table 3. 1 Induction of Indigenous Lysogenic Bacteria from Eutrophic Estuarine Environments by C h emica l and Physical Inducing Agents 75 Table 3 .2 Induction of Indige n ous Lysogenic Bacteria from Marine Coastal Environments by Chemical and Physical Inducing Agents 79 Table 3.3 Induction of Indigenous Lysogenic Bacteria from Oligotrophic Offshore Environments by Chemical and Physica l Inducing Agents 80 Table 3.4 Induction of Indigenou s Lysogenic Bacteria from a Variety of Marine Environments by Aromatic and Aliphatic Hydrocarbons 83 Table 3.5 Abundance of Lysogenic Bacteria in a Variety of Marine Env i ronments 90 Tab l e 3.6 Efficiency of Inducing Agents for the Induction of Indigenous Marine Lysogens 91 Tab l e 4.1 Iso l at i o n of Bacteria l Hosts and Phages from Mamala Bay Hawaii 111 Table 4.2 Identification of Marine Bacterial Isolate s 112 Tab l e 4.3 Morphological Characteristics of Phages Iso l ated from Mama! a Bay Hawaii 116 Table 4.4 Estimated Phage Genome Si zes by Re s triction Enzymes Digestion 119 Table 4 5 Growth Characteristics of Phages Isolated from Mama l a Bay, Hawaii 122 Table 5.1 Bacteria P l asmids and Phage Used in This Study 136 v

PAGE 11

Table 5.2 Oligonucleotides Used as PCR Primers 143 Table 5.3 Construction of Transduction Donor Strains by Triparental Mating 145 Table 5.4 Marine Phage Transduction using Bacterial Isolates as Recipients 147 Table 5.5 Comparing Restriction Patterns ofHSIC Native Plasmid and Plasmid pQSR50 152 Table 5.6 Transduction Using Concentrated Marine Bacterial Communities as Recipients 157 VI

PAGE 12

LIST OF FIGURES Figure 1.1 The microbial l oop, including viruses 8 Figure 1 2 Bacteriophage life cycles showing the lysogenic cycle and lytic cycle 12 Figure 2.1 Culture optical density changes over time after mitomycin C or UV radiation induction 55 Figure 2.2 Culture optical density changes over time after exposed to a range of dosages of UV radiation 57 Figure 2.3 Phage-like particles found in the supernatants of induced bacterial cultures 59 Figure 3.1 Sampling locations 72 Figure 3 .2 Induction of natural communities of marine lysogens by mitomycin C UV radiation temperature and s unlight 77 Figure 3 3 Induction of natural communit ie s of marine ly sogens by aliphatic and aromatic hydrocarbons 85 Figure 3.4 Time series samp ling of mitomycin C-treated water samp l e and a control from the Atlantic station 1 87 Figure 3.5 Time series samp ling of mitomycin C-treated water samp le and a control from the Atlantic station 5 88 Figure 4.1 Morphologies of bacterial isolates from Mamala Bay Hawaii 113 Figure 4.2 Turbid plaque morphologies of bacteriophage s isolated from Mamala Bay Hawaii 114 Figure 4.3 Elec tron photomicrographs of phages isolated from Mamala Bay, Hawaii 117 Figure 4.4 Phage DNA digested with restriction endonuclease for molecular weight determination 120 Vll

PAGE 13

Figure 4 5 One-step growth curve of phage isolates from Mamala Bay Hawaii 121 Figure 4.6 Dot blot hybridization probed with phage DNA probe 123 Figure 5 1 Flow chart of transduction assays 140 Figure 5.2 Locations of PCR primers on the plasmid map 143 Figure 5 3 Colony hybridization of transduction assay using a marine bacterial isolate as recipient 148 Figure 5.4 Dot blot hybridization of plasmid DNA from E. coli RM1259, donor recipient and transductants with nptll probe Figure 5 5 Restriction pattern of plasmid DNA from HOPE-I HSIC and transductants 150 Figure 5 6 Restriction pattern of pQSR50 150 Figure 5.7 Southern hybridization of Hind III digested and undigested plasmid DNA from transductants, E.coli RM1259, donor and recipient with nptll probe 154 Figure 5 8 Southern hybridization of Hind III digested and undigested plasmid DNA from transductants E. coli RM1259 donor and recipient with probe 155 F i gure 5.9 Colony hybridization of transduction assay using indigenous bacterial communities from Tampa Bay as recipients 158 Figure 5 10a PCR amplification using primer JP44 and JP52 160 Figure 5 1 Ob Southern transfer ofDNA from Figure 5.10a and probed with nptll probe 161 Figure 5 .11 Screening JP44 and JP52 PCR amplification products by 4 base-pair cuter restriction enzyme digestion 162 Figure 5.12 PCR amplification using primer JP64 and JP65 163 Figure 5 .13 EcoR I digestion of JP64 and JP65 PCR amplification products from Figure 5.12 163 Figure 5 14 Transduction frequency and MOl 169 Vlll

PAGE 14

Figure 7.1 Spot test ofbacterium 10SJ1 isolated from water sample of Key Largo Florida on bacterial lawn SJ9 from Northshore Beach, St. Petersburg, Florida 190 Figure 7 2 TEM observation of antimicrobial activity producing bacteria 191 Figure 8.1 Marine microbiology lab in the old marine science building 193 Figure 8 2 Sampling location: Fort Jefferson Dry Tortugas, Florida 193 Figure 8.3 Membrex vortex flow filtration systems 194 Figure 8.4 Operating membrex vortex flow filtration systems 194 Figure 8 5 Sea condition during a summer 1994 cruise onboard RJV Pe l ican 195 Figure 8 6 Sampling with Niskin bottles during a 1994 cruise onboard RJV Pelican 195 Figure 8.7 Sampling location: African Reef, Dry Tortugas Florida 196 Figure 8.8 SCUBA sampling at Sand Key, Key West, Florida 196 Figure 8 9 Long Key marine lab 197 Figure 8 .10 Key Largo NURC facility 197 lX

PAGE 15

LYSOGENY AND TRANSDUCTION IN THE MARINE ENVIRONMENT by CHENY ANG JIANG An Abstract Of a dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Marine Science University of South F l orida December 1996 Major Professor : John H Paul Ph.D X

PAGE 16

Viruses were first isolated from seawater nearly 50 years ago. However, we are just beginning to understand viral-host interactions in the marine environment. There are two basic types of viral-host interactions: lytic and lysogenic. Previous studies on marine viruses were mainly concerned with the lytic effects of viruses on microbial populations with little attention given to lysogeny. Temperate viral-host interactions result in lysogenization which may have certain survival advantages for both phages and hosts in the marine environment. The objectives of this study were four-fold. First to detect temperate phage-host interactions in the marine environment by examining the occurrence of lysogenic bacteria in marine isolates. Second to develop a method to detect lysogenic bacteria in microbial communities without cultivation. Third to isolate and describe temperate phage-host systems for evaluation of the genetic impact of viruses on microbial populations. Fourth, to study the potential for transduction in the marine environment using temperate phage-host systems isolated from the marine environment. More than 116 bacterial isolates from a variety of marine environments were tested for the presence of prophage by mitomycin C induction. Over 40% of these isolates tested positive, with the highest percentage of lysogens found in offshore, oligotrophic environments. Lysogenic populations in natural bacterial communities were detected b y comparing the bacterial and viral numbers in the induced samples with those in the control sample. A significant increase in viral numbers coinciding with a significant decrease in bacterial numbers was deemed a positive lysogenic community response. By this criteria, more than 50% of the natural communities examined contained lysogens with up to 38% ofthe bacteria in the community as lysogens Polyaromatic hydrocarbon s XI

PAGE 17

were shown to be efficient agents for lysogenic induction suggesting that hydrocarbon pollution may contri bute to the viral lysogenic production Four phage-host systems were isolated from Mamala Bay, Hawaii using Membrex-concentrated water samples. Three of them were temperate as indicated by the turbid plaque morphology. All phage isolates contained double-stranded DNA with genome sizes ranging from 40 to 90 kb These isolates were used to establish transduction systems by introducing an antibiotic resistant plasmid to the bacterial hosts as a genetic marker. Plasmid transductions were detected using bacterial isolates with transduction frequencies ranging from 1.33 x 10"7 to 5 .13 x 109 per plaque forming units. Using mixed marine bacterial communities as recipients putative transduction was detected in two of six experiments In transfer to indigenous flora plasmid restriction patterns were modified after plasmid transfer, either by restriction modification gene rearrangement, or some other process. Using a numerical model derived from the current transduction system the transduction rate in an estuarine environment was predicted to be 1.3 x 1014 transductants per year Abstract Approved:-------------------Major Professor : John H. Paul, Ph.D. Professor, Department of Marine Science Date Approved : I I ( 2-1 (' /, Xll

PAGE 18

PREFACE It has been long overdue Finally I have the chance to say "thank you" to many o f you who have helped me and encouraged me to reach the end of graduate s chool. First, to my husband friend and colleague Scott Pichard whose support and comfort make those long hard working days easier ; whose knowledge in science sparks man y new id e as in my research I will be never be embarrassed to ask him the silliest question To m y mento r Dr. John Paul, who taught me to grow in science from a child to a mature scientist. Thank you for putting up with me for the past seven years, including the joke about jerk chicken. Deeply in heart, I respect your commitment to scientific excellence and your intelligent guidance in scienti fi c research I'd also like to thank the rest of m y committee members for their guidance and support To Dr. Bradle y, who wa s always there when I ne e ded him. To Dr. Rose and Dr. Coble, who are not only good inspirations and role models in science but also who treat me like a friend To Dr. Dunigan who is the most responsible teacher I have known in college I kept all the little philosophical notes from your Virology course. Thanks to all those who worked with me in the lab. Jennifer Thurmond Marc Frischer Chris Kellogg (m y science editor) Jordan Brown-Kang (my Asian connection), Pam Cochran (my beauty consultant, and "lysogenic torch" carrier) gullig" Rod Stokes Xlll

PAGE 19

and the next door neighbor" Kim Donaldson, I treasure the time shared with you guys. I wish I could have more space to recite many funny stories we shared together. Thanks to all my Chinese comrades in Marine Science. Y antain Lu, Zhaihu a Ji Zhongping Lee Weilin Hou, Lin Qiao Mingrui and Haihua ... you make me feel at home I will miss all the good food you guys cooked. Please please let me know when is the next party Many thanks to those who helped financially during my graduate career. Thanks to the Knight Fellowship Fund the Gulf of Oceanographic Fellowship Fund and the most important to the per s on who makes these fellowships available our departmental chair Dr. Peter Bet z er Thanks to the marine science faculty for awarding me the fellowships Finally, a hearty thank you to Kristen Kusek for editing my dissertation and Chad Edmin s ten for all the slide s and graphics. 1 don't know what to do without you Thank s to the captain and crew memb e rs of the RIV Pelican and RIV Cap e Hatteras for making the research cruises fun and productive xiv

PAGE 20

CHAPTER! INTRODUCTION: LYSOGENY AND TRANSDUCTION IN THE MARINE ENVIRONMENT 1.1 Background Viruses were first isolated from seawater nearly 50 years ago (ZeBell 1946 Spencer 1955). The knowledge of marine viruses at this early period primarily depended on plaque assays which required the proper host s and adequate culture conditions. The limitation of this detection method had l e d to the belief that viruses were rare in the marine environment or non-existent in the open ocean (Moebus 1987) Although a large number of marine bacteriophages were isolated from the oceans using a liquid enrichment method during the '70s and early '80s (see review by Moebus 1987) the interest in marine viruses did not flourish until the employment of direct enumeration techniques b y Bergh et al. (1989). This work indicated that viruses were 4 to 7 orders of magnitude more abundant in seawater than previously expected. Viruses are now known as the most abundant form of life in the world's oceans. Viral abundances range from -104 particles/ml in oligotrophic deep sea environments to more than 1 08 particles / ml in estuarine and coastal environments (Borsheim 1993, 1

PAGE 21

Fuhrman & Suttle 1994 Weinbauer et al. 1995, Steward et al. 1996) Table 1.1 summarizes a literature review on the abundance of marine viruses sampled in a variety of marine environments Most of the marine viruses, as determined by their sizes and morphologies under transmission electron microscopy (TEM), are considered to be bacteriophages (Cochlan et al. 1993). Approximately 50% of viruses are tailed a typical morphological feature of bacteriophages (Wommack et al. 1992). The si zes of marine viruses range from 20 run to over 150 run with over 60% falling between 20-60 run (Borsheim 1993). Viral abundance typically parallels that of bacteria with abundance decreasing from nearshore to offshore waters and from surface to deep waters A subsurface maximum in viral abundance often coincides with subsurface bacteria and maxima (Hara et al. 1991 Paul et al. 1991 1993 Wommack et al. 1992 Cochlan et al. 1993) This strong correlation between bacteria and viruses also indirectly suggests that the majorit y of marine viruses infect bacteria (Paul et al. 1991 ). Viruses are dynamic members of marine microbial communities. Their abundance changes on time scales of a month (Bratbak et a 1. 1990) a week (Borsheim et al. 1990) and even hours (Heldal & Bratbak 1991, Jiang & Paul 1994) A year-long seas onal study of viral abundance in Tampa Bay Florida indicated that viral abundance was more than one order of magnitude higher in the summer (wet s eason) than in the winter (dry season Jiang & Paul 1994). Marine viral decay rates, summarized in Table 1 2, ranged from 0 003/h to 1.1/h under natural conditions (Heldal & Bratbak 1991 Suttle & Chan 1992 Bratbak et al. 1992). However, the higher end of the viral decay rate far exceeds the estimated viral production rate using average burst sizes and total bacterial mortalit y 2

PAGE 22

(Bratbak et al. 1992). A direct approach of measuring viral production using radioactive phosphate or thymidine labeling was developed by Steward et al. (1993a,b). Their results showed that viral production rates ranged from 2 3 x 1011 viruses L -I d-1 in a coastal la goon to below the detection limit ( < 1 x 108 viruses L -I d -1 ) in offshore oligotrophic waters. Table 1.1 Marine Viral Abundance as Determined by D irect Counting Methods. Reference Location Number ofViruses/ml Torrella & Morita 1979 Yaquina Bay >1x10 Sieburth et al. 1988 Narraganet Bay 5.8x106 Bergh et al. 1989 Chesapeake Bay 1x107 North Atlantic 1.5x107 Korsfjord 6.1x106 Raunefjord < 1 x104-1x107 Barent s Sea 6x104 Proctor & Fuhrman 1990 Long Island Sound 1.5x108 Eastern Caribbean 1.9x106 Western Caribbean 4.8x106 Sargasso Sea 3x103 Gulf Stream 4.6x108 Bratbak et al. 1990 Raunefjord 5x105-1x107 Suttle et al. 1990 Laguna Madre ( hypers a line) 3.3x1 07.9x1 07 Gulf of Mexico 2x107.2x107 (Continued on Next Page) 3

PAGE 23

Table 1 1 (Continued) Reference Location Number of Viruses / ml Hara et al. 1991 Osaka Bay 3.5x10 Otsuchi Bay 1.7x1065x106 Sagami Bay 2.7x106-1.6x107 Offshore of Kuroshio 1.2x106-2 .5x106 Heldal & Bratbak 1991 Raunefjord 1.1x107-3.5x107 Bergen harbors 4.4x1 07 -5.9x107 Paul et al. 1991 Tampa Bay 6x106-3.4x107 Florida Bay 2x106 Dry Tortugas 1.5x 106 -2.3x 106 NW Providence Channel 4.4x105 Gulf of Mexico 4.4x1 05 -4.4x1 07 W omrnack et al. 1992 Chesapeake Bay 2.6x106-1.4x108 Cochlan et al. 1993 Southern California Bight 3x105-2.8x107 Scripps Pier 2.8x107 Gulf of Bothnia Sweden 1.7x1 07 -5.2x1 07 Boehme et al. 1993 Tampa Bay 4.6x1062 7x107 Gulf of Mexico, Surface 3.8x1 05 -8.5x1 05 Gulf of Mexico Deep (200-2500m) 4 4 1.4x10 -4 7x10 Paul et al. 1993 Key Largo Coastal 1.7x106-1.2x107 Weinbauer et al. 1993 Northern Adriatic Sea 1.2x106-8.7x107 Jiang & Paul 1994 St. Petersburg Pier (seasonal) 4.8x106-2x107 Maranger et al. 1994 Arctic sea ice 9 0x106-1.3x108 Arctic sea ice underlying water 1.1x106 Weinbauer et al. 1995 Northern Adriatic sea (seasonal) < 106-9.5x107 Steward et al. 1996 Bering and Chukchi seas 2 1x106-2 7x107 4

PAGE 24

Table 1.2 Marine Viral Decay Rates Viral Samples Decay Rates Methods Used Reference Marine Indigenous Viral Populations Raunejford 0.26-0.55 lh KCN inhibition Heldal & Bratbak 199 Bergen Harbor 1.1/h viral production Lake Kalandsvannet 0 .33-0.64/h Knebel Vig,Bay of Arhus 0.3-0.4/h KCN inhibition Bratbak et al. 1992 viral production Marine Phage Isolates phage360,phage369 0.4-1.0/day plaque assay Ahrens 1971 nt-1, nt-6 0.003-0.2 / day plaque assay Zachary 197 6 10 isolates 0 1-1.1/day plaque assay Moebus 1992 3 isolates 0.2-0.7/day plaque assay Suttle & Chan 1992 (dark) 9.6-19 / day (light) 1.1.1 Viral-Induced Mortality of Microbial Populations Viruses are obligate parasites; their production depends primarily on the mortality of their parasitic hosts Therefore, marine viruses may play an important role in controlling microbial populations in the marine environment. Evidence of viruses as an 5

PAGE 25

important agent of bacterial and phytoplankton mortality was obtained from observing ultrathin sections of natural plankton communities by TEM (Proctor & Fuhrman, 1990). Culture studies have shown that mature phages typically appear at the final stage of the infection cycle; hence the proportion of total infected cells can be estimated from the proportion of cells containing mature viral particles. From 1 to 4% of marine bacteria and cyanobacteria were found to contain mature phages. These data indicate that as much as 30% of the cyanobacterial mortality and 60% of the bacterial mortality can be caused by viral lysis. Similar numbers of bacteria containing mature phages were al so observed by high voltage TEM (Bratbak et al. 1993, Weinbauer 1993). In addition Suttle et al. (1990) demonstrated that adding marine viral concentrates to seawater caused up to a 78% decrease in primary production (measured by carbon fixation). Their results suggest that marine viruses are also important in phytoplankton mortality. The high viral decay rates observed in the marine environment impl y that high bact e rial mortality due to viral l ys is must occur to support viral production (Heldal & Bratbak 1991, Bratbak et al. 199 2). Viral production data suggest that bac terial mortality from viral infection i s more important in coastal embayments than in oligotrophic offshore waters (Steward et al. 1993b). However, estimating viral-induced mortali ty from decay or production rates requires a known burst size. Becau se of t he uncertainty of this number Steward et al. (1993b) used a large range of burst sizes ( 10-300) Their estimated vira l-induced mortality rates ranged from 1-740% (Steward et al. 1993b ). Viral-induced mortality of the bacterial stand in g stock was also estimated from the short-term changes observed in bacterial and viral abundances durin g diel studies (Jiang & Paul 1 994 6

PAGE 26

Weinbauer et al. 1995). The results of these studies together with results using other methods were summarized in Table 1.3. However, one group of the data was presented as % net mortality of microbial population, and the other group was given as % daily standing stock mortality rate. Therefore, it is difficult to compare the two groups of data without additional information. The net mortality due to viral lysis averaged 43.9% and the daily bacterial standing stock viral-induced mortality rate averaged 145.2% per day Forty percent of net phytoplankton mortality attributed to viral lysis (Table 1.3). The recent attention given to viruses in marine environments has brought a new concept to microbial ecology: the viral-bacterial loop (Bratbak et al. 199 2, Figure 1.1 ). Via this model, cell debris, viral particles and dissolved organic matter from viral lysis return to "feed" the bacteria in a loop. With additional input of dissolved organic matter from other trophic levels, this loop essentia ll y oxidizes carbon and regenerates a portion of nitrogen and phosphorus (Fuhrman & Suttle 1993). The viral-bacterial loop in creases both bacterial secondary production and respiration and at the same time decreases the carbon transfer to the higher trophic levels. Thus, viruses caused a shift in the overall food web activity from l arger organisms to bacteria (Fuhrman 1992). The effect viruses have on marine microbial populations may explain the question of whether bacteria are a "link or sink" in the food web. When viruses are important agents of microbial mortality, repeated cycling of dissolved organic matter within the bacterial-viral loop combined with bacterial respiration make the bacteria efficient sink s for carbon (Fuhrman & Suttle 1 993). Variations in the relative significance of viruses in 7

PAGE 27

bacterial mortality may help explain why Ducklow et al. (1986) found the bacteria to be a sink while Sherr et al. (1987) indicated they can be more of a link to higher trophic le vels. Phytoplankton (Primary Production) GRAZING FOOD CHAIN Zooplankton (Carnivores) -"""""',"','""'" J.:-. Ciliates -. M icroflagell
PAGE 28

Tab l e 1.3 Vira l -induced Mortality of Microbial Populations Reference Sampling Locations % Net Mortality of %Daily Methods Bacterial Phyto. Mortality Proctor & Long Island Sound 82 56 observing mature Fuhrman Eastern Caribbean 78 34 phage in u l trathin 1 990 sections of Western Caribbean 56 26 marine bacteria Sargasso Sea 18 16 Gulf Stream 86 20 Sutt l e et MSI Pier U. Texas 44% reduction in adding al. 1990 total carbon fixation concentrated viruses to seawater Proctor & North Pacific 4-74 observing mature Fuhrman Ocean sediment phage in ultrathin 1991 trap (30 400m) sections of marine bacteria Heldal & Raunefjord & Lake 48-576 ca l culated from Bratbak Kalandsvannet viral decay rate 1991 and burst size Bratbak Knebel Vig, Bay of 72 calculated from et al. Arhus viral decay rate 1992 and burst size Bratbak Raunefjord 25100 calculated from et al. (Mesocosms) Emiliania Huxleyi changes in phage 1993 and host density Steward Penasquitos Lagoon 25-740 calculated from et al. Mission Bay 12-372 viral prod u ction 1993b and burst size Pacific Ocean 1-40 (Continued on Next Page) 9

PAGE 29

Table 1 3 (Continued) Reference Sampling %Net Mortality of %Daily Methods Locations Bacterial Phyto. Mortality Weinbauer Northern Adriatic 7-39 observing mature et al. 1993 Sea phage in bacteria by high voltage TEM Jiang & St. Petersburg Pier 3-53 3 calculated from Paul 1994 changes in viruses and bacteria Fuhrman Santa Monica CA 1) 50 1 )size fraction of & Noble labeled DNA 1995 2)viral prod and 2) 40-50 bacterial mortality 3) 24-66 3)bacteria contain mature phage Hennes & Lake Constance <34 1.2-2.7 observing mature Simon, phage in 1995 bacteria by high voltage TEM Weinbauer Northern Adriatic 19 9-212.2 calculated from et al. 1995 sea changes in viruses and bacteria Steward et Chukchi Sea 2-36 observing mature al. 1996 phage in bacteria by high voltage TEM Average 43.9.4 39 6.7 145.2 10

PAGE 30

1.1.2 Bacteriophage Life Cycles Bacteriophages have two types of life cycles: the lytic and the lysogenic cycles (Figure 1.2). In the lytic cycle, vira l DNA starts to replicate immediately after host infection followed by progeny production and host lysis (Ackermann & DuBow 1987). Near l y all previous studies on marine viruses have assumed that viruses in the marine environment are produced via lytic life cycles. The lysogenic cycle of viral production has been largely ignored. However, recent evidence suggests that lysogeny is more important in marine microbial systems than previously thought. For example, a study of the viral contribution to carbon flow in microbial ecosystems using a lytic life cycle model resulted in an overestimating of viral-induced bacterial mortality, which suggests that the final fate of viral infection may be lysogenization rather than lysis (Bratbak et al. 1990, 1992, Thingstad et al. 1993). Waterbury and Valois (1993) found that most of the Synechococcus isolates from Woods Hole Harbor were resistant to cyanophages from the same environment. They concluded that most of theses cells were immune to the surrounding viruses; only a small portion were sensitive to lytic infection. This immunity may have been caused by lysogeny, although this was not investigated in their study. 11

PAGE 31

Lytic Lysogenic Figure 1.2 Bacteriophage life cycles showing the lytic and lysogenic cycle. 12

PAGE 32

1.2 Lysogenic Life Cycle 1.2.1 General Description and Terminology Similar to the beginning of lytic life cycle the lys o genic cycle begins with the phage attachment to a cell surface and subsequent injection of the viral DNA into the cell (Figure 1.2). Upon entering the host cell the "lysogenic decision is made depending on the ph y siological conditions of the host the expre s sion of phage and host genes and s everal other host factors (Birge 1994) In the lysogenic state viral DNA either becomes integrated into the host genome or maintained as an extra chromosomal element inside the cytoplasm During this period the transcription of viral genes that encode for phage DNA replication and phage structural proteins are repressed by a repressor protein synthesized by the phage DNA and most of the viral genome remains silent and behaves like host DNA. This "sil e nt" viral DNA called a prophage replicates with the host genome and is present in all progeny of the parent host. Prophages can revert to the vegetative replication state following inactivation of the repressor. This process is called induction which may occur spontaneousl y or in response to external stimuli. The host cell that contains a prophage is called a lysogen Lysogenic cells are homo i mmune to lytic infection by the same or similar types of viruses because of the presence of vegetative replication repressor proteins inside the cell. The phage capable of lysogenizing a host is called a temperate phage, whi ch is in contrast to a phage which only causes cell lysis called a lytic phage 13

PAGE 33

1.2.2 Mechanisms The molecular basis for the lysogenic life cycle is best known from studies on the phage A.. The lysogenic state of /.., is maintained by the products of three genes: cl ell and clll. The cl protein functions by competing with the lytic replication protein "Cro" for promoter binding sites (Birge 1994). The predominance of cl protein leads to the lysogenic cycle; the control of the Cro protein at the promoter binding sites causes a switch to the lytic life cycle. The mechanisms of this lysis-lysogeny decision has been likened to a genetic "switch" that determines whether a phage immediately lysis the cell or forms a relatively stable lysogen (Ptashne 1986) The ell and clll proteins serve to enhance the expression of cl repressor protein. The region of DNA that includes the ci repressor binding sites is referred to as the immunity region because it determines the type of superinfection immunity conferred by the prophage (Birge 1994 ). The repressor is phage type specific. The phage/.., DNA integrates into the host genome at an attachment site (att) with the assistance of a phage gene product called integrase (int). Studies have shown that the host general recombination system (RecA) and a special protein called the integration host factor (IHF) are necessary for the integration. The integration procedure is reversed during prophage induction. In addition to the int function, a phage xis function is also required for the prophage excision. Prophage DNA excision occurs when the cl repressor protein is degraded by proteinase activity during DNA repair. DNA damaging agents 14

PAGE 34

such as ultraviolet radiation and mitomycin C activate the cell DNA repair system and remove the ci repressor to cause induction of vegetative phage replication Studies on the mechanisms of the lysogenic cycle with other lambdoid phages have noted some similarities to and also differences from those of the A phage. For example the repressor of the P4 phage is not a protein but a small untranslated RNA molecule that functions by binding to nascent RNA molecules and causing premature termination (Deho et al. 1992). P 1 prophage is only rarely integrated into the host chromosome and generally remains as an autonomous plasmid (Birge 1994) The prophage Mu is not inducible by DNA damaging agents Its prophage DNA acts like a transposon integrating the host genome randomly by transposition. The phage P22 encodes an anti-repressor that inactivates the normal repressor protein molecules resulting in prophage induction. The anti-repressor is nonspecific and can inactivate the repressors of other temperate phages including some that are not normally inducible such as phage Mu and P2 (Birge 1994). The lysogenic life cycles in marme bacteriophages has not been previously studied. The previous knowledge of the lambdoid phages lysogenic cycle provide models for some common features of marine lysogens such as superinfection immunity and prophage induction by DNA damaging agents, to name a few Because entirely different phage-host systems exist in marine environments and also the physiological conditions of phages and hosts in the marine environment are dramatically different from those found in nutrient-riched culture conditions we expect marine phage host systems to be different from our previous knowledge of lambdoid phages 15

PAGE 35

1.3 Ecological Advantages of Lysogeny Lysogeny is a highly complex process which requires coordinate expression of the prophage and host genes (see above) The occurrence of lysogeny is not an accidental process but rather a highly evolved state. Prophages in certain lysogenic strains have been shown to be stable for over 77 years (Barksdale & Arden, 1974). Furthermore lysogeny has been found to be common in every environment examined thus far ( Ackermann & DuBow, 1987), which suggests that this complex process has certain advantages for survival within the environment. In short natural selection favors l y sogeny The replication and reproduction of viruses requires the constant presence of their sensitive hosts In the lytic life cycle rapid viral amplification leads to the mortality of the hosts leaving the progeny of these viruses with the possibility that new susceptible host cells may not be encountered Free viral particles can become inactivated rapidly b y a v ar iety of factors in the environment (Suttle & Chen 1992 ) Lysogen y, on the other hand can provide a refuge for the viruses when their host densities are low. Temperate phages replicate as prophages inside hosts and they are present in all the progeny of the parent lysogenic host. By coexisting with their hosts temperate phages ensure the perpetuation of their genes Mature viral particles spontaneously released at a low rate from the lysogenic population constantly look for new hosts to further amplify their genes ( Ackermann & DuBow 1987) When favorable environmental conditions are encountered (high host densities and sufficient nutrient supplies for active bacterial growth) the lytic amplification cycle may be initiated for rapid viral replication The 16

PAGE 36

environmental factors which can influence the lytic-lysogenic decision have been demonstrated to act at the molecular level in phage t.. (Birge 1994). Generally, environmental conditions which are unfavorable for host proliferation will cau s e increased frequencies of lysogeny (Marsh & Wellington 1994) Therefore, in the majority of marine environments where the cells are starved and densities are always low lysogeny would seem to be favored. Temperate phages have a competitive advantage over their lytic counterparts by being lysogenic under unfavorable conditions. In addition to the benefit to the temperate phage, lysogeny also gives the bacterial host a competitive advantage over the non-lysogenic bacteria The most obvious advantage is superinfection immunity, which has an obvious survival value. In addition lysogens of Escherichia coli were shown to grow more rapidly than nonlysogens during aerobic growth in glucose-limited chemostats (Edlin et al. 1975 1977, Lin et al. 1976 Dykhuizen et al. 1978). Although the molecular basis for the increased fitness of lysogeny is uncertain, these results suggest that a growth advantage has played a role in the natural selection of the prophage-containing bacteria in nature When a prophage integrate s into its host chromosome some prophage genes may be expressed in the host system, giving new phenotypical properties to the lysogenized host. This phenomenon is called phage conversion. The particular novel properties conferred are specified by the prophage genes and persist as long as the prophage does (Ackermann & DuBow 1987). At least two properties are always conferred: lysogeny and superinfection immunity Thus, to some extent, every lysogenization is a conversion; however, this term is usually applied when other properties conferred (Ackermann & 17

PAGE 37

DuBow 1987) Well known examples of phage conversions include antibiotic resistance (Smith 1972), cytotoxin production (Hayashi et al. 1990) and bacterial virulence factors ( Baronde ss & Beckwith 1990) These new characteristics may increase the survival rate and competitive fitness ofthe lysogen in its environment. 1.4 Methods for Detecting Lysogenic Bacteria Lysogenic bacteria can be detected by cocultivation or spot test with the sensitive host, and by electron microscopy observation of phage part icles in the presence or absence of induction. In general, spontaneous phage production is infrequent and tends to go undetected making induction a necessity to detect lysogeny (Ackermann & DuBow 1987) Although molecular probing techniques have been used to detect natural populations of a specific prophage in a population (Ogunseitan, et al., 1991 ), they are not commonly employed because of the potential for non-specific hybridization A variety of agents have been used to induce prophage from lysogenic bacteria, including mitomycin C, UV radiation and other mutagens, carcinogens or stress conditions like increased temperature and pressure. These agents induce prophage replication by triggering the "SOS" response in the bacterial cell and subsequently removing the lytic replication repressor (Ackermann & DuBow 1987). Mitomycin C and UV radiation are by far the most commonly used inducing agents These agents are more or less equivalent in inducing efficiency although they do not always induce the same phages (Ackermann & Smimoff, 1978). 18

PAGE 38

The induction of phage development from lysogenic bacteria is also controlled by environmental factors and the physiological state of the host cells For example the dosage of ultraviolet light that induces phage development in more than 90 percent of the population during exponential growth, does not affect more than 20 to 30 percent of the same population when irradiation takes place during the lag phase or at the end of the stationary phase (Lwoff et al. 1950) Starved cells have reduced ultraviolet sensitivity and a lower proportion of inducible bacteria (Borek 1952, Lwoff 1951 ). Both ultraviolet sensitivity and the percentage of inducible bacteria will recover in 40 minutes after addition of nutrients (Borek 1952). It is believed that the majority of bacteria in marine environments are in a starvation survival mode of existence (Nystrom et al 1990). Therefore, the number of lysogens in these environments which can be detected by standard induction methods may be low because of nutritional status. 1.5 Occurrence of Lysogeny Lysogeny occurs in most groups of bacteria including cyanobacteria and archaebacteria (Ackermann & DuBow 1987). The frequency of lysogen detection varies considerably with taxonomy, geographical origin of the strains, methods of detection and efforts input into the study A review of the literature by Ackermann and DuBow ( 1987) suggests that out of nearly 1200 strains of bacteria investigated an average of 4 7% contained inducible prophage. Poly lysogeny or the presence of several prophages in the same bacterium was also common. 19

PAGE 39

Lysogeny is important for many reasons and in a myriad of fields Many early studies focused on the biology and molecular biology of the ly soge nic process (Miller et al. 1977, Franche 198 7, Birge 1994). In the field of medical microbiology, researcher s have been concerned about bacterial virulence factors determined by prophage conversion (Loftus & Delisle 1995). In the fermentation industry, lysogenic starter strains could cause an entire fermentation process to fail, due to widespread infection of sensitive strains throughout the industry (Huggins & Sandine 1977, Cuesta et al. 1995 Jarvis e t al. 1992 Sonnen et al. 1990) Furthermore, temperate phages have been sought for use as genetic tools such as chromosomal integration sys tem s and r egu lated promot e rs, in the elucidation of global gene regulatory sys tem s in bacteria (Moreau et al. 1995, Christiansen et al. 1994, Abebe et al. 1992) Temperate phages have also been used as phage typing systems for identifying bacterial strains from a variety of environments (Mitra et al. 1995, Harvey et al. 1993 Shimodori et al. 1984). However only a few studies focused on the occurrence and ecology of ly soge ny in aquatic environments. The abundance of lysogens was studied in Pseudomonas i so lates from freshwater lakes using DNA hybridi za tion and plaque assays. These result s indicated that up to 70% of the Pseudomonas isolates contained DNA homologou s to the bacteriophag e inve st igated (Ogunseitan et al. 1991). Seven percent of the bacterial isolates could form plaques on indicator bacterial lawns (Replicon et al. 1990) Tapper & Hick s (1994) reported increases in viral particles and decreases in bacterial counts after inducing microbial populations in a freshwater lake with mitomycin C and UV radiation. Our pre liminary survey of marine bacteria for the presence of indu cible prophage among 20

PAGE 40

marine bacteria isolates by mitomycin C induction showed that an average 43.1% of bacterial isolates were lysogens (Jiang & Paul, 1994) However, systematic studies on the distribution and abundance of lysogens in the marine environment have not been performed. Furthermore, previous studies on marine and freshwater lysogens only used artificial inducing agents such as mitomycin C and UV radiation ( < 300nrn), neither of which are found in the marine environment. The environmental factors which cause prophage induction in the marine environment remain unknown. 1.6 Environmental Factors for Prophage Induction Among all the inducing agents tested for prophage induction, only a few naturally occur in the marine environment. Since UV radiation has shown to be a powerful agent for prophage induction in culture studies, it has been assumed that solar UV radiation was one of the natural agents of prophage induction. Recently, more detailed studies by Kokjohn et al. (personal communication Schrader et al., 1994) showed that solar UV (mainly UVA > 350nrn), although capable of phage inactivation, did not induce the prophage in P. aeruginosa. In fact, it has been suggested that solar UV favors lysogeny because it provides a strategy for the virus to avoid solar UV inactivation. Prophage induction requires shorter wavelengths of UV (UVB and UVC 302 & 250 run respectively). However they also suggest that more lysogenic bacteria need to be tested to understand the effect of solar UV on lysogeny. 21

PAGE 41

Many hydrocarbons have been shown to induce prophage in bacterial isolates (Ackermann & DuBow 1987). These chemicals are present in many estuarine and coastal marine environments (Bouloubassi & Saliot 1993, Readman et al. 1982) and their effect on prophage induction in the marine environment has not been investigated. However it is unlikely these pollutants cause prophage induction in the open ocean. Among the known inducing agents, temperature and pressure may be most likely to cause prophage induction in marine environments. It has been documented that an increase of temperature from 37C to 42C caused the induction of a temperature sensitive mutant of A. prophage (Bertani 1953) Also, a pressure increase to 2000 atm for 5 min caused A. prophage induction (Rutberg & Heden 1960) In marine environments the vertical movement of bacterial populations through the water column by the processes of Langmuir circulation eddy mixing, or some combination (Murray & Jackson 1993) can result in changes in temperature and pressure, which may cause the induction of the natural populations of lysogens 1. 7 Genetic Significance of Viruses in the Marine Environment In terms of composition, a virus is the simplest microorganism, being composed of little more than a piece of nucleic acid encapsulated in a protein coat. The nucleic acid is the critical component in a virus; in fact, a virus can survive inside its bacterial host as a prophage without a protein coat. The abundance of viral particles in the marine environment also means an abundance of nucleic acid transportation vectors. The 22

PAGE 42

interaction of these protected pieces of genetic information with microbial populations may significantly influence microbial genetic composition and diversity by horizontal gene transfer. Viruses contribute to microbial genetic diversity by four different mechanisms. First viral lysis of the bacterial host sometimes releases bacterial chromosomal and plasmid DNA This DNA can be taken up by other bacteria by the process of natural transformation Natural transformation of plasmid DNA was demonstrated recently in the marine environment (Frischer et al. 1993, Paul et al. 1991). Secondly, viruses can keep their host's abundance in check preventing one species from dominating locally and thereby balancing the microbial composition In addition there has been evidence that viruses play an important role in terminating phytoplankton blooms (Bratbak et al. 1993 Sieburth et al. 1988) and in preventing a single s pecies from dominating mixed bacterial cultures (Lenski 1988). Thirdly, temperate phages contribute to bacterial diversity by genetic conversion. Finally viruses mediate hori z ontal gene transfer by the process of transduction 1.8 Bacteriophage Transduction 1.8.1 Terminology Transduction is the term used to designate bacteriophage-mediated transfer of DNA from one cell (a donor) to another cell (a recipient). It was first described by Zinder 23

PAGE 43

and Lederberg (1952) for Salmonella and phage P22, and has since been shown to occur in many other bacteria involving a variety of bacteriophages (Birge 1994) Bacteriophages that carry donor cell DNA are called transducing phages A host cell that acquires a recombinant phenotype upon transducing particles infection is called a transductant. Transducing particles are by-products of normal phage metabolism and exist in two basic forms (Birge 1994) The first type generalized transducing particles are produced from a lytic infection of hosts by either a temperate phage or lytic phage They may contain any part of the host DNA, including plasmid DNA at random frequency. Host DNA is usually not associated with phage DNA inside the viron so these generalized transducing particles are sometimes called pseudovirions (Birge 1994). The second type, specialized transducing particles are only produced from an integrative prophage infection The only bacterial DNA found within these particles is immediately adjacent to the site of prophage integration and is always covalently linked to the viral DNA. 1.8.2 Mechanisms Both generalized and speciali z ed transducing phage particles re s ult from mistakes of the enzymatic systems responsible for either excising or packaging viral DNA (Birge 1994). Generalized transducing phages are the result of mistakes in the viral DNA packaging process. During lytic viral DNA replication, a large piece of DNA consisting 24

PAGE 44

of tandemly repeated units of the phage genome arranged in a head-to-tail configuration called a concatemer is produced (Sternberg & Maurer 1991). Individual viral genomes are packed into capsids by a "headfull mechanism". The initial cleavage for packaging occurs at a unique sequence on the concatemer, called a pac site, and is mediated by the phage encoded enzymes called pacases (Sternberg & Maurer 1991 ). If a sequence similar to the pac site is present in the bacterial genome, the enzymes accidentally package host DNA in the viral head and generalized transducing particles result. Formation of specialized transducing particles does not occur at the time of packaging DNA but rather during excision of the prophage from the chromosome. The enzymes that are excising a prophage excise flanking host sequences as well as the prophage This results in a DNA molecule that contains both partial viral and bacterial genes. Theoretically, transduction can occur in all phage-host systems (Ackermann & DuBow 1987) because mistakes in excision or packaging exist in all systems. However the frequency of natural transduction is most often below detection limits. Genetic mutation or artificial modification of the phage and host genome can increase the frequency of transduction. High frequencies of generalized transduction have been found in phages with packaging enzyme mutations (Birge 1994). When the specificity of these enzymes for the pac site is reduced they catalyze a random cleavage and packaging of any DNA into capsids. Cloning phage pac sites into host chromosomal or plasmid DNA also significantly increases the frequency of transduction of the DNA adjacent to the cloning site (Liebeschuetz & Ritchie 1986 Schmidt & Schmieger 1984). In some 25

PAGE 45

transduction systems, insertion of any restriction fragment of the phage into a plasmid causes increases in the plasmid transduction frequency, regardless of the size or genetic content of the fragment (Novick et a!. 1986, McHenney & Balt z 1988 Raya & Klaenharnmer 1992) The resulting transducing particles contain mostly tandem repeats of the plasmid : :phage chimera. This suggests that the high frequency of transduction observed is a consequence of homologous recombination between the chimeric plasmid (p lasmid containing the randomly cloned phage DNA fragment) and phage concatemers which ha s the effect of introducing an efficient pac site into the former (Novick et a!. 1986). Sandri and Berger (1980) showed that only about 10% of the P 1 transducing DNA that was injected into a recipient cell is ever stably incorporated into the chromosome. The majority of transductants are abortive, in that, the transducing DNA remains extra chromosomal and is transferred to only one daughter cell at cell division. If transducing particles are treated with UV light to introduce damage in the transducing DNA insertion of that DNA into the chromosome of recipient cells increases due to the activation of r ecA recombination activities in the cell (Sternberg & Maurer 1991 ). UV irradiation treatment of the transducing lysate also reduces killing of recipient bacteria by virulent phages, and can increase the frequency of transduction sometimes as much as 10 to 50fold (Miller 1992). Both lytic and temperate viruses are capable of mediating gene transduction (Ackermann & DuBow 1987). However, Miller et al (1991) indicated that the highest numbers of transductants were routinely recovered from systems in which the recipient 26

PAGE 46

bacteria were ly sogens. They suggested the immunity to superinfection imparted by the resident prophage prevented the killing of transductants 1.8.3 Transduction Assay A transduction assay requires donor cells, a source of transducing phage, recipients, and a means of selection of transductants. For a transduction assay to be successful, properly designed transducing markers are required. The genotype and phenotype differences between donors and recipients must be distinguishable for transduction to be detected. Therefore, a transduction assay often starts with the selection of a marker system. Auxotrophic mutant s are often used as recipients for assaying chromosoma l transduction from auxotrophy to proto trophy. Auxotrophic mutants can be selected by exposing prototrophs to mutagenic agents and replicate plating. Antibiotic encoding plasmids are often chosen for plasmid transduction. They not only provide a convenient selection system for detecting transductants but gene probes made of plasmid DNA fragments can also be used to distinguish transductants from spontaneous antibiotic resistant mutants or resistant contaminants by colony hybridization Plasmid s can be introduced into donor strains by conjugation, artificial tran sformation, electroporation triparental mating or some other methods The source of transducing phage may come directl y from spontaneo u s prophage induction of lysogenic bacterial culture or from a cell-free lysate. When a transducing lysate is used as a source of transducing phage, it is most easily produced by the soft agar 27

PAGE 47

overlay method. Mid-log donor strains are mixed with the phage at a multiplicity of infection (MOl) of 0.1 in a tube containing 2 ml of melted soft agar. The mixture is poured over a nutrient agar plate to form a thin layer. After incubation the transducing phage is eluted from the top layer of agar and either treated with chloroform or filtered to remove residual donor bacteria. Transduction is often performed by adding transducing lysate to recipients at a range of MOl's (usually from 0.01 to 10). After a brief phage absorption period unabsorbed phages are washed off by repeated centrifugation and washing The washed cells are then plated on various media selective for the genetic determinant(s) serving as markers for transduction. Transduction can also be performed by mixing lysogenic donors with recipients. In this case, viral particles spontaneously released from lysogenic donors served as transducing particles (Saye et al. 1987) Recipient cells can be ly sogens or non-ly sog ens (Miller 1991). During a transduction assay, extended incubation is often necessary to allow for the phenotypic expression of the transduced gene (Miller 1992). Gene probin g and PCR (Polymerase Chain Reaction) can also be used to confirm that transduction occurred. Transduction frequency is usually reported as transductants per plaque forming unit (PFU). Alternatively, transductants per recipient, or tran s ductants per donor (when lysogens used as a source of transducing pha ge) can be used. 28

PAGE 48

1.9 Transduction in the Environment Since the discovery of transduction by Zinder and Lederberg in 1 952, phage transduction has been found to occur in many species of bacteria (Alikhanian et al. 1 960, Barsomina et al. 1984 Buchanan Wollaston 1979 Chatterjee & Brown 1980) While transduction systems hav e been u se d routinely in the laboratory as tools for bacterial genetic analysis for many years, the role of transduction in contributing to microbial genetic diver sity and evolution in natural habitat s has only been investigated very recently The use of genetically eng ineered microorganisms (GEMs) in the environment has raised concerns over the ultimate fate of these organisms and their engineered genes. One concern is the possible tran sfer of the novel ge netic inform ation to the indi genous flora For these reasons, the possibility of horizontal gene transfer by the process of transduction ha s been investiga ted in soil and freshwater environments (Zeph et al. 1988, Zeph & Stotzky 1989 Morrison et al. 1 978 Saye et al. 198 7, 1 990) Zep h et al. ( 1 988) emp l oyed a derivative of the temperate bacteriophage P1 to measure speciali z ed tran s du ct i on in a soil environment sup pl emented with recipient E. coli. They s how ed that transd uct ion occurred, with a transduction frequency of 3x1 o-3 transductants per recipient in steri li zed soi l and 1 x 1 o-3 transductants per recipient in non-sterilized soil. The resulting transductant s (lysogens) were also capable of surviv in g in the soi l for a relatively l ong time (at lea st 28 days). However, Germida and Khachatourians (1988) found significantly 29

PAGE 49

lower transduction frequencies (ca. 1 o-6 ) in the soil by using the same transduction system. In freshwater lake environments both chromosomal and plasmid transduction in Pseudomonas aeruginosa was demonstrated during in situ incubation (Morrison 1978, Saye et al. 1987, 1990). Morrison et al. (1978) demonstrated transduction of a chromosomally encoded streptomycin (smr) resistant gene by a generalized transducing phage, F116 in flow-through environmental chambers suspended in a freshwater lake The transduction frequencies ranged from 1.4x1 o-5 to 8 .3x1 0-2 transductants per recipient. Similar rates ofF 116-mediated chromosomal transduction between P aeruginosa strains have also been reported on river stones submerged in the River Taff in southern Wales (Amin & Day 1988). Saye et al. (1987) investigated the transduction of plasmid RMS 149 by a P aeruginosa generalized transducing phage DS 1 in chambers incubated in a freshwater lake Their results indicated that both cell-free phage lysates and phage particles produced by spontaneous induction of lysogens could mediate in situ transduction. Cotransduction of closely linked chromosomal loci was observed between lysogenic and nonlysogenic strains of P. aeruginosa at frequencies of 1 o-6 to 1 o-5 transductants per colony forming unit in this freshwater lake habitat (Saye et al., 1990). Ripp et al. (1994) demonstrated transduction of a freshwater microbial community by a natural Pseudomonas aeruginosa bacteriophage isolated from lake water. The transduction frequencies were enhanced as much as 1 00-fold in the presence of suspended particulates in the lake water (Ripp & Miller 1995) They suggested that 30

PAGE 50

aggregation of bacteriophages and bacterial cells are stimulated by the presence of these suspended particulates The aggregation increases the probability of progeny phages and transducing particles finding and infecting new host cells. Consequently both phage production and transduction frequencies increase in the presence of particulate matter. Extremely limited data are available on transduction in the marine environment. Keynan et al. (1974) reported the isolation of a marine transducing bacteriophage on a strain of luminous bacteria Although no stable lysogens of this phage were isolated it behaved like a specialized transducing phage and specifically transferred the tyrptophan region Generalized transducing phages that attack Vibrio fischeri (Levisohn et al 1987) and other marine Vibrio strains (Ichige et al. 1989) were also isolated from highly polluted seawater collected in the port of Ensenada, Baja California Mexico and the Pacific coast near Tokyo Japan respectively. However these investigations only focused on the development of genetic tools to characterize the Vibrio spp No attempt was made to evaluate the contribution of transduction to microbial diversity in marine environments Furthermore, in situ generalized transduction by the Vibrio phage was demonstrated in oysters by Baross et al. (1974). 1.10 Environmental Factors for Transduction Three basic components are required for a transduction system : a donor transducing phages and a recipient. The donor and recipient bacteria may be lysogens or non-lysogens; the transducing phage is either lytic or temperate. Both viruses and bacteria 31

PAGE 51

are abundant in the marine environment (Boehme et al. 1993), and lysogenic bacteria have also recently been shown to be an import portion of marine bacteria (see above). These indigenous viruses and bacteria, both lysogens and non-lysogens, may well serve as donors, recipients and transducing phages for the indigenous transduction in a variety of natural environments. Many factors affect the occurrence and frequency of transduction. They include nutrients, temperature, ionic strength, multiplicity of infection (MOl) and UV radiation among others. Almost all of these factors are germane to the marine environment. In the laboratory, bacteriophages often show optimal temperature and ion concentrations (Ca2+ Mg2+ ) for adsorption and replication (Seeley & Primrose 1980, Tolmach 1957), and these conditions often reflect their ecological origin. Therefore, seawater-based media should be used for assaying marine transduction. The MOl was found to be one of the most important factors affecting the frequency of transduction (Morgan 1979, Keynan et al. 1974 Miller 1992). Different phages have different optimal MOl's for transduction. For example, a marine lytic transducing bacteriophage attacking a luminous bacterium had an optimal MOl of 0.5 (Keynan et al., 1974). The transduction frequency decreased 5 times when the MOl reached 1.5. Alternatively, there was no significant difference in the transduction frequency when MOl's ranged from 0.1 to 3 for transduction of P. aeruginosa with a mutant of bacteriophage E79 (Morgan, 1979). In most studies, the MOl's have been maintained between 0.1 and 1 (BuchananWollaston 1978 Finan et al. 1984 Sik et al. 1980). It was thought that the low MOl's produced higher transduction frequencies by 32

PAGE 52

reducing the possibility of a recipient cell encountering both a transducing particle and an infectious phage particle. For transduction m freshwater environmental chambers Saye et al. (1990) reported the optimal MOl's for phage F116 and DS1 transduction in P a e ruginosa to be 0 02 However an MOl of 1.5 was used by other investigators in a similar transduction system for in situ transduction studies (Morrison et al. 1978) Since the marine environment is a complex system, it is difficult to determine the MOl for an indigenous phage-host system in the environment. The results of viral direct counts by transmission electron microscope (TEM) indicated that phage-like particles greatly exceed (often by an order of magnitude) the total bacterial populations (Wommack et al. 1990 Hara et al. 1990 Boehme et al. 1993). However natural viral populations are sensitive to solar UV radiation (Suttle & Chen 1992) and it has also been suggested that a large portion of the phage particles counted by TEM are inactive. The results of solar UV radiation may not necessarily shift the natural MOl's to an optimal condition for transduction, yet it definitely adds another positive factor for transduction to occur in the environment. In addition, solar UV radiation may increase the frequency of transduction because it inactivates the "killing effects" of infectious bacteriophage particles in the lysate (BuchananWollaston 1979 Ely & Johnson 1977). Alternatively it has been suggested that UV treatment stimulates recombination within the host cell and leads to increased incorporation of the transduced DNA into the recipient genome (Benzinger & Hartman 1962). 33

PAGE 53

Many bacterial species, including bacteria isolated from marine environments produce bactericidal proteins called bacteriocins (Boemare et al. 1992, Jiang & Paul 1993). The morphology of the bacteriocin type R is very similar to defective phage particles (Boemare et al. 1992, Jiang & Paul 1993), and bacterial genes encoding for these particles share genetic homology with bacteriophage genomes in some cases (Kageyama 1970). Laboratory studies suggested that inserting a fragment of the phage genome into the bacterial plasmid or chromosome increases the frequency of transduction significantly (McHenney & Baltz 1988, Raya & Klaenhammer 1992 Novick et al. 1986 Morrero et al. 1981 ). Similar to the phage DNA insertion the existence of genetic homology with bacteriophage genes in marine bacterial communities may increase the frequency of natural transduction in the marine environment by an increased recombination rate between phage DNA and bacteriocin-encoding region of the host DNA. 1.11 Significance of Transduction in Marine Environments Three gene transfer processes are recognized to occur in the prokaryotes : conjugation transformation and transduction. To date, most environmental studies have focused on the potential for conjugation (O'Morchoe et al. 1988 Bale et al. 1987 Gowland & Slater, 1984) and transformation (Paul et al. 1991, Frischer et al., 1993 Stewart & Sinigalliano 1990) to transfer genetic information among microbes Less attention has been paid to the gene transfer process by phage transduction. However, 34

PAGE 54

transduction may be as important as, if not more so, than conjugation and transformation in the marine environment (Zeph et al. 1988) Packaging nucleic acids in a phage particle may represent an evolutionary survival strategy for the genetic material and s uch viruses may serve as reservoirs for exogenous genes (Stotzky 1989) Compelling data suggests that all of the components and conditions necessary to support transduction are present in marine environments. Therefore, it should be po ssible to develop methods to test in situ transduction with phage-host systems derived directly from the environment. Such studies will allow researchers to evaluate the effectiveness of transduction as a mechanism for altering the genetic makeup and diversity of natural bacterial populations. The objectives of this dissertation research were four-fold. First, I examined marine bacterial isolates for the occurrence and abundance of lysogenic bacteria by prophage induction. Secondly, I developed a method to detect l ysogen ic bacteria in microbial communities without cultivation. Thirdly, temperate phage-host systems were isolated for evaluation of the genetic impact of viruses on microbial populations. The final objective was to s tud y the potential of gene transduction in the marine environment using transduction systems established from indigenous phage-ho s t isolates 35

PAGE 55

Bibliography Abebe, H. M ., Sadowsk y, M J., Kinkle, B. K., Schmidt, E. L. (1992) Lysogeny in Bradyrhizhobium japonicum and its effect on soybean nodulation. Appl. E nviron Microbiol. 58: 3360-3366 Ackermann, H. W., DuBow, M S (1987). Viruses of prokaryotes. Vol. 1. General Properties of bacteriophages. CRC Press. Boca Raton. Ahrens, R. (1971) Untersuchungen zur verbrei tung von phagen der gattung Agrobacterium inder Ostsee. Kieler Meeresforsch 27: 1 02-112 Ackermann, H. W., Smirnoff W A. (1978) Recherches sur Ia lysogenic chez Bacillus thuringiensis et B. Cereus. Can. J. Microbiol. 24: 818-826 Alikhanian S. I., Iljna, T.S ., Lomovskaya, N D (1960) Transduction actinomycetes. Nature 188: 245-246 Amin M K ., Day, M. J. (1988) Donor and recipient effects on transduction frequency in situ. REGEM1, p2. Azarn, F., Fenchel T. Field, J. G., Gray, J. S. Meyer-Rei!, L. A. Thingstad F (1983). The ecological role of water-column microbes in the sea. Mar Ecol. Prog Ser. 10: 257-263 Bale, M. J., Fry, J C ., Day, M J. (1978) Plasmid transfer between strains of Ps e udomonas aeruginosa on membrane filters attached to river stones J Gen. Microbiol. 133: 3099-3107 Barksdale L., Arden, S.B. (1974) Persisting bacteriophage infecti ons, lysogeny, and phage conversions. Ann Rev. Microbiol. 25: 265-299 Barondess, J., Beckwith, J. (1990) A bacterial virulence determinant encoded b y lysogenic coliphage. Nature 346: 871-873 Baro s s, J. H., Liston J., Morita R Y (1974) Some implication of genetic exchange among marine Vibrios including Virbrio parahaemolyticus naturally occurring in the pacific oyster. In : international symposium on Vibrio parahaemolyticus. Saikon Pub Co. Ltd. Tokyo, P 129-137 Barsomina, G D ., Robillard N. 1., Throne, C B. (1984) Chromosomal mappmg of Bacillus thuringiensis by transduction J Bacteriol. 157: 746-750 36

PAGE 56

Benzinger T. Hartmen, P. E. (1962) Effect of ultraviolet light on transducing phage P22. Virology 18: 263-268 Bergh, 0., B0rsheim K. Y. Bratbak G ., Heldal M. (1989). High abundance of viruses found in aquatic environments. Nature 340: 467-468 Bertani, G (1953) Lysogenic versus lytic cycle of phage multiplication Cold Spr. Harb. Symp Quant. Biol. 18 : 65-70 Birge E. A (1994) Bacterial and bacteriophage genetics. 3rd edition Springer-Verlag New York. Boehme, J., Fri scher M E., Jiang, S C., Kellogg, C A Pichard S Rose J. B ., Steinwa y, C Paul, J. H (1993) Viruses bacterioplankton and phytoplankton in the southeastern Gulf of Mexico: distribution and contribution to oceanic DNA pool s. Mar. Ecol. Prog. Ser 97 : 1-10 Boemare, N. E., Boyer Giglio M. H. Thaler J. 0 Akhust R. J., Braehelin, M (199 2 ) L y sogeny and bacteriocinogeny in Xenorhabdus nematophilus and other X e norhabdus spp Appl. Environ Microbial. 58: 3032 3037 Borek, E (1952). Factors cont r olling aptitude and phage development in a lysogenic Esche r ichia c o li K12 Biochem Biophys Acta 8 : 211-215 B0rsheim, K.Y. (1993). Native marine bacteriophages. FEMS Microbial. Ecol. 102 : 141159 Bmsheim, K.Y., Bratbak G Heldal M. (1990) Enumeration and biomass estimation of planktonic bacteria and viruses by transmission electron microscop y App Environ. Microbial. 56: 352-256 Bouloubassi I., Saliot A. (1993) Dissolved particulate and sedimentary naturally derived polycyclic aromatic hydrocarbons in a coastal environment: geochemical significance Marine Chemi s try 42: 127-143 Bratbak, G Heldal, M Norland, S., Thingstad T F. (1990 ). Viruses as partners in spring bloom microbial trophodynamics Appl. Environ Microbial. 56: 14001405 Bratbak G. Heldal M Thingstad T F Riemann B. Has lund 0 H (1992 ). Incorporation of viruses into the budget o f microbial C-transfer. A first approa c h Mar Ecol. Pro g Ser. 83: 273-280 37

PAGE 57

BuchananWollaston, V. (1979). Generalized transduction in Rhizobium leguminosarum. J Gen. Microbial. 112: 135-142 Chatterjee, A K. B rown, M A. (1980). Generalized transduction in the enterobacterial phytopathogen Erwinia chrysanthemi. J. Bacterial. 143: 1444-1449 Christiansen, B., Johnsen, M.G Stenby, E., Vogenesen, F.K ., Hammer, K. (1994) Characterization of the lactococcal temperate phage TP90 1 1 and its site-specific integration J. Bacterial. 176 : 1069-1 076; Cochlan, W.P., Wikner, J., Steward, G.F ., Smith, D C ., Azam, F. (1993) Spatial distribution of viruses, bacteria and chlorophyll in neritic, oceanic and estuarine env i ronments. Mar Ecol. Prog. Ser. 92: 77-87 Cottrell, M., Suttle, C A. (1995) Dynamics of a lytic virus infecting the photosynthetic marine picoflagellate Micromonas pusilla. Lirnnol. Oceanogr. 40 : 730-739 Cuesta P., Suarez, E., Rodriguez A. (1995). Incidence of lysogeny in wild lactococcal strains. J. dairy Sci. 78: 998-1003 Deho, G Zangrossi, S ., Sabbattini, P., Sironi, G Ghisotti, D., (1992) Bacteriophage P4 immunity controlled by small RNAs via transcription termination. Molecular Microbial. 6: 3415-345 Ducklow H. W., Purdie, D A., Williams P. J.L., Davies, J. M (1986) Bacterioplankton : a sink for carbon in a coastal marine plankton community. Science. 232 : 865-867 Dykhuizen D. Campbell, J. H Rolfe, B G (1978). The influences of a lambda prophage on the growth rate of Escherichia coli. Microbial. 23 : 99-113 Edlin, G., Lin, L. Bitner, R. (1977). Reproductive fitness ofP1, P2, and Mu lysogens of Escherichia co li. J. Virology 21: 560-564 Edlin G., Lin, L. Kudrna R (1975). Lysogens of E. coli reproduce more rapidly than non lysogens Nature 255: 735-737 Ely, B Johnson, R. C. (1977) Generalized transduction in Caulobacter crescentus. Genetics. 87: 391-399 Finan, T. M. Hartwieg E., LeMieux, K., Bergman, K ., Walker G. C., Signer, E. T (1984). General transduction in Rhizobium meliloti J Bacterial. 159: 120-124 Franche, C. (1987). Isolation and characterization of a temperate cyanophage for a tropical Anabaena strain Arch. Microbial. 148 : 172-177 38

PAGE 58

Freifelder, D (1987) Molecular Biology Jones and Bartlett Inc Boston. Fri s cher M E Thurmond J. M. Paul J. H. (1993). Factors affecting competence in a high frequency of transformation marine Vibrio J Gen. Microbiology. 139 : 753-761 Fuhrman J A. (1992). Bacterioplankton roles in cycling of organic matter: the microbial food web. In : Primary Productivity and B i ogeochemical Cycles in the Sea P G Falkowski and A.D Woodhead eds Plenum Press, New York 361-383 Fuhrman J. A ., Noble, R. R (1995) Viruses and protists cause similar bacterial mortalit y in coastal seawater Limnology and Oceanography 40 : 1236 1242 Fuhrman, J. A Suttle, C. A. (1993). Viruses in marine planktonic systems Oceanography 6 : 57-63 Gowland P C Slater, J. H (1984). Transfer and stability of drug resistance plasmids in Escherichia coli K12. Microbial. Ecol. 10: 1-13 Germida, J. J ., Khachatourians G. G (1988) Transduction of Escherichia coli in soil. Can J. Microbiol. 34 : 190-193 Hara, S ., Terauchi K., Korike, I. (1991). Abundance of viruses in marine waters : assessment by epifluorescence and transmission electron microscopy Appl. Environ. Microbiol. 57:2731-2734. Harvey D., Harrington, C Heuzenroeder M W., Murry C. (1993) Lysogenic phage in Salmon e lla enterica serovar Heidelberg (Salmonella h e idelb e r g ) : implications for origins tracing. FEMS Micro bioi. letters 108: 291-296 Hayashi, T. Baba T ., Matsumoto H Terawaki Y. (1990). Phage-conversion of cytotoxin production in Pseudomonas aeruginosa Molecular Microbiol. 4: 17031709 H e ld a l M. Bratbak G. (1991) Production and decay ofviruses in aquatic environments. Mar. Ecol Prog Ser. 72 : 205-212 Hennes, K P., Simon M (1995). Significance of bacteriophages for controlling bacterioplankton growth in a mesotrophic lake Appl. Environ Microbiol. 61: 333-340 39

PAGE 59

Huggins, A. R. Sandine, W E (1977). Incidence and properties of temperate bacteriophages induced from latic Streptococci. Appl. Environ Microbial. 33 : 184-191 Ichige, A., Matsutani, S ., Oishi, K. Mizushima, S (1989) Establishment of gene transfer systems and construction of the genetic map of a marine Vibrio strain J. Bacterial. 171: 1825-1834 Jarvis A. W Parker, V R. Bianchin M.B. (1991). Isolation and characterization of two temperate phages from Lactococcus lactis ssp. cre moris C3 Can. J. Microbial. 38: 398-404 Jiang S. C. Thurmond, J. M ., Pichard S. L., Paul, J H (1992). Concentration of microbial populations from aquatic environments by Vortex Flow Filtration. Mar Ecol. Prog Ser. 80: 101-107 Jiang, S C., Paul, J. H. (1994). Seasonal and diel abundance of viruses and occurrence of lysogeny/bacteriocinogeny in the marine environment. Mar. Ecol. Pro g Ser. 104 : 163-172 Kageyama M. (1970). Genetic mapping of a bacteriocinogenic factor in Pseudomonas aeruginosa 1. mapping of pyocin R2 factor by conjugation J. Gen. Appl. Microbial. 16: 523-530 Keynan A., Nealson, K., Sideropoulos, H., Hastins J W. (1974). Marine transducing bacteriophage attacking a luminous bacterium. J. Virol. 14: 333-340 Lenski R. E (1988). Dynamics of interactions between bacteria and virulent bacteriophage. Adv. Microb. Ecol. 10: 1-43 Levin, B R. Lenski, R. E ( 1983). Coevolution in bacteria and their viruses and plasmids. p 99-127 in D J. Futuyma and M. Slatkin, eds. Coevolution. Sinaurer Sunderland Mass Levisohn, R., Moreland J., Nealson, K H. (1987). Isolation and characterization of a generalized transducing phage for the marine luminous bacterium Vibrio fischeri MJ-1. J. Gen. Microbial. 133: 1577-1582 Liebeschuetz, J., Richie D. A. (1986) Phage T1-mediated transduction of a plasmid containing the T1 pac site J Mol. Bioi. 192:681-692 Lin, L. Bitner, R. Edlin G (1977). Increased reproductive fitness of Escherichia coli Lambda lysogens. J. Virology. 21: 554-559 40

PAGE 60

Loftus, A ., Delisle, A L. (1995). Inducible bacteriophages of Actinobacillus actinomycetemcomitans. Current Microbiol. 30 : 317-321 Lwoff, A. (1951). Conditions de l'efficacite inductrice du rayonnement ultra-violet chez une bacterie lysogene. ann. Inst. Pasteur 81: 370-389 Maranger, R., Bird, D.F., Juniper S.K (1994). Viral and bacterial dynamics in Arctic sea ice during the spring algal bloom near Resolute, N.W T., Canada Mar. Ecol. Prog. Ser. 111:121-127 Marsh, P Wellington, E. M H. (1994) Phage host interactions in soil. FEMS Microbiol. Ecol. 15: 99-108 May, W. E Wasik, S. P. (1978). Determination of the solubility behavior of some polycyclic aromatic hydrocarbons in water. Analytical Chemistry. 50 : 997-1000 McHenney, M A., Baltz, R H. (1988) Transduction of plasmid DNA in Streptomyces spp and related genera by bacteriophage FP43. J. Bacteriol. 170: 2276-2282 Miller, R. V., Ripp, S., Replicon, J., Ogunseitan, O.A., Kokjohn, T.A. (1991) Virus mediated gene transfer in freshwater environments. In : Gene transfer in the environment. Proceedings of third European meeting on Bacterial Genetics and Ecology (BAGEC0-3) 20-22 Nov. 1991. eds Michael J. Gauthier. Villefranche Sur-Mer, France. Miller, R. V. (1992). Methods for evaluating transduction: an overview with environmental considerations. In : Microbial Ecology, principles, methods and applications eds by Morris A Levin Romon J. Seidler and Marvin Rogul. McGraw-Hill, Inc. New York. Miller R.V., Pemberton, J. M ., Clark A. J. (1977). Prophage Fl16: Evidence for extra chromosomal location in Pseudomonas aeruginosa strain PAO J. Virol. 22: 844847 Mitra, S N., Kar S., Ghosh, R K Pajni, S Ghosh A. (1995) Presence of lysogenic phage in the outbreak strains of Vibrio cholera e 0139. J. Med. Microbiol. 42: 399-403 Moebus, K (1987). Ecology of marine bacteriophages. In: Phage ecology. ed. by S M. Goyal, C P. Gerba & G. Bitton. Wiley, New York 137 -156 Moebus, K (1992) Laboratory investigations on the survival of marine bacteriophages in row and treated seawater. Helgolander Meeresunter 46: 252 -273 41

PAGE 61

Moreau, P., Bailone, A., Devoret, R. (1976) Prophage induction in Escherichia coli K12 envA uvrB : a highly sensitive test for potential carcinogens Proc. Natl. Acad Sci. 73: 3700-3704 Moreau, S., Leret, V Le Marrec C Varangot, H., Ayache, M., Bonnassie, S., Blanco C., Trautwetter, A. (1995). Prophage distribution in coryneform bacteria Res. Microbial. 146: 493-505 Morgan, A. F. (1979). Transduction of Pseudomonas aeruginosa with a mutant of bacteriophage E79 J. Bacterial. 139 : 137-140 Morrero, T., Chiafari, F. A Lovett, P S (1981 ) SP02 particles mediating transduction of a plasmid containing spo2 cohesive ends. J. Bacterial. 14 7 : 1-8 Morrison, W. D Miller, R.V and Sayler, G S (1978). Frequency of F116 mediated transduction Pseudomonas aeruginosa in a freshwater environment. Appl. Environ Microbial. 36 : 724-730 Murray, A. G ., Jackson, G A. (1993). Viral dynamics II: a model of the interaction of ultraviolet light and mixing processes on virus survival in seawater. Mar. Ecol. Prog. Ser. 102 : 105-14 Novick, R. P., Edelman, I., Lofdahl, S (1986). Small Staphylococcus aureus plasmids are transduced as linear multimers that are formed and resolved by replicative processes. J Mol. Biol. 192 : 209 220 Nystrom T Alvertson N.H ., Flardh, K Kjelleberg, S. (1990). Physiological and molecular adaptation to starvation and recovery from starvation by the marine Vibrio sp. S14. FEMS Microbial. Ecol. 74: 129-140 Ogunseitan O.A Sayler G.S., Miller, R.V (1990). Dynamic interactions of Pseudomonas aeruginosa and bacteriophage in lake water Microb. Ecol. 19 : 171185 Ogunseitan, O A ., Sayler, G S., Miller R.V. (1992) Application of DNA probes to analysis of bacteriophage distribution patterns in the environment. Appl. Environ. Microbial. 58: 2046-2052 O'Morchoe, S Ogunseitan, 0., Sayler, G S. Miller, R V. (1988) Conjugal transfer of R68.45 and FP5 between Pseudomonas aeruginosa in a natural freshwater environment. Appl. Environ Microbial. 54 : 1923-1929 42

PAGE 62

Paul, J. H Frischer M E Thurmond, J. T. (1991). Gene transfer in marine water column and sediment microcosms by natural plasmid transformation Appl. Environ Microbial 59 : 718-724 Paul, J. H ., Jiang S C., Rose J. B (1991 ). Concentration of viruses and dissolved DNA from aquatic environments by vortex flow filtration. Appl. Environ Microbial. 57: 2107-2204 Paul, J. H Rose, J B ., Jiang S C ., Kellogg C A. Dickson, L. (1993) Distribution of viral abundance in the reef environment of Key Largo, Florida Appl. Environ Microbial. 59: 718-724. Proctor L. M. Fuhrman, J A. (1990) Viral mortality of marme bacteria and cyanobacteria Nature 343: 60-62 Ptashne, M. (1986). A genetic switch: Gene control and phage A.. Cell pre ss and Blakwell Scientific Publications. Palo Alto Calif. Raya R. R., Klaenhammer R (1992) High-frequency plasmid transduction by Lactoba c illus gasseri bacteriophage Madh Appl. Environ. Microbial. 58: 187193 Readman, J. W ., Mantoura R. F C., R.head, M M ., Brown, L. (1982) Aquatic distribution and Heterotrophic degradation of polycyclic aromatic hydrocarbons (PAH) in the Tamar Estuary. Estuarin e Coastal and Shelf Science 14 : 369-390 Replicon J., Miller, T. V (1984 ) Mode ling the potential for transduction to stabilize a foreign genotype within a established microbial community Abstra. VIII International Con Virol. p 117 Ripp S. Miller R.V. (1995). Effects of suspended particulates on the frequenc y of transduction among Pseudom onas a e rug i nosa in a freshw a ter environment Appl. Environ Microbial. 61: 1214-1219 Ripp S Ogunseitan, 0 A Miller R V. (1994) Transduction of a freshwater m i crobial community by a new Ps e udomonas aeruginosa generalized transducing phage UTI. Molecu l ar Ecology 3: 121-126 Rutberg L. Heden, C (1960) The activation of prophage in E. coli B b y high pressure Biochemical Biophysical Resear Comm 2 : 114 116 Saye K. J. Ogunseitan 0. Sayler G. S., Miller R. V (1987). Potential for transduction of plasmids in a natural freshw a ter environment: effect of plasmid donor 43

PAGE 63

concentration and a natural microbial community of transduction in Pseudomonas aeruginosa Appl. Environ. Microbial. 53: 987-995 Saye, D. J., Ogunseitan, 0., Sayler, G S., Miller, R.V (1990) Transduction of linked chromosomal genes between Pseudomonas aeruginosa strains during incubation in situ in a freshwater habitat. Appl. Environ. Microbiol. 56 : 140-145 Sandri R M Berger, H. (1980) Bacteriophage PI-mediated generalized transduction in Escherichia Coli: Fate of transduced DNA in Rec+ and RecArecipients Virology 106:14-29 Seeley N.D. Primrose, S. B. (1980) The effect oftemperature on the ecology of aquatic bacteriophages. J. Gen. Virol. 46 : 87-95 Schmidt C., Schmieger H (1984). Selective transduction of recombinant plasmids with cloned pac sites by Salmonella phage P22. Mol. Gen. Genet. 196 : 123-128 Schrader J. 0., Lufburrow M D., Kokjohn T A (1994) Effects of stress on the replication potential of bacteriophages 94th General Meeting of the American Society for Microbiology, Las Vegas. Abs. N213 Sherr E. B., Sherr E. B., Albright, L. J. (1987) Bacteria: Link or sink? Science 235:88 Shimodori, S Takeya, K., Takade A (1984) Lysogenicity and prophage type of the strains of Vibrio cholerae 0-1 isolated mainly from the natural environment. American J. of Epidemiology 120 : 759-768. Sieburth J MeN Johnson P W Hargraves P E (1988) Ultrastructure and ecology of Aureococcus anaphagefferens gen. et. sp. nov (Chrysophyceae): The dominant picoplankter during a bloom in Narrragansett Bay, Rhode Island summer 1985 J. Phycol. 24 : 416-425 Sik, T., Horvath, J., Chatterjee, S (1980) Generalized transduction m Rhi z obium meliloti Mol. Gen. Genet. 178; 511-516 Smith, H. W. (1972) Ampicillin resistance in Escherichia coli by phage infection Nature New Biol. 238: 205-206 Sonnen, H Schneider, J., Kutzner H. J. (1990) Characterization of an inducible phage particle from Brevibacteriumjlavum. J. General Microbiol. 136 : 567-571 Spencer R. (1955). A marine bacteriophage. Nature 175: 690 44

PAGE 64

Sternberg, N. L. Maurer, R. (1991). Bacteriophage-mediated generalized transduction in Escherichia coli and Salmonella typhimurium Methods in Enzymology. 204: 1943 Steward, G F., Wilmer, J., Smith D C., Cochlan, W.P., Azam, F. (1993a). Measurement of virus production in the sea: I. Method development. Mar. Microb Foodwebs. 6: 57-78. Steward, G.F., Wilmer, J., Cochlan, W P., Smith, D.C., Azam F., (1993b). Measurement of virus production in the sea: II Field results. Mar. Microb. Foodwebs. 6 : 79-90. Steward, G. F., Smith, D.C. Azam F. (1996). Abundance and production of bacteria and viruses in the Bering seas and Chukchi seas. Mar. Ecol. Pro. Ser 131: 287 -300 Stewart, G J Sinigalliano, C D. (1990) Detection of horizontal gene transfer by natural transformation in native and introduced species of bacteria in marine and synthetic environments Appl. Environ Microbiol. 58: 1818-1824 Stotzky, G. (1989). Gene transfer among bacteria in soil. In Gene transfer m the environment, S. B Levy, R V. Miller eds. Me Graw-Hill NY. p 165222 Suttle, C.A., Chen, F. (1992). Mechanisms and rates of deca y of marine viruses m seawater. Appl. Environ. Microbiol. 58: 3721-3729 Suttle, C. A Chan, A. M. Cottrell, M T. (1990) Infection of phytoplankton by viruses and reduction of primary productivity Nature 347: 467-469 Tapper M.A., Hicks, R. E (1994). Ultraviolet light and chemical induction oftemperate bacteriophage from a Great Lake ecosystem 94th General Meeting of the American Society for Microbiology Las Vegas Abs N211 Thingstad, T. F., Heldal M., Bratbak, G., Dunda, I. (1993). Are viruses important partners in pelagic food webs? Trends Ecol. Evol. 8: 209-213 Tolmach, L. J. (1957). Attachment and penetration of cells by viruses. Ad Virus Res. 4: 63-110 Torrella, F., Morita, R. Y (1979) Evidence by electron micrographs for a high incidence of bacteriophage particles in the waters of Y aquina Bay Oregon : ecological and taxonomical implications. Appl. Environ. Microbiol. 37: 774-778 Waterbury, J. B., Valois, F W. (1993) Resistance to co-occurring phages enables marine Synechococcus communities to coexist with cyanophages abundant in seawater. Appl. Environ Microbiol 59: 3393 -3399 45

PAGE 65

Weinbauer M.G., Fuks, D ., Puskaric, S. Peduzzi, P. (1993). Distribution of viruses and dissolved DNA along a coastal trophic gradient in the northern Adriatic sea. Appl. Environ. Microbiol. 59: 4074-4082 Weinbauer, M.G. Fuks, D ., Puskaric S ., Peduzzi, P (1995). Diel Seasonal and Depth related variability of viruses and dissolved DNA in the northern Adriatic sea. Microb. Ecol. 30: 25-41 Weinbauer, M. G., Peduzzi, P. (1995). Significance of viruses versus heterotrophic nanoflagellates for controlling bacterial abundance in the northern Adriatic sea. Journal of Plankton Research 17: 18511856 Wommack K.E ., Hill T T., Kessel M. Tussek Chohen E., Colwell, R R. (1992). Distribution of viruses in the Chesapeake Bay. Appl. Environ. Microbiol. 58: 2965-2970 Zachary, A. (1976) Physiology and ecology of bacteriophages in the marine bacterium Beneckea natrigens : salinity. Appl. Environ. Microbiol. 31: 415-422 ZeBell, C. (1946). Marine microbiology. Chron Bot. 1946: 82-83 Zeph, L. R., Onaga, M. A., Stotzky G (1988) Transduction of Escherichia coli by bacteriophage P 1 in soil. Appl. Environ. Microbiol. 54: 1731-173 7 Zinder, N. D. Lederberg J (1952). Genetic exchange in Salmonella. 1. Bacteriol. 64 : 679-699 46

PAGE 66

CHAPTER2 ABUNDANCE OF LYSOGENIC BACTERIA FOUND AMONG MARINE BACTERIAL ISOLATES FROM A VARIETY OF MARINE ENVIRONMENTS 2.1 Abstract The importance of lysogeny in marine microb i al populations is just beginning to be understood. To detect the abundance of lysogens in bacterial populations, we studied the occurrence of lysogenic bacteria among marine bacterial isolates from a variety of marine environments. One hundred sixtee n bacteria isolated on artificial seawater nutrient agar plates were tested for the presence of inducible prophage by mitom yc in C and UV radiation induction Induction was determined as a decrease in culture A600 absorbance after treatment with inducing agents. Samples in which optical density decreased or remained the same as when the inducing agent was added were further examined by transmission electron microscope for the presence of virus-like particles More than 40% of the bacterial isolates contained inducible prophage as determined by mitomycin C induction. A higher percentage of lysogenic bacteria was found in isolates from oligotrophic environments compared to coastal or estuarine environments. These studies 47

PAGE 67

suggest that lysogenic bacteria are one of the important components in marine microbial populations. 2.2 Introduction Viruses are recently recognized as an important component of marine microbial ecosystems. To determine the role of viruses in these systems, it is essential that we understand the virus-host interactions in the marine environment. Recent studies on marine viruses have largely focused on the lytic effect viruses have on marine microbial communities (Bratbak et al. 1992, Fuhrman & Suttle 1993, Weinbauer & Peduzzi 1995). However, it is equally important to understand the symbiotic interaction between viruses and bacteria and the process of lysogeny. Lysogenic bacteria are a group of bacteria which contain prophage inside their cells. Prophage either integrated into the host chromosomal DNA or existing as an autonomous plasmid, replicate with the host during cell division and are present in the progeny of the lysogenic parent bacterium Prophage protect bacterial hosts against lytic infections from similar types of phages at the mean time lysogenic hosts guarantee the presence of phage genomes in the future generations. This relationship between prophages and their hosts has been described as symbiotic (Ackermann & DuBow 1987). Lysogenic bacteria are found among all groups of bacteria including archaebacteria and cyanobacteria (Ackermann & DuBow 1987) A review of the literature by Ackermann and DuBow (1987) suggests that nearly 50% of 1200 bacteria strains 48

PAGE 68

contained inducible prophage. Lysogenic bacteria are found in fermentative bacteria (Huggins & Sandine 1977, Davidson et al. 1990, Cuesta et al. 1995), in soil bacteria (Ogunseitan et al. 1990, Abebe et al. 1992, Marsh & Wellington 1994), and in freshwater bacteria (Miller et al. 1991 ). Cuesta et al. (1995) studied the incidence of lysogeny among 172 Lactococcal strains. Lysis of 92 strains (53% of the strain tested) was observed after mitomycin C induction of cultures. Fifty one of these 92 strains released phages that were capable of propagation on indicator strains. Some temperate phages that were unable to form plaques of lysis appeared to be defective viral particles. Soil lysogens were found among the species of Badyrhizobium japonicum (Abebe et al. 1992) Rhizobium trifolii (Takahashi & Quadling 1961) and Pseudomonas aeruginosa (Ogunseitan et al. 1991 ) Marsh and Wellington (1994) suggested that lysogenic relationships were favored in the soil environment because of the close contact and less mobilization of microbial populations in soil. The occurrence of lysogenic Pseudomonas in a freshwater lake was studied by Ogunseitan et al. (1990 1992) using DNA probes made from Pseudomonas phage DNA. Colony hybridization with the phage DNA probe detected lysogens in up to 70% of the Pseudomonas isolates from the lake One to 7% of Pseudomonas isolates produced plaques on sensitive indicator strains by cocultivation (Miller et al. 1991). Little is known about lysogeny in the marine environment. Since lysogenic bacteria are found to have a competitive advantage over their non-lysogenic counterparts under nutrient-limited conditions (Levin & Lenski 1983) it has been hypothesized that 49

PAGE 69

lysogens should be favored in the marine environment where nutrient levels are generall y low (Freifelder 1987) Kokjohn et al. (1991) suggested that the high numbers of lytic viruses isolated from aquatic environments are artifacts of nutrient enriched isolation methods, and that temperate phages and lysogenic bacteria are more common in these environments Waterbury and Valois (1993) found that many marine c y anobacteria Synechococcus strains were resistant to phages isolated from the same environment This resistance may have been caused by superinfection immunity by the lysogens However the presence of lysogens among those cyanobacter i a isolates was not examined In a previous study we have examined the occurrence of lysogenic bacteria among marine bacterial isolates by mitomycin C induction (Jiang & Paul1994) The preliminary results showed that 43% of the bacterial isolates contain inducible prophage Here we have expanded our collection of marine bacterial isolates for lysogeny testing with samples collected from both the Atlantic Ocean and the Pacific Ocean 2.3 Material and Methods 2.3.1 Sampling Sites Water samples were collected with acid washed carboys from coastal eutrophic environments of the St. Petersburg Pier and Northshore Beach, Tampa Bay and Po i nt Largo Canal of Key Largo, and oligotrophic reef environments of the Florida Keys Florida. Water samples were also taken by Niskin bottles from offshore oligotrophic 50

PAGE 70

stations of the southeastern Gulf of Mexico during research cruises on the R!V Pelican in 1993 and 1994. Water samples were collected by a small boat from Pearl Harbor Honolulu, Sand Island Outfall, Mamala Bay, Hawaii, and the oligotrophic Pacific Ocean off the coast of Diamond Head Oahu Hawaii All samples were processed within 24 hours for bacterial isolation. 2.3.2 Isolation of Bacteria Marine bacteria were isolated either directly from water samples or from samples concentrated by a Membrex Vortex Flow Filtration system (Jiang et al. 1992). One hundred Ill of each water sample was plated on artificial seawater nutrient agar plates (ASWJP) containing 5g!L peptone and lg/L yeast extract (Paul 1982) Plates were incubated at 28C for 18 to 36 hours Individual colonies were picked and reisolated three times by consecutive streaking on artificial s eawater nutrient plates The final isolate was grown in ASWJP nutrient broth for prophage induction assay or stored in 50% glycerin at -80C for future testing. 2.3.3 Prophage Induction of Marine Lysogenic Bacteria by Mitomycin C Each marine bacterial isolate was grown to log-phase (A600::::: 0.6 to 0.8) in 10 ml of artificial seawater nutrient medium at 28C with shaking. Freshly prepared mitom y cin C (0 5 mg / ml in deionized water; Sigma Chemical Co.) was added to the bacterial culture 51

PAGE 71

to a final concentration of 0 5 !J.gl ml. The culture was further incubated and A600 monitored every 2 hour for the first 6 hours and then finally overnight (18 22hr) Cultures in which the optical density decreased or remained the same as when mitomycin C was added were centrifuged at 8000 rpm (5854 x g SS-34 rotor Sorvall, Inc.) for 5 min and the supernatant collected for detection of virus-like particles by transmission electron microscope (TEM) using a Hitachi 500 TEM. Micr o photographs of v iral particles were taken at 50 000 to 100,000 X magnification 2.3.4 Prophage Induction of Marine Lysogenic Bacteria by UV Radiation A germicidal UV lamp (peak wavelength 254 nm NIS G 15T8 15W) was used as a source of UV radiation Five ml of each log phase bacterial culture was added to sterile plastic 100 mm diameter petri dishes spreading into a thin layer barely covering the bottom of dish The petri dish was placed 48 em dire c tly below the UV lamp The UV energy reading at this distance as measured by a lL 1400A photometer (American Ultraviolet Co ) wa s 464 mw/ cm2 A range of exposure times was tested to determine the optimal dosage of radiation for induction After radiation the culture was transferred to a 15 ml sterile tube for continued incubation Culture density was monitored over time a s for mitomycin C-induced samples Supernatants were examined under TEM for virus-like particles 52

PAGE 72

2.4 Results Over 100 bacteria were isolated on ASWJP nutrient medium from a variety of marine environments. Nearly half of the marine bacterial isolates were from eutrophic environments such as Tampa Bay, Florida and Sand Island Outfall, Mamala Bay, Hawaii. The other half of the bacteria were isolated from oligotrophic marine environment such as the Gulf of Mexico and the Pacific Ocean off the coast of Oahu, Hawaii (Table 2 1 ). Most of the isolates formed white to cream colored colonies of various morphologies while a few were pigmented (yellow or purple). However those isolates forming purple colonies did not grow well in liquid medium and they were unable t o be recovered from frozen stocks Most of the isolates were fast growing in nutrient rich medium reaching log phase in 2 to 6 hours Thirteen isolates were sent to MicrobiallD, Inc. (MIDI Newark DE) for identification by fatty acid analysis. Less than half matched the MIDI fatty acid profiles in their data bank The results of a typical prophage induction experiment are shown in Figures 2.1 A-C. Induction as indicated by the decrease of culture optical density compared to the control, occurred as early as two hours after the addition of mitomycin C (Figure 2 1A) In most samples induction was detected within 10 hours of treatment (Figure 2 .1B, C). The lowest culture A600 's were always found 20 hours after the addition of mitomycin C. However UV radiation treated samples recovered rapidly after the initial decrease in culture densities (see discussion) Although virus-like particles were found in some of the 53

PAGE 73

UV -treated samples, there was no difference in A600 between induced and control samples after overnight incubation in the light (Figure 2 1 B,C). A range of exposure times were used to test the efficiency of UV radiation for prophage induction in marine lysogenic bacterial isolates (Figure 2 2) All UV treated samples showed lower optical densities compared with the control samples two hours after the initial treatment, and the decrease continued until four hours after the treatment. Samples which received higher UV radiati on dosages showed lower initial culture densities, yet all samples recovered to normal culture density under light conditions (see discussion) Virus-like particles were found in UV radiation-treated samples which were also inducible by mitomycin C. The shortest exposure time was 10 seconds (data not shown). Figure 2 3 shows electron photomicrographs of viral particles found in the supernatants of induced marine bacterial cultures. Some samples contained complete tailed phages while others had broken phage tails and empty phage head like (Figure 2 3 E & F) The latter were possibly R type bacteriocins (Kageyama 1970) Judging from the numbers of viral particles observed by TEM in completely lysed cultures, the burst sizes ofthese marine lysogens were low However no systematic surve y ofthe burst sizes was performed in these samples 54

PAGE 74

2.5 c 2 .... VJ = ;:: Q. 0 1 = ao.5 A 0 5 10 15 20 25 Elapsed Time (hr) 2.5 -r------------------. c 2;; = -; 1.5 Q. 0 = --= u B 0.5 -!-----_,---r----r----r-------1 0 5 10 15 20 25 Elapsed Time (hr) MC (O.Suglml) -o-Control MC (O.Sug/ml) '*' UV (20 sec) -o-Control Figure 2 1 Culture optical density changes over time after mitomycin C or UV radiation induction as shown by representative lysogenic strains of marine bacterial isolates. Bacterium D1B-1 (A) was isolated from Ke'ehi Lagoon Oahu, Hawaii; P93 4Es-1 (B) was isolated from oligotrophic Gulf of Mexico during a research cruise on board RJV Pelican in 1993; P93 6W-1 (C) was isolated from Loggerhead Key, Dry Tortugas, Florida. 55

PAGE 75

15. fll = = CJ -.... 0 "" = .:: 0.5 = u c 0 5 10 15 20 25 Elapsed Time (hr) Figure 2.1 (Continued) 56 -D-MC (O.Su g / ml) )K UV (20 sec) -o--Contro l

PAGE 76

2.5 -.--------------------. E4s-l ----Q-UV (15 sec) e UV (25 sec) )K UV (35 sec) -{}Control 0.5 0 5 10 15 Elapsed Time (hr) Figure 2 2 Culture optical density changes over time after exposed to a range of dosages ofUV radiation as shown representative lysogenic marine bacterial isolate (E4s-1) from Pacific Ocean offshore Diamond Head Oahu Hawaii 57

PAGE 77

Table 2.1 shows the proportion of lysogenic bacteria among marine bacterial isolates as determined by mitomycin C prophage induction Among a total of 116 bacterial isolates tested, 47 isolates produced phage-like particles after induction suggesting that over 40% of the bacterial isolates from marine environments were lysogens. The percentage of lysogenic bacteria among bacterial isolates from different environments ranged from 25% to 62.5% The greatest percentage lysogens was found in bacterial i so lates from the oligotrophic Pacific Ocean off the coast of Diamond Head, Oahu, Hawaii The lowest percent lysogens were found amongst the bacterial isolates from the estuarine environments of Tampa Bay and Florida Keys. Table 2.1 Occurrence of Lysogenic Bacteria amongst Marine Bacterial Isolates as Determined by Mitomycin C Induction. Sampling Sites No. of Isolates No. ofLysogens % lysogens/Isol. Examined Florida, USA Tampa Bay, Estuarine 23 6 26.1% Florida Keys, Coastal 12 3 25% Eutrophic Zone Florida Keys Oligotrophic 26 15 57 .7% and Reef Environments Oligotrophic Southeastern 31 12 38.7% Gulf of Mexico Mamala Bay HI Sand Island Sewage Outfall 10 3 30% Pearl Harbor 6 3 50% Offshore Diamond Head 8 5 62.5% Total 116 47 40 .5% 58

PAGE 78

Figure 2.3 Phage-like particle s found in the supernatants of induced bacterial cultures. The bacteria were isolated from Gulf of Mexico (A), the Pacific Ocean off the coa s t of Diamond Head Oahu, Hawaii (B) Sand Island Out fall Mamala Bay Hawaii (C ) Gulf of Mexico (D) Offshore Sand Island Mamala Bay Hawaii (E & F). Scale bar repre s ent 1 00 nm in pictures unless indicated 59

PAGE 79

2.5 Discussion Mitomycin C and UV radiation are the most often used treatments for propha ge induction These treatment s are about equal in efficie ncy for induction, although they may not work for the same prophage (Ackermann & Smirnof 1978). Both mitom yc in C and UV radiation were tested for the induction of marine ly sogenic bacteria in thi s study (Figure 1 & 2). Both method s showed prophage induction in so me l ysog enic strains. However, only mitomycin C was used to screen majority of the bacterial isolates because this method is easier for detection of induction by changes in A600 (Figure 1 & 2). In UV radiation treated sam ples, only a portion of the lysogenic bacterial cultures may have been induced to produce phage particles because of self shading and the low penetrability of 254 nm radiation. In addition photore s tor a tion of UV radiation-treated ly sogens has also been known to occur (Jacob & Wollman 1953). Up to 85% of induced bacteria can recover after exposure to photorea ct ivating light (visible light; Jacob & Wollman 195 3). Thus, induction in UV-treated samples cannot be det e rmined by changes in culture optical density after 16-2 4 hr incubation because of the growth of une xposed cells and cells recovered b y photorestoration. Mitomycin C treated samples s howed direct evidence of induction by d ecreases in culture optical densiti es. Therefore mitomycin C i s mor e effic ient for use as an inducin g agent for the detection of marine lysog e nic bacteria. Among 116 bacteria isolates examined for the pre sence of proph age by mitomycin C induction 40.5% were t es t ed positive. This finding i s si milar to that 60

PAGE 80

reported in a review of lysogeny by Ackermann and DuBow which indicated that 47% of 1200 bacterial strains contained prophage. In this study, the percentage of lysogens ranged from 25% to 62.5% for bacterial isolates from different environments. The higher percentages of lysogens were found in the bacterial isolates from oligotrophic waters. This finding supports the theory that lysogens are more fit in the nutrient-limited conditions than their non-lysogenic counterparts (Edlin et al. 1975, 1977 Lin et al. 1976 Dykhuizen et al. 1978) The results of this study demonstrated a high incidence of lysogenic bacteri a among marine bacterial isolates suggesting the ecological and evolutionary significance of lysogenic bacteria in the marine environment. Lysogeny is a highly evolved condition (Levin & Lenski 1983 ) that requires coordinate expression of prophage and host genes (Chapter 1). The presence and abundance of lysogenic bacteria in the environment are the result of coevolution of viruses and their hosts In the marine environment where bacterial host densities are generally low and bacterial cells are believed in a starvation condition lysogenization may be a strategy for viruses to avoid degradation and to ensure perpetuation of their genes. The fitness of lysogens in the marine environment may also be caused by prophage conversions and homoimmunity (Chapter one). In addition lysogens were found to grow more rapidly in the nutrient-limited conditions (Edlin et al. 1975, 1977, Lin et al. 1976 Dykhuizen et al 1978) which may also contribute to the competitive advantage of lysogens in the marine environment. 61

PAGE 81

References Abebe, H. M Sadowsky, M. J., Kinkle, B. K., Schmidt, E. L (1992) Lysogeny in Bradyrhi z obium japonicum and its effect on soybean nodulation. Appl. Environ. Microbial. 58 : 3360-3366 Ackermann H W., DuBow, M S. (1987). Viruses of prokaryotes. Vol. 1. General Properties of bacteri ophages. CRC Press. Boca Raton. Ackermann, H W., Smirnoff, W. A. (1978) Recherches sur la lysogenic chez Bacillus thuringiensis et B Cereus Can J Microbiol. 24: 818-826 Bratbak G., Heldal M., Thingstad T. F., Riemann, B ., Haslund, 0 H (1992) Incorporation of viruses into the budget of microbial C-transfer. A first approach. Mar Ecol. Prog. Ser. 83: 273-280 Cuesta, P. Suarez J. E., Rodriguez, A. (1995) Incidence of lysogeny in wild Lactococcal strains J. Dairy Sci. 78: 998-1003 Davidson, B E., Powell I.B., Hillier, A.J. (1990) Temperate bacteriophages and lysogeny in lactic acid bacteria. FEMS Microbial. Rev. 87: 79-90 Dykhuizen D. Campbell, J. H Rolfe, B G (1978) The influences of a lambda prophage on the growth rate of Escherichia coli Microbial. 23: 99-113 Ed lin G ., Lin L. Bitner R (1977). Reproductive fitness ofP1, P2 and Mu l ysogens of Escherichia coli. J. Virology 21: 560-564 Edlin, G Lin, L. Kudrna, R. (1975). Lysogens of E. c oli reproduce more rapidly than non-lysogens Nature 255: 735-738 Freifelder, D. (1987). Molecular Biology. Jones and Bartlett, Inc Boston. Fuhrman, J. A., Suttle, C A (1993). Viruses in marine planktonic systems. Oceanography 6: 57-63 Huggins A.R., Sandine W E. (1977) Incidence and properties of temperate bacteriophages induced from lactic Str e ptococci. Appl. Environ. Microbial. 33: 184-191 Jacob, F. Wollman E L. (1953) Induction of phage development in lysogenic bacteria Cold Spring Harbor Symposia on Quantitative Biology. 18: 1 01-121 62

PAGE 82

Jiang S. C., Thurmond, J. M ., Pichard, S. L., Paul, J. H. (1992). Concentration of microbial populations from aquatic environments by Vortex Flow Filtration. Mar. Ecol. Prog. Ser. 80 : 101107 Jiang S.C., Paul, J. H (1994). Seasonal and diel abundance of viruses and occurrence of lysogenylbacteriocinogeny in the marine environment. Mar. Ecol. Prog. Ser. 104 : 163-172 Kageyama, M. (1970) Genetic mapping of a bactericinogenic factor in Pseudomonas aeruginosa 1. mapping of pyocin R2 factor by conjugation. J. Gen. Appl. Microbiol. 16: 523-530 Kokjohn, T. A., Sayler G.S., Miller, R. V. (1991) Attachment and replication of Pseudomonas aeruginosa bacteriophages under conditions simulating aquatic environments. J General Microbial. 137: 661-666 Levin, B. R., Lenski R. E. (1983). Coevolution in bacteria and their viruses and plasmids. p 99-1 27 in D J. Futuyma and M. Slatkin, eds. Coevolution. Sinaurer Sunderland, Mass. Lin, L., Bitner, R., Edlin, G. (1977). Increased reproductive fitness of Escherichia co li Lambda lysogens. J. Virology. 21: 554-559 Marsh P ., Wellington, E. M. H. (1994). Phage host interaction s in soil. FEMS Microbiol. Ecol. 15: 99-108 Miller R.V Ripp, S., Replicon, J. Ogunseitan, O.A., Kokjohn T. A. (1991) Viru s mediated gene transfer in freshwater environments. In: Gene transfer in the environment. Proceedin gs of third European meeting on Bacterial Genetics and Ecology (BAGEC0-3), 20-22 Nov. 1991 eds Michael J. Gauthier. Villefranche Sur-Mer, France. Ogunseitan, O.A., Sayler G S., Miller R.V. (1990). Dynamic interaction s of Pseudomonas aeruginosa and bacteriopha ge in lake water. Microb. Ecol. 19: 171185 Ogun sei tan O.A., Sayler, G.S., Miller R.V. ( 199 2). Application of DNA probes to analysis of bacteriophage distribution patterns in the environment. Appl. Environ. Microbiol. 58: 2046-2052 Paul, J. H. (1982). The use of Hoechst dye s 33258 and 33342 for the enumeration of attached and pelagic bacteria. Appl. E nviron. Microbiol. 4 3: 939-949 63

PAGE 83

Takahashi, I. Quadling, C. (1961) Lysogeny in Rhizobium trifolii Can J. Microbial. 7 : 455-465 Waterbury, J B., Valois F.W. (1993) Re s istance to co-occurring phages enables marine Synechoco c cus communities to coex i st with cyanophages abundant in s e awater. Appl. Environ. Microbial. 59: 3393-3399 Weinbauer, M G Peduzzi, P (1995) Significance of viruses versus heterotrophic nanoflagellates for controlling bacterial abundance in the Northern Adriatic sea Journal of Plankton Research 17 : 1851-1856 64

PAGE 84

CHAPTER3 OCCURRENCE OF LYSOGENIC BACTERIA IN MARINE MICROBIAL COMMUNITIES AS DETERMINED BY PROPHAGE INDUCTION* 3.1 Abstract Viruses are abundant and dynamic members of the marine microbial community, and it is important to understand their role in the ecology of natural microbial populations. We have previously found lysogenic bacteria to be a significant proportion (43%) of the cultivatable heterotrophic microbial population. As the majority of the marine bacteria are as yet uncultivatable, we have measured the proportion of marine lysogenic bacteria in natural communities by prophage induction. Mitomycin C UV radiation, sunlight, temperature, and pressure were used to induce prophage in lysogenic bacteria from estuarine, coastal and oligotrophic offshore environments. To determine if hydrocarbon pollutants may cause the induction of marine lysogens, aromatic and aliphatic hydrocarbons (including Bunker C #6 fuel oil, phenanthrene naphthalene, pyrene, and trichloroethylene) were also used as inducing agents Induction was most often found in estuarine environments, where viral direct counts increased from 128 .8% 65

PAGE 85

to 345% of the uninduced control, resulting in mortality of 10.5% to 67.3% (Av 34%) of the bacterial population. Up to 38 % of the bacterial population was lysogenized in estuarine environments as calculated from an average burst size. Microbial populations from oligotrophic offshore environments were inducible at 3 of 11 stations sampled. Eight of the 11 samples (73 %) treated with poly aromatic hydrocarbons resulted in prophage induction in natural populations. Time series analysis was also conducted in two samples induced by mitomycin C from the Atlantic Ocean near the coast of North Carolina For both samples significant decreases in bacterial numbers were detected in treated samples after 8hr of incubation. A significant increase of viruses was detected at 8 hr at one station and at 24 hr at the other station after induction. This study indicates that natural lysogenic populations are sensitive to a variety of inducing agents, and induction occurs more frequently in coastal and estuarine environments than offshore environments 3 2 Introduction Lysogens are bacteria that contain a silent viral genome. The viral DNA is termed a prophage and replicates during host cell division. The prophage can become active spontaneously to vegetative replication and produce viral particles or can be induced to lytic viral production by chemical, physical and other agents (Ackermann & DuBow 1987) In the marine environment lysogeny may be one of the strategies for viruses to survive periods of low host density and/or nutrient depletion (Freifelder 1987). On the 66

PAGE 86

other hand, lysogeny has been shown to benefit the host for a variety of reasons including homoimmunity, conversion by phage genomes and increased general fitnes s (Levin & Lenski 1983) Viruses are the most abundant microorganisms in the oceans The density of viruses ranges from 1 o4 particles / ml in oligotrophic and deep sea environments to over 108 particles /ml in estuarine and coastal environments (Bmsheim 1993 Fuhrman & Suttle 1994 Weinbauer et al. 1995) Recent studies suggest that viruses are dynamic members of the microbial community and that they play an important role in controlling bacteria and phytoplankton mortality in the ocean (Fuhrman & Suttle 1994 Fuhrman & Noble 1995, Wei nbauer & Peduzzi 1995 Cottrell & Suttle 1995) However many of the s e studies also indicated some degree of uncertainty on the viral contribution to carbon flow in the microbial loop ecosystem, in some cases overestimating the virus-induced mortality of microbial populations (Bratbak et al. 1992). Many scientists suggest that in the marine environment, the final fate of viral infection may be lysogenization rather than lysis (Bratbak et al. 1990, 1992, Heldal & Bratbak 1991 Thingstad et al. 1993 ). A study of viral production and bacter ial mortality in microcosms suggested that lytic viral production was the major means of viral regeneration and bacterial mortality rather than prophage induction in lysogens (Wilcox & Fuhrman 1994) However these results do not conflict with the hypothesis that many bacteria in the marine environment may be lysogenic and therefore homoimmune (ie resistant to lytic viral infection) In a previous study we have demonstrated that 43% of the marine bacterial isolates examined were inducible by mitomycin C (Jiang & Paul 1994) Since less than 67

PAGE 87

1% of marine bacteria are cultivatable on conventional media, these results may not be representative of the lysogenic population in natural communities of marine bacteria Moreover, previous studies on marine (Jiang & Paul 1994) and freshwater (Tapper & Hicks 1994) lysogens only used artificial inducing agents, such as mitomycin C and UV radiation ( < 300nm), neither of which are found in the marine environment. The environmental factors which cause prophage induction in the marine environment are unknown. Here we report the induction of indigenous lysogenic bacteria from a variety of marine environments using mitomycin C, UV radiation sunlight temperature pressure and aromat i c and aliphatic hydrocarbons as inducing agents 3.3 Material and Methods 3.3.1 Sampling Sites Wate r samples were collected during two research crui s e s : in Gu l f of Mexico during June 1994, on the RN Pelican and in the Atlantic Ocean during July 1995 on th e RN Cape Hatteras. Station locations for the Pelican and the Cape Hatteras cruises are indicated in Figure 3.1A & 1B, respectively. Subsurface and deep water samples were taken with 2 0-liter Niskin bottles and surface water s were collected by pumping dir e ctly into acid-wa s hed 20-liter carboys. All samples were proces s ed immediately Water samples from Mamala Bay Oahu Hawaii were also used for this study Samples were taken from Pearl Harbor outside the mouth of Pearl Harbor offshore of Ala Wai Canal 68

PAGE 88

and offshore of Diamond Head Samples were processed at the University of Hawaii within 3 hours of sampling. 3.3.2 Induction of Lysogenic Bacteria by Chemical and Physical Inducing Agents For each water sample 10 to 100 liters was concentrated by a Membrex Vortex Flow filtration system to final volume of 40 to 60 ml as previously described (Paul et al. 1991 Jiang et al. 1992). The concentrated samples were subdivided and treated either by adding mitomycin C (1 exposing to 254 nm wavelength UV radiation (NIS G15T8 15W germicidal light) for 30 second (14.76mJ / cm2) in a sterile petri-dish (5ml/dish); exposing to sunlight for 15 min in a petri-dish on the deck with or without UV blocking (Commercial Plastic Co Clearwater, FL) subjecting to increased temperature or pressure, or left untreated (control). Except for the Gulf of Mexico St. 4' and St. 9' samples, temperature experiments were conducted by exposing 5ml Membrex concentrated samples to 30 C, 37 C or 42 oc for 30 min, then incubating for 16 hours at 24 C The control was kept at 24 C For Gulf of Mexico St. 4' and St. 9' samples, freshly collected waters from 250 m subsurface (14 C) were left in a shady area on the deck overnight. The final temperature of the water sample was 30 C before concentration by Membrex the next morning. The control samples were kept at 1 0 C in a cold room Pressure experiments were performed by lowering the Membrex-concentrated sample in sealed, screw-cap microfuge tubes to between 827 and 2000 m depth and maintaining in that environment for at least 30 min All samples were incubated for 16-24 69

PAGE 89

hr, fixed with 2% glutaraldehyde, and stored at 4 C for bacterial direct counts (BDC) and viral direct counts (VDC) Samples which had significantly increased viral direct counts and significantly decreased bacteria direct counts were considered lysogenic inductions 3.3.3 Induction of Lysogenic Bacteria by Aromatic and Aliphatic Hydrocarbons Membrex concentrated oligotrophic offshore samples from Atlantic Ocean and unconcentrated nearshore station water samples from the coast of North Carolina were used for this study Bunker C #6 fuel oil (Texaco Inc.), phenanthrene, naphthalene and pyrene (Chern Service, West Chester, PA.) were each dissolved in hexane (Fisher Chemical, Pittsburg, P A) to make a stock solution. The organic solvent was then evaporated in the fume hood after the desired amount of chemical was added to clean amber glass bottles leaving only chemicals in the bottle Water samples collected from different stations were added to the chemical-containing amber bottles on the cruise Each sample contained 50 naphthalene, phenanthrene or pyrene, or 100 Bunker C #6 fuel oil. However, the effective concentration based on solubility at 25 C and 35 %o salinity was 22.5 Jlg/ ml and 0.72 11g/ml for naphthalene and phenanthrene, respectively (Eganhouse & Calder 1976). The solubility of pyrene at 25C and 35 %o salinity was calculated to be 0.08 Jlg/ml, based on its solubility at O%o salinity (May & Wasik, 1978) Solubility for Bunker C #6 fuel oil in seawater was unknown. Trichloroethylene (a liquid solution) was added to the water sample for a final concentration of 4% v/v All samples were well mixed and incubated in the dark for 24 hr before fixing with glutaraldehyde 70

PAGE 90

3.3.4 Induction Time Series A final concentration of 1 f..Lg/ ml mitomycin C was added to a 500 ml water sample in a plastic one-liter flask. A replicate flask without mitomycin C was used as control. Both flasks were incubated in the dark. Forty ml of each sample was taken each time from both flasks at Ohr, 4hr, 8hr and 24hr The samples were fixed for viral direct counts and bacterial counts. 3.3.5 Viral Direct Counts and Bacterial Direct Counts Viral direct counts for Membrex concentrated water samples were performed as previously described by Paul et al.(1991), except a new Hitachi 7100 transmission electron microscope (TEM) was used. Viral numbers in unconcentrated water samples were enumerated by the ultracentrifugation method of Bergh et al. (1989) Two grids of each sample were prepared. Virus-like particles were counted in two windows (opening on the grid) from each grid and 30 randomly selected fields in each window at 50 000 times magnification directly from the TEM screen Photomicrographs of bacteria containing mature phage were taken at magnification of 30,000 to 60,000 times. 71

PAGE 91

A ) n autical m iles 28 0 50 oo k i lometers /;:v 0 50 100 Bay 2 r 3. z Q) -g 26 4&4' GULF -OF :p ro MEXICO _J 25- 7 b S c DT M ., 9 & 9' K W 24 -85 84 83 82 8 1 Longi t ude W z Q) "'0 35 ::l -:p ro _J 80 8 naut ical miles = 0 100 kilometers 0 100 6 1 75 70 L o n g i tude W ATLAN T IC OCEAN 6 x 0 BERMUD P Figure 3 .1. Sampling locations A) Gu l f of Mexico during June 1994 B BH: Bayboro Harbor ; CH: Charlotte Harbor; DT: Jefferson Mote Dry Tortugas; M: Marquesas ; KW: Key West Harbor; B) Atlantic Ocean during July 1995

PAGE 92

Membrex concentrated samples were diluted with 0.2 J..lm filtered artificial seawater for bacterial direct counts by epifluorescent microscopy (Paul 1982). Bacterial direct counts were also performed with a TEM at 10, 000 times magnification for unconcentrated samples using the same grid for viral direct counts 3.3.6 Statistical Analyses Multi-sample comparison by analysis of variance and two-sample comparison by t-test were performed using Statgraphics software (Manugistics Inc Rockville, Maryland), and further comparison between control and each treatment was performed using Dunnett's test (Zar 1984) Statistical comparisons for VDC were generated from the average of four grid-windows counts of each sample Statistical comparisons for BDC were generated from three replicate slides of each sample. 3.4 Results 3.4.1 Induction of Lysogenic Bacteria from Marine Environments Figure 3 2 and Table 3.1 show the results of the induction of indigenous lysogenic bacteria from eutrophic estuarine environments Mitomycin C, UV radiation elevated temperature and sunlight were tested as inducing agents Five of seven environments sampled showed a significant increase in VDC in response to one or more inducing 73

PAGE 93

agents. VDC in the induced samples ranged from 128.8 to 345 8% of the control samples Most samples that showed a significant increase in VDC, also showed significant decreases of BDC (61.5% to 89. 5% of the controls). Our criterion for induction was a significant increase in VDC concomitant with a s ignificant decrease in BDC. The sixth and the seventh samples (Key West Harbor and Pearl Harbor) showed increases in VDC (140% -17 0%) that were not statistically significant owing to variabi l ity in VDC even though decreases in BDC were noted The effect of sunlight on the microbial community varied, including no significant effect on the Gulf of Mexico St. 1 sample, increases in both VDC and BDC in the Marquesas sample, and decreases in both VDC and BDC in the Fort Jefferson Mote, Dry Tortugas sample. Increasing temperature from 24C to 42 C for 30 min also caused the induction of viruses (242% of the control) and decreases in BDC (58.4% of the control) in a Bayboro Harbor sample. Assuming the increased viral numbers and decreased bacteria in the induced samples were solely caused by lysogenic induction from 10.5 to 41.6 % of the bacteria in these samp le s were inducible lysogens The estimated burst size for lysogenic bacteria in these samples calculated by dividing increased VDC by decreased BDC ( VDC/ BDC), ranged from 1.7 to 30. The second approach for estimating % of lysogens in bacterial communities is to assume an average burst size and calculate the number of l ysoge n s by dividing increased viruses with the burst size. From 11 randomly taken pictures of bacteria containing mature phage we have determined that l ysoge nic induction burst sizes ranged from 6 to 142 averaging 38.3. Since this data was generated from a relatively small sample size 74

PAGE 94

and because we did not conduct a systematic study of burst size by TEM examination, we also took into consideration of burst sizes from lysogenic induction of natural population s by other researchers (Weinbauer & Suttle, personal communication) The average burst size from this communication and our own data was 30. The percentage of lysogenic bacteria calculated by this average burst size ranged from 2 to 38% in estuarine environment s Table 3.1 Induction oflndigenous Lysogenic Bacteria from Eutrophic Estuarine Environments by Chemical and Physical Inducing Agents. Sample VDC BDC % Lysogens based on (Virus/ml or (Bacteria/ml or Bact. Bur st % of Control) % of Control) Mortality Size (30) Bax.bor Q Har.bQr, Tampa Bax Control 1.45 0.39x1o7 3.90.52x1o6 MitomycinC 184.2% (S)a 75.9% (S) 24.1 10.4 uv light 128 8% (S) 84.6% (S) 15.4 3.5 42 C, 30min 242.5%(S) 58.4% (S) 41.6 17.7 Gulf QfMexicQ St. 1 82 43') Control 1.84 0.24x107 3.00.05x106 Mitomycin .C 165% (S) 64%(S) 36 13.3 uv light 286% (S) 61.5% (S) 38.5 38.0 Sunli ght 132% (I) 123% (S) NAb NA Kex West, FlQrida Control 2. 7.84x 1 o6 8.11.35x1 o5 Mitomycin .C 242.8%(S) 66.6% (S) 33.4 15.8 uv light 345 8%(S) 72.6% (S) 27 .4 27.3 Sunlight 597.8%(S) 379.8%(S) NA NA Kex West Har.bQr, FlQrida Control 4.13.7x1o6 7 09 .33x 1o5 Mitomycin .C 154.2 %(!) 84.5% (S) NA NA uv light 1 70.2%(!) 72.1% (S) NA NA (Continued on Next Page) 75

PAGE 95

Table 3.1 (Continued) Sample VDC (Virus / ml or % of Control) Fort Jefferson Mote. Dry Tortufias. Florida Control 1.15 .27x 107 Mitomycin .C 197.4%(S) UV light 154.8 %(S) Sunlight 39 .7% (S) Pearl Harbor Hawaii Control Mitomycin .C 1.24.24x1 o6 140.3 % (I) Mouth of Pearl Harbor. Hawaii Control 7.36.92x105 Mitomycin .C 21 7. 7% (S) BDC (Bacteria/ml or % of Contro l ) 2.67.2x1o6 81.3% (S) 89.5% (S) 31.4% (S) 1.9.2x1o6 62.6% (S) 1.47 .06x106 65.3% (S) % Lysogens ba se d on Bact. Burst Mortality Size(30) 18.7 10.5 NA NA 34.7 14.0 7.9 NA NA 2 astatistical analysis, (S) indicates statistic significance at 95 % confidence; (I) indicates in significance at 95% confidence. bNA : not applicable 76

PAGE 96

0 VDC BDC Figure 3.2. Induction of natural communities of marine l ysoge ns by mitomycin C, UV radiation, temperature and sunlight in samples collected from (A) Bayboro Harbor, Tampa Bay FL. and (B) collected from Fort Jefferson Mote, Dry Tortugas, FL. Error bars for VDC were generated from the average counts of each of 4 windows in 2 replicate grids; for BDC were generated from counts from three replicate slides. 77

PAGE 97

The results of induction of lysogenic bacteria from marine coastal environments are shown in Table 3.2. Of the 4 samples tested, only the sample from Atlantic St. 2 showed induction in VDC (269.8% of the control) and a significant decrease in BDC (73.5% of the control) after an elevated temperature treatment. Slight viral increases were also found in the UV -treated offshore Charlotte Harbor sample and pressure-treated Atlantic St. 5 sample, yet these were not significant when statistically compared with the control. Statistically significant decreases of BDC were detected in nearly all treated samples, except for the Atlantic sample subjected to the increased pressure. Compared with the samples from estuarine environments, the number of inducible lysogens in oligotrophic offshore environments was significantly lower (Table 3 3) Samples collected from 11 stations were tested using mitomycin C UV radiation, natural sunlight temperature and pressure as inducing agents. Only 2 samples from Gulf of Mexico St. 7b and Atlantic St. 6.1, showed significant increase in VDC and decrease in BDC numbers after induction by UV radiation or mitomycin C respectively Significant increases in VDC were also found in the pressure-treated Gulf of Mexico St. 9 sample and the UV -treated Atlantic St. 6x sample, yet no significant changes in BDC could be detected. Increases in VDC were also found in the mitomycin C-treated Gulf of Mexico St. 4 sample, and the UV -treated and temperature-treated Gulf of Mexico St. 9' samples However, these increases were not statistically significant. Using a UV -blocking plastic cover to filter out UV radiation from the natural sunlight did not make a difference in BDC or VDC compared to the sample with a UV transparent cover. Pressure experiments 78

PAGE 98

were performed twice, at Gulf of Mexico St. 4 and Gulf of Mexico St. 9. In both experiments, there were increases in VDC, but no significant changes in BDC. Table 3. 2 Induction oflndigenous Lysogenic Bacteria from Marine Coastal Environments by Chemical and Physical Inducing Agents. Sample VDC (Virus/ml or % of Control) BDC Bacterialrnl or % of Control) % Lysogens based on Charlotte Harbor. offshore. Florida Control 1.06 31x1 o6 Mitomycin .C 75.9% (I)a uv light 11 7. 9%(I) Atlantic St. 2 (35.25'. 75.5') Control 2.62.54x1 o5 Temperature 30 C,30min 37 C,30min 42 C,30min 269.8%(S) 178.6%(!) 198 1 %(1) Atlantic St. 5 (36'. 75 ') Control 2.35.47x106 Pressure 122 .6%(!) (2000m,30min) Ala Wai Canal offshore. Hawaii Control 9.15.66x104 Mitomycin .C 77 .6% (I) 3.25.33x1 o5 77.8% (S) 75.9% (S) 9.69.60x1 o5 73. 5%(S) 76.4%(S) 68.3%(S) 8.20.50x105 100% (I) 3.75.3x105 54.1% (S) Bacterial Mortality 26 5 NA NA NA NA Av. Burst Size (30) NA NA 1.5 NA NA NA NA astatistical analysis, (S) indicates statistic significance at 95% confidence ; (I) indicates insignificance at 95% confidence. bNA: not applicable 79

PAGE 99

Table 3 3 Induction oflndigenous Lysogenic Bacteria from Oligotrophic Offshore Environments by Chemical and Physical Inducing Agents Sample VDC BDC % Lysogens based on (Virus /ml or (Bacteria/ml or ------------------------%of Control) % of Control) Bacterial Av. Mortality Burst Size (30) Gulf Qf St. 3 (27 Q4'/ 83 18') Control 1.78.66x105 3.69.2x1o5 Mitomycin .C. 139% (l)a 78.3% (S) NAb NA Gylf QfMexico St. 4 (25 38.63',845 63') Control 1. 86 1.24 x 1 o5 3.53.13x105 Mitomycin .C. 59.1%(1) 28 6 % (S) NA NA uv light 73.7% (I) 38 5 % (S) NA NA Sunlight 34.9% (S) 39 7% (S) NA NA Pressure 142.5% (I) 103.1% (I) NA NA (827m ,30min) St. 4', 25Qm (258 .6 3', 84.63') Control 2.06 17xl o4 2 2.04xio4 Temperature 3 0 C, Overnight 71.3 % (I) 91.8 % (I) NA NA Gulf QfMexico St. 5c, Deep 15QQm, (24', 85 32') Control 8.29 7.18x103 1.21.15x 1 o4 Mitomycin C 87 .5% (I) 25% (S) NA NA uv light 52.4% (I) 36.4% (S) NA NA Sunlight 102% (I) 56.6% (S) NA NA GulfQfMexicQ St. 7b, a Max (25 Q4', 84') Control 7.3.96x104 1.04.02x105 Mitomycin C 194 5%(S) 101 %(1) NA NA uv light 259% (S) 81.0% (S) 19 3 7 Sunlight 320% (S) 93. 3% (I) NA NA (Continued on Next Page ) 80

PAGE 100

Table 3.3 (Continued) Sample VDC (Virus / ml or % of Control) BDC (Bacteria/ml or % of Control) Gulf of Mexico St 9. Chlorophyll a Max (24 14'.83 38 8') Control 1.01.57x105 1.43.05x105 Mitomycin C 98.0% (I) 11.9 % (S) Sunlight 8.4% (S) 10.1% (S) Pressure 206 9% (S) 92. 3 % (I) (1014m 30rnin) Gulf of Mexico St. 9'. Subsurface 250m (24'. 83 8') Control 6 22 36x104 9.62. 22x103 UV light 153% (I) 74 9% (S) Temperature 30C, Overnight 150.3%(I) 278 6%(S) Atlantic St. 6x. Chlorophyll a Max (33'. 68 00') Control 4.98.08x105 1.95 .08x105 UV light 135.7%(S) 101.0%(1) Sunlight(UV block) 53 .2%(S) 91. 8%(I) (UV trans.) 62.2% ( S) 93.8%(I) Atlantic St. 6 .1. Chlorophyll a Max (31 o 11'. 70 18') Control 4.17.20xi05 2.20.10x1 o5 Mitomycin .C. 166 7%(S) 82. 7%(S) Atlantic St. 8 Chlorophyll a Max (33 59' 73 33') Control 9.06 2.43 x l05 2 84 0.23x105 UV light 97%(I) 78.2%(S) Sunlight(UV block) 55. 2%(I) 76.8%(S) (UVtrans ) 69.4%(1) 71.1%(S) Offshore of Diamond Head. Oahu. Hawaii Control 6 .51 2 39x104 Mitomycin .C 75. 3% (I) 3 01.3x106 73.3% (I) % Lysogens base on Bact. Burst Mortality Si z e(30) NA NA NA NA NA NA NA NA 17.3 NA NA NA NA NA NA NA NA NA NA NA NA 4 2 NA NA NA NA astatistical analysis (S) indicates statistic significance at 95% confidence ; (I) indicates insignificance at 95% confidence bNA: not a pplicable 81

PAGE 101

Aliphatic and aromatic hydrocarbons, including Bunker C #6 fuel oil, phenanthrene, naphthalene, pyrene and trichloroethylene, were used to induce lysogenic bacteria in samples from the Atlantic Ocean in both Membrex-concentrated and unconcentrated samples (Figure 3.3 and Table 3.4) No prophage induction could be detected in any of the samples treated by Bunker C #6 fuel oil. However phenanthrene, naphthalene and pyrene showed significant induction (ie. increases in VDC and decreases in BDC) in 8 of the 11 samples treated with these chemicals VDC in the induced sam ples ranged from 160 to 254% of the controls. Trichloroethylene was found to induce lysogenic viral production in one of the 6 experiments performed. Figure 3.3 shows representative results for induced samples from Atlantic St. 1 and Atlantic St. 3. At both stations, increases in VDC were found in phenanthrene naphthalene, pyrene and trichloroethylene treated samples. Decreases in BDC were found in all treated samples. Among all samples from a variety of marine environments, from 13.2 to 78.3% of the bacterial population was killed by these xenobiotic pollutants. However, we can not separate viral l y si s caused by prophage induction from mortality caused by to xic ity (see discussion) The calculation of percentage of lysogen s based on the average bur st size suggests that only 2 6 to 7% of the total bacteria population in these environments are l ysoge n s Subtracting these numbers from the total mortality caused by inducing agent 9.5 to 75.2% of the bacteria mortality might be caused by the to x ic effect of these chemicals. 82

PAGE 102

Table 3 4 Induction oflndigenous Lysogenic Bacteria from a Variety of Marine Environments by Aromatic and Aliphatic Hydrocarbons. Sample VDC BDC % Lysogens based on (106 / ml or (106 / ml or ---------------------------% of Control) % of Control) Bacterial Av Mortality Bur s t Size (30) Estuarine Environment Atlantic St. 1 (34 35'. 76') Control 6 12.97 6.94 0.83 Bunker C 100 3 % (I)a 49.4 %( S) NAb NA Phenanthrene 220 6%(S) 34.4%(S) 65.6 3 5 Naphthalene 233.7%(S) 32.7%(S) 67.3 3.9 Trichloroethylene 154.6%(1) 22.5%(S) NA NA Coastal Environment Atlantic St. 3 (35.5 75 18') Control 5.26 64 5.99 07 Bunker C 32.3%(S) 54 8%(S) NA NA Naphthalene 214.4%(S) 60.4%(S) 39.6 3.3 Pyrene 218.4%(S) 40 9%(S) 59.1 3 5 Trichloroethylene 205.9%(S) 21.7%(S) 78 3 3.1 Atlantic St. 5 (36'.75 Q6') Control 3 07.48 6 04.19 Bunker C 65.0 %(1) 36 8%(S) NA NA Phenanthrene 132 9 %(1) 15.6%( S) NA NA Pyrene 254 1 %(S) 34 7 % (S) 65.3 2.6 Trichloroethylene 65.0%(1) 55. 6%(S) NA NA (Contin ued on Next Page) 83

PAGE 103

Table 3.4 (Continued) Sample VDC (Virus/ml or % of Control) Offshore Environment BDC (Bacterialml or % of Control) Induction in Membrex concentrated water sample Atlantic St. 6x Chlorophyll a Max. (33'.68') Control 0.5.1 0.2.01 Bunker C 53.0%(S) 103.6%(1) Trichloroethylene 41.2%(S) 81.5%(S) Atlantic St. 6.1 Chlorophyll a Max (31 '. 70') Control 0.42.12 0.22.01 Bunker C 126.1 %(1) 77 3%(S) Phenanthrene 160 7%(S) 86.8%(S) Naphthalene 158.8%(S) 86 8%(S) Pyrene 229 0%(S) 104 .5%(1) Trichloroethylene 51.6%(1) 45.0%(S) Atlantic St. 8, Chlorophyll a Max (33', 73') Control 0 91.24 0.28 .02 Bunker C 124.7%(1) 79.9%(S) Phenanthrene 166.7%(S) 75.0%(S) Pyrene 140.2%(1) 88.0%(S) Trichloroethylene 57 .2%(1) 51.1 %(S) % Lysogens based Bact. Burst Mortality Size(30) NA NA NA 13.2 13.2 NA NA NA 25 NA NA NA NA NA 3 9 3.7 NA NA NA 7.0 NA NA astatistical analysis (S) indicates statistic significance at 95% confidence ; (I) indicates insignificance at 95%. bNA: not applicable 84

PAGE 104

300 A Control II BunkerC El Phenanthrene = 200 "' > Naphthalene 0 "" Tricloroethylene = 0 u 0 100 Q Figure 3.3. Induction of natural communities of marine lysogens by aliphatic and aromatic hy d rocarbons A). Sam ple was collected from A tl antic s t ation 1 during the 1995 Cape Hatteras cruise. B). Sample was collecte d from Atlantic station 3 during the 1995 Cape Hatteras cru i se. Error bars were generated as in Figure 3.2. 8 5

PAGE 105

3.4.2 Induction Time Series The results of two time series studies for samples collected from Atlantic St. 1 and St. 5 are shown in Figure 3.4 and Figure 3 5 respectively. For the sample from Atlantic St. 1, an increase in VDC (from 2.9 x 106 to 4.0 x 106 / ml) was detected 24 hr after the addition of mitomycin C. VDC decreased in the control sample (from 2.6 X 1 o6 to 1.7 x 106 / ml) BDC started to decrease after 4 hrs of incubation in both the mitomycin C treated and control samples. The mitomycin C-treated samp l e had a significantly lower BDC than the control sample after 8 hr of incubation. No dramatic changes in BDC were found after 8 hours. At Atlantic St. 5, VDC increased significantly at 8 hrs after the addition of mitomycin C, from 2.6 x 106 / ml to 3.8 x 106 / ml, in the mitomycin C-treated sample. VDC decreased to 1.5 x1 o6 / ml in the control sample. A slight decrease of VDC from 8hr to 24 hr was detected in both treated and control samples, but neither were statistically significant. BDC decreased in both treated and control samp l es after 8 hr into the experiment. However the decrease in the mitomycin C-treated s ample was much more dramatic from 6.2 x 106 / ml to 2.8 x 106/ml. BDC in the treated sample were significantly lower than those in the control s ample after 8 hrs of incubation 86

PAGE 106

VDC Con t ro l --a-M C t r eate d I -12 -BDC Co ntrol 10 l -o---MC t r eat ed "" -00 0 -T e \C = u T Q = 20 4 8 12 16 20 24 28 Elapsed Time (hours) Figure 3.4. Time series sampling of mitomycin C-treated water sample and a control from the Atlantic station 1 Error bars were generated as in Figure 3 .2 87

PAGE 107

""" -00 a ...... \Q Q u > VDC Co ntrol 4--a-MC treated 3-2 T 1 BDC -DMC treated T T 0 4 8 1 2 16 20 24 28 Ela p sed T im e (hours) Fig ure 3.5. Time s eries s ampling of mitomycin C-trea ted water sample and a contro l from t he Atlantic s tation 5 Error bars we re generated as in Figure 3.2 88

PAGE 108

Table 3 5 summarizes data for the abundance of lysogens in a variety of marine environments The number of samples which indicated the presence of lysogens is based on the positive results of one or more induction methods in a sample. In eutrophic estuarine and coastal environments, 80 and 60%, respectively of the samples tested were positive for lysogens as indicated by prophage induction. Only 27% of the samples from oligotrophic offshore environments were induced by our criterion. However two of the 11 samples showed significant increases in phage numbers without decreases in bacterial density and therefore were not considered positive lysogens by our criteria. The percentage of lysogenic bacteria in natural bacterial communities as estimated by the difference in bacteria number between control and induced sample ranged from 10.5 67.3% (Av. 34%) in estuarine environments, 26.5 78.3% (Av. 54%) in coastal environments, and 13.2 25% (Av. 18%) in oligotrophic offshore environments. However these estimates were sig nificantly higher than those generated from the average bur st s ize (1.5 to 38% average 8.8%), suggesting an important portion of bacterial mortality may due to toxic effects of the inducing agent. The greatest toxic effects were always found in P AHs-induced samp les. Table 3.6 summarizes the efficiency of chemical and physical treatment s used for the induction of indigenous lysogens. P AH chemicals, including phenanthr ene naphthalene and pyrene were the most efficient agents (73%) for the induction of marine lysogens UV radiation and mitomycin C also had relatively high induction efficiencies (42% and 39%, r espec tively). Sunlight had no effect on the induction of marine lysogenic bacteria for all the samples te sted in this s tudy. Increa sed temperature caused 89

PAGE 109

induction in 2 of the 6 experiments, yet this efficiency is based on only a few samples tested by this method. Table 3. 5 Abundance of Lysogenic Bacteria in a Variety of Marine Environments Environment #of Samples #of Samples % Lysogens based on Tested Induced ---------------------------------------------Bacteria Mortality Burst Size (30) Eutrophic Estuarine 10 8 10 .5-67.3 2-38 Av. 34 Av. 13 Coastal 5 3 26.5-78.3 1.5 3.5 Av. 54 Av. 2.8 Oligotro. Offshore 11 3 13.2-25 2.5 -7 Av. 18 Av. 4.5 Total 26 14 10 .5-78.3 1.5 38 Av. 35 Av. 8.8 90

PAGE 110

Table 3. 6 Efficiency of Inducing Agents for the Induction of Indigenous Marine Lysogens. Inducing Agent # of Experiments # ofSamples % of Efficiency Performed Induced MitomycinC 18 7 39 UV radiation 12 5 42 Sunlight 9 0 0 Temperature 6 2 33 Pressure 3 0 0 P AH chemicals 11 8 73 Bunker C Fuel Oil 6 0 0 Trichloroethylene 6 1 17 3.5 Discussion A total of 26-stations from a diversity of marine environments were examined for the presence of inducible lysogens in this study Samples from 14 stations (53 8%) showed prophage induction by one or more of the methods employed (Table 3.5) We are not surprised to see that many of the samples failed to respond to an inducing agent because some of the inducing agents tested are only known to induce prophage from cultured lysogenic bacteria. These agents and/or the concentrations used may either kill 91

PAGE 111

the natural bacterial community before induction occurs or not be sufficient enough to cause the induction. Additionally, different strains of bacteria in the natural community may respond to these treatments very differently. It should also be noted that the detection of inducible l ysog ens in this study was based on a simultaneous statistically significant increase in VDC and decrease in BDC Other studies have only used an increase in VDC as an indication of prophage induction (Suttle, personal communication) This criterion would add two more environments (Gulf of Mexico St. 9 and Atlantic St. 6x) to our list of environments yielding a positive response. Therefore, criteria used in this study may underestimate the indigenous lysogenic population because induction may occur even when there are only small changes in total VDC and BDC or because the changes in VDC and BDC can not be detected by the stringent statistical t es ts A problem in these s tudies is the variability in VDC, which prevents statistical significance even when a numerically greater VDC i s encountered as a re s ult of induction. For example, 22 of 26 samples contained numerically greater VDC after induction. If our precision had been greater in VDC, these might all be significant. This is particularly a problem in offshore environments, where low viral abundance generates a greater standard deviation in TEM VDC. Thus we may have under es timated the number of environments yielding a positiv e response. In a previous study we have shown that about 43% of marine bacterial i so late s contained inducible prophage or bacteriocins when treated with mitomycin C (Jiang & Paul 1994). In the present study, the percentage of ly s ogens among the total indigenous bacteria varies over a wide range. The percentage of bacteria that were lysogenic for all 92

PAGE 112

positively induced samples ranged from 1.5 to 38% (average 8.8%) as determined by the average burst size. We have also attempted to estimate the proportion of lysogens by determining the bacterial mortality caused by inducing agents assuming all mortality was due to induced viral lysis. This method a yielded higher percentage of l ysogens than the average viral burst size method, particularly for coastal and offshore environments. The best agreement occurred for the estuarine environmental samples. There are problems with both these methods of estimating the percentage of the lysogenic populations. The direct measurement of decrease in bacterial counts assumes that this decrease is only the result of lysis by induced prophage after correcting from control samples for natural mortality (caused by lytic phage l ysis, grazing, and senescent cell death). This method ignored mortality caused by toxicity of the inducing agent. Yet all the inducing agents used in this study are mutagenic or DNA-damaging agents and may cause the mortality of indigenous bacteria without induction. The mortality caused by toxicity was particularly great for all xenobiotic hydrocarbons treated samples as well as for coastal and offshore samples induced by mitomycin C. The latter microbial populations are probably particularly sensitive to foreign chemicals and perhap s lower concentrations of inducing agents should have been used there. Moreover, bacteria might also be lysed by bacteriocins in the treated incubations without virus production. The toxicity of these inducing agent s to the non-lysogenic bacteria and the occurrenc e of bacteriocin induction may explain why % mortality in the induced samples were significantly higher than the number of induced l ysogens as determined by the average burst size 93

PAGE 113

Problems also existed when an average burst size was used for the estimation of the % lysogenic populations In our opinion, there is no good method for the determination of bacteriophage burst size in natural populations of marine bacteria The results obtained by counting electron dense particles inside bacteria under high voltage TEM tend to bias toward bacteria containing 6 or more electron dense particles and ignore those containing fewer particles. This method will also count aggregated viruses as bursting bacterial cells. Phage particles attached to the top surface of bacteria may also be counted as mature particles inside a cell. High burst sizes may lead to the underestimation of the presence of lysogens in bacterial communities In the study of marine bacterial isolates we found that the percentage of lysogenic bacterial isolates increased from nearshore environments to offshore environments (Jiang & Paul 1994 ). However this was not found for indigenous marine bacteria as very few induction s were observed in samples from oligotrophic offshore environments. There may be several explanations for this phenomenon: 1) indigenous bacteria in eutrophic estuarine environments may be more metabolically active than their counterparts in oligotrophic environments. Induction of propha ge in cultured bacteria is more efficient during the active exponential growth, because of the active replication and DNA repair mechanisms occurring during such growth (Ackermann & DuBow 1987). T herefore bacteria in eutrophic environments would be more likely to be induced. 2) bacteria in oligotrophic environments may be more sensitive to the toxicity of the inducing agents. Toxic molecules in estuarine environmental samples may be bound by DOM, detritu s and other suspended particles in the sample. Additionally estuarine bacteria are exposed to 94

PAGE 114

more pollutants and may be less sensitive to the toxic effects of the agents. Therefore, at the same final concentration of inducing agent, oligotrophic bacteria may be killed before induction occurs. Decreases in VDC and BDC were often found at the same time in treated oligotrophic samples. 3) VDC in the oligotrophic environments are about one order of magnitude lower than those in the estuarine environment, resulting in greater variability as described above. The efficiency of mitomycin C and UV radiation (254 run) as inducing agents in cultured lysogenic bacteria has been well documented (Ackermann & DuBow 1987). In this study, we showed that these were also efficient agents for the direct induction of indigenous marine lysogenic bacteria However these treatments will not occur naturally in the marine environment. Very little UV radiation at < 300 run wavelength occurs in the natural sunlight (Schrader et al. 1994 ). Sunlight could not induce indigenous lysogenic bacteria (Table 3.6). Prophage induction occurs when the host cell is subjected to mutagenic agents, DNA damaging agents, or stress conditions which trigger the "SOS" response in the bacterial cell thereby removing the prophage transcription repressor (Ackermann & DuBow 1987) To understand the environmental factors that may cause the prophage induction in the marine environment, we te s ted several agents and conditions which can be found in the marine environment including stress conditions such as elevated temperature and pressure and mutagenic agents such as aromatic and aliphatic hydrocarbons as inducing agents. Although all these treatments have been documented as inducing agents for cultured lysogenic bacteria (Ackermann & DuBow 1987) no work has been done on their ability to induce marine lysogens. In this study 95

PAGE 115

two of the six experiments performed with elevated temperature in different samples resulted in induction. Some phage are known to have temperature sensitive promoters. The prophage repressor protein is sensitive to temperatures of >40 C at which i t 's structure conformationally changes and no longer binds to the promoter (Bertani 1953, Birge 1994). These results suggests that short-term temperature increases may be one of the factors for lysogenic induction in the marine environment. Of the two temperatures employed, 30 o c and 42 C, the former occurs in surface waters in tropical and subtropical environments whereas the latter might be encountered in shallow tide pools in the tropics or near hydrothermal vents. Experiments with increased pressure were performed three times with coastal and oligotrophic water samples, and none showed lysogenic induction by our criteria. However no induction was detected in two samples even when mitomycin C was used suggesting that these samples had low levels of lysogens. More research is needed to understand the effect of pressure on the induction of indigenous lysogens in the marine environment. P AHs were found to be the most efficient inducing agents for the indigenous lysogenic bacteria (Table 6). This not surprising because P AHs are known carcinogens and mutagens, which cause induction of the "SOS" DNA repair response (Moreau et al. 1976). Thus environments which contain mutagenic pollutants may have a large degree of prophage induction occurring This result confirmed our original hypotheses that xenobiotic pollutants may be important agents in the induction of lysogenic bacteria in the marine environment. One may argue that Bunker C #6 fuel oil, which contains all the p AHs yet did not cause the induction of an y of the environmental samples, contradicts 96

PAGE 116

that logic. We think that the concentration of Bunker C #6 fuel oil added to the samples may have been too high, causing the mortality of microbial population before causing prophage induction. All the previous studies we have performed included incubations of 16 to 24 hr. Our time series analysis suggested that induction could be detected even after 4 hr with statistical significance after 8 hr incubation Further incubation may cause a decrease of both viruses and bacteria in the sample. Lysogeny may impart a competitive advantage to manne bacteria over non lysogens in the marine environment. Lysogens of E. coli have been shown to reproduce more rapidly than non-lysogens during aerobic growth in nutrient-limited chemostats (Edlin et al. 1975, 1977, Lin et al. 1977). The majority of the environments in the ocean are nutrient limited-environments, thus lysogens may be more fit than the corresponding non-lysogens in these environments Lysogens can also benefit from phage conversion, which is the expression of phenotype characters encoded by prophage. Prophage are known to encode the gene for antibiotic resistance (Smith, 1972), cytotoxin (Hayashi et al. 1990) and other virulence factors (Barondess & Beckwith 1990) These characters may increase the survival rate and competitive fitness of lysogens in the environment. The most basic phageconversion character is homo immunity, which protects the bacterium from lytic infection In the marine environment where viral abundance exceeds bacterial abundance by a factor of 10, homo immunity may have contributed significantly to the survival of lysogenic bacteria. 97

PAGE 117

In summary, lysogenic bacteria may be an important portion of the marine bacterial community Many important environmental factors including xenobiotic pollutants and sudden temperature changes may be inducing agents for natural lysogenic viral production in the marine environment. Whether such phage production contributes significantly to bacterial mortality of sensitive hosts or such cell lysis contributes to the production ofDOM remains unknown. Acknowledgments: We are grateful to Chris Kellogg for her valuable suggestions and comments for the revision of this manuscript, and to Pam Sutton and Ted Van Vleet for providing us with aromatic and aliphatic hydrocarbons. This research was supported by NSF grants OCE 9115942 and OCE 9502775 and also by a Gulf Oceanography Fellowship and a Knight Fellowship to SCJ. *The content of this chapter is in press at Marine Ecology Progress Series. 98

PAGE 118

References Ackermann, H. W., DuBow, M. S. (1987). Viruses of prokaryotes. Vol. 1. General Properties of bacteriophages. CRC Press. Boca Raton. Barondess, J J., Beckwith J. (1990). A bacterial virulence determinant encoded by lysogenic coliphage Nature 346: 871-873 B ergh, 0., B0rsheim, K. Y. Bratbak, G., Heldal, M. (1989). High abundance of v iru ses found in aquatic environments. Nature 340: 467-468 Bertani, G. (1953). Lysogenic versus lytic cycle of phage multiplication Cold Spr. Harb. Symp. Quant. Biol. 18: 65-70 Birge, E. A (1994). Bacterial and bacteriophage genetics. 3rd edition. Springer-Verlag New York. B0rsheim, K. Y. (1993) Native marine bacteriophages FEMS Microbiology Ecology 102: 141-159 Bratbak G., Heldal, M. Norland, S. Thingstad, T. F. (1990). Viruses as partners in spring bloom microbial trophodynamics. Appl. Environ. Microbiol. 56: 14001405 Bratbak G., Heldal, M ., Thingstad, T. F., Riemann, B. Haslund, 0. H. (1992) Incorporation of viruses into the budget of microbial C-t ransfer. A first approach. Mar. Ecol. Prog. Ser. 83: 273-280 Cottrell M., Suttle, C. A ( 1 995). Dynamics of a l ytic virus infecti n g the photosynthetic marine picoflag e llat e Micromonas pusilla. Lirnnol. Oceanogr. 40: 73 0-7 39 Edlin G., Lin, L. Bitner, R. (1977). Reproductive fitness ofP1, P2, and Mu lysogens of Escherichia coli. J. Virology 21: 560-564 E dlin G., Lin, L. Kudrna R. (1975). Lysogens of E coli reproduce more rapidly than non-lysogens. Nature 255: 735-737 Eganho use, R. P., Calder, J. A. (1976). The solubility of medium molecular weight aromatic hydrocarbons and the effects of hydrocarbon co-solutes and salinity. Geochimica et Cosmochimica Acta. 40 : 555-561 Freife ld er, D. (1987). Mol ecular Biology. Jones and Bartlett, Inc. Boston. 99

PAGE 119

Fuhrman, J. A. Noble, R. R. (1995). Viruses and protists cause similar bacterial mortality in coastal seawater. Limnology and Oceanography 40: 1236-1242 Fuhrman J A., Suttle, C. A. (1993). Viruses in marine planktonic systems Oceanography 6 : 57-63 Hayashi, T ., Baba, T. Matsumoto, H. Terawaki, Y. (1990) Phage-conversion of cytotoxin production in Pseudomonas aeruginosa. Molecular Microbiol. 4: 17031709 Heldal, M., Bratbak G. (1991). Production and decay of v1ruses m aquatic environments. Mar. Ecol Prog Ser 72: 205 -212 Jiang, S. C. Thurmond J. M. Pichard, S. L., Paul, J. H (1992). Concentration of microbial populations from aquatic environments by Vortex Flow Filtration. Mar Ecol. Prog. Ser. 80 : 101-107 Jiang, S.C., Paul, J. H (1994). Seasonal and diel abundance of viruses and occurrence of lysogeny/bacteriocinogeny in the marine environment. Mar. Ecol. Prog. Ser. 104: 163-172 Levin, B R., Lenski R. E. (1983). Coevolution in bacteria and their viruses and plasmids. p 99-127 in D J. Futuyma and M Slatkin eds. Coevolution. Sinauer Sunderland Mass Lin L., Bitner, R., Edlin G (1977) Increased reproductive fitness of Escherichia coli Lambda lysogens J Virology. 21:554-559 May, W. E., Wasik, S. P. ( 1978 ). Determination of the solubi lity behavior of some polycyclic aromatic hydrocarbons in water. Analytical Chemistry 50 : 997-1000 Moreau, P Bailone, A., Devoret, R. (1976). Prophage induction in Escherichia coli K12 envA uvrB : a highly sensitive test for potential carcinogens. Proc Natl. Acad. Sci. 73: 3700-3704 Paul J. H. (1982). The use of Hoechst dyes 33258 and 33342 for the enumeration of attached and pelagic bacteria Appl. Environ. Microbiol. 43: 939-949 Paul, J. H., Jiang, S.C., Rose, J. B. (199 1 ). Concentration of viruses and dissolved DNA from aquatic environments by vortex flow filtration Appl. Environ. Microbiol. 57: 2107 -2 204 100

PAGE 120

Schrader, J. 0., Lufburrow, M. D., Kokjohn, T A. (1994). Effects of stress on the replication potential of bacteriophages. 94th General Meeting of the American Society for Microbiology, Las Vegas. Abstract N213 Smith, H. W. (1972). Ampicillin resistance in Escherichia coli by phage infection. Nature New Biol. 238: 205-206 Tapper M.A., Hicks, R. E. (1994). Ultraviolet light and chemical induction of temperate bacteriophage from a Great Lake ecosystem. 94th General Meeting of the American Society for Microbiology, Las Vegas. Abs N211. Things tad, T. F., Heldal M., Bratbak, G., Dunda I. ( 1993) Are viruses important partners in pelagic food webs? Trends Ecol. Evol. 8: 209-213 Weinbauer, M.G., Fuks, D., Puskaric, S., Peduzzi, P. (1995). Diel, Seasonal and Depth related variability of viruses and dissolved DNA in the northern Adriatic sea. Microb. Ecol. 30: 25-41 Weinbauer, M G., Peduzzi, P. (1995). Significance of viruses versus heterotrophic nanoflagellates for controlling bacterial abundance in the northern Adriatic sea. Journal of Plankton Research. 17: 1851-1856 Wilcox, R. M. Fuhrman, J. A. (1994) Bacterial viruses in coastal seawater: lytic rather than lysogenic production. Mar. Ecol. Prog. Ser. 114: 35-45 Zar, J. H. (1984). Biostatistical analysis. Second edition. Prentice-Hall, Inc. Englewood Cliffs, NJ. 101

PAGE 121

CHAPTER4 PRELIMINARY CHARACTERIZATION OF BACTERIAL HOSTS AND TEMPERATE PHAGES ISOLATED FROM MAMALA BAY, HAW All 4.1 Abstract To understand the ecological and genetic role of viruses m the marme environment it is critical to know the infectivity of viruses, and the types of interactions between marine viruses and their hosts We have isolated 4 marine phages from turbid plaques using 4 indigenous bacterial hosts from the concentrated water samples of Mamala Bay Hawaii Two of the bacterial hosts were identified to be Sphingomonas paucimobilis and Flavobacterium sp., respectively All phage isolates were tailed phages w i th the head sizes ranging from 47 nm to 70. 7 nm and tail sizes ranging from 1 2 nm to 146 nm The burst sizes of these phages range from 7 8 to 240 phage/bacterial cell. All phage isolates were double stranded DNA viruses with genome sizes, as determined by restriction digestion ranging from 36 Kb to 112 Kb. Three of the 4 phage-host systems were temperate in nature Hybridization of phage probe with l y sogenic host genomic DNA was observed in dot blot hybridization, indicating that prophage T 102

PAGE 122

was integrated with the host genome. These phage-host systems will be used to study marine phage mediated gene transduction 4.2 Introduction Electron microscopic studies of seawater have indicated a high abundance of viral particles in many regions and habitats of the marine environment (e.g. Torrella & Morita 1979, Bergh et al. 1989, Fuhrman & Suttle 1993, Weinbaur et al. 1995, Steward et al. 1996). Moreover, viruses were found to contribute significantly to the mortality of bacterioplankton and phytoplankton indicating their importance in microbial ecosystems (Fuhrman & Suttle 1993) However little data are available concerning the infectivity of the viruses observed by microscopy which is a critical question with regard to the ecological and genetic roles of viruses in the marine environment. Many infectious marine bacteriophages were isolated by Hidaka's group in the 70s (see review by Moebus 1987) and by Moebus in the '80s and 1991 (Moebus 1980 1991, Moebus & Nattkemper 1981) Moebus suggested that the chances of finding phages infecting a specific bacterial strain depend to a major extent on the length of time between the isolation of the bacterium and the attempted isolation of phage from water samples collected from the same locality. In other words the chances of detecting bacteriophages using bacterial hosts present in the same water sample are relatively high (Moebus 1991) Using indigenous bacterial hosts he had collected 298 marine bacteriophages from a variety of marine environments over time (Moebus & Nattkemper 103

PAGE 123

1981) Among the nearly 300 marine phage isolates tested, 29 were identified as temperate by Moebus ( 1983 ) yet no information on the properties of theses phage-host systems was given Hidaka and Shirahama (1974) also reported isolation of a temperate phage from marine mud in Kagoshima Bay Japan We are primarily interested in the occurrence of lysogeny and bacteriophage mediated gene transfer in the marine environment. The interactions between marine viruses and their hosts may significantly influence the genetic diversity and composition of marine microbial communities. We attempted to isolate several temperate phage-host systems from water samples of Mamala Bay Hawaii with a goal of establishing transduction systems with indigenous marine bacterial hosts and the bacteriophages The characteristics ofthese phage-host systems are described herein. 4. 3 Material and Methods 4.3.1 Isolation of Bacterial Hosts and Phages Twenty liter water samples were collected from surface and subsurface waters of Ke'ehi Lagoon and Sand Island sewage outfall offshore in Mamala Bay, Hawaii by pumping water into acid washed carboys on-board a small boat. Water samples were concentrated by Vortex Flow Filtration (Jian g et al. 1992) from 20 liters to approximately 50 milliliters within 3 hours of collection Bacteria were isolated from the concentrated samples on artificial seawater agar plate s containing Sg/L peptone and 1 g / L yeast extract 104

PAGE 124

(Paul 1982). Each of the colonies was re-isolated three times to ensure the purity of the bacterial isolates. Each bacterial isolate was then used as a host for isolation of temperate phages from the same concentrated sample or samples from nearby locations. For temperate phage isolation one ml or 0.1 ml of concentrated seawater wa s mixed with 1 ml of potential host cultures in a tube containing 3 ml of soft agar at 47 C The mixture was poured over an artificial seawater nutrient plate to form a thin layer After incubation over night at 28 C turbid plaques were picked from the plates and each individual plaque was re-isolated three times to ensure the purity of the phage isolate. Phage lysates were produced by eluting the top agar overlay plates Stock samples were stored at 4 C after filtration through pore-size filters 4.3.2 Characterization of Marine Bacterial Isolates Gram staining was performed on each bacterial host using Fisher Diagnostics Gram Stain Set (Fisher Scientific Pittsburgh PA), following the manufacturer s recommended procedures Bacterial morphologies were examined by transmission electron microscope (TEM) at 9,000 to 15, 000 times magnification. Gram negative rod shaped bacteria were further tested using the API-NFT bacterial identification kit (BioMerieux Viteck, Inc MO) following the manufacturer s recommended procedures 105

PAGE 125

4.3.3 TEM Examination of Phage Morphology One drop of freshly prepared phage lysate was spotted on a Forrnvar/carbon coated 200 mesh TEM grid (Electron Microscopy Sciences, Fort Washington, PA) The edge of the grid was touched to a piece of Whatman filter paper to drain away the excess fluid. The grid was then stained with 2% uranyl sulfate solution for 30 sec washed with a drop of deionized (DI) water for 10 sec, and dried in air before examination using a Hitachi 500 TEM Magnification of the microscope was calibrated using 50 run nanosphere as size standards (Electron Microscope Sciences, Ft. Washington PA). Photo-micrographs of phages were taken at 48,000 to 100,000 times magnification. Morphological characteristics of phages were compiled from multiple photo-micrographs of phage particles, to protect against size or shape anomalies. 4.3.4 Determination of Phage Genome Size by Restriction Enzyme Digestion Phage DNAs were extracted from 10-30ml each of phage lysates using Wizard Lambda Preps DNA Purification System (Promega Madison WI) following the manufacturer's recommended procedures. Briefly, freshly prepared phage lysates were digested with RNase A and DNase I at 37C for 15 minutes and precipitated by polyethylene glycol (PEG-8000) on ice for 30 min. The precipitates were resuspended in 500 of phage buffer containing 150 mM NaCl, 40 mM Tris-HCl (pH 7.4) and 10 mM MgS04 Phage DNA was purified by a m1ru Purification Resin column (Promega 106

PAGE 126

Madison, WI), and eluted from the column with 80 C DI water. The purified phage DNA was used for restriction enzyme digestion within a few days. For restriction enzyme digestion, approximately 1 each of phage DNA was digested in a total volume of 40 Both uncut and restriction cut DNA were visuali ze d on agarose gel electrophoresis (0.4%, 1% and 1.5% agarose) stained with ethidiurn bromide (Sambrook et al. 1989). The molecular weight of each phage DNA was th e n estimated by using the sizes of large fragments determined from 0.4% gels medium fragments from 1% gels and small fragments from 1.5% gel. A one-Kb DNA ladder (12.2-0.5Kb Gibco BRL Gaithersburg, MD), Hind III digested 'A DNA fragments ( 230.56Kb Promega, Madison WI) and a high molecular weight DNA marker (48.5Kb8.3Kb Gibco BRL, Gaithersburg MD) were used as molecular weight markers for calculation of the sizes of the phage DNA fragments by linear regression and invers e prediction 4 3.5 One-step Growth Experiments The burst sizes and one-step growth curves were determined as described b y Weiss et al. ( 1994) with minor modifications One milliliter of each ove rnight cultur e was transferred to 20 ml fresh media and incubated with shaking for about two hours until the A600 was 0.6, and the viable cell counts were around 108/ ml. One milliliter of each bacterial culture was then transferred to fresh tubes and mixed with pha ge at a multiplicity of infecti on (MOl) of 1 The mixtur e was incubated at room temperatur e for 107

PAGE 127

20 minutes to allow phage adsorption. After this adsorption period, cells were pelleted to wash away the unattached phages. Infected cells were diluted to 1 o-s in 1 0 m1 artificial seawater and incubated at 28C with shaking. Samples were withdrawn over time for infectious center assay by the soft agar overlay method Bacterial viable counts were determined at the beginning and at the end of the sampling. Burst size was estimated by dividing the increased viral number at the end of the one-step growth curve with the lysed bacterial number. 4.3.6 Purification of Plasmid and Chromosomal DNA Plasmid DNA and chromosomal DNA were purified from bacterial cells using Wizard Plasmid DNA Preps kit and Wizard Genomic DNA Preps kit (Promega, Madison WI) respectively, following the manufacturer's recommended procedures Special precautions were taken to extract DNA from potential lysogens including washing of potential lysogenic cells three times before DNA extraction to avoid contaminating DNA preparations with free phage DNA. The purity of chromosomal DNA from these preparations was similar to those purified by a cesium chloride gradient. When chromosomal DNA purified from the prep kits was added to cesium gradients, only a single sharp band was observed after centrifugation in each sample. Concentrations of DNA were measured fluorometrically by Hoechst 33258 as described previously (Paul & Meyers 1982) 108

PAGE 128

4.3.7 Probe Labeling and Dot Blot Hybridization A 100 bp Ace I digestion fra g ment of the temperate phage T DNA was randoml y c loned into the Riboprobe vector pGEM4Z ( Promega Madison WI) usin g the cloning protocol recommended by the manufacturer. A 35S RNA probe was prepared by transcription of the fragment with T7 RNA polymerase, using 3 58 UTP (Frisch e r et al. 1990). Phage DNA plasmid DNA and chromosomal DNA were dotted onto charged nylon membranes (Zetaprobe; BioRad Richmond, CA USA ) in various concentrations. The filter was baked in a vacuum oven for 2 h at 80 C, re-wet with 0.4 M Tris-HCL (pH 8) then hybridized overnight with the phage probe at 42C as previously described (Frischer et al. 1990). The filter was washed for 5 min at room temperature in 2 x SSC containing 1 mM DTT ( dithiothreitol) followed by three 1 hour washes at 65 C in PSE ( 0 25M sodium phosphate 2 % sodium dodecyl sulfate 1 mM EDTA pH 7.4) and three 30 min washes in PES (40mM sodium phosphate 1% sodium dodec y l sulfate 1 mM EDTA, pH 7.4) at 65 C. The h y bridization signal was detected by autoradiography 109

PAGE 129

4.4 Results 4.4.1 Isolation of Bacterial Hosts and Phages from Marine Environments Table 4.1 shows the results of isolation of bacterial hosts and phages from marine environments. Four bacterial isolates were found to be able to serve as hosts for isolation of turbid plaques Each bacterium was named after the sampling station's name Bacteriophage isolates were also named using the similar system except with 'T-r prefix, representing temperate phage' Although one of the phage isolates was later shown to be lytic, the name of the phage was unchanged. Most of the phages were isolated from the same sample as that for bacterial isolation. A bacterium designated D1B was also host for a phage isolate from a sample of nearby environment (Ke'ehi Lagoon). has the same plaque morphology as and was later shown to possess identical restriction enzyme banding patterns. The phage isolates were host specific, and none of the viruses cross infected other host s tested. Table 4.2 shows the results of bacterial isolate identification using the API-NFT test kit and Figure 4.1 shows the morphology of isolates. Bacterium HSIC was spherical in shape (Figure 4 1A), while the other three isolates were either short fat rods or slender rods (Figure 4.1B-D) and all were gram negative. Only rod shaped bacteria were further characterized by API-NFT test, because of the limitation of this test. Host DO showed an excellent match with Sphingomonas paucimobilis. DIB belonged to the genus of Flavobacterium, and was tentatively identified as F. breve or F. weeksella. D2S 110

PAGE 130

possessed a capsular layer (Figure 4.1D) and shared traits with Pseudomona s, Aero monas and Shewanella. Clonal culture of isolate DO inoculated from a single colony always contained phage particles (Figure 4.1B), suggesting this bacterial isolate was a lysogen upon isolation Phage particles found in the cell culture were slightly different from the isolate in that the head sizes were smaller, averaging 39.15 nm (n=4), compared to 54.3.7 nm (n=4). Their tails were about the same length as averaging 86 .5.2 4, but appeared wider than (Figure 4 3D). Table 4 1 Isolation of Bacterial Hosts and Phages from Mamala Bay, Hawaii. Bact. Isolation Sites Designated Bact. Turbid Plaque Corresponding Isolates (hosts) Isolation Sites Temperate Phage Ke' ehi Lagoon HSIC Ke' ehi Lagoon Ke' ehi Lagoon DO Ke' ehi Lagoon Sand Island Outfall D1B Sand Island Outfall (15m Subsurface) (15m Subsurface) Ke' ehi Lagoon Sand Island Outfall D2S Sand Island Outfall 111

PAGE 131

Tab l e 4.2 Identification of Marine Bacterial Isolates Bacteria l Isolates Gram Stain Morphology Genus and Species HSIC Coccus Unidentified DO Coccobacillus Sphingomonas paucimobilis D I B Rod Flavobacterium sp. D2S Coccobacillus Unidentified with capsule A ll phage isolates formed turbid plaques on their bacterial host lawns (Figure 4.2), and turbid plaques are the typical plaque morphology of temperate phages. Phage Tformed plaques with complete turbid centers (Figure 4.2a) and poorly defmed edge s Phage plaque had a small clear center and a wide halo of bacterial growth with the edge of the plaque defined by a sharp narrow ring. Small plaque mutants and large clear plaque mutants were often seen in the plaque morpho l ogy (Figure 4.2B), and the number of plaque mutations increased with prolonged storage of the phage lysate in the refrigerator (data not shown). Phage formed very turbid plaques while occasionally possessed a tiny clear center (Figure 4.2C). Phage T p l aques had relatively large clear centers and wider halos Unlike the plaques there wa s not a clear ring around the halo (Figure 4 2D) The temperate nature of i s questionable (see discussion). 112

PAGE 132

Figure 4 1 Morphologies ofbacterial isolates from Mamala Bay Hawaii (A). HSIC; (B). DO and phage particles in the cell culture as indicated by arrows; (b). phage particles found in the DO culture scale bar represent 50nrn ; (C) D1B; (D). D2S. Scale bar on each photo represent 0 5 jlm. 113

PAGE 133

Figure 4.2 Turbid plaque morphologies of bacteriophages isolated from Mamala Bay Hawaii. (A). Plaques formed by phage on host DO; (B) Plaques formed by T on host HSIC; (C). Plaques formed by phage on host DIB; (D). Plaques formed by phage on host D2S. Scale bar on each photo represent lcm. 114

PAGE 134

Figure 4 2 (Continued) 115

PAGE 135

Electron photomicrographs of the temperate phages appear in Figure 4 3 and phage sizes are given in Table 4.3. Phage head sizes ranged from 47 to 70 .7 nm, while tail sizes ranged from 12 to 146nm. T-$HSIC had a long flexible tail, which appeared non-contractile (Figure 4 3E) T-$D1B apparently had a contractile tail (Figure 4.3A & F) and was similar in morphology to T-$D0-3 (Figure 4 3C), both belonging to th e family of M y oviridae. T-$DO had a very thin flexible tail with no observable collar structure (Figure 4.3D). Both T-$DO and T-$HSIC belong to the family of Siphoviridae T-$D2S (Figure 4 3B) had a very short tail typical of the family ofPodoviridae Table 4.3 Morphological Characteristics of Phages Isolated from Mamala Bay Hawaii Temper a te Phages Family Head Size s (nm) Tail Sizes (nm) T-$HSIC Siphoviridae 47 3.7 (n =7) 146 3 .7 (n =7) T-$DO Siphovirida e 54.3 7 (n = 4) 87 9 6.4 (n = 3) T-$D1B Myoviridae 70 7 4 8 (n=5) 108.5.8 (n = 5) T-$D2S Podoviridae 49 1 3 9 (n =7) 12 1.2 (n = 3) 116

PAGE 136

Figure 4.3 Electron photomicrographs of phages isolated from Mamala Bay, Hawaii. (A). T-$D0-3 ; (B). T-$D2S ; (C) T-$D1B ; (D) T-$DO; (E) T-$HSIC; (F) T-$D0-3 Scale bar on each photo represent 1 OOnm. 117

PAGE 137

4.4.2 Genome Sizes and Types of Phage Isolates All phage isolates were double stranded DNA viruses as indicated by re s triction enzyme digestion (Figure 4.4). At least 7 restriction enzymes were used for each purified phage DNA (Table 4.4). Interestingly none of phage DNA could be digested by BamH I restriction endonuclease, although the reason for resistance was unknown. and T DNA were resistant to EcoR I and Bgl II, respectively DNA was found to be resistant to restriction digestion by Xba I Kpn I Sal I Pst I, Sac I, and Sma I (data not shown) Some restriction enzymes digested phage DNA into over 30 fragments which appeared as a DNA smear on the agarose gel, while other enzymes digested phage DNA into many fragments of similar size resulting in smearing in a region of the gel. Only clear restriction patterns were used in molecular weight determinations. Phage genome size was determined by adding up the restriction fragments from each enzyme digestion. Three gels at agarose concentrations of 0.4% 1% and 1.5% were run for each digested sample Table 4.4 shows the estimated phage genome sizes by restriction digestion The genome size for was about 36 Kb a s determined by Bgl II and EcoR I digested fragments Hpa I digested DNA gave a slightly lower molecular weight of 33 Kb Some of the Hpa I digested fragments were more intense than the others on the gel (Figure 4.4), possibly because of multiple bands at identical molecular weight. Such similar molecular weight bands may have also occurred in Hpa I digested and T DNA. The genome was about 71 Kb as determined by Bgl II, Ec o R V and Ace I digestion DNA had the identical restriction pattern as phage 118

PAGE 138

DNA (data not shown), suggesting they were the same or closely related phages isolated from different l ocations. The T 1 B genome size averaged 112 Kb as determined by restriction Hpa I, Bgl II and EcoR V fragments, while T had a genome size of 65 Kb (Table 4.4). Table 4.4 Estimated Phage Genome Sizes by Restriction Enzymes Digestion. Phages Estimated Molecular Weight Kb (#of fragments) Hpai Bg/II EcoRV Ace I EcoRI Hind III BamHI 33 (17)* 37 (3) smear** smear 36 (9) smear no sites*** 43 (16)* 71 (7) 72 (8) 69 (11) no sites smear no sites 110 (20) 113 (19) 114 (30) smear smear smear no sites 52 (21)* no sites 65 (8) 64.4 (26) smear smear no sites doublets or triplets may have occurred in the digested phage DNA **DNA was digested into too many fragments, or similar size fragments were concentrated at a region of the gel. ***DNA cannot be digested by restriction enzyme used. 4.4 3 Phage One-step Growth C u rve Figure 4.5 shows the one-step growth curves for phage isolates. The latent periods and burst sizes estimated from the growth curves are summarized in Table 4 5 had the smallest burst size of the four examined (7 8), while had the largest burst size of 240 The latent period of theses phages ranged from 90 minutes to 180 minutes 119

PAGE 139

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 18 17 18 19 20 21 22 23 24 -7. 0 0.0 -5. 0 -4. 0 3 0 -2.0 -1.6 -1. 0 -0. 5 -0.4 Figure 4.4 Phage DNA digested with restriction endonuclease for molecular weight determination. Lane 1 uncut DNA lane 2-6 DNA cut with Hpa I, Hind III, Bgl II, Ace I and EcoR V, respectively. Lane 7 uncut DNA lane 8-12 DNA cut with Hap I, Ace I Bgl II, EcoR I and EcoR V, respectively. Lane 13 uncut T DNA, lane 14-18 T DNA cut with Hpa I, Hind III, Ace I, EcoR I and EcoR V, respectively. Lane 19 uncut DNA, l ane 20 24 cut with Hpa I, Hind III, Ace I, EcoR I and EcoR V, respectively. 120

PAGE 140

8 .00E+ 5 00E+ 6 .00E+ 8 .00E+ 4 .00E+10 Cl Cl c: 6 .00E+
PAGE 141

Table 4.5 Growth Characteristics of Phages Isolated from Mamala Bay, Hawaii Temperate Phages Latent Period (min.) Burst Size 1 20 47 90 7.8 90 176 180 240 4.4.4 Lysogenic Characteristics Bacteria isolated from the turbid plaque centers or halo area were resistant to phage infection, suggesting that bacterial hosts might be lysogenized with the phages. Among the 4 phage-host systems, only the relationship between temperate phage T and it s host HSIC were characterized in detail. Bacteria picked from the halo area of plaques, named L HSIC, were isolated by at least 3 consecutive streaks on fresh agar plates to ensure the purity of the i so late. L-HSIC had a different colony morphology than wild type HSIC HSIC colonies had smooth surfaces, rounded in shape and opaque in color. L-HSIC colonies were more transparent, had uneven edges, and appeared wrinkly after incubation for 48 hours. L-HSIC cell cultures inoculated from a single colony shed viruses into the medium which were infectiou s to wild type HSIC. To confirm that phage DNA was inside the L-HSIC cell, a dot blot of DNA from pla s mid preparations of HSIC and L -HS IC and chromosomal 122

PAGE 142

preparations of HSIC and L-HSIC was probed with 35S labeled phage T-$HSIC probe (Figure 4.6) Strong hybridi zatio n of the probe with phage DNA was found a s expected. Hybr i dization of probe with L-HSIC pla s mid DNA and weak hybridization with L-HSIC chromosomal DNA were also seen. The weak hybridization of L-HSIC chromosomal DNA was not from contamination of plasmid DNA in the prep, because chromosomal DNA preps showed onl y a single band on a cesium chloride gradient when an attempt was made to re-purify the DNA (data not s hown). The hybridi zat ion of probe with LHSIC plasmid DNA was also not from contamination of chromosomal DNA, becau s e the concentration of plasmid DNA dotted was 1 / 4 used in the chromosomal dot, yet resulted in a higher degree of hybridization. No hybridization was detected in HSIC plasmid and chromosomal DNA. A B C D E 1 2 Figure 4.6 Dot blot hybridi za tion probed with pha ge T-$HSIC DNA probe. (A). 0.4 !l g of T-$HSIC DNA; (B) 2.1 !lg of pla s mid DNA from HSIC; (C). 0.5 !lg plasmid DNA from L-HSIC ; (D). 2.1 !lg of chromosomal DNA from HSIC; (E). 1.8 !lg of chromo soma l DNA from L-HSIC. Row 1 and 2 are repli cates. 123

PAGE 143

4.5 Discussion Many recent studies on marine viruses have only considered lytic phage-ho s t interactions (Bratbak et al. 1992) The dynamics of temperate phage-host relationships in the marine environment have been largely ignored. Previously, we have shown that lysogenic bacteria were abundant among marine bacterial isolates (Jiang & Paul 1994) suggesting that many marine bacteriophages may be temperate in nature However, the i so lation of temperate phages from marine environments was rare. Moe bus tested nearly 300 marine phage isolates, finding only 29 to be temper;:tte (Moebus 1993). However his phage collections were obtained using a liquid nutrient enrichment isolation method (Moebus 1980) Nutrient sufficient conditions favor lytic infection (Jacob & Wollman 1953 Frei felder 1987) Kokjohn et al. (1992) suggested that high numbers of lytic phages found in the aquatic environment was an artifact of nutrient enrichment isolation methods. We have isolated four different types of turbid plaques on native marine bacteri a l hosts from concentrated seawater samples from Mamala B ay Hawaii. Two of the turbid plaques resembled the classical turbid plaques of temperate phage s (Freifelder 1987). T plaque morphology is similar to that of a Bacillus s ubtilis phage described by Romig and Brodesky (1961) However they did not determine if phage DNA was integrated into the host genome. In this study, using dot blot hybridization and probin g we have detected T DNA inside the host cell, sugge st ing this phage isolate is a temperate phage. Plaques of are similar to the plaques of Rhizobium 124

PAGE 144

leguminosarum phage 3H (Staniewski 1987 ), the plaques of the Klebsiella pneumoniae capsule bacteriophage XIV (Lindberg 1977) and also to the plaques of the M-1 phage of R. japonicum (Dandekar & Modi 1978). Lindberg (1977) described bacteriophages isolated from capsulated species of bacteria that plaque morphology consisting of a large clear center surrounded by a crater -like depression or halo in the bacterial lawn. This halo comprised an area in which the bacterial capsular material was destroyed by the phage induced polysaccharide depolymerase without affecting bacterial viability (Barnet & Humphrey 1975, Dandkar & Modi 1978). A similar phenomon was observed with the D2S phage-host system, since bacteria D2S was encapsulated The turbid halo around T plaques may have been the result of bacteria with damaged capsular material rather than from lysogeny. Thus, may be lytic. Using the API-NFT test bacterial ho s t DO has been identified to be Sphingomonas paucimobilis which was previously known as Pseudomonas paucimobilis Pseudomonas phages have been routinely isolated from the marine environment (Hidaka 1973). Bacterium D1B has been identified to be Flavobacterium sp. There are two prior report s of isolation of Flavobacterium marine phages, both from Kagoshima Bay Japan (Hidaka 1971, 1973). It is not surprising that all our phage isolate s are tailed phages. According to a lit erature review by Bor s heim (1993), most marine phages in culture had tails. However the head sizes of our phage isolates were smaller than most of the known marine bacteriophages. Borsheim s review indicated that the majority of cultured marine phage s were in the size range of 60 nm to 1 00 nm He s uggested that mo s t of the marine phages 125

PAGE 145

in seawater belonged to groups that are not cultivable, because the size distribution of viruses from seawater samples were dominated by 30 nm to 60 nm particles. Most of our phage isolates fell in the 30 to 60 nm range, and appear representative of Borsheim's suggested non-cultivatable group. A survey of 52 cultured marine phages by Borsheim suggested that there is a large variation in burst size with the average marine phage burst size being 185, and ranging from 5 to 610. The burst size of our phage isolates fell within this range. It is difficult to compare the genome size of our phage isolates with previously isolated marine phages, because most reports of marine viruses have not characterized the phage nucleic acids. Ackermann and DuBow (1987) suggest that nucleic acid type and gross morphology are the most import properties for phage description and classification with less emphasis placed on molecular weight and restriction endonuclease patterns. The viral DNA maintained as a prophage inside lysogenized cells was proven in the system by dot blot hybridization. We interpret the hybridization signal of the phage gene probe with the lysogenized host chromosomal DNA as an indication that phage DNA is integrated within the host genome. The hybridization signal was weak compared with hybridization of phage DNA, suggesting that only one copy (or a few copies) of phage DNA was integrated in the chromosome. Because our probe is only 100 bp in size, it can only hybridize with a small region of the phage DNA. The lysogen L-HSIC was spontaneously induced to lytic replication in a high frequency and over 1 06 /ml free phage particles were found in the supernatant of the overnight culture Hybridization found in the plasmid DNA fraction maybe because the 126

PAGE 146

phage DNA was maintained as an autonomous plasmid, or the result of phage DNA injected into the cell but unable to replicate, because of the presence of a vegetative replication repressor produced by the prophage. Lysogens are immune to lytic infection but are not resistant to phage DNA injection The presence of free phages in the culture medium may have created a positive pressure for the maintenance of the lysogens The wild type HSIC contained a plasmid upon isolation (detected by plasmid prep and gel electrophoresis data not shown here). The lysogen L-HSIC plasmid DNA preparation must contain both original plasmid DNA and phage DNA within the cytoplasm For equal quantity of DNA the copy number of phage DNA in the plasmid preparation is higher than those in chromosomal preparation but lower than pure phage DNA. The results of this study suggest that temperate phages can be easily found as members ofthe microbial community. We are currently collecting samples from the Gulf of Mexico for the isolation of temperate phage-host systems. Phage isolate s from Mamala Bay, Hawaii share many similar properties with other marine phage isolates while also remaining unique. The interaction of temperate phages and the microbial population in the marine environment may contribute significantly to the microbial genetic diver s ity and composition by conversion and transduction. The indigenous phage-host sy s tem s isolated in this study were used in the study of marine phage gene transduction a s described in Chapter 5. 127

PAGE 147

References Ackermann, H W ., DuBow, M S. (1987). Viruses of prokaryotes. Vol. 1. General Properties of bacteriophages. CRC Press. Boca Raton. Barnet, Y. M. Humphrey B (1975) Exopolysaccharide depolymerase induced by Rhizobium bacteriophage Canad. J. Micro bioi. 21: 164 7-1650 Bergh 0., B0rsheim, K. Y. Bratbak G. Heldal, M. ( 1989 ). High abundance of viruse s found in aquatic environments Nature 340: 467-468 B0rsheim K.Y. (1993). Native marine bacteriophages. FEMS Microbial. Ecol. 102 : 141159 Bratbak, G ., Heldal, M. Thingstad T. F. Riemann B., Haslund, 0. H. (1992). Incorporation of viruses into the budget of microbial C-transfer A first approach Mar. Ecol. Prog Ser 83 : 273-280 Dandekar, A. M., Modi, V. V. (1987). Interaction between Rhizobium japonicum phage M-1 and its receptor. Canad. J. Microbial. 24: 685-688 Freifelder, D. (1987). Molecular Biology. Jones and Bartlett Inc Boston. Frischer, M .E., Thrumond, J. M ., Paul J. H. ( 1 990) Natural pla smid transformation in a high-frequency-of-transformation marine Vibrio strain. Appl. Environ Microbiol. 56: 3439-3444 Fuhrman, J. A., Suttle C A. (1993). Viruses m marme planktonic sys tem s. Oceanography 6: 57-63 Hidaka, T., Shirahama T. (1974) Preliminary characterization of a temperate phage system isolated from marine mud. Mem. Fac. Fish., Kagoshima Univ. 23: 137148 Jacob F. Wollman, E. L. (1953). Induction of phage development in lysogenic bacteria Cold Spring Harbor Symposia on Quantitative Biology. 18 : 101-121 Jiang, S. C., Thurmond, J. M., Pichard, S. L., Paul J. H. (1992). Concentration of microbial populations from aquatic environments by Vortex Flow Filtrati on. Mar. Ecol. Prog. Ser. 80: 101-107 1 28

PAGE 148

Jiang, S.C. Paul, J. H (1994). Seasonal and diel abundance of viruses and occurrence of lysogeny/bacteriocinogeny in the marine environment. Mar. Ecol. Prog. Ser. 104 : 163-172 Kokjohn, T. A., Sayler, G. S., Miller, R. V (1991) Attachment and replication of Pseudomonas aeruginosa bacteriophages under conditions simulating aquatic environments. J. General Microbiol. 13 7: 661-666 Lindberg, A A. (1977). Bacterial surface carbohydrates and bacteriophages adsorption. In: Surface carbohydrates of the prokaryotic cells. ed. I. E. Sutherland. Acad Press London. Moebus, K. (1980). A method for the detection of bacterioph ages from ocean water. Helgolander Meeresunters. 34: 1-14 Moebus, K. (1983). Lytic and inhibition responses to bacteriophages among marine bacteria, with special reference to the origin of phage-host systems. Helgolander Meeresunters. 36: 375-391 Moebus, K. (1987). Ecology of marine bacteriophages. In: Phage ecology. ed. by S. M. Goyal, C P. Gerba & G. Bitton. Wiley, New York. 137-156 Moebus, K. (1991). Preliminary observations on the concentration of marine bacteriophages in the water around Helgoland. Helgolander Meeresunters. 45: 411-422 Moebus K. Nattkemper H. (1981). Bacteriophage sensitivity patterns among bacteria isolated from marine waters. Helgolander Meeresunters. 34: 375-385 Paul, J. H. (1982). The use ofHoechst dyes 33258 and 33342 for enumeration of attached and pelagic bacteria. Appl. Environ. Microbiol. 43: 939-949 Paul, J. H., Meyers, B. (1982). Fluorometric determination of DNA in aquatic microorganisms by use of Hoechst 33258. Appl. Environ. Microbial. 43: 13931399 Romig W. R. Brodesky A. M. ( 1961 ). Isolation and preliminary characterization of bacteriophages for Bacillus Subtilis. J. Bacteriol. 82:135-141 Sambrook, J. Fritsch E. F Maniatis T. (1989) Molecular cloning: a laboratory manual 2nd ed. Co ld Spring Harbor Laboratory Press Cold Spring Harbor, NY Staniewski, R. (1987). Morphology and general characteristics of phage active against Rhizobium. J. Basic Microbiol. 27: 155-165 129

PAGE 149

Steward, G. F., Smith, D.C Azam F (1996). Abundance and production of bacteria and viruses in the Bering seas and Chukchi seas. Mar Ecol. Pro. Ser. 131: 287-300 Suttle, C.A., Chan, F. (1992). Mechanisms and rates of decay of marine viruses m seawater. Appl. Environ. Microbial. 58: 3721-3729 Torrella, F., Morita, R. Y. (1979) Evidence by electron micrographs for a high incidence of bacteriophage particles in the waters of Y aquina Bay, Oregon: ecological and taxonomical implications. Appl. Environ. Microbial. 37: 774-778 Weinbauer, M G., Fuks, D., Puskaric, S Peduzzi, P. (1995). Diel, Seasonal and Depth related variability of viruses and dissolved DNA in the northern Adriatic sea. Microb. Ecol. 30: 25-41 Weiss, B.D Capage M. A., Kessel M. Benson S. A. (1994). Isolation and characterization of a generalized transducing phage for Xanthonmonas campestris pv. campestris. J. Bacterial. 176: 3354-3359 130

PAGE 150

CHAPTERS BACTERIOPHAGE GENE TRANSDUCTION IN THE MARINE ENVIRONMENT 5.1 Abstract To determine the potential for bacteriophage-mediated gene transfer in the marine environment, we established transduction systems using marine phage-host isolates The plasmid pQSR50 which contains tran s poson Tn5 and encodes kanamycin and streptomycin resistance was used in pla s mid transduction assays. Both marine bacterial isolates and concentrated natural bacte rial communities were u se d as recipients for transduction. Transductants were detected by a gene probe complementary to the neomycin phosphotransferase (nptll) ge ne in the Tn5. Transduction frequencies ran ged from 1.33 x 10-7 to 5.13 x 10-9 /pfu (plaque forming unit) in the bacterial isolates. For mixed bacterial communities putative transductants were detected at a frequency of 1 .58 x 10-8 to 3.7 x 10-8 / pfu For putative tran s ductants from natural populations, the pla s mid DNA recovered from transductants showed different restriction hybridization pattern s from the parental pla s mid DNA This modification may have been resulted from restriction modification recombination of the plasmid DNA with the recipient's genome 131

PAGE 151

or phage genome, or replication and transposition of transposon Tn5 sequence in the introduced plasmid The possibility of plasmid evolution during the process of transduction was discussed. Estimation of the transduction rate using a numerical model suggested that up to 1.3 x1014 transductants per year could occur in the Tampa Bay Estuary. The results of this study suggested that transduction could be an important mechanism for horizontal gene transfer in the marine environment. 5.2 Introduction A virus is little more than nucleic acid encapsulated in a protein coat. The recent discovery of the abundance of viruses in the marine environment also means that there is an abundant source of potential gene transfer vectors. In the process of viral propagation viruses transfer nucleic acid synthesized in one bacterium to another. If a virus infecting a new host contains genetic material from the previous host rather than its own DNA, the extra genetic information may become integrated into the new host, resulting in transduction. Bacteriophage-mediated horizontal transduction has been known for nearly half of a century (Zinder & Lederberg 1952). Transduction was found to occur in many phage host systems (Birge 1994) and well studied transduction systems have been routinel y used as molecular cloning tools (Sambrook et al. 1989). However, most transduction studies only focused on the development of tools for the better understanding of bacterial genetics (BuchananWollaston 1979 Sik et al. 1980 Barsomina et al. 1984 Martin & 132

PAGE 152

Long 1984, Finan et al. 1984, McHenney & Baltz 1988, Raya & Klaenhammer 1992, Weiss et al. 1994). The impact of phage transduction on the environment and microbial ecology was not an area of interest until very recently To assess the risk associated with the spread of genetically engineered microorganisms in the environment, the potential for gene transfer by transduction was studied in soil and freshwater environments Using an E. coli and phage PI transduction system, Zeph et al. (1988) studied the transduction in sterile and non-sterile soil. Their results demonstrated that transduction occurred in the soil and the resulting transductants also survived in soil environments for a period of 28 days. Almost all studies of transduction in aquatic environments were performed by Miller's group (see review by Miller, 1991). They demonstrated that both chromosomal and plasmid DNA of Pseudomonas aeruginosa was transduced during in situ incubation in a freshwater lake (Morrison et al. 1978, Saye et al. 1987, 1990). Cell-free phage lysates as well as temperate phages spontaneously released from lysogens were capable of transduction (Saye et al. 1987). Also, both lysogenic and non-lysogenic bacteria can serve as recipients but lysogenic recipients have higher transducing frequencies, possibly due to the lysogenic protection from lysis (Miller et al. 1991). More recently, Ripp et al. (1995) also suggested that the presence of suspended particulates in the water column facilitate transduction by bringing the host and phage into close contact with each other. Little has been known about transduction in the marine environment. Although transducing phages have been isolated from seawater previously (Keynan et al. 1974, Levisohn et al. 1987, Ichige et al. 1989), the focus of these studies was to develop a gene 133

PAGE 153

transfer system to study the genesis of Vibrio, rather than an investigation of the potential for gene transfer in the environment. Viruses are abundant and active members of microbial ecosystems. The dynamic interactions of these viruses with their hosts may contribute significantly to the genetic diversity and composition of microbial populations. For many years, gene transfer in the environment has largely focused on the process of conjugation (Gowland & Slater 1984 Bale et al. 1987, O Morchoe et al. 1988) and transformation (Stewart & Sinigalliano 1990, Paul et al. 1991, Frischer et al. 1993). Gene transfer via transduction was considered negligible because of the killing effect of phage infection (Miller et al. 1991 ). However Zeph et al. (1988) suggest that gene transduction is as important, or more so than conjugation and transformation in the environment. Compared to transformation transducing DNA is packaged inside phage capsids preventin g nuclease degradation Thus, viruses may serve as reservoirs for exogenous genes (Stotzky 1989) To estimate the potential for transduction in the marine environment we developed marine transduction systems u s ing marine phage-ho s t isolates. Transduction assays were performed using marin e bacterial i so lates as well as mixed natural bacterial communities as transduction recipients. This work establishes transduction as a mechanism for hori zon tal gene transfer amongst marine microbial communities. 134

PAGE 154

5.3 Material and Methods 5.3.1 Bacteria, Phages and Plasmids The bacteria, phages and pla s mids used in this study are li sted in Table 5.1. Marine bacteria HSIC and D1B were isolated from Mamala Bay, Hawaii on artificial seawater (ASWJP) agar plates conta ining 5g/L pept one and 1g/L yeast extract. HSIC is an unidentified gram negative coccus, while D1B is a gram negative slender rod identified to be Flavobacteria sp. using the API-NFT test kit ( B ioMerieux Viteck, Inc. MO). Phage and we re isolated using HSIC and D1B as hosts respectively. Both phages are temperate and contain doubles tranded DNA. Detailed information about these phages and their hosts appears in Chapter 4. E. coli RM1259 contains the plasmid pQSR50 which encodes antibiotic resistance to kanamycin and streptomycin. The kanamycin resistance gene nptii, is on the transposon Tn5. Detailed description of thi s plasmid and plasmid map can be found in Meyer et al. (1982). RM1259 was u sed as a plasmid donor in triparental mating. E. coli CA60 contains a conjugative plasmid, pNJ5000, which encodes tetracycline resistance. CA60 was u sed as a helper strain for triparental mating (Winstanley et al. 1989). HOPE-1 and HOPE-2 are wi ld type bacteria HSIC and D1B containing a plasmid pQSR50 respectively, which was introduced to these bacterial cells by triparental mating (see triparental mating below). 135

PAGE 155

Plasmid pQSR50 contains a Tn5 transposon insertion which encodes for neomycin phosphotransferase (nptll). Plasmid pNJ5000 has a mobilizing function and was used as a he l per plasmid for the mobilization of other plasmids Table 5.1 Bacteria Plasmids and Phage Used in This Study Strain or plasmid Description Source Bacteria HSIC Isolated from Mamala Bay HI Chapter 4 D1B Isolated from Mamala Bay, HI Chapter 4 E. coli K.mRSmR Meyer et al. 1982 RM1259(pQSR50) E. co li CA60(pNJ5000) TetR Winstanley et al. 1989 HOPEI HSIC (pQSR50) This study HOPE-2 D 1 B (pQSR50) This study Plasmids pQSR50 R1162 ::T n5 KrnRSmR Meyer et al. 1982 pNJ5000 TetRMob + Winstanle y et al. 1989 Phage Isolated from Mamala Bay, HI on Chapter 4 bacterial host HSIC Isolated from Mamala Bay, HI on Chapter 4 bacterial host D 1 B 136

PAGE 156

5.3 2 Triparental Mating The rifampicin-resistant mutants of bacteria HSIC and DIB were selected on ASWJP nutrient plates containing 500 j.lg/ ml of rifampicin and were used as recipients for triparental mating. One ml of overnight rifampicin-resistant cell culture was transferred to 10 ml of ASWJP nutrient broth containing 500 j.lg/ ml rifampicin, and incubated with shaking until optical density reached 0.8 at A600 One ml of this culture was mixed with one mllog phase plasmid donor strain E. coli RM1259 and one mllog phase helper strain E. coli CA60 in a sterile 15 ml tube. The mi x ture was filtered onto a 47 mm diameter 0.2j.lm-pore size filter at a vacuum of mm Hg. After filtration, the filter was placed on an ASWJP nutrient plate and incubated overnight at 28C The next morning, the filter was transferred to 5 ml artificial seawater medium in a sterile tube Cells were washed off by vortexing the filter for 30 sec The cell suspension was plated on ASWJP nutrient plates containing 250 j.lg/ ml kanamycin 250 j.lg/ ml streptomycin and 500 j.lg/ ml rifampicin These plates were incubated at 28 C for at least 48 hours. Colonies that grew on the selection plates were picked and confirmed to contain pQSR50 by colony hybridization plasmid prep and southern hybridization with radio-labeled npt II probe (see probe labeling below) The sensitivity of these plasmid containing bacterial hosts to their corresponding phages was tested via phage typing. T he HSIC strain containing plasmid pQSR50 was named HOPE I and the DIB strain containing plasmid pQSR50 was named HOPE-2 (Table 5.1) Both HOPE strains were used as donors for the transduction assays 137

PAGE 157

5.3.3 Transduction Assays A flow chart of the transduction assay is shown in Figure 5.1. HOPE strains were used as plasmid donors and transducing particles were produced by infecting the HOPE strains with their corresponding temperate phages by the soft agar overlay method. The phages were eluted from the plates after overnight incubation using warm 0.5 M Tris HCL (pH 8.0) A second round of phage lysate was produced with the same donor strain to ensure that the transducing particles contained DNA only from the donors (Miller 1992). The transducing lysates were 0.2 !J.m filtered to remove residual donor cells A subsample of the transducing lysate was treated with UV radiation (NIS G 15T8 15W germicidal lamp, peak wavelength at 256 nm) to reduce phage titer to 1% of the original (Miller 1992) UV -treated and untreated phage lysates were digested by 50 units / ml DNase I before use in the transduction assays to reduce the chance of transformation Both bacterial hosts isolated from Mamala Bay Hawaii and concentrated bacterial communities from Tampa Bay, Florida the Gulf of Mexico and Dry Tortugas Florida were used as recipient cells for transduction. For cultured recipients 10 ml to 100 mllogphase culture was mixed with transducing phage particles at a range of multiplicity of infection (MOl) from 0.01 to 10. The control treatment contained an equal volume of recipient cell culture and 1 ml of 0.5M pH 8.0 Tris-HCL. After a 10 min adsorption period the unabsorbed phages were removed by centrifugation and washing for three times The final washed cell pellet was resuspended in 0 5 to 1.5 ml ASWJP nutrient broth and cells were allowed to recover (phenotype expression) in this non-selective 138

PAGE 158

medium for 10-20 min before they were plated on selective seawater nutrient plates containing 250 J..Lg/ ml kanamycin and 250 J..Lg/ml streptomycin. The transducing phage lysate (no recipient) was also plated on selective plates as control. For transduction assays using indigenous marine bacterial communities as recipients, natural populations (20 to 100 liters of water) from a variety of marine environments were concentrated to approximately 50 ml by Vortex Flow Filtration using a 100 KD filter (Jiang et al. 1993) One ml of transducing phage lysate was added to 10 ml of the concentrated microbial populations and incubated at room temperature for 1 0 min to allow phage adsorption The mixture was then filtered onto a 47 mm 0.2 J..Lm-pore size filter. An equal volume of concentrated seawater was used as control. The filter was rinsed with sterile ASWJP to wash off the unabsorbed phages and transferred to 2 ml sterile ASWJP nutrient broth, in a tube Bacteria on the filter were resuspended in medium and the suspension was plated on selective medium plates containing 500 J..Lg/ml kanamycin and 1000 J..Lg/ ml streptomycin The phage lysate was also plated on selective plates as a no-recipient control. 139

PAGE 159

Transduction Systems HOPE strains (pQSR50) KmR SmR {Donor) Transducing lysates (pQSR50) Figure 5.1 Flow chart of transduction assays. 140 TefMob+

PAGE 160

5.3.4 Purification of Plasmid DNA and Gene Probe Construction Plasmid DNA from the E. coli strains and from marine bacteria were purified using the alkaline lysis mini prep method (Sambrook et al. (1989) or Promega Plasmid DNA Purification Preps (Promega Madison, WI). A BamH I and Hind III digested fragment of the neomycin phosphotransferase (nptll) gene of plasmid pQSRSO was cloned into Riboprobe vector pGEM 4Z (Promega, Madison WI) following the manufacturer's recommended procedure. A detailed description of cloning and the location of this fragment on the plasmid map is found in Frischer (1994). A 35S RNA probe was prepared by transcription of the fragment with T7 polymerase, using 3 5S UTP (Frischer et al. 1990). This probe termed "nptll probe according to the complementary gene sequence in the plasmid (Frischer et al. 1990) hybridizes with the Tn5 region of the plasmid. A 100 bp Ace I fragment of DNA was also cloned into a Riboprobe vector (Promega, Madison WI) A 35S labeled single-stranded RNA probe, termed T probe was made as previously described (Chapter 4). 5.3.5 Colony Lift, Dot Blot and Southern Hybridization Colonies grown on agar plates were l ifted by using a Magna charged nylon transfer membrane (MSI Westboro MA), and lysed by microwaving for 2 min on Ge l blot paper (Schleicher & Schuell Keene NH) soaked in 2xSSC (0.3 M NaCl 0.03M 141

PAGE 161

sodium citrate pH 7.0) containing 5% SDS (sodium dodecyl sulfate). The lysed colonies were then denatured on gel blot paper saturated with 1.5 M NaOH and 1.5 M NaC l and neutrali ze d to pH 8.0 by 0 5 M Tris.HCI. DNA was fixed on the membrane by bakin g in a vacuum oven at 80 C for 2 hr Plasmid DNA was dotted onto charged nylon membranes (Zetaprobe; BioRad Richmond, CA) using a BioRad Bio-Dot Microfiltration apparatus (BioRad, Richmond CA) DNA on the membrane was denatured neutrali ze d and fixed as previously described (Chapter 4) Southern transfer of DNA from agarose gels to charged nylon membranes (Zetaprobe; BioRad, Richmond, CA) was performed using the Sambrook et al. (1989) protocol for DNA transfer. Hybridization of DNA with the nptll probe or probe was performed at 42C overnight. The washing temperature was 65C as previou s ly described (Chapter 4) 5.3.6 PCR Amplification When natural bacterial communities were us ed as recipient s in the transduction assays, two sets of primers were employed in PCR amplification to detect the pQSR50 gene sequence and differentiate the putative transductants from the indigenous antibiotic resistant colonies. The primer locations and sequences are shown in Figure 5.2 and Table 5.2, respectively Primer s JP44 and JP52 were designed to amplify the Tn5 region of the plasmid which is the region that encodes for neomycin pho s photransferase. Primers JP64 and JP65 were used to amplify the region near the EcoR I s ite which i s the most di stant 142

PAGE 162

region from the Tn5 insertion site (Figure 5.2) The rational for this is to differentiate the presence of the Tn5 and the rest of the plasmid. Table 5.2 Oligonucleotides Used as PCR Primers. Primers JP44 JP52 JP64 JP65 Sequence 5'-3 GGGTCGGACGACAGGATGAGGATCGTTTCG CTCGGATCCAGCGGCGATACCGTAAAG GGATGCATTGAGCCAAATGAGGCGGTCACGC CTCGGATCCTGACGGGTGCCGGTATCAAACGC pQSR50 (14.4 kb) JP65 '-1----l JP64 Size(bp) Location 30 5473-5490 27 6214-6234 31 215-238 32 1410514128 Figure 5.2 Locations of PCR primers on plasmid map. Arrows indicate the primer direction. 143

PAGE 163

For amplification, the plasmid DNA was diluted 1 to 100 times with double distilled deionized water. PCR reactions (total 100 contained 10 mM Tris, 50 mM MgCls, 0.01% gelatin, 0.05% non-idet, 37 5 each of dNTP 200 nM of each primer approximately 1 ng of template, and 2 5 U Taq DNA polymerase. The Taq DNA polymerase was pretreated with the TaqStart antibody (Clontech, Palo Alto, CA) to reduce amplification artifacts. The reaction mix was overlaid with 3 drops of sterile mineral oil. Sterile DI was used as a template for a negative control. The PCR reaction cycle included a 96C 5 min hot start, 40 cycles at 96C for 45 sec, 58C for 1 min and 72 C for 1.5 min, and finally incubated at 72C for 10 min. The amplification products were analyzed by gel electrophoresis 5.4 Results 5.4.1 Establishing Indigenous Marine Phage-Host Transduction Systems To s tud y the potential for gene transduction among marine pha ges and bacterial hosts we attempted to establish transducing systems using marine phage-host isolates. Among the 4 marine phage-host systems isolated from Mamala Bay plasmid pQSR50 was successfully introduced into two ofthe bacterial ho sts and they were named HOPE-I and HOPE-2 (Table 5.3) 144

PAGE 164

Table 5.3 Construction of Transduction Donor Strains by Triparental Mating Wild Type Bacterial Strains Transduction Donor Strains Corresponding Phages HSIC HOPE-I (pQSRSO) DO not availab l e DIB HOPE-2 (pQSRSO) DIB D2S not available D2S The new HOPE strains grew more slowly than their wild type strains, possibly because of the burden of the new extra-chromosomal element. The plaquing efficiency of phage on the HOPE 2 strain was lower than on its wild type host because phage lysates collected from infection of HOPE 2 were often I 0 to I 00 times lower in titers than the lysates generated from infecting the D 1 B strain The sensitivity of the HOPE-I strain to its corresponding phage was basically unchanged and the HOPE-I strain yielded approximately the same number of viruses per infection cycle as when HSIC served as host. 5.4.2 Transduction Assays u sing Bacterial Isolates as Recipients Both UV treated and untreated transducing Iysates were used in transduction assays. Transducing lysates were more resistant to UV radiation requiring I I45

PAGE 165

mm of UV radiation at 464 mW / cm2 for a 2 log reduction of infectivity while transducing lysates were reduced by 2log of infectivity after 10 sec radiation. Putative transductant s were found in three treatments using HOPE-I as donor strains, UV-treated as transducing lysate and HSIC as recipient (Table 5.4). Only transduction assays using a low MOl of 0.01 to 0 05 showed detectable transductants, even though up to 5 MOi s were also tested. The frequencies of transduction in lab trials ranged from 1.33 x 10-7 to 5.13 xl0-9 per plaque forming unit (pfu) or 4 .02 x 10-10 to 6.8 x 10-10 per colony forming unit (cfu) Transduction frequencie s using the untreated HOPE-II and HOPE-2/ system were below the detection limit (see discussion) The putative transductants found on the selective plates coexisted with the phage. The colonies appeared wrinkled similar to th e colony morphology of the lysogen L HSIC (Chapter 4). Tran s ductants were confirmed by probing t he colony lift membranes with the nptii probe. Figure 5.3 shows the strong hybridization of the nptii probe with E. coli RM1259 donor HOPE-1 and the transductants. No hybridi za tion was observed in the wild type recipients, which suggests that plasmid DNA was introduced into the recipient s by phage transduction. 146

PAGE 166

Table 5.4 Marine Phage Transduction using Bacterial Isolates as Recipients Donors Transducing phages Recipients MOl Frequencies of Transduction HOPE-I UV treated THSIC (IOml) O.OI 5.13 x 10-9/PFU or 4.02 x lysat e 10-1 0 /CFU UV treated THSIC (IOOml) < 0 005 <2.6xi0-11/CFU l y sate HSIC (100rnl) O.OI 1.33 x 10-7/PFU or 6.8 x 10-1 0/CFU UV treated THSIC (lOOml) 0.05 1.33 x 10-8/ PFU or 6.8 x lysate 10-10/CFU HSIC (IOOml) 0 5 <2.6xi0-11/PFU HOPE-I untreated HSIC (10ml) O.OI-IO 1ND lysate HOPE-2 UV treated and DIB (IO ml) O.OI-5 ND untreated l ysate Not detected 14 7

PAGE 167

F i gure 5.3 Colony hybridization of transduction assay using marine bacterial isolate as recipient. a) E. coli RM1259. b) HOPE-I donor. c). HSIC recipient d). transductant. 148

PAGE 168

5.4.3 Analysis of Plasmid DNA from Transductants To ensure that the transferred plasmid DNA was maintained as a plasmid in the transductants, plasmid DNA's extracted from E. coli RM1259, donor strains, recipient strains and transductants were dotted on nylon membrane and probed with the plasmid nptll probe (Figure 5.4) Hybridization of the probe with E. coli RM1259, donor and all transductants' plasmid DNA preps were observed in the autoradiograph. No hybridization with the plasmid DNA from the recipient HSIC was found. This result suggests that the transferred plasmid DNA was maintained as an extra-chromosomal element in the transductant' s ce ll. C'd ..c () "0 Q) +-' +-' +-' +-' +-' c c c c c C'd C'd C'd C'd C'd +-' +-' +-' +-' +-' +-' () () () () () 0> c l{) Q) "0 "0 "0 "0 "0 "-C\1 0 a. CJ) CJ) CJ) CJ) CJ) or-c (3 c c c c c 0 Q) C'd C'd C'd C'd C'd "-""-""-a: 0 a: 1-1-111- Figure 5.4 Dot blot hybridization of plasmid DNA from E. coli RM1259, donor (HOPE-1), recipient (HSIC) and transductants with nptll probe. 149

PAGE 169

M 1 2 3 4 56 7 8 9 10111213141516M Figure 5.5 Restriction pattern of plasmid DNA fro m HOPE-I HSIC and transduc tants. Lanel-4 plasmid DNA from don or HOPE-1 Lane 5-8 plasmid DNA from recipient HSIC Lane 9-12 plasmid DNA from transductant a Lane 13-16 plasmid DNA from transductant b. Lane 1, 5, 9, 13 uncut plasmid DNA. Lane 2, 6, 10, 14 EcoR I cut Lane 3 7, 11, 15 EcoR I and BamH I cut, Lane 4 8, 12, 16 Hind III cut. M is Hind ITT digested lambda phage DNA molecular weight marker (kb ). M 1 2 3 4 5 Figure 5.6 Restriction pattern of pQSR50 Lane 1 uncut plasmid DNA, lan e 2 Hind III cut lane 3 Bgl II c ut lane 4 EcoR I cut, lane 5 EcoR I & BamH I cut. M is Hind III digested lambda phage DNA molecular weight marker as in Figure 5 .5. 150

PAGE 170

The restriction patterns of the plasmid DNAs from transductants, donors and recipients were analyzed to determine similarities and differences between theses cells The wild type recipient HSIC contained a plasmid upon isolation, as indicated by the plasmid bands shown in the agarose gel (Figure 5.5, lanes 5 to 8) EcoR I digested this plasmid into two fragments of 15 kb and 4.3 kb; EcoR I and BamH I double digestion yielded three fragments : 10.5 kb, 5.6 kb and 4.3 kb, respectively Hind III cut this plasmid DNA into a 15 kb and a 4.6 kb fragment. The molecular weight of this native plasmid was about 20 kb as determined by restriction fragments. Judging from the DNA yield of the plasmid preps the wild type HSIC contains a high copy number of this native plasmid. Comparing the restriction patterns of the native plasmid with pQSR50 (Figure 5.6) shows that many restriction fragments digested with the same enzymes were similar in size (Table 5.5). Therefore, the presence of pQSR50 DNA was unable to be d e tected from the agarose gel by using re s triction patterns. Restriction patterns of plasmid DNA from the transductants were remarkably similar to those from the wild type recipients (Figure 5.5). Only a 11 kb and a 3.4 kb Hind III digested fragment of pQSR50 could be differentiated from the Hind III digested native plasmid (Table 5.5). These two extra bands were seen in the Hind III digested plasmid DNA of donor s train (Figure 5.5 lane 4) but were barely visible in the plasmid DNAs of the transductants possibly because of the low copy number of the transduced pQSR50. One extra 13 kb band was also observed in the EcoR I and BamH I double digested donor plasmid DNA. The source of this band wa s uncertain It may have resulted from pQSR50 recombination with the helper plasmid 151

PAGE 171

during triparental mating or perhaps recombination with the native plasmid inside the new host. Table 5.5 Comparing Restriction Patterns ofHSIC Native Plasmid and Plasmid pQSR50. Plasmids EcoR I native plasmid in HSIC 15kb, 4.3kb pQSR50 14.4kb Restriction Enzymes EcoR I & BamH I 11.3kb 5.7kb, 4.3kb 1 0.2kb, 4.2kb Hind III 15kb, 4.6kb llkb, 3.4kb To assay the restriction patterns of the transduced plasmid Hind III digested and undigested plasmid DNAs from transductants donors, recipients and E. coli RM1259 were so uth ern transferred to nylon membrane and probed with the radio-labeled nptll probe. Figure 5 .7 shows the autoradiograph of the southern hybridization. The h ybridization patterns of the digested and undigested transductant plasmid DNA were identical to those of the donor plasmid DNA but were different fro m those of the pQSR50 in E. coli RM1259. One l arge hybridization band was missing from the undigested pQSR50 in E. coli RM 1259, indicated by a arrow in Figure 5.7. This change in plasmid banding pattern may have resulted from the transposition of Tn5 from the pQSR50 plasmid to an indigenous plasmid of the wild type bacteria. Alternately some kind of recombination may have occurred between the transferred plasmid, host genetic elements or phage DNA, or perhaps the plasmid was maintained as a multimer in the marine bacteria but not E. coli. We also noticed a modification in all our plasmid preparations. According to the plasmid pQSR50 gene map (Frischer 1994), Hind III digestion of this plasmid should 152

PAGE 172

generate a single 3.4 kb diagnostic band to hybridize with the nptll probe. In all Hind III digested plasmid DNA including pQSR50 from the parental RM 1259, an unexpected 1.2 kb band was found to hybridize strongly with the probe. This southern hybridization was performed several times using plasmid DNA extracted by different methods, and the presence of this 1.2 kb band was confirmed. Although the reason for this band is unknown, a similar hybridization pattern of Hind III digested pQSR50 was also seen by Haydn Gregg Wiliams (personal communication). No hybridization with either the uncut or Hind III-cut plasmid DNA of the recipient was observed. A replicate southern transfer of plasmid DNAs was probed with the probe and a 9 kb Hind III fragment was found to hybridize in all digests of transductants' plasmid DNA (Figure 5.8), while no hybridization was found in plasmid DNA from the donor, recipient or E. coli RM1259. This result suggests that all of the transductants were lysogenized. However, whether the transduction and lysogenization occurred simultaneously with pQSR50 DNA and phage DNA entering the cell from a single transducing phage particle, or in a sequential process involving more than one phage is not known. The molecular weight of the genome and plasmid pQSR50 is 37 kb and 14.4 kb, respectively. Therefore, it is possible for a phage particle to contain both a plasmid DNA and a part of the phage genome. However, other possibilities are equally likely To confirm lysogenization, all putative transductants were tested for sensitivity to the and all were found resistant. 153

PAGE 173

M 1 2 3 4 5 6 7 8 9 1 0 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 23-9.4-6 .5-2.3-2 .0-. . ;-igure 5.7 Southern hybridization of undigested and Hind III digested plasmid DNA from transductants, E. coli RM1259 . . lonor (HOPE-1) and recipient (HSIC) with nvtll probe. Lane 1-20 plasmid DNA from transductants, Lane 21-22 . . 1lasmid DNA from E coli RM1259, Lane 23-24 plasmid DNA from donor (HOPE-I), Lane 25-26 plasmid DNA from recipie HSIC). Odd numbered lanes are undigested plasmid DNA, even numbered lane s are Hind III di gested DNA. M is molecular veight marker (kb ).

PAGE 174

M 23-9.4-6 .5-2 .3-2.0-1314151617181920212223242526 . . . : igure 5.8 Southern hybridization of undigested (odd mumbered lanes) and Hind III digested (even number lanes) lasmid DNA from transductas, E. coli RM1259. donor and recipient with riboorobe. . :ample in each lane is as indicated in Figure 5.9. Odd lane s undigested. even lanes Hind III digested. M is . 1olecular weight marker (kb ).

PAGE 175

5.4.4 Transduction Assays using Indigenous Bacterial Communities as Recipients To understand the potential for transduction in the marine environment concentrated bacterial communities from a variety of marine environments were used as transduction recipients. Among the six samples collected from Tampa Bay Florida the Gulf of Mexico and Dry Tortugas Florida, colony hybridization with the nptll probe was detected in 4 of the indigenous bacterial communities without adding transducing phage making it impossible to detect transductants in these samp le s using the current detection method Potential transduction was found in 2 ex periments (Table 5 6) using the bacterial recipients collected from the Mouth of Tampa Bay and the deep-sea environment of the Gulf of Mexico The indigenous bacteria from these two locations did not hybridize with the nptll probe before adding transducing pha ges (Figure 5 .9), but hybridization positive after transduction assays using the transducing lysate or the UV-treated transducing lysate, respectively. The frequen c ies of transduction m these bacterial communities ran ge d from 1.57 to 3 7 x 10-8/ pfu (Table 5.6). 156

PAGE 176

Table 5.6 Transduction using Concentrated Marine Bacterial Communities as Recipients Recipient Donors Transducing Transduction Transduction Sampling Sites Phages Frequencies (/pfu) Detection limit ( / pfu) Mouth of Tampa HOPE-I not detected 1.74 X 10-IO Bay 1.74 X 10-IO (27 35' ,82 ') HOPE-I UV not detected HOPE-2 1.57 X 10-8 1.74 X 10-IO Gulf of Mexico HOPE-2 & UV Presence of sequences homologous to (27' ,8378') nptii in the indigenous population Gulf of Mexico HOPE-2 & UV Presence of sequences homologous to ChlaMax nptii in the indigenous population (25,84) 3.7 X 10-8 Gulf of Mexico HOPE-2 not detected 1500m Deep Sea 3.7 X 10-8 3.7 X 10-8 (24' ,85 32') HOPE-2 UV African Reef, HOPE-I & UV Presence of sequences homologous to Loggerhead Key nptii in the indigenous population (24 82 56') HOPE-2 & UV Presence of sequences homologous to nptii in the indigenous population Wreck, HOPE-2 & UV Presence of sequences homologous to Loggerhead Key nptii in the indigenous population (24 39 82 56') I 57

PAGE 177

Figure 5.9 Colony hybridization of transduction assay using indigenous bacterial communities from Tampa Bay as recipients. a). no-lysate-added control, b ). trans duction with HOPE-2 / T-ID1b, c). transduction with HOPE-1/T--ISIC d). trans duction with UV tre ated HOPE-1/T-
PAGE 178

To confirm that the putative transductants detected in the transduction assay trul y contained the genetic marker pQSR50 rather than pre-existing similar gene sequence plasmid DNA from the control colonies (antibiotic resistant indigenous recipient s but non-hybridizing with plasmid probe) and putative transductant s were used for PCR amplification. Figure 5.1 Oa shows the amplification using the primer pair JP44 and JP52 which specifically amplifies the Tn5 region of the pQSR50 plasmid Amplification products were only observed when the transductant plasmid DNA and pQSR50 DNA were used as templates. These products also hybridized with the nptll probe (Figure 5.1 Ob ). Amplification products or hybridization signals were not found using the plasmid DNA of the control colonies. In an attempt to differentiate the nptii hybridization positive indigenous bacteria found in so me marine environments ( 4 of the 6 samples collect ed) from the putativ e transductants plasmid DNA extracted from these indigenous bacteria were used for PCR amplification with JP44 and JP52. However this approach was unsuccessful because all indigenous bacterial plasmid yield amplification products similar to tho se of the putativ e transductants. Four-base-pair cutter sc reening confirmed that these amplification product s were identical (Figure 5.11) which suggests that Tn5-like genes are widely spread in the environment. Therefore, the Tn5 gene may not be a good genetic marker for detecting gene tran sfe r in the marine environment. 159

PAGE 179

1 2 3 4 5 6 7 8 9 10 11 12 13 14 M Figure 5.10a PCR amplification using primer JP44 and JP52. Template DNA are from plasmid DNA of transductants (lane 1-7); plasmid DNA of indigenous antibio tic resistant bacteria (lane 8 12); pQSR50 (lane 13); DI negative control (lane 14) M is molecular weight marker from top to bottom (bp) 1000 750 500, 300 150 160

PAGE 180

M 1000-750-500-300-1501 2 3 4 5 6 7 8 9 10 11 12 13 14 . . igure 5.10b Southern tran sfer ofDNA from Figure 5.10a and probed with notTI probe. M is molecular . r eight marker (bp )

PAGE 181

1 2 3 4 5 6 7 8 9 10 1112 M 1000 750 500 300 150 50 Figure 5 .11 Screening JP44 and JP52 PCR amplification products by 4 base pair cutter restriction enzymes digestion. Plasmid DNA templates for amplification were from indigenous bacteria isolated from Dry Tortugas, Florida (lane 1-3) the Gulf of Mexico (lane 4-6) a transductant (lane 7-9) and donor strain HOPE-2 (lane10-12) Lane 1, 4, 7 10 were uncut. Lane 2, 5, 8, 11 were cut withNla III. Lane 3 6 9, 12 were cut with Mae I. M is molecular weight marker (bp ) 162

PAGE 182

1 2 3 4 5 6 7 8 9 10 11 12 13 14 M 1000 750 500 300 150 Figure 5 12 PCR amplification using primer JP64 and JP65. Template DNA were from plasmid DNA of transductants (lane 1-7); indigenous antibiotic resistant bacteria (lane 8-11); pQSR50 (lane 13) and DI negative control (lane 14). M is molecular weight ladder (bp ) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 M 1000 750 500 300 150 Figure 5.13 EcoR I dige s tion of JP64 and JP65 PCR amplification product s from Figure 5.12. Lane 1-10 amplification products oftransductants; lane 11, 12 ampli fication products from indigenous antibiotic resistant bacteria; lane 13 and 14 am plification product of pQSR50 Odd numbered lanes are uncut even number lanes are EcoR I digested samples M is molecular weight ladder (bp). 163

PAGE 183

Primers JP64 and JP65, designed to specifically amplify a 635 bp region of pQSR50 containing a EcoR I site (Figure 5 2) were also used to amplify the plasmid DNA from the transductants and control colonies. Amplification products of approximately 700 bp in size were observed in the plasmid DNA of the transductants and pQSR50 (Figure 5.12). However, the transductant's plasmid amplification products were slightly larger than the pQSR50 amplification product, and seemed to have lost the EcoR I site (Figure 5 13). They were resistant to EcoR I digestion while the amplification product of pQSR50 digested into two fragments (Figure 5 13) Other small faint bands were also observed in the amplification products using the transductant's plasmid DNA as well as the plasmid DNA from the control colonies. However, the single small weak band found in the control colony amplification product was different from both the transductant' s plasmid amplification products and the pQSR50 amplification products. These results suggest that a genetic similarity exists between the transduction recipient and the pQSR50 sequence. The plasmid pQSR50 may have recombined with indigenous extra chromosomal element(s) and the restriction site may have been lost during the process The presence of similar gene sequences in the recipient cells may have also been a factor facilitating the transduction process. Primer pair JP64 and JP65 were also used to amplify plasmid DNA from nptii hybridization positive indigenous bacteria and no hybridization products were found This result suggests that the indigenous bacteria were different from the putative transductants. Only putative transductants contained the gene sequences similar to the region near EcoR I restriction site of the pQSR50 plasmid. 164

PAGE 184

5.5 Discussion Transduction assays using the indigenous marine phage-host isolates and mixed bacterial communities as recipients suggest that transduction can be a means of gene transfer in the marine environment. This is the first attempt to study the potential for transduction in mixed bacterial communities. Ackermann and DuBow (1987) suggest that transduction can occur in all phage-host systems because mistakes in phage replication are made in all systems. However, the frequencies of transduction are often below the detection limit or there is not a genetic marker to be detected The use of UV radiation treated-transducing lysates may have increased the frequency of transduction. Many studies have shown that UV treatment of transducing lysates increases the frequencies of transduction from 10 to 50-fold (Miller 1992) The effect of UV radiation may be due to the inactivation of killing effects of the infectious bacteriophage particles that are present in the lysate (Ely & Johnson 1977, Buchanan Wollaston 1979). Alternatively it has been suggested that this treatment stimulates recombination within the recipient cell which leads to increased incorporation of the transduced DNA into the recipient's genetic elements (Benzinger & Hartman 1962) Sandri and Berger (1980) showed that only about 10 % of the P 1 transducing DNA injected into a recipient cell was ever stably maintained in the cell. Recombination with the recipient native genetic elements could increase the stabi li ty of the introduced DNA. Therefore, the presence of gene sequences similar to that of the introduced DNA in the recipient cell may increase the transduction frequency via recombination. The gene 165

PAGE 185

process, pQSRSO was transferred to the marine host by conjugation in the presence of another mobilizing helper plasmid. By recombination with the helper plasmid plasmid pQSR50 may be modified before entering the marine host. Secondly, plasmid modification could occur after entering the marine host by recombining with its native plasmid, or perhaps the transposon Tn5 region of the plasmid translocated to other genetic elements. In the HOPE-l/T-$HSIC system, the modification seemed to occur in one of these two steps because modifications were detected in donors before they were used for transduction. Also, the plasmid hybridization patterns were similar between the transductants and the donor strain. A third way plasmid DNA modification could occur is during the transducing phage packaging process. In this case plasmid DNA may recombine with phage DNA and become packaged into transducing particles as a chimera. Finally, modification could also occur in the transduction recipient by recombination with the native plasmid or even the host chromosomal DNA Alternatively restriction/modification systems may pla y a role in the rearrangement of the transferred plasmid DNA. In the HOPE-2/ T-$DIB transduction system the plasmid modification seemed to occur in the latter two steps. The shared genetic homology between the transduced plasmid and the native genetic elements may have increased the recombination rate. Colony h ybridization and PCR amplification confirmed the existence of genetic homology with pQSRSO in indigenous marine populations. In fact 4 of the 6 samples of bacterial community contained similar gene sequences with the nptll gene, making it difficult to detect transduction of pQSRSO DNA in the natural communities No 167

PAGE 186

sequences similar to the pQSR50 DNA were observed in the indigenous bacterial communities in this study, which may have facilitated the plasmid transfer to the natural communities. However, on the other hand, the presence of these similar gene seq uenc es in the indigenous bacteria makes it difficult to confirm transduction ever occurred in the indigenous community. 5.5.1 Transduction as a Possible Mechanism for Plasmid Evolution Plasmid DNA extracted from the transductants showed different hybridization patterns from the plasmid transduced. This phenomenon was also observed during plasmid transformation assays using pQSR50 (Frischer et al. 1994). Plasmids represent a group of extra-chromosomal elements. They are capable of self replication and are genetically more flexible than chromosomal DNA As long as the replication functions remain, additional genes can be added, deleted, rearranged or modified by different restriction/modification systems In most cases, this has only minor effects on the plasmid and bacterial host (Frischer 1994). In fact, plasmid pQSR50 is constructed from plasmid R 1162 with a transposon Tn5 insertion (Meyer 1982) Frischer ( 1994 ) suggested that plasmids evolve during the gene transfer process to adapt to their new hosts However the mechanism for plasmid evolution may be significantly different in the transformation process and in the transduction process. During transduction, plasmid modification could occur in several ways. Plasmid pQSR50 was first introduced into marine bacteria by triparental mating. During this 166

PAGE 187

hybridization with the nptll probe was found in the two other bacterial communities. However, they contained gene sequences which can be amplified by primers JP64 and JP65 (Figure 12), suggesting genes similar to the region near the EcoR I restriction site of the pQSRSO exist i n these bacterial communities The presence of these similar gene sequences in the indigenous bacterial communities on one hand, theoretically increases the frequency of transduction via recombination However on the other hand, we wondered whether transduction truly occurred in the indigenous population or pre existing gene sequences in the indigenous bacteria were selected by the assay method 5.5.2 The Potential for Gene Transduction in the Marine Environment Both viruses and bacteria are abundant and active in the marine environment. Lysogenic bacteria were also recently shown to be an important component of marine bacterial communities (Chapter 2 & 3) It is reasonable therefore to believe that transduction occurs in natural marine microbial population To predict the potential rate of transduction in the marine environment, we constructed a simple model using the following factors: bacterial abundance, viral abundance and the frequencies of transduction. Previous transduction assays (Keynan et al. 1974, Svab et al. 1978 Morgan 1979, Ripp et al. 1994) and transduction assay presented in this study suggested that transduction frequency is a function of MOl and this function is most similar to a second order polynomial function (Y=d+bX+c). Using transducing frequencies and MOl data presented in Table 5.4, we predicted the second order polynomial equation using 168

PAGE 188

Microsoft Excel spreadsheet (Microsoft Corp. USA) The relationship between transduction frequencies and MOl is expressed in Figure 14 and the numerical model is shown by equation (5.1) Ft=(2x10-8 ) M + 1x10-8 M + 3x10-10 1 60E-09 c 1.40E-09 0 :0::: (,) 1 20E-09 ::l "0 en 1 00E-09 c E B .OOE-10 .. 1-0 S .OOE-10 >o (,) 4 00E-10 c Cll ::l 2.00E-10 C" u.. O OOE+OO 0 0 1 y = -2E-08x2 + 1 E-08x + 3E-1 0 R2 = 0 567 0 2 MOl 0 3 0.4 0 5 (5.1) Figure 5.14 Transduction frequency and MOL Trendline is predicted using second order polynomial function in Microsoft Excel spreadsheet. Ft represents frequency of transduction and is rewritten as the ratio of number of tansductants (T) and number of recipient bacteria (B). M represents MOl which is the ratio of phage concentration (P) over recipient bacterial concentration (B). Therefore the numerica l model of transd u ction can be expressed by the following equation (5.2) T =(2x10-8 ) ( p )2 + (1x10-8 ) ( p) + (3x10-10 ) B B B (5.2) and T = (2x10 -8 ) P2/B + (1x10-8 ) P + (3x10-10 ) B (5.3) 169

PAGE 189

Assuming n types of phage-host systems in the marine environment and all systems fit to our model of transduction established from the marine phage-host isolates, II then the total number of transductants ( Tt = L Ti) can be modeled by the following equation (5.4) tJ II L Pi and L Bi equal the total viral number (Pt) and the total bacteria (Bt) respectively i=l i=l in an environment. Therefore equation (5.4) can be rewritten to be (5. 5) (5. 5) In any microbial system Pi ranges from 1 to the maximal of the total viral density Bi ranges from the below the threshold density for supporting viral replication to the maximal of the total bacterial concentration. Wiggins & Alexander (1985) suggested that the threshold density for bacterial hosts to support viral replication is about 1 04/ ml in the aquatic environment. Using bacterial and viral abundance of 2x 1 09 1L and 1010 /L respectively, in the Tampa Bay, Florida (Jiang & Paul, 1994), the total number of transductants in one liter of Tampa Bay water per day is calculated from the equation (5.5). The results range from negative values to 100/L per day. The negative numbers resulted when one type of phage abundance is more than 50% of it's host abundance ( ;: > 0. ). The maximum number resulted when the host population is maximum and phage is lowest. Assuming negative values represent 0 transductant then from 0 to 1 00 170

PAGE 190

transductants can occur in one liter of water in one day in the Tampa Bay environment. Extrapolating this transduction rate to the ecosystem scale of Tampa Bay estuary transduction rates up to 1.3 x1014 transductants per year is calculated. This is the first attempt to quantify transduction rates in the marine environment. The model is based on several assumptions. For example, the model assumes that all marine phages are infective. However, Suttle and Chan (1992) suggested that a large number of phages in the environment were uninfectious because they were inactived by solar radiation Furthermore we assumed that all phage-host systems in the marine environment fit to the transduction model generated from a single phage-host system which is unlikely. Other marine phage transduction systems may have generated slightly different numerical models In fact, higher transduction frequencies per MOl were detected in a marine Vibrio phage transduction system (Ichige et al. 1989). In addition, to simplify the model, many factors which may influence the transduction rate were not considered in the model, including temperature ionic strength, effect of predation on marine bacteria, and the non-specific attachment of phage to other particles. To ach i eve a more closely fitting transduction model in the marine environment, several marine phage host transduction systems should be used to generate polynomial empirical curves and equations, and all the factors mentioned above should be integrated into the model. However, in spite of these limitations in our current transduction model, this quantitative estimation is important to our understanding of the potential for transduction in the marine microbial system. 171

PAGE 191

In summary, this research has demonstrated the potential for bacteriophage mediated gene transfer in the marine environment. Gene transfer by transduction may be an important mechanism for gene evolution in the marine environment and bacteriophage transduction could play an important role in contributing to genetic diversity of marine microbial populations. 172

PAGE 192

References Ackermann, H. W., DuBow, M. S. (1987). Viruses of prokaryotes. Vol. 1. General Properties of bacteriophages. CRC Press Boca Raton. Bale M. J ., Fry J. C., Day, M J. (1978) Plasmid transfer between strains of Pseudomonas aeruginosa on membrane filters attached to river stones. J Gen Microbial. 133: 3099-3107 Bar s omina G.D., Robillard, N. J., Throne, C.B. (1984) Chromosomal mapping of Bacillus thuringiensis by transduction. J. Bacterial. 157 : 746-750 Benzinger T., Hartmen P. E. (1962) Effect of ultraviolet light on transducing phage P22 Virology 18: 263-268. Birge E. A. (1994). Bacterial and bacteriophage genetics. 3rd edition. Springer-Verlag New York. BuchananWollaston V. (1979). Generalized transduction in Rhi z obium leguminosarum. J. Gen Microbial. 112: 135-142 E ly, B., John so n R. C. (1977). Generali z ed transduction in Ca uloba c t e r crescentus. Genetics. 87: 391-399 Finan, T. M., Hartwieg E LeMieux, K. Bergman, K. Walker, G. C., Signer, E. T. (1984). General transduction in Rhi z obium meliloti. J. Bacterial. 159: 120-124 Fri s cher, M. E. Thurmond J. M. Paul, J. H. (1990). Natural plasmid transformation in a high-frequency-of-transformation marine Vibrio strain. Appl. Environ. Microbial. 56: 3 439-3444 Frische r M. E., Thurmond, J. M. Paul J. H. (1993) Factor s affecting competence in a high frequency oftransformation marine Vibrio. J. Gen. Microbial. 139: 753-761 Frischer, M. E., Gregory G. J. Paul J. H.(1994). Plasmid transfer to indigenous marine bacterial populations by natural transformation. FEMS Microbial. Ecol. 15: 127136 Gowland, P C., Slater J. H (1984). Transfer and stability of drug resistance plasmid s in Escherichia coli K12 Microbial. Ecol. 10: 1-13 173

PAGE 193

Ichige, A., Matsutani, S., Oishi, K., Mizushima, S. (1989). Establishment of gene transfer systems and construction of the genetic map of a marine Vibrio strain. J. Bacterial. 171: 1825-1834 Jiang, S. C., Thurmond, J. M., Pichard, S. L., Paul, J. H. (1992). Concentration of microbial populations from aquatic environments by Vortex Flow Filtration Mar. Ecol. Prog. Ser. 80: 101-107 Jiang, S.C., Paul, J. H. (1994). Seasonal and diel abundance of viruses and occurrence of lysogeny/bacteriocinogeny in the marine environment. Mar. Ecol. Pro g. Ser. 104: 163-172 Keynan, A., Nealson, K., Sideropoulos, H., Hastins, J. W. (1974). Marine transducing bacteriophage attacking a luminou s bacterium J. Virol. 14 : 333-340 Levisohn, R., Moreland, J., Nealson, K. H. (1987). Isolation and characterization of a generalized transducing phage for the marine luminou s bacterium Vibrio jischeri MJ-1. J. Gen. Microbial. 133: 1577-1582 Martin, M. 0., Long, S. R. (1984). Generalized transduction in Rhizobium m eliloti J. Bacterial. 159: 125-129 Meyer, R., Laux, R., Boch, G., Hinds, M. Bayly, R., Shapiro, J. A. (1982). Broad-host range IncP-4 plasmid R1162 : effects of deletions and insertions on plasmid maintenance and host range. J. Bacterial. 152 : 140-150 McHenney, M. A., Baltz, R. H. (1988) Transduction of plasmid DNA in Strptomyces spp. and related genera by bacteriophage FP43. J. Bact erial. 170: 2276-2282 Miller, R. V., Ripp, S., Replicon, J., Ogunseitan, O.A., Kokjohn, T.A. (1991). Virus mediated gene transfer in freshwater environments. In: Gene transfer in the environment. Proceedings of third E urop ean meeting on Bacterial Genetics and Ecology (BAGEC0-3), 20-22 Nov. 1991. eds Michael J. Gaut hier. Villefranche Sur-Mer, France. Miller, R. V. (1992). Methods for evaluating transduction: an overview with environmental considerations. In : Microbial Eco lo gy, principles, methods, and applications. eds by Morris A. Levin, Romon J. Seidler and Marvin Rogul. McGraw-Hill, Inc New York. Morgan, A. F. (1979). Transd uction of Pseudomonas aeruginosa with a mutant o f bacteriophage E79. J. Bacterial. 139: 137-140 Morrison, W. D., Miller, R.V., and Sayler G.S. (1978). Frequency of F116-mediated transduction Pseudomonas aeruginosa in a freshwater environment. Appl. Environ. Microbial. 36: 724-730 174

PAGE 194

O'Morchoe, S., Ogunseitan, 0., Sayler, G. S. Miller, R. V. (1988) Conjugal transfer of R68.45 and FP5 between Pseudomonas aeruginosa in a natural freshwater environment. Appl. Environ Microbial. 54: 1923-1929 Paul J. H Frischer M.E. Thurmond, J. T. (1991). Gene transfer in marine water column and se diment microcosms by natural plasmid transformation. Appl. Environ. Microbial 59 : 718-724 Raya, R. R., Klaenhammer, R. (1992). High-frequency plasmid transduction by Lactobacillus gasseri bacteriophage Madh. Appl. Environ Microbiol. 58: 187-193 Ripp, S., Miller, R.V. (1995). Effects of suspended particulates on the frequency of transduction among Pseudomonas aeruginosa in a freshwater environment. Appl. Environ. Microbial. 61 : 1214-1219 Ripp, S., Ogunseitan, O.A Miller, R.V (1994) Transduction of a freshwater microbial community by a new Pseudomonas aeruginosa generalized transducing phage UTI. Molecular Ecol. 3: 121-126 Sam brook, J. Fritsch, E. F., Maniatis, T. (1989). Molecular cloning: a laborat ory manual 2nd ed Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Sandri, R. M. Berger, H. (1980) Bacteriophage PI-mediated generalized transduction in Escherichia Coli: Fate of transduced DNA in Rec + and RecA recipients. Virology 106:14-29 Saye, K. J. Ogunseitan 0. Sayler, G. S., Miller R. V. (1987). Potential for transduction of plasmids in a natural freshwater environment: effect of plasmid donor concentration and a natural microbial community of transduction in Pseudomonas aeruginosa. Appl. Env iron Microbial 53: 987-995 Saye D. J., Ogunseitan, 0., Sayler, G. S., Miller R.V. (1990) Transduction of linked chromosomal genes between Pseudomonas aeruginosa strains during incubation in situ in a freshwater habitat. Appl. Environ. Microbial. 56 : 140-145 Sik, T., Horvath, J., Chatterjee S. ( 1980). Generalized transduction in Rhizobium meliloti. Mol. Gen. Genet. 1 78; 511-516 Stewart, G. J. Sinigalliano, C. D. (1990). Detection of horizontal gene transfer by natural transformation in native and introduced species of bacteria in marine and synthetic environments. Appl. Environ Microbial. 58: 1818-1824 175

PAGE 195

Stotzky, G. (1989). Gene transfer among bacteria in soil. In Gene transfer m the environment, S. B. Levy R .V. Miller eds. Me Graw-Hill, NY. p 165-222 Suttle C.A. Chan, F (1992). Mechanisms and rates of decay of marine viruses m seawater. Appl. Environ Microbial. 58: 3721-3729 Svab Z. Kondorasi, A., Oros z, L. (1978). Specialized transduction of cysteine marker b y Rhizobium meliloti phage 16-3. J. Gen. Microbial. 106 : 321 327 Weiss B D Capage, M. A., Kessel. M. Benson S. A. (1994). Isolation and characterization of a generalized transducing phage for Xanthomonas ca mpe stris pv. campestris. J. Bacterial. 176: 3354-3359 Wiggins B.A. Alexander M. (1985). Minimum bacterial density for bacteriophage replication: implications for significance of bacteriophages in natural ecosystems. Appl. Environ. Microbial. 49 : 19-23 Win s tanley C., Morgan J. A. W Pickup, R. Jone, J. G ., Sauders, J. R (1989). Differential regulation of lambda PL and PR Promoters by a ci repressor in a broad-host-range thermoregulated plasmid marker sys tem. Appl. Environ. Microbial. 55: 771-777 Zeph, L. R., Onaga, M. A., Stotzky, G. (1988). Transduction of Escherichia coli b y bacteriophage P 1 in so il. Appl. Environ. Microbial. 54: 1731 173 7 Zinder, N. D. Lederberg J. (1952). Genetic exchange in Salmonella J. Bacterial. 64 : 679-699 176

PAGE 196

CHAPTER6 SUMMARY AND DISCUSSION Our current understanding of the significance of bacteriophage in the marine environment has evolved dramatically over the past 50 years when the first bacteriophage was isolated from seawater (ZoBell 1946) Many of the studies on marine viruses came to light only within the past 10 years. Using the direct count technique, the abundance and distribution of marine phage have been surveyed in almost every ocean, including the Arctic and Antarctic regions (Chapter 1) with reported viral abundance ranging 104 to over 108 /ml of seawater. Furthermore, marine viruses were also shown to contribute significantly to the mortality of marine microbial populations (Chapter 1 ), suggesting that viruses are an important component of the microbial loop. The aim of this chapter is to summarize all the studies reported in this dissertation and place each individual chapter into an integrated picture of viruses in the marine environment". My dissertation project "Lysogeny and Transduction in the Marine Environment" was developed from a previous study of the ecological roles of viruses in the marine environment. We have shown that viruses are abundant and dynamic members of the microbial community and that viral abundance is strongly correlated with bacterial and phytoplankton abundance in the marine environment (Boehme et al. 1993, Jiang & Paul 177

PAGE 197

1994). During this previous study I was questioning the survival fitness of viruses in the marine environment. Because viruses are obligate parasites their survival and replication depends on the presence of their hosts and the physiological fitness of the host. Cell s under starvation conditions or dormant states are unable to support lytic phage replication (Kokjohn et al. 1990) It is believed that bacteria in the marine environment are in a starvation-survival mode of existence (Nystrom et al. 1990) Therefore marine environments may be unfavorable for the lytic replication of marine viruses. However a study of viral production in eutrophic microcosms suggested that lytic viral production was the major means of viral regeneration (Wilcox & Fuhrman 1994) which is contrary to the theory We hypothesized that temperate phages and lysogens are more common in the oligotrophic marine environment, while lytic phage may be favored in eutrophic water. A study of the abundance of lysogenic bacteria amongst marine bacterial isolates was presented in Chapter 2 We have isolated over 116 bacteria from a variety of marine environments. Using mitomycin C and UV radiation induction methods we detected that 43% of the bacterial isolates contained inducible prophage Higher percentages of lysogens were found in the bacterial isolates from oligotrophic environments whereas lower percentages of lysogens were found among bacterial isolates from eutrophic coastal environments. These results confirmed our hypotheses that nutrient-limited conditions favor lysogenic interaction and coastal environments favor lytic interaction because of the fast growth rate of bacterial hosts 178

PAGE 198

Conventional cultivation methods can only isolate less than 1% of marine bacteria. Therefore, the percentage of lysogens detected in bacterial isolates ma y not represent the abundance of lysogens in the natural bacterial communities. In Chapter 3 we investigated the occurrence of lysogenic bacteria in the natural bacterial communities by comparing the numbers of viruses and bacteria in induced samples with those in control samples The samples showing both significant increases in viruses and significant decreases in bacteria were deemed successful lysogenic inductions. Fifty-four percent of the bacterial communities tested showed lysogenic induction by this criterion The percentages of lysogenic population in each community were estimated using an average burst size and also by direct observation of decrease in bacteria in the presence of the inducing agent. By the average burst size method we estimated that from 1.5% to 35% of the bacteria in each community may be lysogens By the decrease in bacterial abundance method, from 10 5 to 78 3% of the population contained inducible prophage. We have also tested a variety of inducing agents for the induction of indigenous lysogenic bacteria In addition to mitomycin C and short wavelength UV radiation polyaromatic hydrocarbons were found to be an efficient agent for lysogenic induction Increased temperatures to 37C or 42C for 30 min also caused induction in some samples, while solar radiation had no effect on lysogenic induction of marine bacteria. These results suggest that aromatic hydrocarbon pollution in the marine enyironment has the potential to cause lysogenic phage production The results of Chapter 2 and Chapter 3 suggest that there should be an additional factor pertaining to viral-bacterial interactions in the environment: the lysogenic 179

PAGE 199

interaction. The fmal fate of many phage infections of marine bacterial hosts is not lysis and mortality of the hosts, but rather protecting the host from other lytic infections During this lysogenic interaction, a small portion of the lysogenic progenies spontaneously reverse to lytic replication and release phage particles. To estimate the lysogenic viral production in the marine environment, we have constructed a numerical model using prophage spontaneous induction rate (Sr), fraction of lysogenic bacteria (L ), total bacterial population (B) and bacterial generations per day (G) in the natural environment. If no induction agent is assumed to be present in the environment the viral spontaneous release (Vs) from the lysogenic bacterial population can be described by the following equation ( 6 .1) Vs=Sr*G*L *B (6 1) Assuming viral decay is balanced by production then the new viral production per day (Vn) can be described by decay rate (Dr) and total viral population (Vt) using equation (6.2) Vn=Dr*Vt (6 2) Therefore the contribution of lysogenic viral production to the total viral production is: VL%=Vs/ Vn*100% (6.3) and V % = Sr G L B 1 OO% L Dr Vt (6.4) The study of lysogenic bacteria indicated that 1 0-2 to 1 o-5 phage particles were spontaneously released per bacterium at each generation (Ackermann & DuBow 1987) Marine viral decay rate averages 6 95 per day (range from 0 003 to 26.4) (Chapter 1). Our 180

PAGE 200

conservative estimation of lysogenic bacteria indicated that an average of 13% of the total bacteria are lysogens, at least in the eutrophic estuarine environment (Chapter 3). Bacterial abundance and viral abundance in Tampa Bay is approximate 2xl09/L and 1010/L, respectively (Boehme et al. 1993). The bacterial production measured by 3H thymidine incorporation in Tampa Bay is 2.34 generations per day (Paul et al. 1988). Therefore, the contribution of lysogenic viral production to the total viral production in the estuarine environment calculated using the above numbers and equation (6.4) is 9x 10"6 to 0 009% In the offshore environments, bacterial and viral abundance is approximately 108 /L and 5x 1 08 IL, respectively (Boehme et al. 1993 ) and bacterial production averages 1 5 generations per day (Pomeroy et al. 1995). Using an average of 4 5% for the proportion of lysogenic bacteria in offshore bacterial communities (Chapter 3) and the above conditions, we have estimated that only 2x106 to 0.002 % of viral production is contributed by prophage spontaneously released from lysogens Lysogenic viral production became important only when replacing the average viral decay rate with the lowest viral decay rate. For example, if the lowest decay rate was used in the estuarine environment, the lysogenic viral production contributed up to 20 3% of total viral production In the oligotrophic environment, lysogenic production could contribute up to 4.5% of viral production The results suggest that although lysogenic bacteria are an important portion of marine bacterial communities, viral production is predominated by lytic replication under normal conditions Lysogenic viral production may have a delayed amplification effect: a 181

PAGE 201

large number of viruses may be produced from the progenies of the original infected bacterium after induction by external stimuli In the absence of the inducing agents the proportion of lysogenic bacteria may serve as sources of the phage, but their densities are unlikely to be dramatically affected by the surrounding phage population. Waterbury and Valois (1993) have found that cyanobacteria Synechoccocus are resistant to the cyanophage infection from the same environment. In the case of prophage induction in the presence of inducing agent, we have observed a 28.8 to 245% increase of total viral direct counts over a period of 24 hours (Chapter 3). These converted to lysogenic viral production of2.88x108 to 2.45x109 phage per liter per day in an environment where viral density is 109 /L. Therefore, the presence of an inducing agent, such as a polyaromatic hydrocarbons, may cause a sharp increase of viral density in a short period with a concomitant decrease in the bacterial population. This lysogenic induction may be important in microbial population dynamics and termination of blooms. Nagasaki et al (1994) have attributed the termination of the red tide species Heterosigma akashiwo (Raphidophyceae) bloom in Hiroshima Bay Japan to lysogenic viral induction. They came to this conclusion because they did not observe any virus-like particles attached to the surface of this species at any time during the red tide bloom (Nagasaki et al. 1994). The abundance of lysogenic bacteria in marine bacterial populations also suggests the potential for a genetic impact of viruses in the marine environment. At least two properties are always conferred in each lysogen: lysogeny and superinfection immunity (Ackermann & DuBow 1987). Lysogenic phage conversions are also known to confer 182

PAGE 202

many other characteristics to the bacterial hosts (Chapter 1) which may affect the genetic diversity and composition of the marine bacterial community. For example, lysogenic bacteria have been shown to grow more rapidly than their non-lysogenic counterparts in nutrient-limited chemostats (Edlin et al. 1975, 1977 Lin et al. 1977 Dykhuizen et al. 1978), although no phage genes have been identified which are responsible for the increased growth rate. The other impact of viruses on microbial genetic diversity and composition may be generated from phage transduction. Gene transfer by phage transduction has been known for almost as long as the presence of bacteriophages in the marine environment (Zinder and Lederberg 1952). Transductions are found in many species of bacteria and involve a variety of phages. To study the potential for gene transduction to occur in the marine environment, we have isolated 4 phage host systems from seawater (Chapter 4) Three of the systems are temperate in nature with phage genome sizes ranging from 40 kb to 90kb. Phage-host systems isolated during this study share many properties with known marine phages. However they are smaller in size than the previously reported average for marine phage isolates. Chapter 5 described the assay for the potential of transduction in the marine environment. Marine transduction systems were established using phage-host isolate s described in Chapter 4. A plasmid encoding for antibiotic resistance was used as a transducing genetic marker. Transduction of this plasmid was found using bacterial isolates as well as concentrated mixed bacterial communities as recipients Using a numerical model, the rate of transduction in Tampa Bay Estuary was estimated to be up 183

PAGE 203

to 1 3 x 1014 transductants per year. This rate is similar to the estimated transformation rate (6 x 1010 to 2 x 1015 transformants per year) in the same environment (Frischer et al. 1994 ) The results of this study suggest that transduction is as important as transformation for gene transfer in the marine environment. During this transduction study we also observed the alteration of the transduced plasmid. We interpreted this result as an indication of plasmid evolution or modification in the process of gene transfer. Therefore phage transduction not only influences the microbial genetic diversity and composition b y horizontal gene transfer but may also play an important role in the evolution of genes in general. Transducing phages have been isolated previously from marine environments (Keynan et al. 1974, Ichige et al. 1989) However our study not only demonstrated pla s mid transduction to the marine bacterial isolates but also reported for the first tim e transduction assays using indigenous bacterial populations as recipients. In summary the studies presented in this dissertation are critical for our und e rstanding of the roles of viruses in the marine environment. Viruses are not onl y important in controlling microbial populations by lytic infection but also contribute to the increased fitness of bacterial populations under nutrient-limited conditions, coevolving with bacteria and, in some sense protecting bacteria through temperate int e raction Bacteriophage mediated transduction may be an important mechanism for gene transfer in the marine environment. Th e refore, viruses can also influence the genetic make up and composition of microbial populations in the marine environment. 184

PAGE 204

References Ackermann, H. W., DuBow M. S. (1987). Viruses of prokaryotes. Vol. 1. General Properties of Bacteriophages CRC Press. Boca Raton Boehme J., Frischer, M.E. Jiang S.C., Kellogg, C.A. Pichard S., Rose, J B. S teinway, C. Paul, J. H. (1993) Viruses bact erioplankton, and phytoplankton in the so utheastern Gul f of Mexico: distribution and contribution to oceanic DNA po o ls. Mar. Ecol. Prog. Ser. 97: 1-10 Dykhuizen, D Campbell, J. H. Rolfe, B G. (1978). The influences of a lambda prophage on the g rowth rate of Escherich ia coli. Microbial. 23: 99-113 Edlin, G., Lin, L. Bitner R. ( 1977) Reproductive fitness ofP1, P2, and Mu ly sogens of Escherichia coli. J Virology 21: 560-564 E dlin G., Lin, L. Kudrna, R (1975). Lysogens of E. coli reproduce more rapidl y than non-lysogens. Nature: 255 : 735-737 Frischer, M. E. Stewart G. J. Paul, J. H. (1994) Plasmid transfer to indigenous marin e bact eria l populations b y natural transf ormation. FEMS Microbiol. Eco l. 15: 127136 Ichi ge, A., Matsutani, S., Oishi, K., Mizushima, S. ( 1989) Est ab li shmen t of gene transfer systems and construction of the genet ic map of a m ar ine Vibrio strain. J. Bacterial. 171: 18251834 Jian g, S.C., Paul, J. H. (1994). Seasonal and diel abundance ofviruses and occurrence of ly sogeny/bacter iocino geny in the marine environment. Mar. Ecol. Pr og. Ser. I 04: 163-172 Keynan A., Nealson, K., Sideropoulos, H., Hastins, J. W. (1974). Marine transducing bacteriophage attacking a luminou s bacterium J. Virol. 14: 333-340 Kokjohn T. A., Sayler G. S. Miller R. V. (1991) Attachment and replic a tion of Pseudomonas aeruginosa b ac teri op h ages under co nditi on s simulating aquatic enviro nments J. General Microbial. 1 37: 661-666 Lin L., Bitner R., Edlin, G. (1977). Increa sed reproductive fitness of Escherichia co li Lambda lysogen s. J. Virolo gy. 21: 554-559 185

PAGE 205

Moebus, K. (1983). Lytic and inhibition responses to bacteriophages among marine bacteria with special reference to the origin of phage-host systems. Helgolander Meeresunters. 36: 375-391 Nagasaki, K. Ando, M. ltakura, S. Imai I. Ishida, Y. (1994) Viral mortality in the final stage of Heterosigma akashiwo (Raphidophyceae) red tide. J. Plankton Re sear. 16: 1595-1599 Nystrom, T. Alvertson N.H Flardh, K., Kjelleberg, S (1990). Physio l ogical and molecular adaptation to starvation and recovery from starvation by the marine Vibrio sp. S14. FEMS Microbial. Ecol. 74: 129-140 Paul J. H., Jiang, S.C., Rose, J. B (1991). Concentration of viruses and dissolved DNA from aquatic environments by vortex flow filtration. Appl. Environ. Microbial. 57 : 2107-2204 Paul, J. H. DeFlaun, M. D. Jeffrey, W. H. David A. W. (1988). Seasonal and diel variability in Dissolved DNA and in microbial biomass and activity in a subtropical estuary Appl. Environ. Microbial. 54: 718-727 Pomeroy, L. R. Sheldon J. E., Sheldon, W. M. Peters, J. F. (1995). Limits to growth and re sp iration of bact er ioplankton in the Gulf of Mexico Mar. Ecol. Prog. Ser. 117: 259-268 Waterbury J. B., Valois F.W. (1993) Resistance to co-occurring phages enables marine Synechococcus communities to coexist with cyanophages abundant in seawater. Appl. E nviron Microbial 59: 3393-3399 Wilcox, R. M., Fuhrman, J. A. (1994) Bacterial viruses in coa sta l seawater: lytic rath er than lysogenic production. Mar. E col. Prog Ser. 114: 35-45 Zinder, N. D ., Lederberg, J. (1952). Genetic exchange in Salmonella. J. Bacterial. 64: 679-699 ZoBell, C. (1946). Marine microbiology. pp. 82-83 Chronica Botanica, Waltham Massachusetts. 186

PAGE 206

APPENDICES 187

PAGE 207

APPENDIX 1. ANTIMICROBIAL ACTIVITY FOUND AMONG MARINE BACTERIAL ISOLATES Antimicrobial activity in marine bacteria was first recognized nearly 50 years ago (Rosenfeld & Zobell1947 Grein & Meyers 1958) Despite this early evidence, relatively little research has been directed toward the study of natural products from marine microorganisms. Most of the recent work on antimicrobial agents from marine bacter ia has been performed by Dr. Fenical's group at Scripps Institution of Oceanography. One example of their finding is an unusual Gram-positive bacterium isolated from a deep sea sediment core which produces antiviral and cytotoxic macrolides (Gustafson et al. 1989) During our studies of marine lysogenic bacteria more than 116 bacteria were isolated from a variety of marine environments (Chapter 2). Lysogenic indicators were searc hed for by spotting bacterial cultures on other bacterial lawns as pre v iously described by Parisi and Meng ( 1988). Six strains were found to form inhibition zo nes (antimicrobial zones) on the indicator bacterial lawns (Figure 7.1) All six strains also lyse and produce detectable phage-like particles when treated with mitomycin C (Data not shown). However, the 0 2 11m or 0.45 11m filtrates of these bacterial cultures and mitomycin C induced-cultures yielded no antimicrobial activity (Figure 7.1 ) Attempts to concentrate the filtrates either by ultracentrifugation at 201 ,OOOg or by 30 kd Ami con centriprep (Amicon, Inc Austin, TX) also yielded no antimicrobial activity, suggesting that the antimicrobial activity was either associated with the active metabolizing bacteria or larger than 0.45 IJ.m. In addition samples scraped from the clear inhibition zones could 188

PAGE 208

APPENDIX 1. (Continued) not re-infect the indicator bacterium su g g e sting that this inhibition wa s not caused b y v i ruses The activity was inactivated by autocla v ing the antibiotic producing cell culture or a heat treatment at 70C for 2 h (Figure 7.1 ) suggesting this activity wa s associated with heat -labile materials. Furthermore this antimicrobial activity had a broad host range For example one producer strain (#5 isolated from the concentrated seawater sample off the St. Petersburg Pier Florida) formed inhibition zones on the 27 out of the 34 bacterial lawns t e s t ed This finding ruled out the possibility of being bacter i ocins which on l y inh i bit the growth of clo s ely related bacterial strains Three of the producer strain s also produced substances which turned the liquid or agar medium blackish-brown after 48 hours of incubation. Transmi ssion electron micro s copy (TEM) examination of the antibiotic producing bacteria (F i gure 3) showed some filaments and membrane vesicles associated with th e bacterial s urfaces and free within th e medium However it is uncertain if the y were responsible for the antimicrobial activities TEM examination of ultrathin sections of producer bacteria did not reveal any abnormal morphology within the cells (Figure 3D) The chemistry production mechanism and mode of action of these observed antimicrobial activities are currently unknown. However the observation of the s e antimicrobial activity producing bacteria suggests that marine microorganisms can be an important source of bioactive agents for future biomed i cal and pharmaceut i cal a pplications 189

PAGE 209

APPENDIX 1. (Continued) Figure 7. 1. Spot test ofbacterium 10SJ1 isolated from water sample ofKey Largo Florida on bacterial lawn SJ9 from Northshore Beach St. Petersburg Florida. Bac terial lawn was formed by top agar overlay method using 1 ml of bacterial host. 2 to 5 ).tl of 1 osn culture, or autoclaved or heat treated culture or supernatant of the culture, or 0.45 filtrate of the culture or centriprep or ultracentrifugation concentrated filtrate was spotted on the lawn as indicated. Picture was taken after 24 hour incubation at 28 C 190

PAGE 210

APPENDIX 1. (Continued) Figure 7. 2. TEM observation of antimicrobial activity producing bacteria. (A) and (B) filamentous material found in cultures of bacteria from the St. Petersburg pier, Florida. (C) Bacterium isolated from Key Largo, Florida. (D) Ultrathin section of bacteria isolated from the St. Petersburg Pier Florida 191

PAGE 211

APPENDIX 1. (Continued) References Grein, A Meyers, S. P. (1958) Growth characteristics and antibiotic production of actinomycetes isolated from littoral sediments and material suspended in sea water J. Bacteriol. 76 : 457-463 Gustafson K, Roman M Fenical, W. (1989). The macrolactins, a novel class of antiviral and cytotoxic macrolides from a deep-sea marine bacterium J. of American Chern Society 111: 7519-7524 Parisi, J. T. Meng L. (1988) Rapid method for the isolation of bacteriophages from l ysogens. Diagn Microbiol. Infect. Dis 11: 121-123 Rosenfeld, W. D., Zobell,C (1947). Antibiotic production by marine microorganisms. J. Bacteriol. 54: 393-398 192

PAGE 212

APPENDIX 2. RESEARCH ENVIRONMENTS AND SAMPLING LOCATIONS Figure 8.1 Marine microbiology lab in the old marine science building. Figure 8 2 Sampling location : Fort Jefferson, Dry Tortugas Florida 193

PAGE 213

APPENDIX 2. (Continued) Figure 8.3 Membrex vortex flow filtration systems Figure 8.4 Operating Membrex vortex flow filtration systems 194

PAGE 214

APPENDIX 2. (Continued) Figure 8 5 Sea condition during a summer 1994 cruise onboard RN Pelican. Figure 8.6 Sampling with Niskin bottles during a 1994 cruise onboard RN Pelican. 195

PAGE 215

APPENDIX 2. (Continued) Figure 8 7 Sampling location: African Reef, Dry Tortugas Florida. Figure 8.8 SCUBA sampling at Sand Key, Key West Florida 196

PAGE 216

APPENDIX 2 (Continued) Figure 8 9 Long Key marine lab. Figure 8.10 Key Lar g o NURC facility 197


printinsert_linkshareget_appmore_horiz

Download Options

close
No images are available for this item.
Cite this item close

APA

Cras ut cursus ante, a fringilla nunc. Mauris lorem nunc, cursus sit amet enim ac, vehicula vestibulum mi. Mauris viverra nisl vel enim faucibus porta. Praesent sit amet ornare diam, non finibus nulla.

MLA

Cras efficitur magna et sapien varius, luctus ullamcorper dolor convallis. Orci varius natoque penatibus et magnis dis parturient montes, nascetur ridiculus mus. Fusce sit amet justo ut erat laoreet congue sed a ante.

CHICAGO

Phasellus ornare in augue eu imperdiet. Donec malesuada sapien ante, at vehicula orci tempor molestie. Proin vitae urna elit. Pellentesque vitae nisi et diam euismod malesuada aliquet non erat.

WIKIPEDIA

Nunc fringilla dolor ut dictum placerat. Proin ac neque rutrum, consectetur ligula id, laoreet ligula. Nulla lorem massa, consectetur vitae consequat in, lobortis at dolor. Nunc sed leo odio.