Environment and host species shape the skin microbiome of captive neotropical bats

Citation
Environment and host species shape the skin microbiome of captive neotropical bats

Material Information

Title:
Environment and host species shape the skin microbiome of captive neotropical bats
Series Title:
PeerJ
Creator:
Lemieux-Labonté, Virginie
Tromas, Nicolas
Shapiro, B. Jesse
Lapointe, François-Joseph
Publication Date:
Language:
English
Physical Description:
1 online resource

Subjects

Subjects / Keywords:
Bats ( lcsh )
White-nose syndrome ( lcsh )
Microbiology ( lcsh )
Genre:
serial ( sobekcm )

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
K26-05071 ( USFLDC DOI )
K26.5071 ( USFLDC handle )

USFLDC Membership

Aggregations:
Added automatically
Karst Information Portal

Postcard Information

Format:
serial

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

Submitted 2May2016 Accepted 10August2016 Published 20September2016 Correspondingauthor VirginieLemieuxLabont,virginie.lemieuxlabonte@umontreal.ca Academiceditor KimberlyBishop-Lilly AdditionalInformationand Declarationscanbefoundon page13 DOI 10.7717/peerj.2430 Copyright 2016Lemieux-Labontetal. Distributedunder CreativeCommonsCC-BY4.0 OPENACCESS Environmentandhostspeciesshapethe skinmicrobiomeofcaptiveneotropical bats VirginieLemieux-Labont,NicolasTromas,B.JesseShapiroand Fran cois-JosephLapointe DpartementdeSciencesBiologiques,UniversitdeMontral,Montral,Canada ABSTRACT Background .Awiderangeofmicroorganismsinhabitanimalskin.Thismicrobial communitymicrobiomeplaysanimportantroleinhostdefenseagainstpathogens anddisease.BatsChiroptera:Mammaliaareanecologicallyandevolutionarilydiversifiedgroupwitharelativelyunexploredskinmicrobiome.Thebatskinmicrobiome couldplayaroleindiseaseresistance,forexample,towhitenosesyndromeWNS, aninfectionwhichhasbeendevastatingNorthAmericanbatpopulations.However, fundamentalknowledgeofthebatskinmicrobiomeisneededbeforeunderstanding itsroleinhealthanddiseaseresistance.Captiveneotropicalfrugivorousbats Artibeus jamaicensis and Carolliaperspicillata provideasimplecontrolledsysteminwhichto characterizethefactorsshapingthebatmicrobiome.Here,weaimedtodeterminethe relativeimportanceofhabitatandhostspeciesonthebatskinmicrobiome. Methods .Weperformedhigh-throughput16SrRNAgenesequencingoftheskin microbiomeoftwodifferentbatspecieslivingincaptivityintwodifferenthabitats. Inthefirsthabitat, A.jamaicensis and C.perspicillata livedtogether,whilethesecond habitatcontainedonly A.jamaicensis. Results .Wefoundthatbothhabitatandhostspeciesshapethecompositionanddiversityoftheskinmicrobiome,withhabitathavingthestrongestinfluence.Cohabitating A.jamaicensis and C.perspicillata sharedmoresimilarskinmicrobiomesthanmembers ofthesamespecies A.jamaicensis acrosstwohabitats. Discussion .Theseresultssuggestthatincaptivity,theskinmicrobialcommunityis homogenisedbythesharedenvironmentsandindividualproximitiesofbatsliving togetherinthesamehabitat,attheexpenseoftheinnatehostspeciesfactors.The predominantinfluenceofhabitatsuggeststhatenvironmentalmicroorganismsor pathogensmightcolonizebatskin.Wealsoproposethatbatpopulationscoulddiffer inpathogensusceptibilitydependingontheirimmediateenvironmentandhabitat. Subjects Ecology,Microbiology,Zoology Keywords Batskinmicrobiome,Habitatmicrobiomeinteraction,Hostmicrobiomeinteraction INTRODUCTION Animalskinisanecosysteminhabitedbyhighlyvariableandcomplexcommunitiesof microorganisms Grice&Segre,2011 ,whichcanbedividedintoresidentandtransient floraacquiredfromtheenvironment Roth&James,1988 .Ahealthyskinmicrobiome contributestohostfitnessbyoccupyingpathogenadhesionsitesandproducingpathogen Howtocitethisarticle Lemieux-Labontetal.,Environmentandhostspeciesshapetheskinmicrobiomeofcaptiveneotropical bats. PeerJ4:e2430;DOI10.7717/peerj.2430

PAGE 2

inhibitors Roth&James,1988 ; Grice&Segre,2011 .Forexample,thesalamanderskin associatedbacteria Janthinobacteriumlividum confersresistancetothedevastatingfungal pathogen Batrachochytriumdendrobatidis Bruckeretal.,2008 ,possiblyexplainingwhy somesalamanderpopulationsdeclinewhileothersdonot.Competitiveinteractions betweenbeneficialandpathogenicskinmicrobesmaythereforeplayaroleinpreventing diseaseinwildanimals Belden&Harris,2007 .Despiteitsimportance,littleisknowabout thefactorsshapingtheskinmicrobiomeofwildanimalspecies. Exogenousenvironmentalandendogenoushost-specificfactorssuchpH,sebum production,temperatureandmoisture Grice&Segre,2011 areknowntoshapetheskin microbiome,buttherelativeinfluenceoftheseparametersdifferbetweenstudies.Inthegut microbiome,hosttaxaandphylogenyappearstohaveagreatereffectthantheenvironment ontheassemblageofbacterialcommunities Ochmanetal.,2010 ; Roeselersetal.,2011 ; Tzengetal.,2015 .Inprimates, Moelleretal. concludedthatsympatricmembersof differentspeciesi.e.,gorillasandchimpanzeessharingthesamehabitatharboramore similargutmicrobiomethanallopatricmembersofthesamespecies.Inneotropicalbats, gutmicrobiomeshavebeenproposedtobeinfluencedbyacomplexinteractionbetween exogenousandendogenousfactors Phillipsetal.,2012 ,withanimportantroleforhost taxaandphylogeny Phillipsetal.,2012 ; Carrillo-Araujoetal.,2015 Duetoitsdirectexposuretotheenvironment,theskinmicrobiomeissuspectedtobe muchmoredynamicthanthegutmicrobiome Romano-Bertrandetal.,2015 .Hence,the roleoftheenvironmentisexpectedtobestronginshapingtheskinmicrobiome.Studies oftheskinmicrobiomeofwildpopulationsofamphibianssuggestthathostspeciesdoes playamajorrolebecausetheskinmicrobiomesofcohabitatingspecieswerefoundto besignificantlydifferent McKenzieetal.,2012 ; Kuenemanetal.,2014 ; Walkeetal.,2014 However, Kuenemanetal. identifiedthehabitatasthesecondmostimportant parameterontheskinmicrobiomeofamphibianspecies.Indeed,theenvironmentshould actasabacterialreservoirfortheskinmicrobiomeandhostspeciesmaybeabletoselect particulartaxa Loudonetal.,2014 ; Walkeetal.,2014 .Consequently,itisthoughtthat hostandenvironmentalfactorsinteractcloselytoshapetheamphibianskinmicrobiome. Inspiteofrecentinvestigationsontheskinmicrobiomeofvariousanimalspecies,few studieshaveanalyzedtherelativeinfluenceofendogenoushostandexogenousenvironmentalfactorsontheskinmicrobiomeinnon-humanmammals.Inhumans,different variablesareexpectedtoshapetheskinmicrobiome,suchasbodysite,age,genderand habitat Fiereretal.,2008 ; Giacomoni,Mammone&Teri,2009 ; Yingetal.,2015 .Humans werefoundtosharemoresimilarmicrobiomeswiththeirdogsthanwithdogsfrom differenthouseholds Songetal.,2013 .Therefore,asharedhabitatmighthomogenize skinmicrobiomesacrossindividualsandevenacrossspecies. Incontrasttothegutmicrobiome,theskinmicrobialcommunityappearstobemuch moreinfluencedbyexposuretotheenvironment,includingenvironmentalmicrobes andabioticfactors Chengetal.,2015 .Yet,understandingthecomplexityoftheskin microbiomeclearlysuffersfromalackofstudiesacrossdifferentmammals.BatsChiroptera:Mammaliaarepartofoneofthemostecologicallyandevolutionarilydiversified mammalianorders Kunz&Fenton,2003 ; Voigt&Kingston,2016 ,providinganexcellent Lemieux-Labontetal., PeerJ ,DOI10.7717/peerj.2430 2/19

PAGE 3

modeltostudyhowmicrobiomesvaryacrossrelatedhostspecies.Astheonlyflyingmammals,withacave-dwellinglifestyle,theskinmicrobiomeofbatsisprobablyuniqueamong allvertebrates.Additionally,theskinmicrobiomeprovidesapossibledefenseagainstwhite nosesyndromeWNS,askindiseasecausedbythefungus Pseudogymnoascusdestructans Pd Gargasetal.,2009 ; Lorchetal.,2011 ,formerlyknownas Geomycesdestructans ; Minnis&Lindner,2013 andresponsibleforthedeathofover6millionNorthAmerican bats USFish&WildlifeService,2012 .Notallbatspeciesareequallyaffectedbythedisease Turner,Reeder&Coleman,2011 ,suggestingthatbothhostgenetics,ecology,andmicrobiomesmightplayarolein Pd resistance.Inthelightofthisknowledge,basicinformation aboutfundamentalsourcesofvariationsinthebatskinmicrobiomeisbadlyneeded toharnessthepossibleimplicationsofthismicrobialcommunityinadiseasecontext. Jamaicanfruitbats Artibeusjamaicensis andSeba'sshort-tailledbats Carollia perspicillata provideconvenientanimalmodelstostudytheskinmicrobiomeof chiropterans.ThesespeciesofneotropicalbatsfamilyPhyllostomidaearewidely distributedinCentralandSouthAmerica.Theyshareagregariouslifestyle,witha polygynousharemsocialorganisationbasedonmaledefenseoftheroostingsites wherefemalesaggregate Porter,1978 ; Williams,1986 ; Ortega&Arita,1999 .Inthewild, bothspeciesroostinhollowtreesandcaves Morrison,1979 ; Williams,1986 ; Cloutier& Thomas,1992 ; Ortega&Arita,1999 ,where A.jamaicensis normallyaggregateinsmall groups<12individualsorverylargecolonies>500bats Arita&Vargas,1995 ,and C.perspicillata aggregateingroupsof10tomorethan100individuals Cloutier&Thomas, 1992 .Thesespeciesaregeneralistfrugivores Cloutier&Thomas,1992 ; Ortega&CastroArellano,2001 .Theyareeasilymaintainedincaptivity,wheretheycanevenbreed.The gutmicrobiomeofbothspecieshaverecentlybeencharacterized Carrillo-Araujoetal., 2015 ,whiletheskinmicrobialcommunitystillremainsunknownatthisdate. Here,westudiedhowhabitatfactorsincludingcolonyparametersanddietandhost speciescontributedtothestructureof A.jamaicensis and C.perspicillata skinmicrobiome understableenvironmentalconditionsi.e.,incaptivity.Althoughsuchtropicalspeciesare notaffectedorendangeredbythewhitenosesyndrome,theyprovideausefulmodeltostudy thefactorsthatshapetheskinmicrobiomeandmightprovideresistancetopathogens.The skinmicrobiomesofwildandcaptiveorganismsarecertainlydifferent Beckeretal.,2014 ; Loudonetal.,2014 ; Chengetal.,2015 ,butstudyingthemincaptivityispractical,allowing ustolimitenvironmentalfluctuationsthatmightobscuretheeffectsofhostspeciesin naturalsetting.Weusedhigh-throughput16Sampliconsequencingtoassessthetaxonomic compositionanddiversityoftheskinmicrobiomeofthesetwospeciesofbatssampledin twodifferentzooshabitats.Thisdesignallowedustocomparedbatgroupslivinginshared vs.separateenvironments.Theobjectivesweretoquantifythecontributionsofhabitat andhostspeciesinshapingthebatskinmicrobiome.Ourresultsshowasignificanteffect ofbothhabitatandhostspeciesontheskinmicrobiome,withhabitatplayingadominant role.Thisstudythusprovidesaninitialviewofwhatfactorsshapetheskinmicrobiomeof neotropicalbats.Thesefindingsprovidebasicknowledgeoftheskinmicrobiome,whichcan ultimatelybeappliedtothemanagementandconservationofthreatenedbatpopulations. Lemieux-Labontetal., PeerJ ,DOI10.7717/peerj.2430 3/19

PAGE 4

MATERIALSANDMETHODS Sampling Inthisstudy,42adultspecimensfromtwodifferentfrugivorousbatspeciesweresampled intwodifferentzoos.Namely,10 A.jamaicensis and12 C.perspicillata individualsall malesweresampledinDecember2014fromtheMontralBiodmeCanada,wherethey livetogetherinanartificialcavemaintainedatatemperatureof22 Cduringwinter,and 26 Cinsummer.Inaddition,20 A.jamaicensis individualsmalesand14femaleswere alsosampledinMarch2015fromtheGranbyZooCanada.Thesebatsalsoliveinan artificialcave,wherethetemperatureismaintainedat26 Callyearlong.Bothcoloniesof batswereestablishedin1992,withactualpopulationsizesof95individualsattheMontral Biodme A.jamaicensis and50 C.perspicillata ,and247individualsattheGranbyZoo. Skinmicrobiomesampleswereobtainedfromeachspecimenbyswabbingthebackand onewingfor30swithasterileWhatmanOmniswabFisherScientificsoakedinNaCl 0.15M.SwabstipswereejectedintoMobioPowersoilDNAisolationKittubesMoBio Laboratories,whichwerethenstoredat )]TJ/F61 10.9091 Tf 8.509 0 Td [(20 CuntilDNAextraction.Asanegative control,ahumidifiedsterileswabwasalsocollectedateachsamplingsite.Handlingof animalsattheGranbyZooaswellastheMontralBiodmewasapprovedbythelocal ethicscommitteesComitOprationsenConservationetRecherche,andBiodme's WelfareAnimalandEthicscommittee. DNAextraction,amplicationandsequencing BacterialgenomicDNAwasextractedfromeachswabusingtheMoBioPowersoilDNA isolationKitaccordingtothemanufacturer'sprotocols.Amplificationandsequencingwere thenperformedaspreviouslydescribed Preheimetal.,2013a .Librarieswereprepared usingatwo-stepPCR.ThefirstPCRamplifiesthehypervariableregionV4ofthe16S smallsubunitribosomalgenewithforwardprimerU515_f:ACACGACGCTCTTCCGAT CTYRYRGTGCCAGCMGCCGCGGTAAandreverseprimerE786_R:CGGCATTCCTG CTGAACCGCTCTTCCGATCTGGACTACHVGGGTWTCTAAT Caporasoetal.,2011 2 m lofextractedDNAequivalentDNAamountbysamplewasaddedtothePCR reactioncontaining14.25 m lofsterilewater,5 m lHFbuffer,0.5 m lDNTPs,0.25 m l PhusionHigh-FidelityDNAPolymeraseNewEnglandBiolabsinc.,and1.5 m lofforward andreverseprimers.AmplificationswereperformedwithaMastercycernexusGSX1 Eppendorfunderthefollowingconditions:initialdenaturationat98 Cfor30s;30 cyclesalternating98 Cfor25s,40sat54 C,35sat72 C,andfinalelongationstepfor oneminuteat72 C.Negativecontrolswereincludedintheamplificationsteptoaccount forpossiblecontamination.Eachsamplewasamplifiedinquadruplicateandpooledto limitpossiblePCRartefacts.AllPCRproductswerethenpurifiedwithZYMODNAClean &Concentrator TM -5ZYMORESEARCHfollowingthemanufacturer'sprotocol.The secondPCRstepconsistedofaddingprimerscontainingabarcodeindexandIllumina adaptersequencestoeachDNAamplicon.Todoso,4 m lofthefirststepamplification productwasaddedtoaPCRreactioncontaining10.25 m lofsterilewater,5 m lHFbuffer, 0.5 m lDNTPs,0.25 m lPhusionHigh-FidelityDNAPolymeraseand2.5 m lofforward primerPE-III-PCR-F:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTAC Lemieux-Labontetal., PeerJ ,DOI10.7717/peerj.2430 4/19

PAGE 5

ACGACGCTCTTCCGATCTandreverseprimerPE-III-PCR-001-096:CAAGCAGA AGACGGCATACGAGATNNNNNNNNNCGGTCTCGGCATTCCTGCTGAACCGCT CTTCCGATCTNindicatingtheuniquebarcode Preheimetal.,2013b .Indexingwas performedunderthefollowingthermalconditions:initialdenaturationat98 Cfor 30s,7cyclesalternating98 Cfor30s,30sat83 C,andfinally30sat72 C.This secondamplificationwasperformedintriplicate.Sampleswerepooledandpurifiedwith thePCRpurificationAgencourtAMPureXPBeckmanCoulter.Qubit2.0Fluorometer InvitrogenwasusedtomeasureDNAconcentrationineachsample.Indexedsamples werethenpooledtoobtainafinalconcentrationrangebetween10and20ng/ m l.DNA wasnextdilutedanddenaturedaccordingtothemanufacturer'sprotocolforpaired-end sequencingusingMiSeqReagentKitv2cycles2 250bponMiSeqIllumina. Dataanalysis 2,105,588sequenceswereamplifiedfrom41ofthe42skinsamples.Onespecimenof A.jamaicensis fromGranbyZoowasremovedfromthedatasetduetofailureofsequencing. Ameanof51,356sequenceswasobtainedpersample,withaminimumof2,247anda maximumof243,588sequences.RawsequencedataandmetadataareavailableonFigshare atDOI:10.6084/m9.figshare.3206668andDOI:10.6084/m9.figshare.3428159. Preclustering,qualityfiltering,primerremoval,mergingofrawsequences,and postclusteringdereplicatingwereperformedwiththeSmileTrainscriptshttps://github. com/almlab/SmileTrain/wiki/for16SdataprocessingusingUSEARCHv.7.0.1090 http://www.drive5.com/usearch/ Edgar,2010 .Distribution-basedclustering Preheimet al.,2013b usingthedbOTUcalleralgorithmhttps://github.com/spacocha/dbOTUcaller wasperformedtoclustersequencesintoOperationalTaxonomicUnitsOTUsby consideringthedistributionofDNAsequencesacrosssamplesandsequencedistances. ThecorrespondingOTUtableprovidingrelativeabundancesofbacterialtaxainthe differentsampleswasassignedwithQIIMEversion1.8.http://qiime.org/ Caporasoet al.,2010 usingGreenGenesdatabaserelease13_5http://greengenes.lbl.gov DeSantiset al.,2006 seeTableS1.Forcompositionalanalysis,thegenus Halomonas Shewanella and Lactobacillus wereidentifiedascontaminationbecauseoftheirhighproportioninnegative controls.Thesetaxawereconsequentlyfilteredoutfromallsamplespriortofurtheranalysis. TheLinearDiscriminantAnalysisLDAsizeEffectLEfSealgorithmhttps: //huttenhower.sph.harvard.edu/galaxy/ Segataetal.,2011 wasusedtoidentifytaxa andOTUscontributingthemosttodifferencesbetweenhabitatsandhostspecies.LEfSe detectssignificantdifferencesintaxaandOTUabundancewiththenon-parametricfactorial Kruskal-Wallissumranktest Kruskal&Wallis,1952 .Then,acanonicalmethodisapplied toestimatelinearcombinationsofOTUsthatprovidethebestdiscriminationamongbat speciesorhabitats. Toinvestigatethediversityoftheskinmicrobialcommunityalphadiversity,Shannon Hill,1973 andBalancedWeightedPhylogeneticDiversityBWPD Barker,2002 ; Vellend etal.,2011 ; McCoy&MatsenIV,2013 indiceswerecomputedfrommultiplerarefieddata sets.MultiplerarefactionconsistsofarepeatedsubsamplingoftheOTUtable.Thisprocedureisgenerallyusedtoensureamoreconsistentcomparisonbetweensamplesinwhichthe Lemieux-Labontetal., PeerJ ,DOI10.7717/peerj.2430 5/19

PAGE 6

numberofsequencesdiffers.Fiftyiterationsofthedeepestsequencingdepthforeachsample wereusedinalphadiversitycalculations.TheShannonindex,whichincludesbothOTU richnessandevenness,wascomputedduetoitsreducedsensitivitytosampledepth differences Haegemanetal.,2013 ; Preheimetal.,2013a .BWPDisadiversitymeasurethat usesphylogeneticinformationtoevaluatediversityofmicrobialcommunitywherespecies delimitationisdifficult.ContrarytothePhylogeneticDiversityPDmeasure,BWPD accountsforabundanceandisrobusttosamplingdepthdifferencesbetweensamples McCoy&MatsenIV,2013 .Rversion3.1.3http://www.r-project.org/ RDevelopement CoreTeam,2015 wasusedforallstatisticalanalyses.Alphadiversityresultswere comparedbetweenhabitatsandspeciesusingnon-parametricWilcoxonSigned-Ranktest Wilcoxon,1945 .The p -valueforalltestswasadjustedwithHolm'ssequentialBonferroni Holm,1979 .Phylogeneticdiversityindiceswerecalculatedusingaphylogenetictree constructedwithFastTree2.1.8http://meta.microbesonline.org/fasttree/ Price,Dehal& Arkin,2010 Betadiversitywascalculatedbetweenbatmicrobiomesgroupedaccordingtohabitat andhostspecies.Phylogeny-basedweightedUniFracdistances Lozupone&Knight,2005 ; Lozuponeetal.,2007 andthesquarerootofJensenShannondivergenceJSD 1/2 Fuglede &Topse,2004 werecalculatedonunrarefieddataaspreviouslysuggested McMurdie& Holmes,2014 withthephyloseqpackagehttps://joey711.github.io/phyloseq/ McMurdie &Holmes,2013 .WeightedUniFrac,whichaccountsfordifferencesinabundance,is widelyusedtocomparedistancesbetweenmicrobialcommunities,althoughitissensitive todifferencesinsequencingdepthbetweensamples Lozuponeetal.,2011 .Toaddressthis problem,weusedrelativeOTUabundancestocalculateweightedUniFracdistances McMurdie&Holmes,2014 .JSDwasalsoselectedbecauseitisarobustmeasureofdivergence basedonthedistributionofrelativeabundancesbetweenmicrobialcommunities.Taking thesquarerootofJSDtransformsthismeasureintoaninterpretablemetric Preheimet al.,2013a .Allbetadiversityresultswerevisualizedwithnon-metricmultidimensional scalingNMDS Kruskal,1964 usingthephyloseq ordinate function. Totestforsignificantdifferencesamonggroupsofbats,weusedthepermutational multivariateanalysisofvariancePERMANOVA,ananalogofMANOVAforpartitioning distancematricesamongvarioussourcesofvariation Anderson,2001 .Thenullhypothesis ofthistestisthatthemetriccentroiddoesnotdifferbetweengroupsinourcase,hostspecies andhabitat Anderson&Walsh,2013 .PERMANOVAwascalculatedwiththe adonis functionintheveganpackagehttp://cran.r-project.org/package=vegan Oksanenetal., 2015 .Sincethistestissensitivetodatadispersionandmaythereforeconfusewithingroupvariationwithamong-groupvariation Anderson,2001 ,weperformedananalysis ofmultivariatehomogeneityPERMDISP Anderson,2006 withthe betadisper function totestifgroupsdifferedintheirdispersion.Thenullhypothesisofthistestisthatthe averagewithin-groupdispersionisthesameinallgroups Anderson&Walsh,2013 .In eachofthesetwotests,thenumberofpermutationswassetto9999.Forallanalyses,a p -valuethresholdof0.05wasconsideredsignificant. Lemieux-Labontetal., PeerJ ,DOI10.7717/peerj.2430 6/19

PAGE 7

Figure1Relativeabundancesofthesixdominantbacterialphylaintheskinmicrobiomeofcaptive neotropicalbats. ThecompletelistoftaxaisprovidedinTableS2. RESULTS Habitatandhostspeciesbothshapethecompositionofbatskin microbiomes Wefirstcharacterizedthetaxonomiccompositionofthebatskinmicrobiomebysequencing skinswabsfrom41captivebats.Weidentifiedfivedominantsharedphylaintheskin microbiomeofcaptivebatsFig.1:Actinobacteria%%,Proteobacteria% 36%,Firmicutes%%,Cyanobacteria%%,Bacteroidetes%%and Fusobacteria 1%.Attheorderlevel,LEfSeanalysisninetaxathatdifferedsignificantly byeitherhostspeciesorhabitatLDAscore 3.4, p < 0 : 05.Namely,fivetaxawere representativeof A.jamaicensis fromtheGranbyZoo,whereasoneandthreetaxawere respectivelyrepresentativeof A.jamaicensis and C.perspicillata fromtheBiodmeFig.2. Accordingtotheseresults, A.jamaicensis sampledfromtheGranbyZooappearstobethe mostdifferentgroupintermsofdifferentiallyabundanttaxa. Atfinertaxonomicresolution,aLEfSeanalysisattheOTUlevelalsorevealedthe importanceofhabitatinshapingtheskinmicrobiomecomposition.Weidentified924 OTUssignificantlyenrichedinaparticularhabitatFig.3Aalmosttwicethenumber ofOTUsenrichedinaparticularhostspeciesFig.3B.Theseresultssuggestthathabitat playsastrongerrolethanhostspeciesinshapingtheskinmicrobiome. Lemieux-Labontetal., PeerJ ,DOI10.7717/peerj.2430 7/19

PAGE 8

Figure2ResultsofLEfSeanalysisshowingthemaindifferencesamongbacterialordersintheskin microbiomeofcaptiveneotropicalbats. Significantresultsareidentifiedwithastar*.See`Methods' formoredetails.CpBiodme,Biodme C.perspicillata ;AjZoo,GranbyZoo A.jamaicensis ;AjBiodme, Biodme A.jamaicensis Figure3NumberofOTUsoperationaltaxonomicunitsenrichedindifferenthabitatsorhost species. ARepresentativeOTUsaccordingtohabitatBiodmeorGranbyZoo.BRepresentative OTUsaccordingtobatspecies A.jamaicencis or C.perspicillata .Theintersectionindicatesthenumbers ofOTUsthatdidnotdiffersignificantlybetweengroupsbyLEfSeanalysisMethods. Habitatisamajordeterminantofalphadiversity Wenextaskedwhetherthetotalamountofdiversityalphadiversityinthebatskin microbiomedifferedaccordingtohostspeciesorhabitatFig.4.BasedontheShannon indexofalphadiversity,wefoundthat A.jamaicensis fromBiodmeismostdiverse,and A.jamaicensis fromGranbyZooisleastdiverseFig.4A.Thus,thetwoBiodmespecies seemstoharboramorerichandevenskinmicrobiomecommunity.Shannondiversity betweenspecies A.jamaicensis and C.perspicillata isnotsignificantlydifferentFig.4B, Lemieux-Labontetal., PeerJ ,DOI10.7717/peerj.2430 8/19

PAGE 9

Figure4Alphadiversitydifferssignificantlybyhabitat. AShannonindexcomparedacrossbat groups.BShannonindexcomparedacrossbatspecies.CShannonindexcomparedacrosshabitats. DBWPDindexphylogeneticmeasureacrossbatgroups.EBWPDindexacrossbatspecies. FBWPDindexacrosshabitats.Errorbarsrepresentstandarddeviations.AjBiodme,Biodme A.jamaicensis ;AjZoo,GranbyZoo A.jamaicensis ;CpBiodme,Biodme C.perspicillata .Non-parametric WilcoxonSigned-Ranktest p 0 : 05, p 0 : 01, p 0 : 001. WilcoxonSigned-Ranktest, V D 227, p D 0 : 134,whiletheBiodmebatsofbothspecies havesignificantlyhigherdiversitythanGranbyZoobatsFig.4C,WilcoxonSigned-Rank test, V D 400, p < 0 : 001. TheresultsbasedonShannondiversitywereconfirmedbyBWPD,anothermeasureof alphadiversity,whichaccountsforthephylogeneticrelatednessandrelativeabundanceof microbialtaxaFig.4D.AsobservedwithShannondiversity, A.jamaicensis fromBiodme hasthehighestalphadiversity,followedby C.perspicillata fromBiodmeand A.jamaicensis fromGranbyZooFig.4D.TheBWPDindexisnotsignificantlydifferentbetweenbats speciesFig.4E,WilcoxonSigned-Ranktest, V D 211, p D 0 : 300,whereassignificant differencesexistbetweenbatssampledfromtheBiodmeandGranbyZoohabitatsFig. 4F,WilcoxonSigned-Ranktest, V D 363, p < 0 : 001.ResultsoftheBWPDandShannon indexarethusconsistentandsuggesthabitatandpossiblyahabitat-speciesinteraction astheprincipalforcesshapingalphadiversityintheskinmicrobiomecommunity. Habitatandhostspeciesshapemicrobialcommunitybetadiversity Wenextusedbetadiversityanalysistoestimatetheeffectsofthehabitatandhostspeciesin shapingthecompositionoftheskinmicrobiome.Ourresultsshowthatsamplesareclusteredbybothhabitatandhostspecies,basedontwodifferentmetricsofbetadiversityFig. 5,andthatallsamplesareclearlydistinctfromnegativecontrolsFig.S1.UsingtheJSD 1/2 Lemieux-Labontetal., PeerJ ,DOI10.7717/peerj.2430 9/19

PAGE 10

betadiversityindex,individualsofdifferentspeciesfromthesamehabitatBiodmeappear tobemorecloselyclusteredthanindividualsofthesamespecies A.jamaicensis from distincthabitatsFig.5A.TheweightedUniFracanalysisstilldiscriminatedthesamples byhabitatattheexpenseofhostspeciesFig.5B.OrdinationofonlyGranbyZoo,which includedbothmaleandfemale A.jamaicensis bats,doesnotshowanyclusteringaccording tosexdatanotshown.Howeverourlimitedsamplesizeonly6malespreventsusfrom drawingfirmconclusionontheinfluenceofsexonthebatskinmicrobiome.Sextherefore remainsapossibleconfoundingfactorofhabitat,becausetheBiodmecontainsallmale bats,wheretheGranbyzoowaspredominantlyfemale.Globally,betadiversityordinations thussuggestapredominantinfluenceofhabitatonskinmicrobiomebetadiversity. PERMANOVAanalysesalsostronglysupportedtheordinationresults.Habitat andhostspeciestogetherexplainedthemostvariationinJSD 1/2 .04%, adonis F D 16 : 212, p D 0 : 0001.Habitatappearedtobethemostimportantfactor,explaining 31.71%ofvariationinJSD 1/2 adonis F D 18 : 117, p D 0 : 0001.Infact,habitat explainedmorethantwicethevarianceexplainedbyhostspeciesfactors.95%, adonis F D 5 : 295, p D 0 : 0004.However,thePERMANOVAresultscouldbeaffected bynon-homogeneousdispersionofthedata.Indeed,the A.jamaicensis samples fromtheGranbyZooappearedtobelessdispersedinJSD 1/2 Fig.5A,andwe founddifferentlevelsofdispersionbyhabitat betadisper F D 33 : 4298, p D 0 : 0001 andbyhabitatandhostspeciescombined betadisper F D 7 : 0628, p D 0 : 0023, butnotforhostspeciesalonebetadisper, F D 3 : 5063, p D 0 : 0703.Nevertheless, theordinationclearlysupportsaclusteringpatternthatconfirmstheimportance ofhabitatandhostspeciesfactorscombined. RepeatingthesameanalysisonweightedUniFracdistancesyieldedsimilar PERMANOVAresultshabitatandhostspeciestogether:45.82%, adonis F D 16 : 066, p D 0 : 0001;habitat32.9%, adonis F D 19 : 1220, p D 0 : 0001;hostspecies:7.2%, adonis F D 3 : 0131, p D 0 : 0340.However,theUniFracdistancesdidnotvarysignificantlyindispersion byhabitat betadisper F D 1 : 6594, p D 0 : 2077orhabitatandhostspeciescombined betadisper F D 0 : 2244, p D 0 : 7989.Differentspeciesweredifferentlydispersed betadisper F D 8 : 0426, p D 0 : 0081.ResultsbasedonWeightedUniFracconfirmthathabitatandhost speciesareactingtogethertoshapetheskinmicrobiomeoftwospeciesofneotropicalbats livingindistincthabitats.Habitatappearstobethemajordriverofmicrobiomecommunity structure,withamoresubtlebutsignificantroleofhostspecies. DISCUSSION Theskinmicrobiomeisafirstlineofdefenseagainstpathogens Grice&Segre,2011 However,theskinmicrobiomeisstillpoorlyinvestigatedinmanyanimalseventhoughit couldplayaroleindiseaseoutcomes.Investigatingthefundamentalsourcesofvariationin theskinmicrobiomeisthereforeacriticalsteptowardunderstandingitsroleinhealthand diseases,andinhopeofeventuallydeployingmicrobiome-basedtherapiesagainstwildlife pathogens.Thisstudyexploredtherelativeinfluenceofendogenousandexogenousfactors i.e.,hostspeciesandhabitatinshapingtheskinmicrobiomeoftwospeciesoffrugivorous Lemieux-Labontetal., PeerJ ,DOI10.7717/peerj.2430 10/19

PAGE 11

Figure5Microbiomesclustermainlybyhabitat,butalsobyhostspecies. ANon-metricmultidimentionalscalingofJSD 1/2 ofbatskinmicrobiomecomposition.Eachpointrepresentsasinglemicrobiome sample.2Dstress D 0.09.BNon-metricmultidimentionalscalingofweightedUniFracdistancesamong batskinmicrobiomes.2Dstress D 0.09. captivebats.However,theskinmicrobiomeinfluenceisexpectedtobedifferentinwild populationswithrespecttobatslivingincaptivity Beckeretal.,2014 ; Loudonetal.,2014 ; Chengetal.,2015 .Indeed,captivebatsarerestrictedtoalimitedarea,whereaswild individualsareusuallyexposedtosignificantenvironmentalvariationwhenforagingand roostinginnature.Theenvironmentalstabilityofthecavesinwhichcaptivebatsareliving couldinturnexplaintherelativeimportanceofthehabitatontheskinmicrobiomewith respecttohostspeciesinourresults. Thespeciesofbatsunderstudywerefoundtohaveskin-associatedmicrobial communitiessimilartothosecharacterizedinothermammalianorderssuchascarnivores Lemieux-Labontetal., PeerJ ,DOI10.7717/peerj.2430 11/19

PAGE 12

dog,marsupialsTasmaniandevil,andprimateshuman Hoffmannetal.,2014 ; Chengetal.,2015 .Whereasthemostabundantbacterialphylai.e.,Actinobacteria, Proteobacteria,Firmicutes,Cyanobacteria,BacteroidetesandFusobacteriawere representedinallofthemammalsinvestigated,relativeabundancessometimesdiffered betweenspecies.Namely,Actinobacteriaisthemostabundantphyluminbatandhuman profilesalike, Grice&Segre and Ohetal. ,butonlythethirdmostabundant indogsandTasmaniandevils Hoffmannetal.,2014 ; Chengetal.,2015 .Suchdifferences couldbeexplainedbyhostspecies,samplingsiteontheskin,orhabitatvariation.Yet, captiveneotropicalbatswerealsofoundtoharborahigherproportionofCyanobacteria ontheirskin,aphylumalreadyidentifiedinthegutmicrobiomeofbats Phillipsetal., 2012 ,particularlyinwildpopulationsof C.perspicillata Carrillo-Araujoetal.,2015 .The presenceofthistaxonissuggestedtobeattributabletothecavehabitat,becausethistype ofmoistenvironmentisknowntobesuitablefortheestablishmentofCyanobacteriae.g., atthecaveentrancewherelightisavailable Albertano,2012 Wefoundapredominantinfluenceofhabitat,withaminorbutsignificantrole ofhostspeciesinshapingthemicrobiome.Specifically,thetwocohabitatingspecies, A.jamaicensis and C.perspicillata ,appearedtosharemoresimilarskinmicrobiomes,in termsofcompositionanddiversity,thanmemberofsamespecies A.jamaicensis from differenthabitats.Insuchgregariousanimals Porter,1978 ; Williams,1986 ; Ortega&Arita, 1999 ,individualsinhabitingasinglecavearepronetocontactwithoneanother,suchthat microbialtransferisfacilitatedincaptivity,bothdirectlyandindirectly.Inaddition,sharing thesamehabitatwithidenticalenvironmentalconditionslogicallyincursimilarconstraints ontheskinmicrobiomeofotherwisedifferenthostspecies.Contrarytopreviousstudies onamphibians,whichshowedsignificantdifferencesamongspeciescohabitinginthesame habitat McKenzieetal.,2012 ; Kuenemanetal.,2014 ; Walkeetal.,2014 ,habitatappearsto bethemainfactoractingontheskinmicrobiomeinbats,atleastincaptivity.Considering thathostspeciesandotherendogenicfactorsactincombinationwiththehabitattodrive theskinmicrobiomestructure,wesuggestthatbatpopulationscoulddifferindisease susceptibilitydependingontheirimmediateenvironment,aswellasthespeciesinvolved. Ourdefinitionofenvironmentalfactorshabitatsisbasedonacomparisonoftwo differentzoos,whichcoulddifferinotherconfoundingfactors.Someoftheseconfounding factorscanbeexcluded.Forexample,dietwasthesameinthetwozoos,andthebatcolonies wereestablishedatthesametimebothin1992.Therefore,dietandtimeincaptivitycan besafelyexcludedaspossibleconfoundersofenvironment.Otherfactorsdiddifferbetween zoos.Forexample,temperaturewas26 CallyearlongattheGranbyZooandrangedfrom 22intheBiodme.Therefore,weincludetemperatureaspartofwhatweconsidertobe ``environmentaleffects.''Thesexratioalsodifferedbetweenzoos,withonezooconsisting entirelyofmalesandtheotherprimarilyfemale.However,basedonbetadiversityanalyses, wefoundnoapparentdifferencesincommunitycompositionbetweensexes.Nevertheless, wecannotcompletelyexcludeenvironmentaleffectsbeingconfoundedwithsex.Sexis knowntoinfluencetheskinmicrobiomeinhumans Fiereretal.,2008 ; Yingetal.,2015 andithasbeenhypothesizedthatdifferencesinhormoneproductionandmetabolismmay affecttheskinmicrobiomecompositione.g.,pHandsebumproduction Giacomoni, Lemieux-Labontetal., PeerJ ,DOI10.7717/peerj.2430 12/19

PAGE 13

Mammone&Teri,2009 .However,suchdifferencesarenotalwaysdetectable,especially forbodysitesthatdonotexhibitsexualdifferencese.g.,drysitesvs.moistsites Ohetal., 2012 .Inourstudy,batswereswabbedonthebackandthewingssiteswhichareunlikely toexperiencesexualdimorphism.Therefore,differencesbetweenzooslikelyrepresent environmentalfactorse.g.,differencesintemperature,humidityandenvironmental bacteria,althoughwecannotcompletelyexcludeaconfoundinginfluenceofsex. Thepredominanteffectoftheenvironmenthabitatinshapingtheskinmicrobiome ofbatsprovidesbothrisksandbenefitstothehostinthefaceofpathogens.Onthe negativeside,becausethebatskinmicrobiomevariesmoreaccordingtohabitat,itmight behighlysusceptibletoinvasionbypathogenssuchasthe Pd fungus.Onthepositiveside, theskinmicrobiomecouldbemanipulatedwithprobiotics.Thisobservationsuggests thatpreviouslyconsideredprobioticanti-fungalbacteriasuchas Pseudomonas Hoytet al.,2015 and Rhodococcusrhodochrous strainDAP96253 Cornelisonetal.,2014 could beintroduceddirectlyintobathabitatstoeasetheirimplantationinskincommunities. Probioticscouldthereforerepresentapromisingmanagementtoolagainstpathogenslike Pd .Ofcourse,suchmanagementtoolswouldhavetobevalidatedintherelevanthost speciesandenvironments. Ourinvestigationoftheskinmicrobiomeoftwoneotropicalspeciesofbatslivingin controlledhabitatsrevealedthecombinedinfluenceofendogenousandexogenousfactors. Theseresultsshowthatthecaptivebatskinmicrobiomeisshapedbothbyhabitatand hostspecies.Goingforward,itwillbeimportanttoextendourresultstoadditionalbat specieslivingincaptivityandtowildpopulationsofbats.Inbatsandothermammals,the skinmicrobiomehasthepotentialtobecomeanimportanttoolforpopulationhealth, conservationandmanagement. ACKNOWLEDGEMENTS TheauthorswouldliketothankPatrickPar,LouisLazure,AlexChandonnet,Nathalie MaroisfromGranbyZooandJacquesDancosse,Anne-MariePlante,EmikoWongfrom MontralBiodmefortheirassistanceinthesamplingprocedure,CatherineGirard,Ins LevadesandJulieMarleauforhelpwithexperiments,YvesTerratforhelpwithdata analysis,andthreeanonymousreviewersfortheircommentsonanearlierversionofthis manuscript. ADDITIONALINFORMATIONANDDECLARATIONS Funding ThisresearchwasfundedbyanNSERCdiscoverygrantsOGP0155251toFJLandBJSwas supportedbyaCanadaResearchChair.Thefundershadnoroleinstudydesign,data collectionandanalysis,decisiontopublish,orpreparationofthemanuscript. GrantDisclosures Thefollowinggrantinformationwasdisclosedbytheauthors: NSERCdiscoverygrants:OGP0155251. Lemieux-Labontetal., PeerJ ,DOI10.7717/peerj.2430 13/19

PAGE 14

CompetingInterests Theauthorsdeclaretherearenocompetinginterests. AuthorContributions VirginieLemieux-Labontconceivedanddesignedtheexperiments,performedthe experiments,analyzedthedata,contributedreagents/materials/analysistools,wrotethe paper,preparedfiguresand/ortables,revieweddraftsofthepaper. NicolasTromasconceivedanddesignedtheexperiments,analyzedthedata,contributed reagents/materials/analysistools,revieweddraftsofthepaper. B.JesseShapirocontributedreagents/materials/analysistools,revieweddraftsofthe paper. Fran cois-JosephLapointeconceivedanddesignedtheexperiments,contributed reagents/materials/analysistools,revieweddraftsofthepaper. AnimalEthics Thefollowinginformationwassuppliedrelatingtoethicalapprovalsi.e.,approvingbody andanyreferencenumbers: WelfareAnimalandEthic'scommitteeofBiodmedeMontralandGranbyZoo institutionapprovedthisbyletter. DataAvailability Thefollowinginformationwassuppliedregardingdataavailability: FigshareSequencingdataDOI:10.6084/m9.figshare.3428159;Figshare MetadataDOI:10.6084/m9.figshare.3206668. SupplementalInformation Supplementalinformationforthisarticlecanbefoundonlineathttp://dx.doi.org/10.7717/ peerj.2430#supplemental-information. REFERENCES AlbertanoP.2012. Cyanobacterialbiofilmsinmonumentsandcaves.In:WhittonBA, ed. EcologyofcyanobacteriaII .Heidelberg:Springer,317. AndersonMJ.2001. Anewmethodfornon-parametricmultivariateanalysisofvariance. AustralEcology 26 :32DOI10.1111/j.1442-9993.2001.01070.pp.x. AndersonMJ.2006. Distance-basedtestsforhomogeneityofmultivariatedispersions. Biometrics 62 :245DOI10.1111/j.1541-0420.2005.00440.x. AndersonMJ,WalshDCI.2013. PERMANOVA,ANOSIM,andtheManteltestinthe faceofheterogeneousdispersions:whatnullhypothesisareyoutesting? Ecological Monographs 83 :557DOI10.1890/12-2010.1. AritaHT,VargasJA.1995. Naturalhistory,interspecificassociation,andincidenceofthe cavebatsofYucatan,Mexico. TheSouthwesternNaturalist 40 :29. BarkerGM.2002. Phylogeneticdiversity:aquantitativeframeworkformeasurement ofpriorityandachievementinbiodiversityconservation. BiologicalJournalofthe LinneanSociety 76 :165DOI10.1111/j.1095-8312.2002.tb02081.x. Lemieux-Labontetal., PeerJ ,DOI10.7717/peerj.2430 14/19

PAGE 15

BeckerMH,Richards-ZawackiCL,GratwickeB,BeldenLK.2014. Theeffectofcaptivity onthecutaneousbacterialcommunityofthecriticallyendangeredPanamanian goldenfrog Atelopuszeteki BiologicalConservation 176 :199 DOI10.1016/j.biocon.2014.05.029. BeldenLK,HarrisRN.2007. Infectiousdiseasesinwildlife:thecommunityecology context. FrontiersinEcologyandtheEnvironment 5 :533DOI10.1890/060122. BruckerRM,HarrisRN,SchwantesCR,GallaherTN,FlahertyDC,LamBA,Minbiole KPC.2008. Amphibianchemicaldefense:antifungalmetabolitesofthemicrosymbiont Janthinobacteriumlividum onthesalamander Plethodoncinereus Journalof ChemicalEcology 34 :1422DOI10.1007/s10886-008-9555-7. CaporasoJG,KuczynskiJ,StombaughJ,BittingerK,BushmanFD,CostelloEK,Fierer N,GonzlezPeaA,GoodrichJK,GordonJI,HuttleyGA,KelleyST,KnightsD, KoenigJE,LeyRE,LozuponeCA,McdonaldD,MueggeBD,PirrungM,ReederJ, SevinskyJR,TurnbaughPJ,WaltersWA,WidmannJ,YatsunenkoT,ZaneveldJ, KnightR.2010. QIIMEallowsanalysisofhigh-throughputcommunitysequencing data. NatureMethods 7 :335DOI10.1038/nmeth.f.303. CaporasoJG,LauberCL,WaltersWA,Berg-LyonsD,LozuponeCA,Turnbaugh PJ,FiererN,KnightR.2011. Globalpatternsof16SrRNAdiversityatadepthof millionsofsequencespersample. ProceedingsoftheNationalAcademyofSciencesof theUnitedStatesofAmerica 108 :4516DOI10.1073/pnas.1000080107. Carrillo-AraujoM,Ta sN,Alcntara-HernndezRJ,GaonaO,SchondubeJE,Medelln RA,JanssonJK,FalcnLI.2015. Phyllostomidbatmicrobiomecomposition isassociatedtohostphylogenyandfeedingstrategies. FrontiersinMicrobiology 6 :Article447DOI10.3389/fmicb.2015.00447. ChengY,FoxS,PembertonD,HoggC,PapenfussAT,BelovK.2015. TheTasmanian devilmicrobiomeimplicationsforconservationandmanagement. Microbiome 3 :Article76DOI10.1186/s40168-015-0143-0. CloutierD,ThomasDW.1992. Carolliaperspicillata MammalianSpecies 417 :1 DOI10.2307/3504157. CornelisonCT,KeelMK,GabrielKT,BarlamentCK,TuckerTA,PierceGE,CrowSA. 2014. Apreliminaryreportonthecontact-independentantagonismof Pseudogymnoascusdestructans by Rhodococcusrhodochrous strainDAP96253. BMCMicrobiology 14 :246DOI10.1186/s12866-014-0246-y. DeSantisTZ,HugenholtzP,LarsenN,RojasM,BrodieEL,KellerK,HuberT,Dalevi D,HuP,AndersenGL.2006. Greengenes,achimera-checked16SrRNAgene databaseandworkbenchcompatiblewithARB. AppliedandEnvironmentalMicrobiology 72 :5069DOI10.1128/AEM.03006-05. EdgarRC.2010. SearchandclusteringordersofmagnitudefasterthanBLAST. Bioinformatics 26 :2460DOI10.1093/bioinformatics/btq461. FiererN,HamadyM,LauberCL,KnightR.2008. Theinfluenceofsex,handedness, andwashingonthediversityofhandsurfacebacteria. ProceedingsoftheNational AcademyofSciencesoftheUnitedStatesofAmerica 105 :17994 DOI10.1073/pnas.0807920105. Lemieux-Labontetal., PeerJ ,DOI10.7717/peerj.2430 15/19

PAGE 16

FugledeB,TopseF.2004. JensenShannondivergenceandHilbertspaceembedding. In: Proceedingsofthe2004IEEEinternationalsymposiumoninformationtheory ISIT ,31. GargasA,TrestMT,ChristensenM,VolkTJ,BlehertDS.2009. Geomycesdestructans sp.nov.associatedwithbatwhite-nosesyndrome. Mycotaxon 108 :147 DOI10.5248/108.147. GiacomoniP,MammoneT,TeriM.2009. Gender-linkeddifferencesinhumanskin. JournalofDermatologicalScience 55 :144DOI10.1016/j.jdermsci.2009.06.001. GriceEA,SegreJA.2011. Theskinmicrobiome. NatureReviewsMicrobiology 9 :244 DOI10.1038/nrmicro2537. HaegemanB,HamelinJ,MoriartyJ,NealP,DushoffJ,WeitzJS.2013. Robustestimationofmicrobialdiversityintheoryandinpractice. TheISMEJournal 7 :1092 DOI10.1038/ismej.2013.10. HillMO.1973. Diversityandevenness:aunifyingnotationanditsconsequences. Ecology 54 :427DOI10.2307/1934352. HoffmannAR,PattersonAP,DieselA,LawhonSD,LyHJ,StephensonCE,Mansell J,SteinerJM,DowdSE,OlivryT,SuchodolskiJS.2014. Theskinmicrobiomein healthyandallergicdogs. PLoSONE 9 :e83197DOI10.1371/journal.pone.0083197. HolmS.1979. Asimplesequentiallyrejectivemultipletestprocedure. Scandinavian JournalofStatistics 6 :65DOI10.2307/4615733. HoytJR,ChengTL,LangwigKE,HeeMM,FrickWF,KilpatrickAM.2015. Bacteria isolatedfrombatsinhibitthegrowthof Pseudogymnoascusdestructans ,thecausative agentofwhite-nosesyndrome. PLoSONE 10 :e0121329 DOI10.1371/journal.pone.0121329. KruskalJB.1964. Multidimensionalscalingbyoptimizinggoodnessoffittoanonmetric hypothesis. Psychometrika 29 :1DOI10.1007/BF02289565. KruskalWH,WallisWA.1952. Useofranksinone-criterionvarianceanalysis. Journalof theAmericanStatisticalAssociation 47 :583 DOI10.1080/01621459.1952.10483441. KuenemanJG,ParfreyLW,WoodhamsDC,ArcherHM,KnightR,McKenzieVJ.2014. Theamphibianskin-associatedmicrobiomeacrossspecies,spaceandlifehistory stages. MolecularEcology 23 :1238DOI10.1111/mec.12510. KunzTH,FentonMB.2003. Batecology .Chicago:UniversityofChicagoPress. LorchJM,MeteyerCU,BehrMJ,BoylesJG,CryanPM,HicksAC,BallmannAE, ColemanJ,RedellDN,ReederDM,BlehertDS.2011. Experimentalinfectionof batswith Geomycesdestructans causeswhite-nosesyndrome. Nature 480 :376 DOI10.1038/nature10590. LoudonAH,WoodhamsDC,ParfreyLW,ArcherH,KnightR,McKenzieV,Harris RN.2014. Microbialcommunitydynamicsandeffectofenvironmentalmicrobial reservoirsonred-backedsalamanders Plethodoncinereus TheISMEJournal 8 :830DOI10.1038/ismej.2013.200. LozuponeCA,HamadyM,KelleyST,KnightR.2007. Quantitativeandqualitative diversitymeasuresleadtodifferentinsightsintofactorsthatstructuremicrobial Lemieux-Labontetal., PeerJ ,DOI10.7717/peerj.2430 16/19

PAGE 17

communities. AppliedandEnvironmentalMicrobiology 73 :1576 DOI10.1128/AEM.01996-06. LozuponeCA,KnightR.2005. UniFrac:anewphylogeneticmethodforcomparing microbialcommunities. AppliedandEnvironmentalMicrobiology 71 :8228 DOI10.1128/AEM.71.12.8228-8235.2005. LozuponeCA,LladserME,KnightsD,StombaughJ,KnightR.2011. UniFrac:an effectivedistancemetricformicrobialcommunitycomparison. TheISMEJournal 5 :169DOI10.1038/ismej.2010.133. McCoyCO,MatsenIVFA.2013. Abundance-weightedphylogeneticdiversitymeasures distinguishmicrobialcommunitystatesandarerobusttosamplingdepth. PeerJ 1 :e157DOI10.7717/peerj.157. McKenzieVJ,BowersRM,FiererN,KnightR,LauberCL.2012. Co-habitingamphibian speciesharboruniqueskinbacterialcommunitiesinwildpopulations. TheISME Journal 6 :588DOI10.1038/ismej.2011.129. McMurdiePJ,HolmesS.2013. Phyloseq:anRpackageforreproducibleinteractive analysisandgraphicsofmicrobiomecensusdata. PLoSONE 8 :e61217 DOI10.1371/journal.pone.0061217. McMurdiePJ,HolmesS.2014. Wastenot,wantnot:whyrarefyingmicrobiomedatais inadmissible. PLoSComputationalBiology 10 :e1003531 DOI10.1371/journal.pcbi.1003531. MinnisAM,LindnerDL.2013. .Phylogeneticevaluationof Geomyces andalliesreveals nocloserelativesof Pseudogymnoascusdestructans ,comb.nov.,inbathibernaculaof easternNorthAmerica. FungalBiology 117 :638 DOI10.1016/j.funbio.2013.07.001. MoellerAH,PeetersM,NdjangoJ-B,LiY,HahnBH,OchmanH.2013. Sympatric chimpanzeesandgorillasharborconvergentgutmicrobialcommunities. Genome Research 23 :1715DOI10.1101/gr.154773.113. MorrisonDW.1979. Apparentmaledefenseoftreehollowsinthefruitbat, Artibeus jamaicensis JournalofMammalogy 60 :11DOI10.2307/1379753. OchmanH,WorobeyM,KuoC-H,NdjangoJ-BN,PeetersM,HahnBH,Hugenholtz P.2010. Evolutionaryrelationshipsofwildhominidsrecapitulatedbygutmicrobial communities. PLoSBiology 8 :e1000546DOI10.1371/journal.pbio.1000546. OhJ,ConlanS,PolleyEC,SegreJA,KongHH.2012. Shiftsinhumanskinandnares microbiotaofhealthychildrenandadults. GenomeMedicine 4 :1 DOI10.1186/gm300. OksanenJ,BlanchetG,KindtR,LegendreP,MinchinPR,O'HaraRB,SimpsonGL, SolymosP,StevensM,WagnerH.2015. Vegan:communityecologypackage.R packageversion2.3-0. Availableathttp://CRAN.R-project.org/package=vegan OrtegaJ,AritaHT.1999. Structureandsocialdynamicsofharemgroupsin Artibeus jamaicensis Chiroptera:Phyllostomidae. JournalofMammalogy 80 :1173 DOI10.2307/1383168. OrtegaJ,Castro-ArellanoI.2001. Artibeusjamaicensis MammalianSpecies 662 :1 DOI10.1644/1545-1410<0001:AJ>2.0.CO;2. Lemieux-Labontetal., PeerJ ,DOI10.7717/peerj.2430 17/19

PAGE 18

PhillipsCD,PhelanG,DowdSE,McDonoughMM,FergusonAW,HansonJD,SilesL, Ordez-GarzaN,SanFranciscoM,BakerRJ.2012. Microbiomeanalysisamong batsdescribesinfluencesofhostphylogeny,lifehistory,physiologyandgeography. MolecularEcology 21 :2617DOI10.1111/j.1365-294X.2012.05568.x. PorterFL.1978. Roostingpatternsandsocialbehaviorincaptive Carolliaperspicillata JournalofMammalogy 59 :627DOI10.2307/1380245. PreheimSP,PerrottaAR,FriedmanJ,SmilieC,BritoI,SmithMB,AlmEJ.2013a. Computationalmethodsforhigh-throughputcomparativeanalysesofnatural microbialcommunities.In:EdwardFD,ed. Methodsinenzymology .SanDiego: ElsevierAcademicPress,353. PreheimSP,PerrottaAR,Martin-PlateroAM,GuptaA,AlmEJ.2013b. Distributionbasedclustering:usingecologytorefinetheoperationaltaxonomicunit. Appliedand EnvironmentalMicrobiology 79 :6593DOI10.1128/AEM.00342-13. PriceMN,DehalPS,ArkinAP.2010. FastTree2:approximatelymaximum-likelihood treesforlargealignments. PLoSONE 5 :e9490DOI10.1371/journal.pone.0009490. RDevelopementCoreTeam.2015. R:alanguageandenvironmentforstatistical computing.Vienna:RFoundationforStatisticalComputing. RoeselersG,MittgeEK,StephensWZ,ParichyDM,CavanaughCM,GuilleminK, RawlsJF.2011. Evidenceforacoregutmicrobiotainthezebrafish. TheISME Journal 5 :1595DOI10.1038/ismej.2011.38. Romano-BertrandS,Licznar-FajardoP,ParerS,Jumas-BilakE.2015. Impactde l'environnementsurlesmicrobiotes:focussurl'hospitalisationetlesmicrobiotes cutansetchirurgicaux. RevueFrancophonedesLaboratoires 2015 :75 DOI10.1016/S1773-035X-8. RothRR,JamesWD.1988. Microbialecologyoftheskin. AnnualReviewofMicrobiology 42 :441DOI10.1146/annurev.mi.42.100188.002301. SegataN,IzardJ,WaldronL,GeversD,MiropolskyL,GarrettWS,HuttenhowerC. 2011. Metagenomicbiomarkerdiscoveryandexplanation. GenomeBiology 12 :Article R60DOI10.1186/gb-2011-12-6-r60. SongSJ,LauberC,CostelloEK,LozuponeCA,HumphreyG,Berg-LyonsD,Caporaso JG,KnightsD,ClementeJC,NakielnyS,GordonJI,FiererN,KnightR.2013. Cohabitingfamilymemberssharemicrobiotawithoneanotherandwiththeirdogs. eLife 2 :e00458DOI10.7554/eLife.00458. TurnerGG,ReederDM,ColemanJTH.2011. Afive-yearassessmentofmortalityand geographicspreadofwhite-nosesyndromeinNorthAmericanbats,withalookat thefuture:updateofwhite-nosesyndromeinbats. BatResearchNews 52 :13. TzengT-D,PaoY-Y,ChenP-C,WengFC-H,JeanWD,WangD.2015. Effectsofhost phylogenyandhabitatsongutmicrobiomesoforientalriverprawn Macrobrachium nipponense PLoSONE 10 :e0132860DOI10.1371/journal.pone.0132860. USFish&WildlifeService.2012. NorthAmericanbatdeathtollexceeds5.5million fromwhite-nosesyndrome. NewsRelease Availableathttp://www.batcon.org/pdfs/ USFWS_WNS_Mortality_2012_NR_FINAL.pdf Lemieux-Labontetal., PeerJ ,DOI10.7717/peerj.2430 18/19

PAGE 19

VellendM,CornwellWK,Magnuson-FordK,MooersA.2011. Measuringphylogeneticbiodiversity.In:MagurranAE,ed. Biologicaldiversity:frontiersinmeasurement andassessment .Oxford:OxfordUniversityPress,194. VoigtCC,KingstonT.2016. Batsintheanthropocene:conservationofbatsinachanging world .ChamHeidelberg:Springer. WalkeJB,BeckerMH,LoftusSC,HouseLL,CormierG,JensenRV,BeldenLK.2014. Amphibianskinmayselectforrareenvironmentalmicrobes. TheISMEJournal 8 :2207DOI10.1038/ismej.2014.77. WilcoxonF.1945. Individualcomparisonsbyrankingmethods. BiometricsBulletin 1 :80DOI10.2307/3001968. WilliamsCF.1986. Socialorganizationofthebat, Carolliaperspicillata Chiroptera: Phyllostomidae. Ethology 71 :265DOI10.1111/j.1439-0310.1986.tb00591.x. YingS,ZengDN,ChiL,TanY,GalzoteC,CardonaC,LaxS,GilbertJ,QuanZX.2015. Theinfluenceofageandgenderonskin-associatedmicrobialcommunitiesinurban andruralhumanpopulations. PLoSONE 10 :e0141842 DOI10.1371/journal.pone.0141842. Lemieux-Labontetal., PeerJ ,DOI10.7717/peerj.2430 19/19


printinsert_linkshareget_appmore_horiz

Download Options

close
No images are available for this item.
Cite this item close

APA

Cras ut cursus ante, a fringilla nunc. Mauris lorem nunc, cursus sit amet enim ac, vehicula vestibulum mi. Mauris viverra nisl vel enim faucibus porta. Praesent sit amet ornare diam, non finibus nulla.

MLA

Cras efficitur magna et sapien varius, luctus ullamcorper dolor convallis. Orci varius natoque penatibus et magnis dis parturient montes, nascetur ridiculus mus. Fusce sit amet justo ut erat laoreet congue sed a ante.

CHICAGO

Phasellus ornare in augue eu imperdiet. Donec malesuada sapien ante, at vehicula orci tempor molestie. Proin vitae urna elit. Pellentesque vitae nisi et diam euismod malesuada aliquet non erat.

WIKIPEDIA

Nunc fringilla dolor ut dictum placerat. Proin ac neque rutrum, consectetur ligula id, laoreet ligula. Nulla lorem massa, consectetur vitae consequat in, lobortis at dolor. Nunc sed leo odio.