Genetic diversity of coronaviruses in Miniopterus fuliginosus bats


previous item | next item

Citation
Genetic diversity of coronaviruses in Miniopterus fuliginosus bats

Material Information

Title:
Genetic diversity of coronaviruses in Miniopterus fuliginosus bats
Series Title:
Science China Life Sciences
Creator:
Du, Jiang
Ren, Xianwen
Zhang, Junpeng
Dong, Jie
Sun, Lillian
Zhu, Yafang
Yang, Fan
Zhang, Shuyi
Wu, Zhiquiang
Jin, Qi
Publisher:
Springer Link
Publication Date:
Language:
English

Subjects

Subjects / Keywords:
Coronavirus ( local )
Miniopterus Fuliginosus ( local )
Bat ( local )
Co-Infection ( local )
Recombination ( local )
Genre:
serial ( sobekcm )

Notes

Abstract:
Coronaviruses, such as severe acute respiratory syndrome coronavirus and Middle East respiratory syndrome coronavirus, pose significant public health threats. Bats have been suggested to act as natural reservoirs for both these viruses, and periodic monitoring of coronaviruses in bats may thus provide important clues about emergent infectious viruses. The Eastern bent-wing bat Miniopterus fuliginosus is distributed extensively throughout China. We therefore analyzed the genetic diversity of coronaviruses in samples of M. fuliginosus collected from nine Chinese provinces during 2011–2013. The only coronavirus genus found was Alphacoronavirus. We established six complete and five partial genomic sequences of alphacoronaviruses, which revealed that they could be divided into two distinct lineages, with close relationships to coronaviruses in Miniopterus magnater and Miniopterus pusillus. Recombination was confirmed by detecting putative breakpoints of Lineage 1 coronaviruses in M. fuliginosus and M. pusillus (Wu et al., 2015), which supported the results of topological and phylogenetic analyses. The established alphacoronavirus genome sequences showed high similarity to other alphacoronaviruses found in other Miniopterus species, suggesting that their transmission in different Miniopterus species may provide opportunities for recombination with different alphacoronaviruses. The genetic information for these novel alphacoronaviruses will improve our understanding of the evolution and genetic diversity of coronaviruses, with potentially important implications for the transmission of human diseases.
Original Version:
Science China Life Sciences, Vol. 59 (2016-04-28).

Record Information

Source Institution:
University of South Florida Library
Holding Location:
University of South Florida
Rights Management:
This object is protected by copyright, and is made available here for research and educational purposes. Permission to reuse, publish, or reproduce the object beyond the bounds of Fair Use or other exemptions to copyright law must be obtained from the copyright holder.
Resource Identifier:
K26-05155 ( USFLDC: LOCAL DOI )
k26.5155 ( USFLDC: LOCAL Handle )

USFLDC Membership

Aggregations:
University of South Florida
Karst Information Portal

Postcard Information

Format:
serial

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

SCIENCE CHINA Life Sciences The Author(s) 2016. This article is pub lished with open access at link.springer.c om life.scichina.com link.springer.com *Corresponding author (email: wuzq2009@ipbcams.ac.cn) Corresponding author (email: zdsys@vip.sina.com) • RESEARCH PAPER • June 2016 Vol.59 No.6: 604 doi: 10.1007/s11427-016-5039-0 Genetic diversity of coronaviruses in Miniopterus fuliginosus bats Jiang Du1, Li Yang1, Xianwen Ren1, Junpeng Zhang4, Jie Dong1, Lilian Sun1, Yafang Zhu1, Fan Yang1, Shuyi Zhang3, Zhiqiang Wu1* & Qi Jin1,2 1MOH Key Laboratory of Systems Biology of Pathogens, Institute of Pathogen Biology, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing 100176, China; 2Collaborative Innovation Center for Diagnosis and Treatm ent of Infectious Diseases, Hangzhou 310003, China; 3College of Animal Science and Veterinary Medicine, She nyang Agricultural University, Shenyang 110866, China; 4State Key Laboratory of Estuarine and Coastal Research, Institute of Estuarine and Coastal Research, East China Normal Universi ty, Shanghai 200062, China Received February 1, 2016; accepted Februa ry 22, 2016; published online April 27, 2016 Coronaviruses, such as severe acute respiratory syndrome coro navirus and Middle East respiratory syndrome coronavirus, pose significant public health threats. Bats have been suggested to act as natural reservoirs for both these viruses, and periodic monitoring of coronaviruses in bats may thus provide important clues about emergent inf ectious viruses. The Eastern bent-wing bat Miniopterus fuliginosus is distributed extensively throughout China. We therefore analyzed the genetic diversity of coronaviruses in samples of M. fuliginosus collected from nine Chinese provinces during 2011. The only coronavirus genus found was Alphacoronavirus . We established six complete and five partial genomic sequences of al phacoronaviruses, which revealed that they could be divided into two distinct lineages, with close relationships to coronaviruses in Miniopterus magnater and Miniopterus pusillus . Recombination was confirmed by detecting putat ive breakpoints of Lineage 1 coronaviruses in M. fuliginosus and M. pusillus (Wu et al., 2015), which supported the results of topological and phylogene tic analyses. The established alphacoronavirus genome se quences showed high similarity to other alphacoronaviruses found in other Miniopterus species, suggesting that their transmission in different Miniopterus species may provide opportunities for recombination with different alphacoronaviruses. The genetic information for these novel alphacoronavi ruses will improve our understanding of the evolution and genetic diversity of coronaviruses, with pot entially important implications for the transmission of human diseases. coronavirus, Miniopterus fuliginosus , bat, co-infection, recombination Citation: Du, J., Yang, L., Ren, X., Zhang, J., Dong, J., Sun, L., Zhu, Y ., Yang, F., Zhang, S., Wu, Z., and Jin, Q. (2016). Genetic dive rsity of coronaviruses in Miniopterus fuliginosus bats. Sci China Life Sci 59, 604 – 614. doi: 10.1007/s11427-016-5039-0 INTRODUCTION Coronaviruses (CoVs; order Nidovirales , family Coronaviridae , subfamily Coronavirinae ) are enveloped RNA viruses with unusually large, positive-stranded RNA genomes of 26–32 kb (Lai, 2001). The viral genome contains five major open reading frames (ORFs) that encode the replicase polyproteins (ORF1a and ORF1b), spike (S), envelope (E), and membrane (M) glycoproteins, and the nucleocapsid protein (N) (Gonzalez et al., 2003; Holmes and Enjuanes, 2003). According to a proposal submitted to the International Committee on the Taxonomy of Viruses, CoVs can be classified into four genera, Alphacoronavirus , Betacoronavirus , Gammacoronavirus , and Deltacoronavirus, which replace the traditional CoV groups 1, 2, and 3 (King et al., 2011; Woo et al., 2009, 2012). CoVs are known to cause upper and lower respiratory diseases, gastroenteritis, and central nervous system infections in a

PAGE 2

Du, J., et al. Sci China Life Sci June (2016) Vol.59 No.6 605 number of avian and mammalian hosts, including humans (Weiss and Navas-Martin, 2005). Bats have been increasingly recognized as important natural reservoirs for CoVs. In particular, previously unknown CoVs related to severe human pathogens, such as severe acute respiratory syndrome (SARS) CoV (Li et al., 2005) and Middle East respiratory syndrome CoV (van Bo heemen et al., 2012), were discovered in bats from Chin a and other countries, with consequent recent increases in research into the biodiversity and genomics of CoVs in different bat species. The diversity of CoVs arises from the infidelity of RNA-dependent RNA polymerase (RdRp), the high frequency of recombination, and the large genomes of CoVs (Woo, 2009). These factors have generated diverse strains and genotypes of the CoV lineage, and have given rise to new lineages able to adapt to new hosts. These new lineages have occasionally caused major zoonotic outbreaks with disastrous consequences (Woo, 2006). A previous study reported the detection of several novel bat CoVs (BtCoVs) in Miniopterus magnater and Miniopterus pusillus from Hong Kong (Chu et al., 2008), and in Miniopterus fuliginosus from Japan (Shirato et al., 2012). However, despite being the most extensively distributed Miniopterus species in China, the CoVs harbored by M. fuliginosus (the Eastern bent-wing bat) have not been systematically studied. M. fuliginosus are known to migrate long distances and typically roost with large numbers of bats from different genera, including Rhinolophus , Hipposideros , and Myotis (Cui et al., 2007; Miller-Butterworth et al., 2003), which habits may facilitate viral exchange between different bat species. Fu rthermore, our understanding of the diversity of CoVs in the genus Miniopterus remains limited. We therefore launched a survey to determine the dynamics and prevalence of CoVs in M. fuliginosus living in different geographical regions. In the current study, we explored the genetic diversity of CoVs in M. fuliginosus in China by analyzing 194 bat samples collected from nine Chinese provinces during 201113. RESULTS Bat surveillance and identification of CoVs A total of 194 M. fuliginosus bats were captured in nine provinces of China from October 2010 to October 2013, and pharyngeal and anal swabs were collected (Figure 1). All sampling sites were in or close to human gathering places. Only the anal swab samples harbored CoVs according to single-strain screening with conserved primers, and the positivity rates for each province are shown in Figure 1. Sequence analysis of the PCR amplicons identified alpha-CoV-positive bats in six provinces (Guangdong, Hubei, Fujian, Henan, Anhui, and Jiangxi), but no other CoV genera were found. Interestingly, co-infections with different CoVs were detected in two M. fuliginosus anal specimens; one from Guangdong and one from Henan. We selected samples positive for CoVs that were representative of each province fo r genomic sequencing and established the complete genomic sequences of six alphaCoVs: BtMf-AlphaCoV/Guangdong2012 (GD), BtMfAlphaCoV/Hubei2013 (HB), BtMf-Alpha CoV/Fujian2012 (FJ), BtMf-AlphaCoV/Henan2013 (HN), BtMf-AlphaCoV/ Figure 1 The nine provinces (indicated in blue) in China, where bats we re captured, and samples were collected. The numbers on the right indicate the numbers of samples positive for Lineage 1 (L1) and Lineage 2 (L2) and the total number of samples collected in each province. T he red shading on Guangdong and Henan indicate the regions where co-i nfections of two lineages were detected.

PAGE 3

606 Du, J., et al. Sci China Life Sci June (2016) Vol.59 No.6 Anhui2011 (AH), and BtMf-AlphaCoV/Jiangxi2012 (JX). We also established partial genomic sequences of five other alpha-CoVs: BtMf-AlphaCoV/Guangdong2012-a (GD-a), BtMf-AlphaCoV/Guangdong2012-b (GD-b), BtMf-AlphaCoV/ Hubei2013-a (HB-a), BtMf-AlphaCoV/Henan2013-a (HN-a), and BtMf-AlphaCoV/Henan2013-b (HN-b). The GD and GD-b sequences were identified in the same sample from Guangdong, and the HN and HN-b sequences were identified in the same sample from Henan. Genomic sequences The sizes of the BtCoVs GD, HB, FJ, HN, AH, and JX genomes, excluding the 3 poly(A) tails, were 28,748, 28,745, 28,755, 28,725, 28,300, and 28,301 nt, respectively, with G+C contents of 41.8%, 41.85%, 41.87%, 41.98%, 38.17%, and 38.19%, respectively. The genomic organization of these CoVs was similar to that of other alpha-CoVs (Table 1). The main difference among genomes was in ORF7, which was present in GD, HB, FJ, and HN, but absent in AH and JX. We then compared the complete genomes (Table 2). The full-length genomic sequences of HB, FJ, and HN showed 91.9%–97.0% nt identities with each another, and lower identity with the GD genome (82.1%–85.7%). In contrast, AH and JX exhibited 96.2% overall nt identity with each other, and lower identities with the other four genomes (68.0%8.8%). The sizes of the 5 untranslated regions of GD, HB, FJ, HN, AH, and JX were 270, 269, 268, 268, 272, and 273 nt, respectively. The core sequences of the leader transcription regulatory sequence (TRS; 5 CUAAAC-3 ) were identified in the 5 untranslated sequences (Table 3). The TRSs of ORF3 and the E genes in AH and JX differed from those of the other four CoVs. The TRS of ORF7 in FJ and GD (CUGAAU) differed by 1 nt from that in HB and HN (CUGAAC). Apart from ORF3, E, and ORF7, the TRSs for the other ORFs were predicted in these six CoV genome sequences. ORF1ab occupied approximately 70% of the genome, and consisted of ORF1a and ORF1b, encoding viral polyprotein 1a (pp1a) and pp1b, re spectively. Putative features responsible for ribosomal frame shifting, e.g. the “slippage sequence” (5 -UUUAAAC-3 ), were predicted in the genomes. ORF1a of AH and JX shared 98.5% aa identity, but lower (63.0%3.8%) aa identity with the other four CoVs, while the ORF1a sequences of HB, FJ, and HN showed 99.2%.5% aa identity, but lower (87.5%7.6%) aa identity with GD. The ORF1b sequences exhibited the same Table 1 Predicted ORFs in the genomes of bat CoVsa) ORFs GD HB FJ HN AH JX Position Length (nt) Position Length (nt) Position Length (nt) Position Length (nt) Position Length (nt) Position Length (nt) ORF1a 271–12,96612,693 270–12,94412,672 269–12,94312,672 269–12,94312,672 273–13,07612,801 274–13,077 12,801 ORF1b 12,936,9608,022 12,914,9388,022 12,913,9378,022 12,913,9378,022 13,046,0678,019 13,047,068 8,019 NSP1 271–600 330 270–599 330 269–598 330 269–598 330 273–599 327 274–600 327 NSP2 601–2,943 2,343 600–2,942 2,343 599–2,941 2,343 599–2,941 2,343 600–2,951 2,352 601–2,952 2,352 NSP3 2,944–8,175 5,232 2,943–8,153 5,211 2,942–8,152 5,211 2,942–8,152 5,211 2,952–8,288 5,337 2,953–8,289 5,337 NSP4 8,176–9,600 1,425 8,154–9,578 1,425 8,153–9,577 1,425 8,153–9,577 1,425 8,289–9,710 1,422 8,290–9,711 1,422 NSP5 9,601–10,506906 9,579–10,484906 9,578–10,483906 9,578–10,483906 9,711–10,616906 9,712–10,617 906 NSP6 10,507,343837 10,485,321837 10,484,320837 10,484,320837 10,617,453837 10,618,454 837 NSP7 11,344,592249 11,322,570249 11,321,569249 11,321,569249 11,454,702249 11,455,703 249 NSP8 11,593,174582 11,571,152582 11,570,151582 11,570,151582 11,703,284582 11,704,285 582 NSP9 12,175,504330 12,153,482330 12,152,481330 12,152,481330 12,285,614330 12,286,615 330 NSP10 12,505,912408 12,483,890408 12,482,889408 12,482,889408 12,615,022408 12,616,023 408 NSP11 12,913,96654 12,891,94454 12,890,94354 12,890,94354 13,023,07654 13,024,077 54 NSP12 12,913,6922,781 12,891,6702,781 12,890,6692,781 12,890,6692,781 13,023,8022,781 13,024,803 2,781 NSP13 15,693,4831,791 15,671,4611,791 15,670,4601,791 15,670,4601,791 15,803,5841,782 15,804,585 1,782 NSP14 17,484,0401,557 17,462,0181,557 17,461,0171,557 17,461,0171,557 17,585,1471,563 17,586,145 1,560 NSP15 19,041,0571,017 19,019,0351,017 19,018,0341,017 19,018,0341,017 19,148,1641,017 19,146,165 1,020 NSP16 20,058,960900 20,036,938900 20,035,937900 20,035,934900 20,165,067900 20,166,068 900 S 20,962,0984,134 20,935,0594,122 20,939,0754,134 20,939,0754,134 21,069,1964,125 21,070,200 4,128 ORF3 25,098,766666 25,059,727666 25,075,743666 25,075,743666 25,196,855657 25,200,859 657 E 25,750,974222 25,711,935222 25,727,951222 25,727,951222 25,849,073222 25,853,077 222 M 25,984,742756 25,945,709762 25,961,719756 25,961,719756 26,080,841759 26,084,842 756 N 26,791,0591,266 26,758,0261,266 26,768,0361,266 26,768,0361,266 26,862,0311,167 26,863,032 1,167 ORF7a 27,809,979168 27,776,522744 27,786,532744 27,786,505717 ORF7b 28,034,528492 a) BtMf-AlphaCoV/Guangdong2012 (GD), BtM f-AlphaCoV/Hubei2013 (HB), BtMf-AlphaCoV/ Fujian2012 (FJ), BtMf-AlphaCoV/Henan2013 (HN), BtMf-AlphaCoV/Anhui2011 (AH), and BtMf-AlphaCoV/Jiangxi2012 (JX).

PAGE 4

Du, J., et al. Sci China Life Sci June (2016) Vol.59 No.6 607 Table 2 Percent nucleotide identity between whole genomes and percent amino aci d similarities between viral protein sequences in bat C oVsa) Nucleotide or protein Virus Lineage 1 Lineage 2 GD HB FJ HN AH JX 1A Genome HKU8 91.8 86.1 82.2 81.6 67.7 67.6 67.7 GD 82.1 85.4 85.7 68.6 68.5 68.5 HB 92.8 91.9 68.1 68.0 68.0 FJ 97.0 68.8 68.8 68.8 HN 68.7 68.7 68.6 AH 96.2 96.2 JX 96.0 ORF1a HKU8 99.0 87.2 87.1 87.3 63.4 63.4 63.0 GD 87.6 87.5 87.6 63.5 63.5 63.2 HB 99.2 99.5 63.6 63.7 63.3 FJ 99.3 63.7 63.7 63.3 HN 63.6 63.6 63.2 AH 98.5 97.7 JX 98.4 ORF1b HKU8 99.6 98.2 98.2 98.2 87.9 87.7 87.4 GD 98.3 98.2 98.3 88.0 87.8 87.5 HB 99.8 99.8 88.0 87.8 87.5 FJ 99.9 87.9 87.7 87.4 HN 87.9 87.7 87.4 AH 99.8 99.4 JX 99.3 RDRP HKU8 99.8 97.1 97.1 97.0 90.1 89.9 90.0 GD 97.1 97.1 97.0 90.1 89.9 90.0 HB 100.0 99.9 90.2 90.0 90.1 FJ 99.9 90.2 90.0 90.1 HN 90.1 89.9 90.0 AH 99.8 99.9 JX 99.7 S HKU8 52.9 95.7 53.5 53.5 49.0 48.4 49.1 GD 52.5 87.8 87.5 61.0 60.7 60.6 HB 52.7 52.8 49.1 48.6 49.2 FJ 98.0 60.7 59.6 60.5 HN 60.9 59.6 60.6 AH 93.2 93.2 JX 91.6 ORF3 HKU8 97.8 98.2 97.8 97.3 46.3 46.3 46.3 GD 99.6 99.1 98.7 46.3 46.3 46.3 HB 99.6 99.1 46.3 46.3 46.3 FJ 99.6 46.3 46.3 46.3 HN 46.3 46.3 46.3 AH 99.5 99.1 JX 98.6 E HKU8 98.7 98.7 98.7 98.7 70.7 70.7 70.7 GD 100.0 100.0 100.0 70.7 70.7 70.7 HB 100.0 100.0 70.7 70.7 70.7 FJ 100.0 70.7 70.7 70.7 HN 70.7 70.7 70.7 AH 100.0 100.0 JX 100.0 M HKU8 85.6 85.3 85.6 85.6 72.2 72.5 73.0 GD 93.7 99.6 99.2 73.3 73.6 73.1 HB 93.7 93.7 71.5 71.8 72.9 FJ 99.6 73.3 73.6 73.1 HN 72.9 73.2 73.1 AH 99.6 93.3 JX 93.7 ( To be continued on the next page )

PAGE 5

608 Du, J., et al. Sci China Life Sci June (2016) Vol.59 No.6 ( Continued) Nucleotide or protein Virus Lineage 1 Lineage 2 GD HB FJ HN AH JX 1A N HKU8 93.9 88.9 88.2 87.9 64.3 64.1 64.3 GD 91.5 90.3 90.1 63.8 63.6 63.8 HB 98.6 97.9 65.9 65.6 65.6 FJ 98.3 66.1 65.9 65.9 HN 65.6 65.4 65.4 AH 99.7 98.7 JX 99.0 ORF7 HKU8 61.0 84.7 84.8 59.0 GD 61.3 61.0 96.5 HB 97.9 61.7 FJ 63.0 HN a) BtMf-AlphaCoV/Guangdong2012 (GD), BtM f-AlphaCoV/Hubei2013 (HB), BtMf-AlphaCoV/ Fujian2012 (FJ), BtMf-AlphaCoV/Henan2013 (HN), BtMf-AlphaCoV/Anhui2011 (AH) , and BtMf-AlphaCoV/Jiangxi2012 (JX), HKU8, and 1A. tendencies in terms of sequence similarities. Based on a previous analysis, the pp1a and pp1b proteins were predicted to be cleaved by virus pr oteases to produce a total of 16 nonstructural proteins (NSPs) (Chen et al., 2003). ORF1ab in GD, HB, FJ, HN, AH, and JX CoVs contained functional units typical of CoVs (Table 1), including RdRps in the NSP12 region. RdRp is a highly conserved CoV protein that is frequently used for phylogenetic comparisons. Six CoV genome sequences had RdRps genes of the same size (2781 nt). aa-sequence identity analyses of the RdRp proteins (Table 2) suggested that the six alpha-CoVs could be divided into two lineages: Lineage 1, including GD, HB, FJ, and HN, which shared 97%–100% aa identity, and Lineage 2, including AH and JX, which were closely related to each other (99.8% aa identity) and showed lower (89.9%–90.2%) aa identity with Lineage 1 CoVs. Comparison of the aa sequences of the seven conserved replicase domains or NSPs (ADP-ribose-1 -phosphatase, NSP5 (3CLpro), NSP12 (RdRp), NSP13 (Hel), NSP14 (3 5 exonuclease; (guanine-N7)-methyltransferase), NSP15 (nidoviraluridylate-specific endoribonuclease), and NSP16 (2 -O-ribose methyltr ansferase) for CoV species demarcation (de Groot, 2011) showed that Lineage 1 and Lineage 2 possessed <90% aa-sequence id entity with each other, and BtCoV-HKU8 showed high aa identities (87.9%–93.9%) in terms of N protein with other Lineage 1 CoVs (GD, FJ, HB, HN). The N protein aa identities between the Lineage 2 CoVs AH, JX and BtCoV-1A, BtCoV-1B were 98.7%% and 91.6%.9%, respectively, indicating that Lineage 1 and Lineage 2 represented different species of Alphacoronavirus . The most striking differences among CoVs were observed in the S protein sequence. The S gene sequence had five nts (AAAAU) inserted between the TRS and AUG in all CoVs except HB CoV (Table 3). Interestingly, the S protein (1,378 aa) was the same size in all members of Lineage 1, except HB (1,374 aa). However, the HB S protein shared only about 52.5%–52.8% aa identities with the S proteins of other Lineage 1 CoVs. Among the other Lineage 1 CoVs, the S proteins of FJ and HN were 98.0% identical, but they shared only 87.5% and 87.8% aa identity, respectively, with GD. In Lineage 2, AH and JX S proteins were 93.2% identical. Notably, the S proteins of GD, FJ, and HN in Lineage 1 appeared to be more closely related to the S proteins of Lineage 2 CoVs (59.6%1.0%) than to the S protein of HB (52.5%.8%). Inter-ProScan analysis predicted that all six CoVs included type I membrane glycoproteins, where most of the protein (prior to residues 1318/1319/1322) was exposed on the outside of the viral capsule, and the C terminus comprised a transmembrane domain (residues 1319/1320/1323–1341/1342/1345), followed by the internal region in the virion, which was rich in cysteine residues. The S protein responsible for virus entry was divided into two domains; the S1 domain involved in receptor binding and the S2 do main for cellular membrane fusion. The putative S1 region was located at residues 229–741 for HB; 227–739 for GD and AH, 22840 for JX, and 2249 for FJ and HN. The diversity of S proteins was mainly within the S1 domain. HB S1 showed 93.3% aa identity with BtCoV-HKU8 and 39.6%.5% with other Lineage 1 and Lineage 2 CoVs . AH shared high aa identities with Lineage 2 CoVs in the S1 region (86.8%.7%), and GD had 85.1%–85.7% aa identities with FJ and HN. Analysis of the aa identities of the S1 region were consistent with the phylogenetic trees fo r the whole S region (Figure 2). S2 included two putative heptad repeat regions, important for membrane fusion and viral entry (Bosch et al., 2003), located at residues 977–1122 and 126420 in GD, FJ, and HN, 975–1120 and 1260–1316 in HB, and 973/97422/1123 and 1252/1253–1311/1312 in AH and JX. ORF3, which encoded putative 222-aa and 219-aa proteins in Lineage 1 and Lineage 2 CoVs, respectively, was located between the S and E sequences in all six genomes.

PAGE 6

Du, J., et al. Sci China Life Sci June (2016) Vol.59 No.6 609 Table 3 Transcription regulatory sequences (TRSs) for six bat CoVsa) ORF TRS CoV TRS sequence Nucleotide position Leader TRS GD CUCAACUAAACGAAAU 69 HB CUCAACUAAACGAAAU 68 FJ CUCAACUAAACGAAAU 67 HN CUCAACUAAACGAAAU 67 AH CUCAACUAAACGAAAU 68 JX CUCAACUAAACGAAAU 69 S GD UUCAACUAAAUAAAAUG 20,953 HB UUCAACUAAAUG 20,931 FJ UUCAACUAAAUAAAAUG 20,930 HN UUCAACUAAAUAAAAUG 20,930 AH UUCAACUAAAUAAAAUG 21,060 JX UUCAACUAAAUAAAAUG 21,061 ORF3 GD UACAACAAUACGAAGUN21AUG 25,066 HB UACAACAAUACGAAGUN21AUG 25,027 FJ UACAACAAUACGAAGUN21AUG 25,043 HN UACAACAAUACGAAGUN21AUG 25,043 AH UACAACGUUACGAAAUN21AUG 25,164 JX UACAACGUUACGAAAUN21AUG 25,168 E GD UACAACUCUACGAAGAUG 25,740 HB UACAACUCUACGAAGAUG 25,701 FJ UACAACUCUACGAAGAUG 25,717 HN UACAACUCUACGAAGAUG 25,717 AH UUCAACUACACGAAGAUG 25,839 JX UUCAACUACACGAAGAUG 25,843 M GD GAUGUCUAAACGAACAAAAUG 25,971 HB GAUGUCUAAACGAACAAAAUG 25,932 FJ GAUGUCUAAACGAACAAAAUG 25,948 HN GAUGUCUAAACGAACAAAAUG 25,948 AH AAUGUCUAAACGAGAAUG 26,070 JX AAUGUCUAAACGAGAAUG 26,074 N GD AUAAACUAAACAAGUGN36AUG 26,744 HB AUAAACUAAACAAGUGN36AUG 26,711 FJ AUAAACUAAACAAGUGN36AUG 26,721 HN AUAAACUAAACAAGUGN36AUG 26,721 AH UUAAACUAAACAAGAAN8AUG 26,843 JX UUAAACUAAACAAGAAN8AUG 26,844 ORF7 GD GAUUGCUGAAUUGCUAN88AUG 27,710 HB AAUUGCUGAACUGAUUN88AUG 27,677 FJ AAUUGCUGAAUUGAUUN88AUG 27,687 HN AAUUGCUGAACUGAUCN88AUG 27,687 a) For putative ORFs, we aligned the TRS th at preceded the start codon AUG with the lead er TRS. The core sequence is indicated in a box. The start codons of genes are in bold type. The aa sequences of ORF3 were highly conserved within Lineages 1 and 2 (98.7%.6% and 99.5%, respectively), but varied between lineages (46.3%). Among the CoV proteins, ORF3 showed the greatest inter-lineage diversity. Multiple transmembrane motifs were predicted in ORF3 proteins, suggesting that they might be surface proteins. TMHMM analysis showed that Lineage 1 CoVs harbored three putative transmembrane domains in ORF3 (aa residues 36, 70, and 9613), while Lineage 2 CoVs harbored only two putative transmembrane domains (aa residues 37 and 713). The E, M, and N proteins were highly conserved within CoVs of the same lineage (> 90% identity) and were diverse between lineages (63.6%.6%) . ORF7 was located at the 3 end of the Lineage 1 virus genome, and overlapped with the N gene. ORF7 encoded a putative NSP of 239–248 aa residues in FJ, HN, and HB. Interestingly, ORF7 in GD possessed two small ORFs, encoding putative proteins of 56 and 164 aa residues, respectively (Table 1). Phylogenetic analyses We performed phylogenetic analyses based on the aa se-

PAGE 7

610 Du, J., et al. Sci China Life Sci June (2016) Vol.59 No.6 quences of the RdRp, S, E, M, and N proteins of these BtCoVs, including the RdRp and S proteins in the five partial CoV sequences (GD-a, GD-b, HB-a, HN-a, and HN-b). Phylogenetic trees were constructed using MEGA5.0 software, based on the deduced aa sequences. Several reference CoV genome sequences were downloaded from GenBank and aligned with the fragments of the newly discovered CoVs (Figure 2). The results of the phylogenetic analyses were consistent with those of the sequence identity analyses, and confirmed that the newly identified alpha-CoVs could be divided into two lineages. The aa sequences of the RdRp, E, M, and N proteins in Lineage 1 viruses always clustered with BtCoV HKU8, found in M. pusillus . In contrast, phylogenetic analysis based on the S proteins showed a different tree structure, in which GD, FJ, and HN in Lineage 1 clustered together in a clade with Lineage 2 viruses, and HB and BtCoV HKU8 form ed a relatively distant cluster, sharing 95.7% aa identity with each other and only 52.7%–53.5% identity with the other three Lineage 1 CoVs. Phylogenetic analysis of the S protein thus indicated that Lineage 1 CoVs could be further divided into two types: type I (HB and HKU8) and type II (FJ, HN, and GD). According to the phylogenetic trees, Lineage 2 viruses (AH, JX, GD-a, HB-a, and HN-a) always clustered with BtCoV 1A, found in M. magnater (>99.7% nt identity in RdRp and >91.4% aa in S protein), and GD-b and HN-b with BtCoV 1B, found in M. pusillus (98.7% aa identity with RdRp and about 92.0% with S protein). These tree branches were very short, reflecting the high sequence similarities. Figure 2 Phylogenetic trees based on the amino acid sequences of the par tial RNA-dependent RNA polymerase (RdRp; an 324-nt sequence fragment corresponding to positions 14828–15151 in bat coronavirus (BtCoV-HKU8 ; NC010438)), full-length spike (S), envelope (E), membrane ( M), and nucleocapsid (N) proteins. The following CoVs and GenBank accession numbers we re used: BtCoV-1A (NC010437), BtCoV-1B (NC010436), BtCoV-HKU7 (DQ249226), BtCoV-HKU2 (NC009988), BtCoV-HKU10 (NC018871), BtCo V-512 (NC009657), BtCoV-Mf/Japan/01/2009 (AB619638), BtCoVMf/Japan/02/2009 (AB619639), BtCoV-Mf/Japan/01/2010 (AB619640), BtCoV-Mf/Japan/03/2010 (AB619642), BtCoV-A773/2005 (DQ648835), Feline infectious peritonitis virus (FIPV; AY 994055), Canine CoV-341/05 (EU 856361), BtCoV-HKU9 (EF065513), se vere acute respiratory sy ndrome coronavirus (SARS-CoV; NC004718), human CoV OC43 (HCoV-OC43; NC005147), HCoV-HKU1 (NC006577), HC oV-229E (NC002645), HCoV-NL63 (NC005831), Middle East respiratory syndrom e coronavirus (HCoV-MERS; KF192507), avian infec tious bronchitis virus (IBV; NC001451), beluga w hale CoV SW1 (BWCoV; NC010646). Scale bar indicates genetic distance, estimated with a WAG+G model im plemented in MEGA5 (www.megasoftware.ne t).

PAGE 8

Du, J., et al. Sci China Life Sci June (2016) Vol.59 No.6 611 Recombination analyses Co-infection with different CoVs in the same bat may create opportunities for recombination, potentially resulting in the emergence of new viruses. Co-infections with different lineages in M. fuliginosus were detected in two anal specimens collected in Guangdong and Henan (Wu et al., 2015). Previous studies have shown that CoVs have a tendency to undergo RNA recombination (Herre wegh et al., 1998; Lai and Cavanagh, 1997; Lau et al., 2012b; Makino et al., 1986; Zeng et al., 2008). In this study, we found that recombinant events had occurred among the four Lineage 1 sequences (FJ, GD, HN, HB) and BtCoV HKU8. GD showed the highest degree of similarity to BtCoV HKU8 in the ORF1ab region with an aa identity >99% (Table 2). The ORF1ab region of GD may have originated from BtCoV HKU8 during a co-infection event in the same bat species. However, HB showed the highest degree of similarity to BtCoV HKU8 in the S region, with an aa identity of 95.7% (Table 2). The S region of HKU8 may be the parental sequence of the equivalent region in HB. Considering the diversity of the S region in Lineage 1 CoVs, we analyzed possible recombination events in Lineage 1 BtCoVs from different sites in China by detecting putative breakpoints and using SimPlot software (Wu et al., 2015). GARD analysis results were consistent with the boots can analysis results, and three recombination breakpoints were found in the alignments of GD, HB, HN, FJ, and BtCoV HKU8 from M. pusillus (nt 20,930, nt 26,861, and nt 28,128, respectively) (Wu et al., 2015). The positions of the detected breakpoints corresponded to the areas of recombination. DISCUSSION In this study, we detected and characterized alpha-CoVs carried by M. fuliginosus bats in China. M. fuliginosus-related alpha-CoVs were detected in six different provinces (Guangdong, Hubei, Fujian, Henan, Anhui, and Jiangxi), representing the mi ddle, eastern, and southern parts of China. Based on genetic and phylogenetic analyses, these alpha-CoVs could be classified into two distinct lineages, Lineage 1 and Lineage 2. Lineage 1/Lineage 2 co-infections were detected in two specimens collected from Guangdong and Henan (Wu et al., 2015). Lineage 1 and Lineage 2 CoVs showed high intra-lineage genomic similarities, except in the S region. This high similarity suggests each lineage shared a common ancestor. However, Lineage 1 genomes (GD, HB, FJ, and HN), isolated from Guangdong, Hubei, Fujian, and Henan provinces, presented marked differences in the S region, and phylogenetic analysis of S proteins showed that Lineage 1 CoVs formed two distinct clus ters, comprising GD, FJ, and HN in one cluster, and HB in a relatively distant cluster. The same CoV in one bat species had thus evolved diverse S proteins in different provinces. Different environmental pressures, including food availability, climate, shelter, and predators, may have exerted different selection pressures on the CoVs in the same bat sp ecies in different locations, leading to the emergence of a novel S protein subtype in the same CoV isolated from different regions. The S protein in CoV is responsible for receptor binding and host-species adaptation, an d is one of the major determinants of specificity of host-species infection (Dveksler et al., 1991; Lau et al., 2005, 2007). The S protein gene therefore constitutes one of the most variable regions within the CoV genome. GD in M. fuliginosus and BtCoV HKU8 in M. pusillus showed a higher degree of genomic similarity than any of the other CoVs, except in the S region. Phylogenetic analysis of the S protein rev ealed that BtCoV HKU8 clustered with HB, rather than with GD; indeed the BtCoV HKU8 S protein exhibited higher identity with HB than the other three Lineage 1 CoVs, including GD. Phylogenetic analysis, similarity plots, bootscan analysis, and recombination-breakpoint analysis sugg ested that recombination occurred around the S region among BtCoV HKU8, GD, and HB (Wu et al., 2015), which may have facilitated adaptation of the virus to a new bat species, finally leading to interspecies transmission (Graham and Baric, 2010; Song et al., 2005). Furthermore, within th e complete genome (including the S region), some of the es tablished Lineage 2 CoVs (AH, JX, GD-a, HB-a, and HN-a) sh owed high similarity to BtCoV 1A found in M. magnater , while other Lineage 2 CoVs (GD-b and HN-b) showed high similarity to BtCoV 1B found in M. pusillus . Overall, bat migration and roosting habits provide opportunities for large numbers of bats to gather together (Cui et al., 2007; Woo et al., 2006a, 2006c; Woo, 2006), and could explain the mechanisms whereby Miniopterus acquires various viruses and transmits them to other bat species. In addition, our findings also suggested that the S protein had undergone varying degrees of modification in response to the evolutionary pressure of adapting to a new host. Previous studies found that CoVs are particularly host-specific, though host-shifting has also been demonstrated (Jonassen et al., 2005; Lai, 1990; Liu et al., 2005; Rest and Mindell, 2003). A larger-scale study including different geographic regions will be necessary to confirm the phenomenon of host specificity. The results of the present study showed that a single bat species ( M. fuliginosus ) could harbor more than one species of CoV (Lineage 1 and 2 CoVs), and that one CoV could be found in different species of bats, indicating no strict association between BtCoVs and bat species. The availability of genomicsequence data for CoVs from bat species from different locations will allow analysis of the relationships between these viruses and the geographic distribution of their hosts. Further characterization of novel CoVs revealed high genetic diversity across a large geographic distribution. Moreover, we found that the same species of bat from different geographic locations contained the same species of

PAGE 9

612 Du, J., et al. Sci China Life Sci June (2016) Vol.59 No.6 CoV, but with distinct S proteins. The novel genomes described in this study represent the first genomic data for CoVs in M. fuliginosus bats in China. The results also provide the first evidence for the high diversity of S proteins within a given CoV carried by the same bat species at different locations. This diversity most likely arose as a result of en vironmental pressures, migration abilities, and roosting behaviors (Lau et al., 2012a). Conversely, highly similar CoV genomes, including similar or diverse S regions, were found in different bat species from different regions, suggesting that recombination and interspecies transmission may occur among BtCoVs. Recombination may create opportunities for the emergence of new viruses that might drive CoV evolution (Vijaykrishna et al., 2007; Woo et al., 2006b). Previous studies demonstrated that SARS and a number of other new human diseases have emerged as a result of interspecies transmission of viruses carried by bats. The genetic features and host restriction of BtCoVs thus remain important subjects for global public health studies. Further studies and genomic analyses of CoVs from different Miniopterus species in different regions will contribute to a better understanding of the diversity and evolution of CoVs, and periodic studies could provide genetic clues regarding potential emergent infectious viruses. MATERIALS AND METHODS Ethics statement The field studies did not involve endangered or protected species. Bats were treated acco rding to the guidelines set out in the Regulations for the Administration of Laboratory Animals (Decree No. 2 of the State Science and Technology Commission of the People’s Republic of China, 1988). The sampling procedures were approved by the Ethics Committee of the Institute of Pathogen Biology, Chinese Academy of Medical Sciences & Peking Union Medical College (Approval number: IPB EC20100415). Bat samples Pharyngeal and anal swabs we re collected from 194 captured M. fuliginosus bats from nine provinces in China. No specific permissions were required for these procedures at these locations. All bats trapped for this study were released back into their habitat after sample collection. The bat species was initially determined morphologically and subsequently confirmed by sequence analysis of mitochondrial cytochrome b DNA, as described previously (Tang et al., 2006). The samples were immersed in maintenance medium in virus-sampling tubes (Yocon, China), temporarily stored at 20C, and then transported to the laboratory and stored at 80C. RNA extraction and virus detection Viral RNA was extracted from the pharyngeal and anal swab samples using a QIAamp viral RNA minikit (Qiagen, Germany). Reverse transcription was performed using a SuperScript III kit (Invitrogen, USA). CoV screening was performed by amplifying a 440-bp fragment of the RdRp gene of CoVs using conserved primers (5 -GGTTGGGACTATCCTAAGTGTGA-3 and 5 -CCATCATCAGATAGA-ATCATCATA-3 ), as described previously (Lau et al., 2012a, 2012b). Polymerase chain reaction (PCR) products were gel purified using a QIAquick gel extraction kit (Qiagen). Both strands of the PCR products were sequenced twice with an ABI Prism 370 0 DNA analyzer (Applied Biosystems, USA), using the two PCR primers. The sequences of the PCR products were compared with known CoV RdRp gene sequences in the GenBank database. After screening single samples with conserved primers, we confirmed the positivity rates of CoVs in each province (Figure 1). Complete genome sequencing We selected samples positive for CoVs that were representative of each province for genomic sequencing. The initial results revealed that they belonged to the genus Alphacoronavirus and showed close relationships with BtCoVHKU8, 1A, or 1B. We therefore amplified the cDNA using degenerate primers designed by multiple alignment of the genomes of BtCoVHKU8 (NC010438), BtCoV1A (NC010437), and BtCoV1B (NC010436). Based on the genetic sequences obtained, sequence-specific primers were used in the subsequent PCR amplifications. The primers used to amplify the fragments of each virus are available upon request. The 5 /3 ends of the viral genomes were confirmed by rapid amplification of cDNA ends (RACE) using a 5 RACE kit (Invitrogen) and 3 RACE kit (TaKaRa, Japan). For PCRs with weak or non-specific products, the desired DNA fragments were cloned in DNA vectors (pGEM-T Easy vector; Promega, USA). Multiple clones from a PCR were selected fo r standard DNA sequencing. Sequences were assembled and edited manually to produce the final viral genome sequences. Each full genome was deduced from a single specimen. Sequencing complete RdRp and S genes Some positive samples did not undergo complete genome sequencing because of limited amounts of sample. To increase the accuracy of subsequent phylogenetic analyses, we amplified the complete RdRp genes of four strains and the complete S genes of three strains, in addition to the complete genomes of six strains. Sequencing was performed using the primers available from the genomic sequencing, as previously described. The sequences of the PCR products were assembled manually to produce the complete RdRp and S gene sequences.

PAGE 10

Du, J., et al. Sci China Life Sci June (2016) Vol.59 No.6 613 Genomic analysis The nucleotide (nt) sequences of the genomes and the deduced amino acid (aa) sequences of the ORFs were predicted using Vector NTI software (Invitrogen) or the ORF Finder tool of NCBI (http://www.ncbi.nlm.nih.gov/gorf/ gorf.html). Pairwise genome sequence alignment was conducted with EMBOSS Needle software (www.ebi.ac. uk/Tools/psa/emboss_needle/) using the default parameters. MEGA5.0 (Tamura et al., 2011) was used to align nt and deduced aa sequences with the MUSCLE package and default parameters. The best substitution model was then evaluated using the Model Selection package implemented in MEGA5. Phylogenetic analyses were processed by the maximum-likelihood method with an appropriate model, to create phylogenetic trees with 1,000 bootstrap replicates (Guindon et al., 2010). Protein-family analysis was performed with PFAM (Bateman et al., 2002) and InterProScan (Apweiler et al., 2001). Predictions of transmembrane domains were performed with TMHMM (Sonnhammer et al., 1998). Recombination analysis Recombinations among five ge nomes were detected with SimPlot software (version 3.5.1). We used a sliding window of 1,000 nt, which moved in steps of 300 nt, and applied the Genetic Algorithms for Recombination Detection program in the DataMonkey software package (http://www. datamonkey.org) (Kosakovsky Pond et al., 2006). When multiple breakpoints were detected between the non-recombinant and recombinant models, they were assessed by comparing the corrected Akaike’s Information Criterion scores. The Kishino-Hasegawa test was applied to verify if the adjacent sequence fragments yielded significant topological incongruence. Nucleotide sequence accession numbers All genome sequences have been submitted to GenBank. The accession numbers for the bat alpha-CoVs are KJ473795 to KJ473805. Compliance and ethics The author(s) declare that they have no conflict of interest. Acknowledgements This study was supported by the Program for Changjiang Scholars and Innovative Resear ch Team in University of China (IRT13007), the National S&T Major Project “China Mega-Project for Infectious Disease” (2011ZX10004001, 2014ZX10004001) from China, the National Natural Science Foundation of China (81501773), and the PUMC Youth Fund and Fundamental Research Funds for the Central Universities (3332015095, 3332015006). Apweiler, R., Attwood, T.K., Bairoc h, A., Bateman, A., Birney, E., Biswas, M., Bucher, P., Cerutti, L., Corpet, F., Croning, M.D., Durbin, R., Falquet, L., Fleischmann, W., Gouzy, J., Hermjakob, H., Hulo, N., Jonassen, I., Kahn, D., Kanapin, A., Karavidopoulou, Y., Lopez, R., Marx, B., Mulder, N.J., Oinn, T.M., Pagni, M., Servant, F., Sigrist, C.J., and Zdobnov, E.M. (2001). The InterPro database, an integrated documentation resource for protein fami lies, domains and functional sites. Nucleic Acids Res 29, 37. Bateman, A., Birney, E., Cerruti, L., Durbin, R., Etwiller, L., Eddy, S.R., Griffiths-Jones, S., Howe, K.L., Marshall, M., and Sonnhammer, E.L. (2002). The Pfam protein families database. Nucleic Acids Res 30, 276–280. Bosch, B.J., van der Zee, R., de Haan, C.A., and Rottier, P.J. (2003). The coronavirus spike protein is a class I virus fusion protein: structural and functional characterization of the fusion core complex. J Virol 77, 880111. Chen, L.L., Ou, H.Y., Zhang, R., and Zhang, C.T. (2003). ZCURVE_CoV: a new system to recognize protein coding genes in coronavirus genomes, and its applications in analyzing SARS-CoV genomes. Biochem Biophys Res Commun 307, 3828. Chu, D.K., Peiris, J.S., Chen, H., Guan, Y., and Poon, L.L. (2008). Genomic characterizations of bat co ronaviruses (1A, 1B and HKU8) and evidence for co-infections in Miniopterus bats. J Gen Virol 89, 128287. Cui, J., Han, N., Streicker, D., Li, G., Tang, X., Shi, Z., Hu, Z., Zhao, G., Fontanet, A., Guan, Y., Wang, L., Jones, G., Field, H.E., Daszak, P., and Zhang, S. (2007). Evolutionary relationships between bat coronaviruses and their hosts. Emerg Infect Dis 13, 1526532. King, A.M.Q., Adams, M.J., Carstens, E.B. (2011). Virus Taxonomy, Classification and Nomenclature of Viruses. Ninth Report of the International Committee on Taxonomy of Vi ruses, International Union of Microbiological Societies, Virology Division. London: Elsevier Academic Press, 806. Dveksler, G.S., Pensiero, M.N., Cardellichio, C.B., Williams, R.K., Jiang, G.S., Holmes, K.V., and Dieffenbach, C.W. (1991). Cloning of the mouse hepatitis virus (MHV) rece ptor: expression in humaaan and hamster cell lines confers susceptibility to MHV. J Virol 65, 688191. Gonzalez, J.M., Gomez-Puertas, P., Cavanagh, D., Gorbalenya, A.E., and Enjuanes, L. (2003). A comparative sequence analysis to revise the current taxonomy of the family Coronaviridae . Arch Virol 148, 220735. Graham, R.L., and Baric, R.S. (2010). Recombination, reservoirs, and the modular spike: mechanisms of coronavirus cross-species transmission. J Virol 84, 3134146. Guindon, S., Dufayard, J.F., Lefort, V., Anisimova, M., Hordijk, W., and Gascuel, O. (2010). New algorithms and methods to estimate maximum-likelihood phylogenies: assessing th e performance of PhyML 3.0. Syst Biol 59, 307–321. Herrewegh, A.A., Smeenk, I., Horzinek, M.C., Rottier, P.J., and de Groot, R.J. (1998). Feline coronavirus type II strains 79-1683 and 79-1146 or iginate from a double recombination between feline coronavirus type I and canine coronavirus. J Virol 72, 450814. Holmes, K.V., and Enjuanes, L. (2003). Virology. The SARS coronavirus: a postgenomic era. Science 300, 13778. Jonassen, C.M., Kofstad, T., Larsen , I.L., Lovland, A., Handeland, K., Follestad, A., and Lillehaug, A. ( 2005). Molecular identification and characterization of novel coronavi ruses infecting graylag geese ( Anser anser ), feral pigeons ( Columbia livia ) and mallards ( Anas platyrhynchos ). J Gen Virol 86, 159707. Kosakovsky Pond, S.L., Posada, D., Gravenor, M.B., Woelk, C.H., and Frost, S.D. (2006). GARD: a genetic algorithm for recombination detection. Bioinformatics 22, 3096098. Lai, M.M. (1990). Coronavirus: organi zation, replication and expression of genome. Annu Rev Microbiol 44, 3033. Lai, M.M., and Cavanagh, D. (1997). The molecular biology of coronaviruses. Adv Virus Res 48, 1. Lai, M.M.C., and Holmes, K.V. (2001). Coronaviruses. In: Knipe, D.M., Howley, P.M., Griffin, D.E., Lamb, R.A., Martin, M.A., Roizman, B., and Straus, S.E., eds. Fields Virology. Philadelphia: Lippincott Williams & Wilkins 1163–1185. Lau, S.K., Li, K.S., Tsang, A.K., Shek, C.T., Wang, M., Choi, G.K., Guo, R., Wong, B.H., Poon, R.W., Lam, C.S., Wang, S.Y., Fan, R.Y., Chan, K.H., Zheng, B.J., Woo, P.C., and Yuen, K.Y. (2012a). Recent trans-

PAGE 11

614 Du, J., et al. Sci China Life Sci June (2016) Vol.59 No.6 mission of a novel alphacoronavirus, bat coronavirus HKU10, from Leschenault’s rousettes to pomona leaf-nosed bats: first evidence of interspecies transmission of coronavirus between bats of different suborders. J Virol 86, 11906–11918. Lau, S.K., Woo, P.C., Li, K.S., Huang, Y., Tsoi, H.W., Wong, B.H., Wong, S.S., Leung, S.Y., Chan, K.H., and Yuen, K.Y. (2005). Severe acute respiratory syndrome coronavirus-like virus in Chinese horseshoe bats. Proc Natl Acad Sci USA 102, 1404045. Lau, S.K., Woo, P.C., Li, K.S., Huang, Y., Wang, M., Lam, C.S., Xu, H., Guo, R., Chan, K.H., Zheng, B.J., and Yuen, K.Y. (2007). Complete genome sequence of bat coronaviru s HKU2 from Chinese horseshoe bats revealed a much smaller spike gene with a different evolutionary lineage from the rest of the genome. Virology 367, 428. Lau, S.K., Woo, P.C., Yip, C.C., Fan, R.Y., Huang, Y., Wang, M., Guo, R., Lam, C.S., Tsang, A.K., Lai, K.K., Chan, K.H., Che, X.Y., Zheng, B.J., and Yuen, K.Y. (2012b). Isolation and characterization of a novel Betacoronavirus subgroup A coronavi rus, rabbit coronavirus HKU14, from domestic rabbits. J Virol 86, 5481496. Li, W., Shi, Z., Yu, M., Ren, W., Smith, C., Epstein, J.H., Wang, H., Crameri, G., Hu, Z., Zhang, H., Zhang, J., McEachern, J., Field, H., Daszak, P., Eaton, B.T., Zhang, S., and Wang, L.F. (2005). Bats are natural reservoirs of SARSlike coronaviruses. Science 310, 6769. Liu, S., Chen, J., Kong, X., Shao, Y., Han, Z., Feng, L., Cai, X., Gu, S., and Liu, M. (2005). Isolation of avia n infectious bronchitis coronavirus from domestic peafowl ( Pavo cristatus ) and teal ( Anas ). J Gen Virol 86, 719–725. Makino, S., Keck, J.G., Stohlman, S.A., and Lai, M.M. (1986). High-frequency RNA recombination of murine coronaviruses. J Virol 57, 729–737. Miller-Butterworth, C.M., Jacobs, D. S., and Harley, E.H. (2003). Strong population substructure is correlated with morphology and ecology in a migratory bat. Nature 424, 18791. Rest, J.S., and Mindell, D.P. (2003). SARS associated coronavirus has a recombinant polymerase and coronaviruses have a history of host-shifting. Infect Genet Evol 3, 2195. Shirato, K., Maeda, K., Tsuda, S., Suzuki, K., Watanabe, S., Shimoda, H., Ueda, N., Iha, K., Taniguchi, S., K yuwa, S., Endoh, D., Matsuyama, S., Kurane, I., Saijo, M., Morikawa, S., Yoshikawa, Y., Akashi, H., and Mizutani, T. (2012). Detection of bat coronaviruses from Miniopterus fuliginosus in Japan. Virus Genes 44, 40. Song, H.D., Tu, C.C., Zhang, G.W., Wang, S.Y., Zheng, K., Lei, L.C., Chen, Q.X., Gao, Y.W., Zhou, H.Q., Xiang, H., Zheng, H.J., Chern, S.W., Cheng, F., Pan, C.M., Xuan, H., Chen, S.J., Luo, H.M., Zhou, D.H., Liu, Y.F., He, J.F., Qin, P.Z., Li, L.H., Ren, Y.Q., Liang, W.J., Yu, Y.D., Anderson, L., Wang, M., Xu, R.H., Wu, X.W., Zheng, H.Y., Chen, J.D., Liang, G., Gao, Y., Liao, M., Fang, L., Jiang, L.Y., Li, H., Chen, F., Di, B., He, L.J., Lin, J.Y., Tong, S., Kong, X., Du, L., Hao, P., Tang, H., Bernini, A., Yu, X.J., Spiga, O., Guo, Z.M., Pan, H.Y., He, W.Z., Manuguerra, J.C., Fontanet, A., Danchin, A., Niccolai, N., Li, Y.X., Wu, C.I., and Zhao, G.P. (2005). Cross-host evolution of severe acute respiratory syndrome coronavirus in palm civet and human. Proc Natl Acad Sci USA 102, 2430–2435. Sonnhammer, E.L., von Heijne, G., and Krogh, A. (1998). A hidden Markov model for predicting transmembrane helices in protein sequences. Proc Int Conf Intell Syst Mol Biol 6, 175–182. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. (2011). MEGA5: molecular evolutiona ry genetics analysis using maximum likelihood, evolutionary di stance, and maximum parsimony methods. Mol Biol Evol 28, 2731–2739. Tang, X.C., Zhang, J.X., Zhang, S.Y., Wang, P., Fan, X.H., Li, L.F., Li, G., Dong, B.Q., Liu, W., Cheung, C.L. , Xu, K.M., Song, W.J., Vijaykrishna, D., Poon, L.L., Peiris, J.S., Sm ith, G.J., Chen, H., and Guan, Y. (2006). Prevalence and genetic divers ity of coronaviruses in bats from China. J Virol 80, 748190. van Boheemen, S., de Graaf, M., Lauber, C., Bestebroer, T.M., Raj, V.S., Zaki, A.M., Osterhaus, A.D., Haagmans, B.L., Gorbalenya, A.E., Snijder, E.J., and Fouchier, R.A. ( 2012). Genomic characterization of a newly discovered coronavirus associat ed with acute respiratory distress syndrome in humans. MBio doi: 10.1128/mBio.00473-12. Vijaykrishna, D., Smith, G.J., Zhang, J.X., Peiris, J.S., Chen, H., and Guan, Y. (2007). Evolutionary insights into the ecology of coronaviruses. J Virol 81, 4012020. Weiss, S.R., and Navas-Martin, S. (2005). Coronavirus pathogenesis and the emerging pathogen severe acute respiratory syndrome coronavirus. Microbiol Mol Biol Rev 69, 63564. Woo, P.C., Lau, S.K., Lam, C.S., Lai, K.K., Huang, Y., Lee, P., Luk, G.S., Dyrting, K.C., Chan, K.H., and Yuen, K.Y. (2009). Comparative analysis of complete genome sequences of three avian coronaviruses reveals a novel group 3c coronavirus. J Virol 83, 90817. Woo, P.C., Lau, S.K., Lam, C.S., Lau, C.C., Tsang, A.K., Lau, J.H., Bai, R., Teng, J.L., Tsang, C.C., Wang, M., Zheng, B.J., Chan, K.H., and Yuen, K.Y. (2012). Discovery of seven novel Mammalian and avian coronaviruses in the genus deltacoronavirus supports bat coronaviruses as the gene source of alphacorona virus and betacoronavirus and avian coronaviruses as the gene source of gammacoronavirus and deltacoronavirus. J Virol 86, 3995008. Woo, P.C., Lau, S.K., Li, K.S., Poon, R.W., Wong, B.H., Tsoi, H.W., Yip, B.C., Huang, Y., Chan, K.H., and Yuen, K.Y. (2006a). Molecular diversity of coronaviruses in bats. Virology 351, 180–187. Woo, P.C., Lau, S.K., Yip, C.C., Huang, Y., Tsoi, H.W., Chan, K.H., and Yuen, K.Y. (2006b). Comparative an alysis of 22 coronavirus HKU1 genomes reveals a novel genotype and evidence of natural recombination in coronavirus HKU1. J Virol 80, 7136–7145. Woo, P.C., Lau, S.K., and Yuen, K.Y. (2006c). Infectious diseases emerging from Chinese wet-markets: zoonotic origins of severe respiratory viral infections. Curr Opin Infect Dis 19, 40107. Woo, P.C., Lau, S.K., Huang, Y., and Yuen, K.Y. (2009). Coronavirus diversity, phylogeny and interspecies jumping. Exp Biol Med 234, 111727. Woo, P.C., Lau, S.K., and Yuen, K.Y. (2006). Infectious diseases emerging from Chinese wet-markets: zoonotic origins of severe respiratory viral infections. Curr Opin Infect Dis 19, 401–407. Wu, Z., Yang, L., Ren, X., He, G., Zha ng, J., Yang, J., Qian, Z., Dong, J., Sun, L., Zhu, Y., Du, J., Yang, F., Zhang, S., and Jin, Q. (2015). Deciphering the bat virome catalog to better understand the ecological diversity of bat viruses and the bat origin of emerging infectious diseases. ISME J 10, 60920. Zeng, Q., Langereis, M.A., van Vliet, A.L., Huizinga, E.G., and de Groot, R.J. (2008). Structure of coronavirus hemagglutinin-esterase offers insight into corona and influenza vi rus evolution. Proc Natl Acad Sci USA 105, 9065069. Open Access This article is distributed under the terms of the Creative Comm ons Attribution License which permits any use, distribution, an d reproduction in any medium, provided the original author(s) and source are credited.


printinsert_linkshareget_appmore_horiz

Download Options

close


  • info Info

    There are only PDFs associated with this resource.

  • link PDF(s)



Cite this item close

APA

Cras ut cursus ante, a fringilla nunc. Mauris lorem nunc, cursus sit amet enim ac, vehicula vestibulum mi. Mauris viverra nisl vel enim faucibus porta. Praesent sit amet ornare diam, non finibus nulla.

MLA

Cras efficitur magna et sapien varius, luctus ullamcorper dolor convallis. Orci varius natoque penatibus et magnis dis parturient montes, nascetur ridiculus mus. Fusce sit amet justo ut erat laoreet congue sed a ante.

CHICAGO

Phasellus ornare in augue eu imperdiet. Donec malesuada sapien ante, at vehicula orci tempor molestie. Proin vitae urna elit. Pellentesque vitae nisi et diam euismod malesuada aliquet non erat.

WIKIPEDIA

Nunc fringilla dolor ut dictum placerat. Proin ac neque rutrum, consectetur ligula id, laoreet ligula. Nulla lorem massa, consectetur vitae consequat in, lobortis at dolor. Nunc sed leo odio.