Host, Pathogen, and Environmental Characteristics Predict White-Nose Syndrome Mortality in Captive Little Brown Myotis (Myotis lucifugus)

previous item | next item

Host, Pathogen, and Environmental Characteristics Predict White-Nose Syndrome Mortality in Captive Little Brown Myotis (Myotis lucifugus)

Material Information

Host, Pathogen, and Environmental Characteristics Predict White-Nose Syndrome Mortality in Captive Little Brown Myotis (Myotis lucifugus)
Series Title:
Johnson, Joseph S.
Reeder, DeeAnn M.
McMichael, James W.
Meierhofer, Melissa B.
Stern, David W.F. et al
Johnson et al
Publication Date:


Subjects / Keywords:
Hibernation ( local )
Bats ( local )
Winter ( local )
Death Rates ( local )
Fats ( local )
White-Nose Syndrome ( local )
Fungal Physiology ( local )
North America ( local )
serial ( sobekcm )


An estimated 5.7 million or more bats died in North America between 2006 and 2012 due to infection with the fungus Pseudogymnoascus destructans (Pd) that causes white-nose syndrome (WNS) during hibernation. The behavioral and physiological changes associated with hibernation leave bats vulnerable to WNS, but the persistence of bats within the contaminated regions of North America suggests that survival might vary predictably among individuals or in relation to environmental conditions. To investigate variables influencing WNS mortality, we conducted a captive study of 147 little brown myotis (Myotis lucifugus) inoculated with 0, 500, 5 000, 50 000, or 500 000 Pd conidia and hibernated for five months at either 4 or 10°C. We found that female bats were significantly more likely to survive hibernation, as were bats hibernated at 4°C, and bats with greater body condition at the start of hibernation. Although all bats inoculated with Pd exhibited shorter torpor bouts compared to controls, a characteristic of WNS, only bats inoculated with 500 conidia had significantly lower survival odds compared to controls. These data show that host and environmental characteristics are significant predictors of WNS mortality, and that exposure to up to 500 conidia is sufficient to cause a fatal infection. These results also illustrate a need to quantify dynamics of Pd exposure in free-ranging bats, as dynamics of WNS produced in captive studies inoculating bats with several hundred thousand conidia may differ from those in the wild.
Original Version:
PlosONE, Vol. 9, no. 11 (2014-11-19).

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
This item is licensed with the Creative Commons Attribution License. This license lets others distribute, remix, tweak, and build upon this work, even commercially, as long as they credit the author for the original creation.
Resource Identifier:
K26-05131 ( USFLDC: LOCAL DOI )
k26.5131 ( USFLDC: LOCAL Handle )

USFLDC Membership

University of South Florida
Karst Information Portal

Postcard Information



This item is only available as the following downloads:

Full Text


Host,Pathogen,andEnvironmentalCharacteristics PredictWhite-NoseSyndromeMortalityinCaptiveLittle BrownMyotis(Myotislucifugus)JosephS.Johnson1,DeeAnnM.Reeder1,JamesW.McMichaelIII1,MelissaB.Meierhofer1, DanielW.F.Stern1,ShayneS.Lumadue1,LaurenE.Sigler1,HarrisonD.Winters1,MeganE.Vodzak1, AllenKurta2,JosephA.Kath3,KennethA.Field1*1 DepartmentofBiology,BucknellUniversity,Lewisburg,Pennsylvania,UnitedStatesofAmerica, 2 DepartmentofBiology,EasternMichiganUniversity,Ypsilanti, Michigan,UnitedStatesofAmerica, 3 IllinoisDepartmentofNaturalResources,Springfield,Illinois,UnitedStatesofAmericaAbstractAnestimated5.7millionormorebatsdiedinNorthAmericabetween2006and2012duetoinfectionwiththefungus Pseudogymnoascusdestructans ( Pd )thatcauseswhite-nosesyndrome(WNS)duringhibernation.Thebehavioraland physiologicalchangesassociatedwithhibernationleavebatsvulnerabletoWNS,butthepersistenceofbatswithinthe contaminatedregionsofNorthAmericasuggeststhatsurvivalmightvarypredictablyamongindividualsorinrelationto environmentalconditions.ToinvestigatevariablesinfluencingWNSmortality,weconductedacaptivestudyof147little brownmyotis( Myotislucifugus )inoculatedwith0,500,5000,50000,or500000 Pd conidiaandhibernatedforfivemonths ateither4or10 u C.Wefoundthatfemalebatsweresignificantlymorelikelytosurvivehibernation,aswerebatshibernated at4 u C,andbatswithgreaterbodyconditionatthestartofhibernation.Althoughallbatsinoculatedwith Pd exhibited shortertorporboutscomparedtocontrols,acharacteristicofWNS,onlybatsinoculatedwith500conidiahadsignificantly lowersurvivaloddscomparedtocontrols.Thesedatashowthathostandenvironmentalcharacteristicsaresignificant predictorsofWNSmortality,andthatexposuretoupto500conidiaissufficienttocauseafatalinfection.Theseresultsalso illustrateaneedtoquantifydynamicsof Pd exposureinfree-rangingbats,asdynamicsofWNSproducedincaptivestudies inoculatingbatswithseveralhundredthousandconidiamaydifferfromthoseinthewild.Citation: JohnsonJS,ReederDM,McMichaelJWIII,MeierhoferMB,SternDWF,etal.(2014)Host,Pathogen,andEnvironmentalCharacteristicsPredictWhiteNoseSyndromeMortalityinCaptiveLittleBrownMyotis( Myotislucifugus ).PLoSONE9(11):e112502.doi:10.1371/journal.pone.0112502 Editor: MichelleL.Baker,CSIRO,Australia Received June11,2014; Accepted October15,2014; Published November19,2014 Copyright: 2014Johnsonetal.Thisisanopen-accessarticledistributedunderthetermsoftheCreativeCommonsAttributionLicense,whichpermits unrestricteduse,distribution,andreproductioninanymedium,providedtheoriginalauthorandsourcearecredited. DataAvailability: Theauthorsconfirmthatalldataunderlyingthefindingsarefullyavailablewithoutrestriction.Allrelevantdataarewithinthepaper. Funding: FundingforthisprojectwasprovidedbytheUnitedStatesFishandWildlifeServicegrantF12AP01210(DMRandKAF)andtheWoodtigerFoundation (DMR).Thefundershadnoroleinstudydesign,datacollectionandanalysis,decisiontopublish,orpreparationofthemanuscript. CompetingInterests: Theauthorshavedeclaredthatnocompetinginterestsexist. *Email:kfield@bucknell.eduIntroductionWhite-nosesyndrome(WNS)isafungaldiseaseaffecting hibernatingbats,causingthedeathofanestimated5.7–6.7 millionbatssinceitsinitialdiscoveryinNorthAmericain2006 (USFWS2012).WNSiscausedbythecold-adaptedfungus Pseudogymnoascusdestructans ( Pd ),whichinvadesthedermisand epidermisofbatsduringhibernation[1–3].Batsarevulnerableto Pd becausetheirimmunesystemissuppressedalongwithnearly allphysiologicalprocessesduringhibernation[4–6],andbecause thecoldtemperatureandhighhumiditytypicalinmanybat hibernacularepresentidealconditionsfor Pd growth[7–9]. Pd wasfirstidentifiedas Geomycesdestructans in2009[10],andwas reclassifiedtothegenus Pseudogymnoascus in2013[11].The fungusisnotnativetoNorthAmerica,andisbelievedtohave beenintroducedfromEurope[12,13].Althoughlarge-scale mortalityofbatshasneverbeendocumentedinEurope,90% mortalityofbatsoccursinNorthAmericanhibernaculaafter Pd is introduced[14,15].Suchhighmortalityrateshaveledto predictionsofregionalextinctions,althoughnotallbatspecies appearequallyaffectedbythedisease[15,16]. Thelittlebrownmyotis( Myotislucifugus )isamongthespecies mostheavilyimpactedbyWNS[15].Littlebrownmyotisinfected with Pd arousemorefrequentlyfromhibernationthanunaffected bats,resultinginexhaustionoffatreservesneededtosurvivethe winter[13,17].Althoughthetriggerforthisincreaseinarousals hasyettobeconfirmed,thereisevidencethathypotonic dehydrationofinfectedbatsmayinfluencearousalbehaviors [18].Thus,itislikelythatlittlebrownmyotisareparticularly vulnerableto Pd becausetheyhavenaturallyhighratesof evaporativewaterlossduringwinter,andbecausetheirsmallsize ( , 10g)limitstheirtotalfatreservesuponenteringhibernation andthenumberofperiodicarousalsthatcanbesustainedduring winter[19–21]. Despitethehighmortalityratesoflittlebrownmyotisinhabiting Pd -contaminatedhibernacula,summermaternitycoloniesoflittle brownmyotisstillpersistwithinthecontaminatedregionofNorth America.Thepersistenceofthesematernitycolonies,whichare typicallycomposedoffemalebatsthatreturntofamiliarroosts eachyearafterhibernation[22–24],suggeststhatsomebatshave survivedseveralwintersofexposureto Pd .Althoughitispossible PLOSONE|www.plosone.org1November2014|Volume9|Issue11|e112502


thatthesebatsover-winterinhibernaculastillunexposedto Pd or survivedduetorandomfactors,itismorelikelythatsomebats havenaturallyhighersurvivalrateswhenexposedtothefungus. Thissurvivalmayresultfromimmunologicalresistanceto Pd , differencesinphysiology(e.g.,largerbodysizeorlowerrateof evaporativewaterloss),orbehavioralecology(e.g.,useof hibernaculummicroclimateslessfavorableforfungalgrowth)that resultinhigherresilience.Studiesofthelittlebrownmyotis demonstrateindividualvariabilityinbothwinterecologyand physiology,includingdifferencesintorporpatternsandenergy use,andselectionofmicroclimateswithinahibernaculum, representingpossiblefoundationsforvariationinsurvival[25–27]. IfindividualvariationinecologyandphysiologyrelatetoWNS mortality,thenmortalityshouldvarypredictably.Forexample, malelittlebrownmyotisutilizetheirwinterenergyreservesmore rapidlythanfemales[26,27],potentiallymakingthemmore vulnerabletothefurtherdepletionoffatreserveswhenexposedto Pd .Mortalitymayalsovaryamongbatsinhabitingdifferent hibernaculaorareaswithinahibernaculumthathavedifferent microclimates.Higherpopulationdeclineshavebeenobserved amongpopulationsoflittlebrownmyotisinhabitingwarmer hibernacula[28],atrendpossiblylinkedtothegrowthrateof Pd , whichpeaksbetween12.5and15.8 u Canddeclinesatwarmerand coldertemperatures[8].Temperaturesinsidehibernaculaoflittle brownmyotisaretypicallybelow10 u Cbutrangewidely,including environmentalconditionswithvaryingsuitabilityfor Pd growth [7,29].Becausetemperaturealsoaffectsthewintertorpor behaviorsandenergyexpenditureofbats[30,31],variablessuch asthetemperatureandindividualbehaviorandphysiologyare likelytohaveinteractingeffectsonfungalgrowthandWNS mortality. Thus,understandingwhetherornotsomebatsarebetterableto surviveWNSrequiresanunderstandingoftheinteractionofthe environment,host,andpathogen,aconceptpresentedinthe diseasetriangle[9,32,33].However,ourcurrentunderstandingof WNSmortalitylackssuchcontextbecauselaboratorystudies investigatingthediseaseareconductedunderasingleenvironmentalcondition,typicallyexposingbatsto500000 Pd conidia andhibernatingthemat7 u C,withoutconsiderationforindividual variationinsurvival[3,13]. OurpurposewastoexamineWNSmortalityandsurvivalina captivepopulationoflittlebrownmyotisinthecontextofthis diseasetriangle.Wehypothesizedthatthenumberof Pd conidia batsareinitiallyexposedtoaffectsfungalloadattheendof hibernation,durationoftorporbouts,andmortality.Wefurther hypothesizedthatbatshibernatingatwarmtemperatureshave higher Pd loadsattheendofhibernation,exhibitshortertorpor bouts,andexperiencegreatermortality.Finally,wehypothesized thatmortalitywouldbeinverselyrelatedtobodyconditionatthe onsetofhibernation,andthatmortalitywouldbegreatestamong males.ResultsOfthe147littlebrownmyotis,69(47%)survivedthefivemonthcaptivehibernationstudy.Threeemaciatedbatsdied within1weekofremovalfromhibernationandwerenot consideredtohavesurvivedhibernation.Logisticregression analysisshowedthatmortalityamonglittlebrownmyotiswas notrandom( x2=65.9,df=6, P , 0.001),with Pd inoculation ( P =0.037),temperature( P , 0.001),sex( P =0.024),andprehibernationbodycondition( P , 0.001)significantlyinfluencing mortality(Fig.1).Mortalityincontrolgroupsconsistedmostly (89%)ofmales(3of3batsinthe4 u Ccontrol;5of6batsinthe 10 u Ccontrol),allofwhichhadbodyconditionindicesattheonset ofhibernationthatwerebelowthemedian.Amonginoculation treatments,onlybatsexposedto500 Pd conidiahadregression coefficientssignificantlydifferentfrom0,meaningitwastheonly inoculationtreatmentwithmortalityoddssignificantlygreater thanthecontrolgroups(Table1).Mortalityoddsformaleswere significantlygreaterthanfemales,greaterforbatshibernatingat 10 u Ccomparedto4 u C,andinitialbodyconditionhadanegative, lineareffectonmortality(Table1).Averagebodyconditionof females(0.224 6 0.02s.d.)wassignificantlyhigher( t = 2 6.0,df 145, P , 0.001)thanmales(0.206 6 0.02)attheonsetof hibernation,butthecorrelationbetweenbodyconditionandsex inthelogisticregressionmodel(0.255)wasnotgreatenoughto meritremovalofeithervariable.Thus,hostandenvironmental variableshelpedpredictmortality,withmales,batsofbothsexes withlowbodycondition,andbatshibernatingatwarmer temperatureslesslikelytosurvive. Differencesintorporpatternsamongtreatmentgroupsresembleddifferencesinmortality(Fig.2).Skintemperaturedatawere successfullycollectedfor113bats(77%).Ananalysisofvariance (ANOVA)showedthataveragetorporboutdurationvariedwith Pd inoculation( F4,10223.0, P , 0.001)andhibernationtemperature( F1,102=115, P , 0.001).Batsexhibitedlongertorporbouts at4 u C,andbatsinthecontrolgroupshadlongertorporbouts thanbatsineachinoculationtreatment( P , 0.05;Fig.2). Additionally,batsinoculatedwith500conidiaalsoexhibited shortertorporboutsthanbatsinoculatedwith500000conidia ( P , 0.05).Therewasasignificantinteractionbetween Pd inoculationandtemperature( F4,102=6.6, P , 0.001)reflecting alargerdecreaseinaveragetorporboutdurationassociatedwith Pd inoculationat10 u C(Fig.2).Therewasnosignificanteffectof sexontorporboutduration( F1,103=3.5, P =0.063),although theobservedpowerwaslow(0.46),duetolowsamplesizesand highvarianceforeachsexwithingroups.Comparisonofcontrol malesandfemales(Fig.3)revealedlongertorporboutsamong femaleshibernatingat4 u C( t = 2 1.984,df=12, P =0.04)butnot 10 u C( t = 2 1.302,df=9, P =0.11).Overall,wefoundthat Pd inoculation,especiallyatlowdoses,resultedinanincreasein arousalsfromhibernation. Greateramountsof Pd detectedonwingswabswerenot associatedwithhighermortalityormorefrequentarousalsfrom torpor. Pd wasnotdetectedbyquantitativepolymerasechain reaction(qPCR)onanybats( n =147)uponarrivalatourfacility, andwasnotdetectedonanycontrolbatattheendofhibernation ( n =29). Pd loadsdetectedoninoculatedbatsattheendof hibernationwerehighlyvariable(Fig.4).Wefoundnodifference inthemedianfungalloadsdetectedonbatsineachinoculation treatmentbetweentemperatures.Withineachtemperature, however,medianfungalloadsvariedsignificantlyamonginoculationgroups(4 u C: H =35.4, P , 0.001;10 u C: H =22.6, P , 0.001;Fig.4).Atbothtemperatures,significantlyless Pd was detectedonbatsinoculatedwith500conidiacomparedtoallother treatmentgroups.At4 u C,less Pd wasdetectedonbatsinoculated with5000conidiacomparedtobatsinoculatedwith500000. Inoculatedbatssurvivingthehibernationexperimentshowed markeddeclinesin Pd loadswithinseveralweeksofremovalfrom hibernation.Forty-fiveinoculatedbatswereswabbedbothupon removalfromhibernationaswellas19dayslater. Pd wasdetected onneitherdatefor8bats(18%),and Pd loadsdeclinedtozeroin 16bats(35%).Theremaining21bats(47%)exhibiteda15-fold mediandecreasein Pd load,withamedianloadof11487 genomicequivalents(range=292–640000)attheendof hibernation,followedbyamedianloadof735genomic equivalents(range:10–18611)19dayslater.Host,Pathogen,andEnvironmentinWNS PLOSONE|www.plosone.org2November2014|Volume9|Issue11|e112502


DiscussionWefoundthatWNSmortalityisinfluencedbythelevelof Pd exposure,characteristicsofthehost,andtheenvironment,and thatseveralvariableshaveinteractingeffects.Aswepredicted, differencesintorporpatternsmirroreddifferencesinmortality,but contrarytoourexpectations,batsinoculatedwiththelowest Pd doseexperiencedthegreatestmortalityrateandshortesttorpor boutsduringourstudy.Together,thesedataprovideimportant insightsonWNSsurvivorsandhaveseveralimplicationsforthe possibilityoflong-termsurvivaloflittlebrownmyotisineastern NorthAmerica. Batswithgreaterbodycondition,indicativeofgreaterfat reserves[34],weremorelikelytosurviveourexperiment.Because batsrelyonthemetabolismoffattoarousefromtorporand sustainbriefperiodsofeuthermyduringhibernation[4],fat reserveslimitthenumberoftimesabatcanarouse[35].Thus, batswithgreaterbodyconditionattheonsetofhibernationcan sustainmorearousalsduringthecourseofawinter,makingthem bettersuitedtosurvivingtheincreasedfrequencyofarousals associatedwithWNS[13,17].Inastudyoffree-rangingbats affectedbyWNS,however,Reederandcolleagues[17]foundno relationshipbetweendateofdeathandbodycondition.This discrepancylikelyresultsfromtheconfoundingeffectsofother pertinentvariablesinfluencingthedisease.Asourresultsshow, WNSmortalityisdrivenbytheinteractionofvariablespertaining tonotonlythehost,butalsothepathogenandtheenvironment. Figure1.Comparisonofsurvivalrates(percent)forlittlebrownmyotis(Myotislucifugus)inoculatedwithdifferentdosesofPseudogymnoascusdestructans(Pd)conidiaandhibernatedforfivemonthsateither4or106C. doi:10.1371/journal.pone.0112502.g001 Table1. Logisticregressionanalysisoflittlebrownmyotis( Myotislucifugus )survivalwhenexperimentallyinoculatedwith Pseudogymnoascusdestructans undervaryingconditions.VariableWP-valueOddsRatio95%ConfidenceInterval BodyCondition15.6 , 0.0010.570.43–0.75 Temperature 10 u C15.6 , 0.0015.82.4–14.0 Sex Male5.10.0242.81.1–6.8 Pd inoculation 500spores8.40.0049.12.0–40.4 5000spores1.50.2172.40.61–8.8 50000spores0.20.6631.30.36–5.1 500000spores0.30.6091.40.38–5.6 Forcategoricalvariables,resultsaregiveninrespecttoareferenceconditionof10 u C,female,andinoculatedwithnofungalspores. doi:10.1371/journal.pone.0112502.t001Host,Pathogen,andEnvironmentinWNS PLOSONE|www.plosone.org3November2014|Volume9|Issue11|e112502


Understandinghowourresults,obtainedundercarefullycontrolledconditions,comparetosurvivalandmortalityofwild populationsrequirestheincorporationofallthesevariables,and providesafoundationforhypothesesrelatedtothepersistenceof littlebrownmyotisintheWNS-affectedregionofNorthAmerica. Femalesalsoexhibitedgreatersurvivalprobabilityinourstudy. Femalelittlebrownmyotisarefrequentlydocumentedwith greatermassorbodyconditioncomparedtomalesinthelate fallorearlywinter[17,27,36,37],adifferencealsopresentinour captivesample.Althoughfemalesinourstudyhadgreaterbody conditionthanmalesattheonsetofhibernation,wedidnotfinda largecorrelationbetweensexandbodyconditioninoursurvival analysis,demonstratingthatwhilelargebodyconditioncontributestosurvivalinfemales,thereareothersex-baseddifferences contributingtovariationinmortality.JonassonandWillisfound thathibernatinglittlebrownmyotisfemaleshavelesspronounced declinesinbodymassoverwintercomparedtomales[26,27],but wereunabletoattributethistodifferencesintorporpatterns duringhibernationbetweenthetwosexes.Wewerealsounableto detectdifferencesinmeantorporboutdurationbetweenmales andfemalesinouroverallanalysis,althoughstatisticalpowerwas low.Alimitedcomparisonoftorporboutsbetweenmalesand Figure2.Averagedurationoftorporbouts(days)forlittlebrownmyotis(Myotislucifugus)inoculatedwithdifferentdosesofPseudogymnoascusdestructans(Pd)conidiaandhibernatedforfivemonthsateither4or106C. Withineachtemperature,treatmentsnot sharingcommonsuperscriptlettersweresignificantlydifferent( P , 0.05).Alldosesdifferedbetweentemperatures( P , 0.05). doi:10.1371/journal.pone.0112502.g002 Figure3.Averagedurationoftorporbouts(days)ofmaleandfemalelittlebrownmyotis(Myotislucifugus)notinoculatedwithPseudogymnoascusdestructans(Pd)andhibernatedateither4or106C. Withineachtemperature,sexesnotsharingcommonsuperscript lettersweresignificantlydifferent( P , 0.05). doi:10.1371/journal.pone.0112502.g003 Host,Pathogen,andEnvironmentinWNS PLOSONE|www.plosone.org4November2014|Volume9|Issue11|e112502


femalesincontrolgroupsdidrevealdifferencesintorpor behaviors,however,potentiallyexplainingwhyfemaleshadhigher survivalratesthanmales.Thiswastrueofinoculatedaswellas controlbats;83%( n =5)ofthemortalityobservedamongcontrol batshibernatedat10 u Cconsistedofmaleswithbodycondition belowthatofanyfemaleinthegroup. Differencesinwinterbodyconditionandtorporbehaviors betweenmaleandfemalelittlebrownmyotisarebelievedtobe relatedtothereproductivebiologyofthespecies.Because copulationoccursthroughoutfallandwinter,andovulation occursinspringafteremergencefromhibernation,severalhave arguedthatmalesbenefitfromawintertorporstrategyfavoring frequentarousalswhilefemalesarouselessfrequentlytoemerge fromhibernationwiththefatstoresnecessaryforovulation [27,38–42].Whilesomedatasupportthishypothesis[27],the largevariationobservedinwintertorporbehaviorprovides evidencethateachsexexhibitsdiversityintheirtorporbehaviors [27].Furthermore,arousalfromhibernationandenergysavings whiletorpidarenotonlydeterminedbysex.Frequencyofarousals andtorpidmetabolicratesdecreasewithtemperature,resultingin greaterenergysavings[30,31].Boylesandcolleaguessuggested thatbothsexesoflittlebrownmyotisselectmicroclimateswithin cavesforhibernationbasedupontheirbodycondition,i.e.bats withlessfathibernatingincolderregionstoconserveenergy[25]. Thus,torporpatternsinfree-ranginglittlebrownmyotisare influencedbytheinteractionofnumerousvariables,includingsex, bodycondition,andenvironmentalconditions. Becausecoldertemperaturesareconducivetogreaterenergy savingsforbats(providedambienttemperatureremainsabovethe hypothalamicset-point)[4,31]andareassociatedwithslower fungalgrowth[8],wepredictedthatWNSmortalitywouldbe greaterathighertemperatures.Thiswassupportedbyour mortalityandtorpordurationresults,thelatterofwhichfounda significantinteractionbetween Pd inoculationandtemperature, andisconsistentwithpopulationdeclinesobservedinlittlebrown myotishibernacula,wherewarmerhibernaculaexhibitedthe largestdeclines[28].Similarly,wehypothesizedfungalloads wouldbegreaterat10 u C,butcontrarytoourexpectations,wedid notdetectdifferencesin Pd loadsbetweentemperatures.Thus, Pd loadsappeartobepoorindicatorsoftheseverityofinfectionand WNS,asbothmortalityandfrequencyofarousalsfrom hibernationincreasedat10 u C.Itisimportanttonote,however, thatbecause90%relativehumiditywasmaintainedinenvironmentalchambersatbothtemperatures,theabsolutehumidityof theairwasapproximately40%greaterat10 u C.Thisdifferencein absolutehumiditybetweentemperaturescouldpotentiallyresultin differentprogressionsofWNS,resultingindifferencesintherates ofevaporativewaterlossinbatsorfungalinvasionoftheskin[43]. Thus,theroleofabsolutehumiditywasunclearfromour experiment.Regardless,thehighvariabilityin Pd loadsdetected atbothtemperatureshighlightsthevariabilityin Pd growthon batsrelativetogrowthpatternsinculture.Infree-rangingbats exposedtomorevariableinitial Pd exposuresthanthoseusedin ourexperiment,andinhabitinghibernaculawithconditionsthat canfluctuatethroughoutthewinter,changeinfungalloadsare likelytobeevenmorevariable.Inadditiontobeingmorevariable, exposureto Pd infree-rangingbatsislikelytooccurrepeatedly duringthewinter,asbatsmoveaboutwithinandamong hibernacula.Thesedynamicsof Pd spreadarepoorlyunderstood, however,andmoreresearchinthisareaisneeded. Alsocontrarytoourprediction,weobservedthegreatest mortalityandshortesttorporboutsinbatsinoculatedwiththe leastconcentratedsolutionof Pd conidia.Thisparadoxicalresult couldbeexplainediflowerconcentrationsof Pd growdifferently than Pd athighdensities.Wehypothesizethat Pd germinationis inverselyrelatedtothedensityofconidia,resultinginmorerapid fungalinvasionandmortalityinbatsinoculatedwith500conidia. Density-dependentgrowthhasbeendocumentedinmanyfungal speciesandisknownasautoinhibitionorself-inhibition,aprocess thatcanbemediatedbyvolatileorganiccompoundsproducedby multiplegeneraoffungi[44,45].Inthefirststudytoshow inoculationofbatswith Pd causesWNS,Lorchandcolleagues [3,13]notedthattheircaptivestudywasnotlongenoughtoresult inmortalitydespitehistologicalevidenceofinfectionamong inoculatedbats.Density-dependentgrowthof Pd mayexplainwhy mortalitydidnotoccurwithinthetimeperiodoftheirstudy, Figure4.Pseudogymnoascusdestructans(Pd)DNAdetectedat theendofhibernationonlittlebrownmyotis(Myotislucifugus) inoculatedwithvaryingdosesofPdconidiaandhibernatedfor fivemonthsateither46C(A)or106C(B). Individualobservations arerepresentedwithopencirclesandmediansrepresentedby horizontallines.Atbothtemperatures,significantlyless Pd was detectedonbatsinthe500conidiagroupthanonbatsinother treatmentgroups.At4 u C,less Pd wasdetectedonbatsinoculatedwith 5000conidiacomparedtobatsinoculatedwith500000. doi:10.1371/journal.pone.0112502.g004 Host,Pathogen,andEnvironmentinWNS PLOSONE|www.plosone.org5November2014|Volume9|Issue11|e112502


whichinoculatedbatswith500000conidia.Ourmortalitydata areonlysuggestiveofself-inhibitionin Pd ,however,andresearch documentinggerminationatvaryingconcentrationsofconidiais neededtodirectlyaddressthishypothesis.Suchresearch,along withstudiesdocumentingnaturalexposuredynamicsamongfreerangingbats,areneededtobetterinformcaptivestudiesofWNS, whichtypicallyinoculatebatswith500000conidia[3,13]. Inoculationsresultinginmortalitypatternsthatdifferfromwild populationsmayproducemisleadinginsightsintoWNS. Itisnotablethatwewereoftenunabletodetect Pd DNAon swabsfrombatsinoculatedwith500conidia.Thisdemonstrates thatthenumberof Pd conidiadidnotexponentiallyincreaseon batsinthistreatment.Wehypothesizethatbatshavesomeability tocontrolthefungalinfectionatthislevelofexposure.Although themechanismofcontrolisuncertain,theincreasedfrequencyof periodicarousalsobservedinthesetreatmentslikelyplayssome role.Arousalsprovideopportunitiesforeuthermicrest,grooming [46],andimmuneupregulation,althoughthebrevityofperiodic arousalsinbatscomparedtootherhibernatingmammalslikely limitspotentialimmuneresponsesto Pd [47–49].Aspreviously discussed,however,thenumberofarousalsbatscanenergetically sustainarelimited,andthefrequentarousalsinbatsinoculated with500conidiaresultedinhighmortalitydespiteanabilityto controlthefungus.Furthermore, Pd alwaysremainedonsome batswithinthe500conidiatreatmentgroups,servingasvectorsfor continued Pd exposurewithinthishibernationchamber. Mortalityintheremaininginoculationtreatmentswasnot significantlygreaterthancontrolsinourmodel.Thislackof differencewasdrivenbythelowmortalityobservedinthe remaininginoculationtreatmentshibernatedat4 u C(33–47%)and relativelyhighmortalityinthe10 u Ccontrolgroup(43%).The mortalitiesinthe10 u Ccontrolgroup( n =6)arewellexplainedby thelogisticregressionmodel.Mortalitiesinthisgroupwere primarily(83%; n =5)maleswithbodyconditionindicesatthe onsetofhibernationthatwerebelowthemedianbodycondition. Itiswelldocumentedthatlowertemperaturesaremore energeticallyfavorableforhibernatingbats[4,31],aconclusion supportedbyourowndata.Thus,itisnotsurprisingthatwe observedhighmortalityamongmalebats,whicharousedmore frequentlyfromhibernation,withlowfatreserveswhenplacedin anenergeticallyunfavorableenvironment.Mortalityamongbats withlowbodyconditioninbothcontrolgroupsmayalsoresult fromplacingbatsinenvironmentalconditionsthatdifferfrom theirnativehibernacula.The4 u and10 u Cenvironmental chambersrepresentedtemperaturesthatarecolderandwarmer, respectively,thanbothofthehibernaculawesampledinIllinois andMichigan.Researchwithcaptivebigbrownbatsfoundthat althoughhibernatingbatsconformtotemperaturesinsideof environmentalchambers,torpidmetabolicratesareinfluencedby thetemperatureregimebatswereaccustomedtointheirnative hibernacula[50].Asaresult,conditionsinsidebothchambersmay bemoreenergeticallystressfulthancanbepredictedbasedupon temperaturealone.Regardlessofwhysomemortalityoccurredin thecontrolgroups,thelackofdifferenceinmortalitybetweenthe controlandtreatmentgroupsexposedto . 500conidiashouldnot beinterpretedtomeanthatbatsinthesetreatmentsdidnothave WNS.Tothecontrary,batsinallinoculationtreatmentgroupsat bothtemperaturesexhibitedsignificantlyshortertorporboutsthan controls,akeysignofWNS[13,17].Thereductionintorporbout lengthdemonstratesthatbatsinallinoculationtreatments developedoneofthehallmarksofWNSandwouldexhausttheir energyreservesinalongerhibernationperiod,unlikebatsinthe controlgroupthathadnormaltorporboutlengths,butourresults showthismortalitywouldoccurafterbatsexposedtoasmaller numberofconidiaearlyduringhibernation.Itisimportanttonote thatwedidnotusehistopathologiccriteriatoconfirmWNSin batsinourexperiment,andassumedthat Pd inoculationwasthe causeoftheincreasedfrequencyofarousalsandincreased mortalitycomparedtocontrolbats,anassumptionthatisstrongly supportedbyrecentresearch[3,13]. Atthenorthernedgeoftheirrange,littlebrownmyotisare reportedtohibernatefortwomonthslongerthanthedurationof ourexperiment[37].Thus,theabilityoffree-rangingbatsto surviveexposureto Pd mustbeconsideredinthecontextofwinter durationandhibernaculumtemperature.Ourmodelpredictsthat littlebrownmyotiswithgreaterbodyconditionindicesinhabiting theregionsofNorthAmericawherethehibernationperiodlasts approximately5monthswillbeabletopersistin Pd -contaminated hibernacula,providedbatshaveaccesstocoldroostingmicroclimates.Althoughthemaximumwinterdurationlittlebrownmyotis cansurvivewith Pd isuncertain,hibernaculatemperaturesbelow thoseincludedourstudymayconferevengreatersurvivalbenefits. Variablesrelatingtotheenvironment,host,andpathogen interacttoproducedisease[32].OurstudypresentsWNSsurvival andmortalitywithinthecontextofthediseasetriangle,showing thatlittlebrownmyotisfemales,andindividualsofbothsexeswithhigherbodycondition,aremoreresilientto Pd ,andthatcold hibernaculafurtherincreaseindividualoddsofsurvival.These resultssuggestascenarioinwhichlittlebrownmyotismay continuetopersistintheaffectedregionofNorthAmerica,with selectionfavoringindividualswithlargefatreservesandpreference forcoldhibernationsites.Becauseourstudywasconductedwith na ¨ veindividualsundercontrolledconditions,however,additional researchonsurvivalinfree-rangingpopulations,andthepossible roleoftheimmunesysteminpathologyorresistance,areneeded tobetterunderstandthefateoflittlebrownmyotisandothercavehibernatingspeciesineasternNorthAmerica.MaterialsandMethods AnimalCollectionThisstudywascarriedoutonnon-endangeredanimalsinstrict accordancewiththerecommendationsintheGuidefortheCare andUseofLaboratoryAnimalsoftheNationalInstitutesof Health.AllmethodswereapprovedbytheInstitutionalAnimal CareandUseCommitteeatBucknellUniversity(protocolnumber DMR-016).AnimalswerecollectedatBlackballMineinUtica, Illinois,USAbystatewildlifeofficials(includingJAKwithIllinois DepartmentofNaturalResources)onnon-endangeredbats;thus numberedpermitswerenotrequiredorissued.Animalswere collectedatIronMountainIronMineinVulcan,Michigan,USA underScientificCollector’PermitSC1475fromtheMichigan DepartmentofNaturalResourcestoDMR.Inaccordancewith thepermitandwithstatewildlifepolicies,researchwaseither conductedonstatelandoronprivateproperty,withtheexplicit permissionofprivatelandowners. Wecollected147hibernatinglittlebrownmyotis(70male;77 female)fromBlackballMineandIronMountainMineon2–3 November,2013.Batswereplacedinindividualclothbagsand transportedtoBucknellUniversityinPennsylvaniainsidea portablerefrigerationunit(DometicLtd.,Bedfordview,South Africa)settoaninternaltemperatureof4 u C.Wedeterminedthe sex,weight,andrightforearmlengthofeachbatuponarrivalat thelaboratoryanddeterminedthebodyconditionofeachbatby dividingthemassbytheforearmlength[34].Althoughthe hibernaculathatbatswerecollectedfromwerebelievedtobe unexposedto Pd ,weswabbedthewingsandmuzzleofeachbat withasterilecottonswabtocollectany Pd cellsinordertoverifyHost,Pathogen,andEnvironmentinWNS PLOSONE|www.plosone.org6November2014|Volume9|Issue11|e112502


thatbatshadnotbeenexposed.Bothwingswereswabbedfive timesonboththedorsalandventralsides.Allbatswerefittedwith modifiediButtontemperaturedataloggers(EmbeddedData Systems,Lawrenceburg,KY,USA),programmedtorecordskin temperature( Tsk)at30-minintervals[17].FungalInoculationandHibernationBatswereplacedintotreatmentgroupsrepresentingthe numberof Pd conidiathatbatsweretobeinoculatedwithprior tobeingplacedintohibernation:0(control),500,5000,50000,or 500000conidia.The Pd culturewasderivedfromanisolatefrom aninfectedlittlebrownmyotisinPennsylvaniain2010.Conidia wereenumeratedusingahemocytometerand0.25%TrypanBlue staining,andviabilityofsporeswasconfirmedbycultureon Sabouraudagarplates.Eachgroupwasreplicatedonceat4and onceat10 u C.Totheextentpossible,werandomlyselectedan equalnumberofmalesandfemalesfromeachhibernaculumtobe placedintoeachtreatmentgroup( n =14–15batspertreatment). Onceseparatedintotreatmentgroups,eachbatwaseithersham inoculated(controls)with50mLphosphatebufferedsalinewith 0.05%Tween-20(PBST)orinoculatedwiththeappropriate numberof Pd conidiasuspendedin50mLPBST.Thesolution waspipettedontotheventralsurfaceofonewingbelowthewrist, anddistributedalongthewingbygentlemanipulationofthewing. SimilarcaptiveinoculationmethodshavebeenclearlydemonstratedtocauseWNSinrecentstudies[3,13].Batsineach treatmentgroupwerehousedtogetherinopenairaluminumcages (ZooMedLaboratoriesInc.,SanLuisObispo,CA,USA), providedwith adlib water,andplacedintoenvironmental chamberssettomaintainaconstanttemperature(4or10 u C) and $ 90%relativehumidity.Controlandinoculatedtreatment groupswerehousedinseparateenvironmentalchambers.Within thechamberhousinginoculatedtreatmentcages,individualcages werenotincontactwithoneanother,preventinganycontact amongbats,and,therefore, Pd transmissionamongcages.Astudy withasimilardesignfoundthat Pd transmissiondidnotoccur betweencagesofinoculatedandun-inoculatedbatswhencages wereseparatedwithinthesameenvironmentalchamber[3]. Temperatureandrelativehumiditydataloggers(TransiTempII, MadgeTech,Warner,NewHampshire,USA)wereplacedinside eachchambertoconfirmenvironmentalconditions.Toavoid disturbanceandunnaturalarousalsfromhibernation,chambers wereonlyopenedoncepermonthtoprovidefreshwaterand removeanymoribundbats. Allbatswereswabbedasecondtimefollowingremovalfrom hibernationtoestimate Pd loads.Batswereleftinhibernationfor ca.5months(148d),afterwhichdataloggerswereremovedfrom allbats,andsurvivingindividualswereplacedinanindoorflight cagewheretheywerehand-fedgut-loadedmealwormsuntilable toself-feed.Conditionsinsidetheflightcageweremaintainedat approximately21 u Cand60%relativehumidity.Inoculatedbats survivinghibernationwereswabbedathirdtime19dafterthe endofhibernationtodeterminethechangein Pd loadsafterbats wereremovedfromanenvironmentfavorableforthegrowthof thefungus.Becausesurvivingbatswerenoteuthanizedinthis experiment,andmoribundbatswereonlyremovedonceper month,typicallyseveraldaysorweeksaftermortality,notissues wereavailableforahistologicalconfirmationofWNS[2].QuantifyingFungalDNAWeusedqPCRtodetermine Pd loadsonbatspriortoand followingemergencefromhibernation.Toprepareforgenomic DNA(gDNA)extraction,swabswereincubatedat37 u Cfor 30minutesinTris-EDTAbuffer(10mMTris,1mMEDTA; Amresco,Solon,Ohio,USA)containing20U/mlLyticase (Sigma-Aldrich,St.Louis,Missouri,USA)and30mMDithiothreitol(Sigma-Aldrich).GenomicDNAwasextractedusingthe QIAampDNAMicrokit(QiagenInc.,Valencia,California, USA),followingthemanufacturer’sinstructions,includingthe additionof1mgcarrierRNA. WeusedaTaqman5 9 endonucleaseassaytargetingtheIGS regionoftherRNAcomplextodetect Pd gDNAextractedfrom swabs.PrimersweresynthesizedbyIntegratedDNATechnologies (Coralville,IA,USA)usingthesequences[51]:forwardprimernuIGS-0169-5’Gd:5’–TGCCTCTCCGCCATTAGTG–3’; reverseprimernu-IGS-0235-3’–Gd:5’–ACCACCGGCTCG CTAGGTA–3’;andprobenu-IGS-0182/0204-Gd:5’–(FAM) CGTTACAGCTTGCTCGGGCTGCC(BHQ-1)–3’.Each 25mLPCRreactioncontained12.5mLBio-Rad2 6 Supermix (Hercules,California,USA),10.5mLsampleelution,1mLofeach primer(0.4mM),and1mLprobe(0.2mM).Reactionswere performedusingaBio-RadiCyclerstartingwithaninitial3min incubationat95 u C,followedby40cyclesof30sat95 u Cand30s at60 u C.Asacontrol,unusedswabsknowntobenegativefor Pd , andswabsexposedtoaknownquantityof Pd ,wereincludedon eachplate,aswellasno-templatecontrol.Inordertoquantify gDNAonswabs,wecreatedstandardsbyspikingswabswith10or 10000conidia.Standardswerepurifiedinparallelwitheach batchofsamplesandrunintriplicateoneachPCRplate. Thecyclethreshold(Ct)wasdeterminedusingthethresholdsset bythedataanalysissoftware(iCycleriQversion3.0a).The averageCtforaswabspikedwith10 Pd cellswas34.8( n =34), andtheassaywasfoundtobelinearatallCtvalueslowerthan this.ACtof38.1wascalculatedtorepresent1conidiaandwas usedasthelimitofdetectionfortheassay.AllswabswithnonexponentialfluorescenceincreasesorwithaCtbetween34.8and 38.1Ctwereconsideredambiguousandreanalyzedtoconfirm thattheamountof Pd detectedwasgreaterthan1conidia.Swabs withambiguousresultsintwoanalyseswerenotconsidered( n =3). AllsampleswithfinalCtvaluesbetween34.8and38.1were consideredtohavea Pd loadof # 10genomicequivalents,while sampleswithCtvaluesgreaterthan38.1wereconsidered Pd negative.TheamplificationefficiencyofthePCRreactionwas calculatedtobe , 100%basedontheslopeofthestandardcurve. SwabswithaCtlessthan34.8wereusedtocalculatethenumber ofconidiapresentaccordingtotheformula:10000 6 2Ct(exp)-Ct(ss), where exp isaswabsamplefromabatand ss isaswabspikedwith 10000conidia.DataAnalysisMortalityandsurvivalwereanalyzedusingabinary(logit function)logisticregressionmodelincludingtemperature(categorical), Pd inoculation(categorical),sex(categorical),andbody condition(scale)asdependentvariables.Toaidinterpretationof results,bodyconditionvalues(range:0.161–0.269)weremultiplied by100priortoinclusioninthemodel.Wedidnotincludethe stateoforigin(MichiganandIllinois)asavariablebecausewithin eachsex,preliminaryanalysesfoundthatthebodyconditiondid notdifferbetweenstates(two-tailedt-tests, P . 0.05)andbecause mortalityratesweresimilar(Illinois:46%;Michigan:48%). Tskdatarecordedat30-minintervalswereanalyzedtocharacterize thetorporbehaviorofbatsduringhibernation.Foreachbat,we determinedthedateandtimeforeacharousalfromtorporand calculatedtheaveragedurationoftorporbouts.Batswere consideredarousedfromtorporwhen Tskwas $ 20 u Cfor $ 1 reading,orwhen Tsk$ 15 u Cfor $ 2readings.Wecomparedthe averagedurationoftorporboutswithanANOVAusing temperature,inoculation,sex,andatemperature-inoculationHost,Pathogen,andEnvironmentinWNS PLOSONE|www.plosone.org7November2014|Volume9|Issue11|e112502


interactionasmaineffectstotestourhypothesesregardingtorpor behaviors.Duetolowstatisticalpowerforthevariablesex,wealso conductedtwo1-tailed t -testscomparingthedurationoftorpor boutsofmalestofemalesateachtemperature.Datafortorpor boutdurationweretransformedbycalculatingthenatural logarithmpriortoanalysistomeetstatisticalassumptions. Pd loadingdatacouldnotbetransformedtomeetassumptionsof normalityandwerecomparedamonginoculationtreatmentsusing separateKruskal-Wallistestsforeachhibernationtemperature. MeanscomparisonsweremadeusingaWilcoxontestforeachpair oftreatments,withasequentialBonferroni-Holmcorrection[52]. Pd loadswerecomparedbetweentemperaturesusingaWilcoxon testforeachinoculationtreatment.Controlgroupswerenot includedin Pd loadanalyses,because Pd wasneverdetectedon controlanimals.Alltestsusedasignificancethresholdof0.05and Fisher’LeastSignificantDifferencetocomparemeanswhere appropriate.AcknowledgmentsWewouldliketothankMPucciarello,KDeRuff,SReeder,BRogers, MHSchwartz,CSeery,andMHayesofBucknellUniversityfortheir invaluableassistancewiththisresearch.Wearealsogratefultotheanimal carestaffatBucknell,especiallyCRhone,GLong,andMGavitt,forhelp caringforcaptivebats.AuthorContributionsConceivedanddesignedtheexperiments:DMRKAF.Performedthe experiments:JSJDMRJWMMBMDWFSSSLLESHDWMEVKAF. Analyzedthedata:JSJDMRJWMKAF.Contributedreagents/materials/ analysistools:AKJAK.Wrotethepaper:JSJDMRKAF.References1.BlehertDS,HicksAC,BehrM,MeteyerCU,Berlowski-ZierBM,etal.(2009) Batwhite-nosesyndrome:anemergingfungalpathogen?Science323:227–227. 2.MeteyerCU,BucklesEL,BlehertDS,HicksAC,GreenDE,etal.(2009) Histopathologiccriteriatoconfirmwhite-nosesyndromeinbats.Journalof VeterinaryDiagnosticInvestigation21:411–414. 3.LorchJM,MeteyerCU,BehrMJ,BoylesJG,CryanPM,etal.(2011) ExperimentalinfectionofbatswithGeomycesdestructanscauseswhite-nose syndrome.Nature480:376–378. 4.CareyHV,AndrewsMT,MartinSL(2003)Mammalianhibernation:cellular andmolecularresponsestodepressedmetabolismandlowtemperature.Physiol Rev83:1153–1181. 5.BoumaHR,CareyHV,KroeseFG(2010a)Hibernation:theimmunesystemat rest?JLeukocBiol88:619–624. 6.StoreyKB,HeldmaierG,RiderMH(2010)Mammalianhibernation: Physiology,cellsignaling,andgenecontrolsonmetabolicratedepression.In: AnonymousDormancyandResistanceinHarshEnvironments.:Springer. pp.227–252. 7.WebbPI,SpeakmanJR,RaceyPA(1996)Howhotisahibernaculum?Areview ofthetemperaturesatwhichbatshibernate.CanJZool74:761–765. 8.VerantML,BoylesJG,WaldrepWJr,WibbeltG,BlehertDS(2012) Temperature-dependentgrowthofGeomycesdestructans,thefungusthat causesbatwhite-nosesyndrome.PloSOne7:e46280. 9.ReederDM,MooreMS(2013)White-nosesyndrome:Adeadlyemerging infectiousdiseaseofhibernatingbats.In:AdamsRA,PedersenSC,editors.Bat Evolution,Ecology,andConservation.USA:SpringerNewYork.pp.413–434. 10.GargasA,TrestM,ChristensenM,VolkTJ,BlehertD(2009) Geomyces destructans sp.nov.,associatedwithbatwhite-nosesyndrome.Mycotaxon108: 147–154. 11.MinnisAM,LindnerDL(2013)Phylogeneticevaluationof Geomyces andallies revealsnocloserelativesof Pseudogymnoascusdestructans ,comb.nov.,inbat hibernaculaofeasternNorthAmerica.FungalBiology117:638–649. 12.PuechmailleSJ,VerdeyrouxP,FullerH,GouilhMA,BekaertM,etal.(2010) White-nosesyndromefungus(Geomycesdestructans)inbat,France.Emerging InfectiousDiseases16:290. 13.WarneckeL,TurnerJM,BollingerTK,LorchJM,MisraV,etal.(2012) InoculationofbatswithEuropean Geomycesdestructans supportsthenovel pathogenhypothesisfortheoriginofwhite-nosesyndrome.ProcNatlAcad SciUSA109:6999–7003. 14.PuechmailleSJ,FrickWF,KunzTH,RaceyPA,VoigtCC,etal.(2011)Whitenosesyndrome:isthisemergingdiseaseathreattoEuropeanbats?TrendsEcol Evol26:570–576. 15.TurnerGG,ReederDM,ColemanJTH(2011)Afiveyearassessmentof mortalityandgeographicspreadofwhite-nosesyndromeinNorthAmerican batsandalooktothefuture.BatResearchNews52:13–27. 16.FrickWF,PollockJF,HicksAC,LangwigKE,ReynoldsDS,etal.(2010)An emergingdiseasecausesregionalpopulationcollapseofacommonNorth Americanbatspecies.Science329:679–682. 17.ReederDM,FrankCL,TurnerGG,MeteyerCU,KurtaA,etal.(2012) Frequentarousalfromhibernationlinkedtoseverityofinfectionandmortalityin batswithwhite-nosesyndrome.PLoSOne7:e38920. 18.CryanPM,MeteyerCU,BlehertDS,LorchJM,ReederDM,etal.(2013) Electrolytedepletioninwhite-nosesyndromebats.JWildlDis49:398–402. 19.ThomasDW,DoraisM,BergeronJ(1990)Winterenergybudgetsandcostof arousalsforhibernatinglittlebrownbats, Myotislucifugus .JMammal71:475– 479. 20.ThomasDW,CloutierD(1992)Evaporativewaterlossbyhibernatinglittle brownbats, Myotislucifugus .PhysiolZool:443–456. 21.CryanPM,MeteyerCU,BoylesJG,BlehertDS(2010)Wingpathologyof white-nosesyndromeinbatssuggestslife-threateningdisruptionofphysiology. BMCBiol8:135-7007-8-135. 22.HumphreySR,CopeJB(1976)Populationecologyofthelittlebrownbat, Myotislucifugus ,inIndianaandnorth-centralKentucky.AmericanSocietyof Mammalogists. 23.DixonMD(2011)Populationgeneticstructureandnatalphilopatryinthe widespreadNorthAmericanbat Myotislucifugus .JMammal92:1343–1351. 24.NorquayKJ,Martinez-Nun ˜ezF,DuboisJE,MonsonKM,WillisCK(2013) Long-distancemovementsoflittlebrownbats( Myotislucifugus ).JMammal94: 506–515. 25.BoylesJG,DunbarMB,StormJJ,BrackV(2007)Energyavailabilityinfluences microclimateselectionofhibernatingbats.JExpBiol210:4345–4350. 26.JonassonKA,WillisCK(2011)Changesinbodyconditionofhibernatingbats supportthethriftyfemalehypothesisandpredictconsequencesforpopulations withwhite-nosesyndrome.PLoSOne6:e21061. 27.JonassonKA,WillisCK(2012)Hibernationenergeticsoffree-ranginglittle brownbats.JExpBiol215:2141–2149. 28.LangwigKE,FrickWF,BriedJT,HicksAC,KunzTH,etal.(2012)Sociality, density-dependenceandmicroclimatesdeterminethepersistenceofpopulations sufferingfromanovelfungaldisease,white-nosesyndrome.EcolLett15:1050– 1057. 29.HumphriesMM,ThomasDW,SpeakmanJR(2002)Climate-mediated energeticconstraintsonthedistributionofhibernatingmammals.Nature418: 313–316. 30.TwenteJW,TwenteJ,BrackVJr(1985)Thedurationoftheperiodof hibernationofthreespeciesofvespertilionidbats.II.Laboratorystudies. CanJZool63:2955–2961. 31.GeiserF(2004)Metabolicrateandbodytemperaturereductionduring hibernationanddailytorpor.AnnuRevPhysiol66:239–274. 32.vanderPlankJE(1963)Plantdiseases:epidemicsandcontrol.NewYorkand London:AcademicPress. 33.BlehertDS(2012)Fungaldiseaseandthedevelopingstoryofbatwhite-nose syndrome.PLoSPathog8:e1002779. 34.SpeakmanJ,RaceyP(1986)Theinfluenceofbodyconditiononsexual developmentofmalebrownlong-earedbats( Plecotusauritus )inthewild.JZool210:515–525. 35.ThomasDW,CloutierD,GagneD(1990)Arrhythmicbreathing,apneaand non-steadystateoxygenuptakeinhibernatinglittlebrownbats( Myotis lucifugus ).JExpBiol149:395–406. 36.FentonMB,BrockettM(1970)Populationstudiesof Myotislucifugus : (Chiroptera:Vespertilionidae)inontario.In:Anonymous:RoyalOntario Museum.pp.1–34. 37.FentonMB,BarclayRM(1980)Myotislucifugus.MammalianSpecies142:1–8. 38.GustafsonA,ShemeshM(1976)Changesinplasmatestosteronelevelsduring theannualreproductivecycleofthehibernatingbat, Myotislucifuguslucifugus withasurveyofplasmatestosteronelevelsinadultmalevertebrates.BiolReprod 15:9–24. 39.ThomasDW,FentonMB,BarclayRM(1979)Socialbehaviorofthelittlebrown bat, Myotislucifugus .BehavEcolSociobiol6:129–136. 40.BuchananGD(1987)Timingofovulationandearlyembryonicdevelopmentin Myotislucifugus (Chiroptera:Vespertilionidae)fromnortherncentralOntario. AmJAnat178:335–340. 41.HumphriesMM,ThomasDW,KramerDL(2003)Theroleofenergy availabilityinmammalianhibernation:acost-benefitapproach.Physiological andBiochemicalZoology76:165–179. 42.KunzTH,WrazenJA,BurnettC(1998)Changesinbodymassandfatreserves inpre-hibernatinglittlebrownbats( Myotislucifugus ).Ecoscience5:8–17. 43.WillisCK,MenziesAK,BoylesJG,WojciechowskiMS(2011)Evaporative waterlossisaplausibleexplanationformortalityofbatsfromwhite-nose syndrome.IntegrCompBiol51:364–373. 44.ChitarraGS,AbeeT,RomboutsFM,PosthumusMA,DijksterhuisJ(2004) Germinationof Penicilliumpaneum conidiaisregulatedby1-octen-3-ol,a volatileself-inhibitor.ApplEnvironMicrobiol70:2823–2829.Host,Pathogen,andEnvironmentinWNS PLOSONE|www.plosone.org8November2014|Volume9|Issue11|e112502


45.Herrero-GarciaE,GarziaA,Cordobe ´sS,EspesoEA,UgaldeU(2011)8Carbonoxylipinsinhibitgerminati onandgrowth,andstimulateaerial conidiationin Aspergillusnidulans .FungalBiology115:393–400. 46.Brownlee-BouboulisSA,ReederDM(2013)White-nosesyndrome-affectedlittle brownmyotis( Myotislucifugus )increasegroomingandotheractivebehaviors duringarousalsfromhibernation.JWildlDis49:850–859. 47.MooreMS,ReichardJD,MurthaTD,NabhanML,PianRE,etal.(2013) Hibernatinglittlebrownmyotis( Myotislucifugus )showvariableimmunological responsestowhite-nosesyndrome.PloSOne8:e58976. 48.PrendergastBJ,FreemanDA,ZuckerI,NelsonRJ(2002)Periodicarousalfrom hibernationisnecessaryforinitiationofimmuneresponsesingroundsquirrels. AmJPhysiolRegulIntegrCompPhysiol282:R1054–62. 49.LuisAD,HudsonPJ(2006)Hibernationpatternsinmammals:arolefor bacterialgrowth?FunctEcol20:471–477. 50.DunbarMB,BrighamRM(2010)Thermoregulatoryvariationamong populationsofbatsalongalatitudinalgradient.JournalofComparative PhysiologyB180:885–893. 51.MullerLK,LorchJM,LindnerDL,O’ConnorM,GargasA,etal.(2013)Bat white-nosesyndrome:areal-timeTaqManpolymerasechainreactiontest targetingtheintergenicspacerregionof Geomycesdestructans .Mycologia105: 253–259. 52.HolmS(1979)Asimplesequentiallyrejectivemultipletestprocedure. ScandinavianJournalofStatistics:65–70.Host,Pathogen,andEnvironmentinWNS PLOSONE|www.plosone.org9November2014|Volume9|Issue11|e112502


Download Options


  • info Info

    There are only PDFs associated with this resource.

  • link PDF(s)

Cite this item close


Cras ut cursus ante, a fringilla nunc. Mauris lorem nunc, cursus sit amet enim ac, vehicula vestibulum mi. Mauris viverra nisl vel enim faucibus porta. Praesent sit amet ornare diam, non finibus nulla.


Cras efficitur magna et sapien varius, luctus ullamcorper dolor convallis. Orci varius natoque penatibus et magnis dis parturient montes, nascetur ridiculus mus. Fusce sit amet justo ut erat laoreet congue sed a ante.


Phasellus ornare in augue eu imperdiet. Donec malesuada sapien ante, at vehicula orci tempor molestie. Proin vitae urna elit. Pellentesque vitae nisi et diam euismod malesuada aliquet non erat.


Nunc fringilla dolor ut dictum placerat. Proin ac neque rutrum, consectetur ligula id, laoreet ligula. Nulla lorem massa, consectetur vitae consequat in, lobortis at dolor. Nunc sed leo odio.